The effects of 3 different microalgae species on the growth, metamorphosis and MYP gene expression of two sea urchins, Strongylocentrotus intermedius and S. nudus

Aquaculture 492 (2018) 123–131

Contents lists available at ScienceDirect

Aquaculture journal homepage: www.elsevier.com/locate/aquaculture

The effects of 3 different microalgae species on the growth, metamorphosis and MYP gene expression of two sea urchins, Strongylocentrotus intermedius and S. nudus ⁎

T

⁎

Shoubing Qia, Xiaowei Zhaob, Weijie Zhangb, Changhai Wanga, , Meilin Hea, Yaqing Changb, , Jun Dingb a b

College of Resources and Environmental Science, Nanjing Agricultural University, Nanjing 210095, PR China Key Laboratory of Mariculture and Stock Enhancement in North China's Sea, Ministry of Agriculture, Dalian Ocean University, Dalian 116023, Liaoning, China

A R T I C LE I N FO

A B S T R A C T

Keywords: Sea urchin Microalgae Fatty acid composition Protein content Growth MYP gene

As a result of the increase in demand for sea urchin gonads, which are considered a gourmet food, the sea urchin aquaculture industry has gradually expanded in some South American and Asian countries. This study investigated the growth, metamorphosis and MYP gene expression of larvae of two species of sea urchin (Strongylocentrotus intermedius and Strongylocentrotus nudus) fed with four microalgal diets: Chaetoceros muelleri, Dunaliella tertiolecta, Isochrysis galbana, and a mixture of the three. The larvae fed the C. muelleri and mixture diets were successfully raised to competence for metamorphosis and showed better stomach growth, development rates and metamorphosis rates than the larvae that were fed D. tertiolecta or I. galbana. The results also suggest that the larvae could accumulate long-chain polyunsaturated fatty acids (LC-PUFAs), such as docosahexaenoate (DHA; 22:6n-3), eicosapentaenoate (EPA; 20:5n-3) and arachidonate (ARA; 20:4n-6), either by the assimilation and retention of dietary fatty acids or by synthesis from α-linolenic acid (18:3n-3) and linoleic acid (18:2n-6). Moreover, an accumulation of n-6 and n-3 LC-PUFAs and higher ARA/EPA ratios in the larvae appeared to be associated with improved larval performance. The results also showed that the MYP gene expression levels in the larvae fed the C. muelleri and mixed diets were significantly higher than in the D. tertiolecta and I. galbana groups. In addition, the trend of the MYP gene expression in the different stages was 6-arm stage > 8-arm stage > 4-arm stage > fertilized eggs > prismatic stage. These results provide suggestions for diet selection for sea urchin larvae and the fatty acid composition of diets for urchin larvae, and they provide a reference for further study of the effects of diets on the gene expression of MYP in larvae.

1. Introduction Sea urchins are benthic marine echinoderms that are distributed across oceans worldwide (Pearse, 2006). The gonads of sea urchin are a popular gourmet food item that is high in unsaturated fatty acids, amino acids and other nutrients (Archana and Babu, 2016). As a result of the increase in demand, the sea urchin aquaculture industry has gradually expanded in some countries in South America and Asia, and this expansion has brought significant economic benefits (Ding et al., 2007). The life cycle of sea urchins can be divided into three different stages in accordance with the corresponding food sources: Larvae (1st stage) develop from the embryo and utilize microalgae as food, and this period ranges from 10 days to several months, depending on the type of sea urchin and the culture temperature (Huggett et al., 2005). Juvenile

⁎

sea urchins (2nd stage) metamorphose from larvae, persist for several months, and utilize benthic diatoms as food (Hinegardner, 1969). In addition, the morphological structures of the juveniles assume more complex features typical of the adult stage. At sexual maturity (3rd stage), the food is large algae, including kelp (Laminaria japonica) and wakame (Undaria pinnatifida) (Harrold and Reed, 1985). The larval period is the most important stage because of the more rigorous requirements for food and culture water environment than in the other stages. Microalgae represent the primary productivity in the ocean and provide food for various marine animals. D. tertiolecta, which provided sea urchin larvae with higher rates of survival and growth compared with other microalgae, has been found to be the most suitable for larvae of sea urchins including Psammechinus miliaris, Paracentrotus lividus (Brundu et al., 2016a, 2017; Liu et al., 2007a, 2007b), Dendraster

Corresponding authors. E-mail addresses: [email protected] (C. Wang), [email protected] (Y. Chang).

https://doi.org/10.1016/j.aquaculture.2018.02.007 Received 30 June 2017; Received in revised form 1 February 2018; Accepted 2 February 2018 Available online 03 February 2018 0044-8486/ © 2018 Published by Elsevier B.V.

Aquaculture 492 (2018) 123–131

S. Qi et al.

2. Materials and methods

excentricus (George et al., 2008) and P. miliaris (Jimmy et al., 2003). Meanwhile, because of its high levels of polyunsaturated fatty acids (PUFAs) and lipids, C. muelleri is one of the most suitable microalgae species for feeding mollusk larvae worldwide (Goksan et al., 2003; Richmond, 2008). Moreover, mixed feeding of different microalgae, such as I. galbana and D. tertiolecta, was reported to offer better benefits to D. excentricus (Schiopu et al., 2006). At the same time, PUFAs in the microalgae and larvae have been suggested to have the potential to promote larval development and growth (Brundu et al., 2016a, 2017; Cárcamo et al., 2005), and DHA, EPA and n-3 PUFAs were also found to promote larvae growth and development (Gisbert et al., 2005; Harel et al., 2000; Vagner et al., 2009). Unfortunately, although C. muelleri has been widely used in the artificial breeding of sea urchins in most of the Asian countries where sea urchins (Strongylocentrotus intermedius and S. nudus) are cultured, D. tertiolecta has not been studied as a diet for those urchins or used commercially. Therefore, it is necessary to compare the effects of the two types of microalgae on the culture of sea urchin larvae. Major yolk protein (MYP) is a glycoprotein (170 kDa) that was originally identified in sea urchin oocytes, eggs and embryos (Harrington and Easton, 1982; Wang et al., 2015; Yamasaki et al., 2010). MYP is mainly synthesized in the digestive tract (Walker et al., 2015) and stored in vegetative phagocytic cells in the yolk in granular form (Unuma et al., 2001) as a source of nutrients during gametogenesis and embryonic development (Walker, 1982; Walker et al., 2007; Walker et al., 2005). Another form of MYP is synthesized by the intestine as a 195 kDa protein and secreted into the coelomic fluid of the adult sea urchin, where it is the major protein of the coelomic fluid and is involved in the transport of zinc derived from food (Cervello et al., 1996; Harrington and Easton, 1982). Some studies refer to the coelomic fluid-type MYP as CFMYP and the egg-type MYP as EGMYP (Unuma et al., 2009). Genomic Southern blot analysis has suggested that sea urchins have only one gene encoding MYP (Byrne et al., 1999; Shyu et al., 1987). Many animals store yolk in their eggs to be used as an energy source until the embryo can develop the tissue specializations necessary to import food by feeding (Wessel et al., 2000). After fertilization, MYP serves as a nutrient source for the larval stage; after the maternal EGMYP is depleted, the MYP again becomes immunologically detectable in the premetamorphic larvae of S. purpuratus (Scott et al., 1990). The EGMYP disappears by the 4-arm stage, and newly synthesized CFMYP is detectable at and after the middle of the 8-arm stage. CFMYP is synthesized in the digestive tract and secreted into the body cavities during and after the early 8-arm stage (Unuma et al., 2009). However, whether the intake of outside nutrients affects the expression of MYP has not been studied. The current study aimed to investigate the effects of D. tertiolecta, C. muelleri, I. galbana and the mixture of the 3 different microalgae on the growth, metamorphosis, fatty acid composition and MYP gene expression of S. intermedius and S. nudus. Fatty acid composition and MYP gene expression may provide guidelines for recommendations for the uptake and transformation of fatty acids and proteins in sea urchin larvae to identify the key nutrients in diets. Moreover, it is also important to determine the gene expression patterns of MYP in various stages of sea urchin larvae and the effects of dietary microalgae (D. tertiolecta, C. muelleri, I. galbana) on MYP expression.

2.1. General methods Approximately three-year-old S. nudus and S. intermedius were housed under laboratory conditions (culture temperatures from 13.4 °C to 21.3 °C). During this time, both species of sea urchin were fed kelp (Laminaria japonica). When the experiment began, several sea urchins of both species were treated by injection of 1–2 mL 0.5 M KCl into the coelom via the peristomial membrane. The sperm and eggs of each individual were collected separately. One female and one male of each species were used for in vitro fertilization. Approximately 2 million eggs and diluted sperm, which included 5 times the number of egg cells, were put into a 2 L measuring beaker, and the fertilization was completed by stirring. The fertilized eggs were left to hatch in the containers in static seawater without aeration for 24 h. The average hatching rate was 90 ± 1%. Each species of microalga was applied to three containers that contained incubated eggs at a density of 500 per liter. To obtain enough larvae for the fatty acid analysis, protein content determination and gene expression analysis, each container was a 70 L tank. The seawater that was used during the spawning, hatching and larval rearing processes was 5 μm filtered and maintained at 20 ± 2 °C. The experimental ambient light was kept at 1000 lx. The larvae were cultivated in aerated static water, and the water was completely replaced every 4 days by using a cloth sieve (25 μm) as a filter and accompanied by thorough cleaning of the containers. 2.2. Experimental diets The diets included three species of microalgae, D. tertiolecta (540 μm3 volume), Chaetoceros muelleri (71.4 μm3 volume), and Isochrysis galbana (119 μm3 volume), as well as a mixture of the three species (with reference to (Schiopu et al., 2006) and (Azad et al., 2011)). The number of cells fed daily at each stage is shown in Table 1 (with reference to (Kelly et al., 2000)). In addition, the number of cells needed to be adjusted by microscopically determining the stomach sizes of the larvae before feeding. The larvae were fed three times per day at intervals of 8 h. The equation used to calculate the feed ratio was as follows: volume of microalgae given = (number of microalgal cells × rearing volume)/microalgal culture concentration. 2.3. Larval growth and morphology Each day, twenty larvae were collected from each tank by filtering the seawater, and the larvae were photographed with a Nikon microscope to measure the body length, body width, post-oral arm length, stomach length and stomach width. In addition, 100 individuals per tank were collected to determine the developmental stages on the 6th, 9th and 12th days of the developmental period. Larvae were starved for 12 h before they were sampled for analysis of fatty acid content, MYP gene expression and protein content. Then, the larvae were collected into 1.5 mL centrifuge tubes, washed with sterile seawater by low-speed centrifugation and stored at −80 °C. To study the effects of different microalgae species on the

Table 1 The number of microalgae and the number of mixed microalgae that were fed separately every day in each stage.

C. muelleri D. tertiolecta I. galbana Mixture

4-arm stage

6-arm stage

8-arm stage

7000–9000 1000–2000 2000–4000 2500 + 500 + 1000

9000–11,000 3000–5000 4000–6000 3000 + 1300 + 1800

11,000–15,000 5000–7000 6000–8000 4000 + 2000 + 2300

124

Aquaculture 492 (2018) 123–131

S. Qi et al.

18S gene was used as the reference gene (Zhou et al., 2008).

metamorphic rate, on the 12th day, 1000 larvae from each group were placed in a 70 L tank with a benthic diatom corrugated plate at the bottom. Then, the larvae were continuously fed while the light intensity was increased. The number of metamorphosed sea urchins was counted on the 24th day.

2.6. Statistical analysis The growth parameters of the sea urchin larvae were measured by using Photoshop (version 4), and the actual length was determined based on the ratio on the photograph. Mean values of the sampled larvae from each replicate bucket were used for the statistical analyses. The effects of microalgal diets and diet ratios on the various body dimensions, protein contents of the different microalgae and larvae and the relative expression levels of MYP were assessed using one-way analysis of variance (ANOVA). The data were tested for normality and homogeneity of the variance to ensure compliance with the assumptions of the ANOVA (Sokal and Rohlf, 1995).

2.4. Lipid and fatty acid analyses and protein content detection The microalgae fluid was collected at the end of the experiment, and the density was measured with a hemocytometer. Next, 20 × 106 cells of the microalgae samples were measured and stored at −80 °C. For measuring the fatty acid composition of the three species of microalgae, the liquid was vacuum-dried to a powdery solid. Total lipids were extracted and quantified according to Folch et al. (1957). The fatty acid compositions were determined by gas chromatography of fatty acid methyl esters (FAMEs) according to Christie (2003). The FAMEs were prepared from the total lipids by acid-catalyzed transesterification at 50 °C for 16 h with extraction and purification by thin-layer chromatography as described previously (Tocher and Harvie, 1988). The samples were tested using a ThermoFisher Trace 1310 ISQ gas chromatograph mass spectrometer with a TG-5 MS column (30 m × 0.25 mm × 0.25 μm). Individual methyl esters were identified by comparison with known standards and by reference to published data (Tocher and Harvie, 1988). The data were collected and processed using ChromCard for Windows (version 1.19), and the FAMEs were quantified through a comparison with a heptadecanoic acid (17:0) internal standard. The measurement methods for the larvae were the same as those for the microalgae. For the protein analysis, the microalgal and larval samples were analyzed using the Kjeldahl method (Lynch and Barbano, 1999).

3. Results 3.1. Larval growth and morphology The growth indices of the sea urchin larvae were measured from the 3rd day to the 11th day after fertilization. The S. intermedius and S. nudus larval growth rates are indicated by the post-oral arm length, body length, body width, stomach length and stomach width, as exhibited in Fig. 1 and Fig. 2, respectively. The growth of S. intermedius was significantly affected by different diets beginning on the 4th day (P < 0.05). The body lengths (Fig. 1a) of the S. intermedius larvae fed with I. galbana were significantly longer than those fed with the other 3 diets (P < 0.05), with no significant differences among the other 3 diets. On the 9th day, the body widths (Fig. 1b) of the S. intermedius larvae fed with D. tertiolecta and I. galbana were significantly decreased compared with those on the 8th day (P < 0.05). The post-oral arm length profiles (Fig. 1c) of the S. intermedius larvae were similar to those of body length. The stomach lengths (Fig. 1d) and widths (Fig. 1e) of the S. intermedius larvae fed with C. muelleri and mixed microalgae were obviously superior to those fed with D. tertiolecta and I. galbana starting on the 5th day, but there was no significant difference between the latter two microalgal diets. Likewise, the growth of S. nudus was markedly affected by different microalgae diets from the 5th day, and all the indices in C. muelleri and mixed microalgae treatment groups were significantly better than those in the I. galbana and D. tertiolecta groups from the 6th day (Fig. 2, P < 0.05), but there were no significant differences between the C. muelleri group and the mixed microalgae group. Compared with the I. galbana group, the body lengths of the S. nudus larvae in the D. tertiolecta group were significantly larger from the 5th day to the 7th day (Fig. 2a), but they were notably shorter from the 8th day to the 10th day. Regarding the body widths (Fig. 2b), post-oral arm lengths (Fig. 2c), stomach lengths (Fig. 2d) and stomach widths (Fig. 2e), the S. nudus larvae fed with I. galbana exhibited poorer phenotypes compared with larvae of the same species the other three diets. Moreover, the post-oral arm lengths (Fig. 2c) of all the experimental groups decreased from the 10th day to the 11th day.

2.5. MYP gene expression The expression pattern of the MYP gene was analyzed by quantitative real-time PCR (qRT-PCR) at the 4-arm, 6-arm and 8-arm larvae stages. Total RNA was isolated from the samples using TRIzol reagent (Invitrogen, CA, USA) following the manufacturer's instructions. The concentration and quantity of total RNA were verified using 1% agarose gel electrophoresis and an Agilent 2100 Bioanalyzer. In addition, 1000 ng of high-quality RNA was used to synthesize the first cDNA strand in 20 μL of reaction mixture with 4 μL of 5× PrimerScript buffer, 1 μL of oligo (dT) primer, 1 μL of random 6-mers and 1 μL of PrimerScript RT Enzyme Mix I (PrimerScript™ RT reagent kit, Takara, Japan), using RNase-free dH2O to constitute the rest of the volume. The MYP and 18S primers are shown in Table 2. Briefly, the amplification was performed in a total volume of 20 μL that contained 10 μL of 2× SYBR Green Master mix (SYBR PrimerScript™ RT-PCR kit II, Takara, Japan), 0.4 μL of ROX Reference Dye II, 0.8 μL (10 mM) of each genespecific primer, 2 μL of 1:10 diluted original cDNA and 6 μL of ddH2O. The qRT-PCR was performed with the Applied Biosystems 7500 realtime system (Applied Biosystems, USA), and three technical replications were performed for each qRT-PCR validation. The qRT-PCR cycling program was conducted as follows: 95 °C for 30 s, 45 cycles of 95 °C for 5 s, and 60 °C for 32 s. The relative mRNA levels of the MYP were analyzed using the 2–ΔΔCt method (Livak and Schmittgen, 2001). The

3.2. Developmental period and metamorphosis rate The development stage ratios of the S. intermedius and S. nudus larvae are shown in Fig. 3. On the 6th day, the 6-arm stage was not observed among either the S. intermedius or S. nudus larvae fed with I. galbana, whereas in the other three feeding groups, > 50% of the larvae were in the 6-arm stage; moreover, the proportion of S. nudus larvae in the 6-arm stage was slightly larger than that of S. intermedius (Fig. 3a). On the 9th day, the proportions of larvae in the 8-arm stage in the C. muelleri and mixed groups were much higher than those in the D. tertiolecta (14%–22%) and I. galbana (approximately 0) groups, while the 6-arm individuals still constituted the largest parts of the D. tertiolecta and I. galbana groups (Fig. 3b). On the 12th day, no 4- or 6-arm larvae

Table 2 Primer sequence information for the MYP genes. Gene

Primer sequence (5′ → 3′)

S. nudus MYP-F S. nudus MYP-R S. intermedius MYP-F S. intermedius MYP-R 18S rRNA-F 18S rRNA-R

TTCAACCATAACCTCTCCACCC TTCATCTTCTTCCTGCCTTCG ACCATATGTGGACTGACGT GGGTTCTACCTCGGAGTTGAC GTTCGAAGGCGATCAGATAC CTGTCAATCCTCACTGTGTC

125

Aquaculture 492 (2018) 123–131

S. Qi et al.

Fig. 1. Measurements of (a) body length, (b) body width, (c) post-oral arm length, (d) stomach length and (e) stomach width throughout the larval lifespan of S. intermedius (days after fertilization). The mean values for the pooled replicates (n = 3) are presented. The positive error bars represent the 95% confidence limits, and the negative error bars represent the standard error. Different letters indicate significant (P < 0.05) differences among diets.

3.3. Composition of major fatty acids in microalgae and larvae

were observed in the C muelleri or mixed groups, whereas only 20–30% of the individuals in the D. tertiolecta group were in the 8-arm stage and no 8-arm individuals were found in the I. galbana group (Fig. 3c). On the 20th day, the overall rates of metamorphosis were calculated for S. intermedius and S. nudus in each tank (Fig. 3d). The rates of metamorphosis of the larvae fed with C. muelleri and mixed microalgae were > 60% and not significantly different from each other, but the rates in these groups were higher than those in the D. tertiolecta and I. galbana groups. While the rates of metamorphosis were lowest for the S. intermedius and S. nudus larvae fed with I. galbana, no abnormal sea urchins were found. The rates of metamorphosis of the S. nudus larvae fed with mixed microalgae were higher than those of S. intermedius larvae in the same treatment; however, there was no significant difference between them.

The major fatty acid compositions in the microalgae and larvae are shown in Table 3 and Table 4. The results demonstrated that the C20 series, including C20:3 N3, C20:3 N6, C20:4 N6 (ARA) and C20:5 N3 (EPA), was present in C. muelleri and I. galbana but not D. tertiolecta. In addition, the n-6 PUFA, n-3 PUFA and total PUFA contents in D. tertiolecta were significantly lower than those in C. muelleri and I. galbana. However, the level of C18:3 N6 was significantly higher in D. tertiolecta than in the other two microalgae. Notably, the ARA/DHA, EPA/ARA and EPA/DHA rof D. tertiolecta were meaningless, whereas the DHA/ EPA ratios were greater in I. galbana than in C. muelleri. Fatty acids were collected from S. intermedius and S. nudus larvae (8arm stage), and their composition was measured. The results indicated that C17:1, C20:2, C20:3 N3 and C22:1 N9 were found selectively in S. intermedius. Compared with the other groups, S. intermedius and S. nudus larvae fed with I. galbana showed significantly lower levels of C18:1 N9,

Fig. 2. Measurements of (a) body length, (b) body width, (c) post-oral arm length, (d) stomach length and (e) stomach width throughout the larval lifespan of S. nudus (days after fertilization). The mean values for the pooled replicates (n = 3) are presented. The positive error bars represent the 95% confidence limits, and the negative error bars represent the standard error. Different letters indicate significant (P < 0.05) differences among diets. 126

Aquaculture 492 (2018) 123–131

S. Qi et al.

Fig. 3. The proportions of sea urchin larval development stages and the final metamorphosis rate (Mean ± SEM). For each trait, the columns sharing a superscript are not significantly different (P < 0.05). (a) On the 6th day. (b) On the 9th day. (c) On the 12th day. (d) On the 24th day. C = C. muelleri; D = D. tertiolecta; I = I. galbana; M = Mix. Different letters indicate significant (P < 0.05) differences among diets.

was not detected in D. tertiolecta, it was present in the S. intermedius and S. nudus larvae fed with D. tertiolecta. Similar to the change profile of EPA/ARA, significantly higher levels of n-3 PUFAs were also found in the S. intermedius and S. nudus larvae fed with C. muelleri and mixed microalgae in comparison with the other two groups (P < 0.05).

Table 3 Fatty acid compositions of C. muelleri, D. tertiolecta and I. galbana. The values are given as % of the total fatty acids and are the average of the larvae in three replicate groups in each treatment (mean ± SE). Different letters indicate significant (P < 0.05) differences among diets. PUFA = polyunsaturated fatty acid; EPA = eicosapentaenoic acids; and DHA = docosahexaenoic acids. Tr = level < 0.1%; − = not detected.

C10:0 C12:0 C13:0 C14:0 C15:0 C16:0 C16:1 C17:0 C18:0 C18:1 N9 C18:2 N6 C18:3 N6 C20:0 C20:3 N3 C20:4 N6(ARA) C20:5 N3(EPA) C21:0 C22:0 C22:1 N9 C22:6 N3 (DHA) C23:0 C24:0 C8:0 Saturated Monounsaturated n-6 PUFA n-3 PUFA Total PUFA EPA/ARA DHA/EPA EPA/DHA

C. muelleri

D. tertiolecta

I. galbana

0.08 ± 0.01 0.22 ± 0.02 0.04 ± 0.00 4.81 ± 0.05 0.60 ± 0.01 35.98 ± 3.24b 3.60 ± 0.17 0.35 ± 0.08 24.89 ± 3.27 23.08 ± 2.12a 3.07 ± 0.12a Trb 0.42 ± 0.03 0.02 ± 0.00 0.34 ± 0.04 1.78 ± 0.11a 0.01 ± 0.00 0.11 ± 0.00 0.27 ± 0.02 0.12 ± 0.00b 0.02 ± 0.00 0.12 ± 0.01 0.07 ± 0.00 67.73 ± 2.75b 26.95 ± 1.77a 3.41 ± 0.11a 1.91 ± 0.18a 5.32 ± 0.72a 5.24 ± 0.40a 0.07 ± 0.02b 15.30 ± 1.02a

0.09 ± 0.00 0.26 ± 0.01 0.03 ± 0.00 1.16 ± 0.03 0.30 ± 0.02 52.70 ± 2.78a – 0.31 ± 0.09 36.92 ± 2.11 5.34 ± 0.33b 1.40 ± 0.02b 0.36 ± 0.01a 0.54 ± 0.06

0.05 ± 0.00 0.17 ± 0.00 0.02 ± 0.00 2.53 ± 0.07 0.27 ± 0.05 36.55 ± 1.45b 1.61 ± 0.34 0.25 ± 0.04 23.99 ± 2.68 28.42 ± 2.38a 4.11 ± 0.35a Trb 0.40 ± 0.04 0.02 ± 0.00 0.38 ± 0.02 0.08 ± 0.00b 0.03 ± 0.00 0.14 ± 0.00 0.25 ± 0.02 0.64 ± 0.08a 0.02 ± 0.00 0.04 ± 0.00 0.04 ± 0.00 64.51 ± 2.95b 30.27 ± 1.73a 4.48 ± 0.63a 0.74 ± 0.06b 5.22 ± 0.84a 0.20 ± 0.02b 8.37 ± 1.23a 0.12 ± 0.03b

– – 0.01 ± 0.00 0.09 ± 0.00 0.35 ± 0.03 – 0.06 ± 0.00 0.07 ± 0.00 92.55 ± 2.47a 5.69 ± 0.86b 1.76 ± 0.22b – 1.76 ± 0.21b – – –

3.4. Protein content in microalgae and larvae There were no significant differences in the measured protein contents between C. muelleri and I. galbana (P > 0.05), and the protein content of D. tertiolecta was significantly lower than those of C. muelleri and I. galbana (P < 0.05) (Fig. 4a). There were some differences in the protein contents in larvae fed with different diets (Fig. 4b). The protein contents of the larvae fed with C. muelleri or the mixed diet were significantly higher than that of the larvae fed with D. tertiolecta, while the larvae fed with D. tertiolecta had significantly higher protein contents than those fed with I. galbana. In addition, this pattern was found in both species of sea urchin. The protein content of the S. nudus larvae was generally higher than that of the S. intermedius larvae, and this difference reached significance in the larvae fed with C. muelleri. However, this result was not found in the larvae fed with I. galbana, among which the protein content was significantly lower in the S. nudus larvae than in the S. intermedius larvae. 3.5. MYP gene expression in the larvae The relative expression level of the MYP gene in the S. intermedius and S. nudus larvae at all stages (from 4-arm stage to 8-arm stage) was significantly affected by the different diets (Fig. 5a,b). For each larval stage of S. intermedius, the MYP gene was expressed at similar levels in the groups fed C. muelleri and mixed microalgae and in the groups fed D. tertiolecta and I. galbana; moreover, MYP expression was significantly higher in the former two groups than in the latter two groups (Fig. 5a, P < 0.05). At the different S. nudus larval stages, MYP expression showed changes similar to those in the S. intermedius larvae except for in the 4-arm stage. At the 4-arm stage, MYP gene expression in S. nudus larvae was highest in the C. muelleri group and the mixed group, in which it was significantly greater than the MYP expression level in the I. galbana group but not that in the D. tertiolecta group; furthermore, there were no significant differences between the latter two groups (Fig. 5b). The MYP gene expression levels in the S. intermedius and S. nudus larvae fed with each diet were affected at different stages (from fertilized eggs to the 8-arm stage) as shown in Fig. 6. The relative levels of MYP gene expression in the S. intermedius larvae fed with different diets

C18:3 N3 and C20:5 N3 but significantly higher levels of C21:0 (P < 0.05). There were no significant differences between the S. intermedius larvae and the S. nudus larvae fed with I. galbana or D. tertiolecta (P > 0.05). High levels of highly unsaturated fatty acids (HUFAs), particularly 20:4 n-6 (ARA) and 20:5 n-3 (EPA), were present in the S. intermedius and S. nudus larvae, although they were present at low levels in the diets and were absent from the microalgae. Although 22:6 n-3 (DHA) 127

Aquaculture 492 (2018) 123–131

S. Qi et al.

Table 4 Fatty acid compositions of S. intermedius and S. nudus larvae fed diets of different microalgae. The values are given as % of the total fatty acids and are the average of the larvae in the three replicate groups in each treatment (mean ± SE). Different letters indicate significant (P < 0.05) differences among larvae fed diets of different microalgae. PUFA = polyunsaturated fatty acid; EPA = eicosapentanoic acids; and DHA = docosahexaenoic acids. Tr = level < 0.1%; − = not detected. S. intermedius C. muelleri C14:0 C15:0 C16:0 C16:1 C17:0 C17:1 C18:0 C18:1 N9 C18:2 N6 C18:3 N3 C20:0 C20:1 C20:2 C20:3 N3 C20:4 N6 (ARA) C20:5 N3 (EPA) C21:0 C22:1 N9 C22:6 N3 (DHA) Saturated Monounsaturated n-6 PUFA n-3 PUFA Total PUFA

S. nudus D. tertiolecta

a

5.45 ± 0.68 0.35 ± 0.03 27.84 ± 1.12b 1.81 ± 0.40b 0.24 ± 0.03 Tr 16.74 ± 1.28b 6.48 ± 0.73ab 0.25 ± 0.02b 0.56 ± 0.03b 0.56 ± 0.03 1.19 ± 0.37 0.51 ± 0.02 Tr 4.19 ± 0.24b 25.22 ± 1.89b 0.03 ± 0.00 0.22 ± 0.04 8.37 ± 0.78a 51.21 ± 2.96b 9.70 ± 1.57b 4.43 ± 0.25b 34.15 ± 2.14a 39.10 ± 1.67a

I. galbana a

6.31 ± 0.72 0.29 ± 0.03 29.19 ± 2.99b 4.48 ± 0.76a 0.18 ± 0.02 – 17.48 ± 1.21b 5.39 ± 0.36ab 0.39 ± 0.02a 0.16 ± 0.01c 0.54 ± 0.03 1.11 ± 0.30 – – 6.13 ± 0.46a 21.27 ± 2.00c 0.03 ± 0.00 0.22 ± 0.04 1.81 ± 0.32c 54.03 ± 1.85b 16.20 ± 2.66a 6.53 ± 0.41a 23.24 ± 2.05b 29.77 ± 1.02b

Mixture b

2.17 ± 0.11 0.24 ± 0.03 47.73 ± 2.36a 0.64 ± 0.06c 0.31 ± 0.04 – 33.58 ± 2.07a 1.82 ± 0.07c 0.40 ± 0.02a – 0.35 ± 0.02 2.03 ± 0.22 – – 3.52 ± 0.38b 4.56 ± 0.86d 0.37 ± 0.03 0.30 ± 0.03 1.98 ± 0.22c 84.76 ± 2.31a 4.79 ± 0.98c 3.91 ± 0.54b 6.54 ± 0.65c 10.46 ± 0.87c

C. muelleri a

7.78 ± 0.39 0.38 ± 0.06 21.74 ± 2.85c 3.52 ± 0.61a 0.19 ± 0.02 0.11 ± 0.01 9.32 ± 0.53c 8.80 ± 0.35a 0.55 ± 0.02a 1.71 ± 0.24a 0.38 ± 0.04 1.76 ± 0.28 1.10 ± 0.09 1.30 ± 0.16 5.39 ± 0.28 30.95 ± 1.67a 0.03 ± 0.00 0.31 ± 0.02 4.67 ± 0.38b 39.83 ± 2.65c 14.51 ± 2.69a 5.93 ± 0.66ab 38.63 ± 2.21a 45.67 ± 2.09a

D. tertiolecta a

6.06 ± 0.45 0.28 ± 0.02 28.49 ± 2.22b 3.26 ± 0.25 0.15 ± 0.01 – 13.43 ± 2.27c 9.47 ± 0.66a 0.45 ± 0.04 0.91 ± 0.17a 0.30 ± 0.04 1.13 ± 0.36 – – 2.70 ± 0.20b 32.13 ± 2.19a 0.02 ± 0.00 – 1.21 ± 0.67a 48.73 ± 1.94c 13.86 ± 1.74ab 3.15 ± 0.32 34.26 ± 2.43a 37.41 ± 1.65a

I. galbana b

3.59 ± 0.31 0.21 ± 0.01 39.44 ± 2.75ab 2.78 ± 0.56 0.20 ± 0.02 – 22.91 ± 1.12b 6.05 ± 0.78b 0.45 ± 0.02 0.27 ± 0.02b 0.25 ± 0.08 1.58 ± 0.17 – – 5.08 ± 0.47a 16.41 ± 1.36b 0.03 ± 0.00 – 0.76 ± 0.03b 66.62 ± 2.26b 10.42 ± 0.95b 5.53 ± 0.74 17.44 ± 1.09b 22.97 ± 1.43b

Mixture b

2.91 ± 0.42 0.24 ± 0.02 47.90 ± 2.96a 1.10 ± 0.23 0.27 ± 0.04 – 31.37 ± 2.26a 3.23 ± 0.45c 0.36 ± 0.02 0.07 ± 0.01c 0.28 ± 0.02 2.02 ± 0.43 – – 4.80 ± 0.29a 3.79 ± 0.83c 0.15 ± 0.03 – 1.52 ± 0.38a 83.11 ± 2.18a 6.34 ± 0.41c 5.17 ± 0.29 5.38 ± 0.52c 10.54 ± 0.65c

5.79 ± 1.02a 0.28 ± 0.01 24.29 ± 1.43b 3.65 ± 0.49 0.17 ± 0.01 – 13.43 ± 0.92c 10.97 ± 1.27a 0.42 ± 0.06 0.70 ± 0.11a 0.31 ± 0.04 1.79 ± 0.25 – – 4.38 ± 0.91a 32.04 ± 1.24a 0.04 ± 0.01 – 1.75 ± 0.49a 44.31 ± 2.93c 16.41 ± 2.13a 4.80 ± 0.25 34.48 ± 2.16a 39.28 ± 1.87a

2008; Schiopu et al., 2006). The stomach lengths/widths and metamorphosis rates were the poorest in the S. intermedius and S. nudus larvae fed with I. galbana. The stomach lengths/widths were slightly better in the D. tertiolecta group and the best in the C. muelleri and mixed microalgae groups, suggesting that C. muelleri and mixed microalgae were the best diets for S. intermedius and S. nudus, which is consistent with a previous study reporting that mixed I. galbana and D. tertiolecta were more effective as diets for sea urchins (Dendraster excentricus) (Schiopu et al., 2006). Therefore, it can be conjectured that the fastest development rate of the larvae indicated the best stomach length/width but did not necessarily indicate the best body length/ width or post-oral arm length, which is inconsistent with a previous study (Carboni et al., 2012). The morphology, growth and duration of urchin development are strongly affected by their species (Jimmy et al., 2003; Kelly et al., 2000; McEdward and Herrera, 1999), suggesting that different sea urchins have different food preferences or requirements. Consistent with that idea, the present study showed differences in growth and development in response to various diets; for instance, the S. intermedius larvae fed with I. galbana showed longer body/post-oral arm lengths than S. nudus. Nonetheless, consistent final results were obtained, which might be due to the similar latitudes and longitudes of their habitats. Consistent with the ability of sea urchins to maintain food selection throughout the feeding process (Appelmans, 1994), on the 12th day, a majority of the larvae fed with I. galbana did not develop to the 8-arm stage, suggesting that either the nutritional value of I. galbana was insufficient for normal development or the larvae were

at all stages in the C. muelleri and the mixed microalgae groups exhibited similar trends. There was a nonsignificant decrease from the fertilized eggs to the prismatic stage; thereafter, a significant increase was observed in the 4-arm individuals. MYP gene expression was highest at the 6-arm stage; although the final stage showed a significant decrease compared to the 6-arm stage, the levels were still significantly higher than those at the other 3 stages (Fig. 6a). The trends of the MYP expression levels in the larvae fed with D. tertiolecta and I. galbana were also similar, but, unlike the larvae fed with C. muelleri or mixed microalgae, the expression levels did not show a significant increase in the 4-arm stage, and the overall changes in expression at each stage were smaller in magnitude. Similarly, the changes in the relative MYP gene expression levels in the S. nudus larvae were similar to those in the S. intermedius larvae, but the changes at the 6- and 8-arm stages in the D. tertiolecta and I. galbana groups were much larger than those in the S. intermedius larvae (Fig. 6b).

4. Discussion 4.1. The effects of different microalgal diets on larval growth, development and rate of metamorphosis Stomachs can be used to evaluate the general growth and conditions of larvae, reflecting the digestive ability and whether the nutrition provided by the diet is suitable for larvae, and larger stomachs are found when larvae are fed the most appropriate diets (George et al.,

Fig. 4. The protein contents of the three types of microalgae and the larvae fed with different diets. Different letters indicate significant (P < 0.05) differences among diets, and a and b indicate the comparison of different diets in a single species of sea urchin; X and Y indicate the comparison of a single diet between two different species of sea urchins.

128

Aquaculture 492 (2018) 123–131

S. Qi et al.

Fig. 5. The relationship between the relative MYP gene expression levels and diet for each stage of S. intermedius and S. nudus larvae. a, S. intermedius; b, S. nudus. Different letters indicate significant (P < 0.05) differences among diets.

C20:5 N3 (EPA) showed the opposite results. At the same time, in all larvae, the total levels of n-6 PUFAs, n-3 PUFAs, and monounsaturated fats exhibited trends similar to those observed for C18:1 N9, C18:3 N3, and C20:5 N3 (EPA); thus, their presence might be conducive to larval growth and metamorphosis, which is in line with a previous study (Liu et al., 2007b). The much higher levels of 20:1 n-9 and 22:1 n-9 in the larvae than in the microalgae indicated that they were elongated from 18:1 n-9, a pattern that was also found in juvenile S. droebachiensis (Castell et al., 2004). Freshwater fish can also elongate and desaturate 18:2 n-6 to 20:4 n-6 as well as 18:3 n-3 to 20:5 n-3 and 22:6 n-3 (Sargent et al., 2003), which is similar to the biosynthetic pathway in P. lividus larvae. No significant differences were observed in the fatty acid compositions of S. intermedius that were fed with C. muelleri or mixed microalgae; nonetheless, there were differences in C22:1 N9, C20:2 and C20:2 N2 that were not detected in S. nudus. The different capacities for fatty acid conversion or generation in the different species of sea urchin suggested differences in their food requirements. Further research in this area is needed to reveal more information about sea urchin nutrition.

unable to effectively take up the nutrition in I. galbana.

4.2. Composition of major fatty acids in microalgae and larvae The proportions of DHA, EPA and ARA have been acknowledged to be key determinants of microalgae quality, but the DHA/EPA and EPA/ ARA ratios are also important (Reitan et al., 1997; Schiopu et al., 2006). Both higher (Schiopu et al., 2006) and lower DHA/EPA ratios have been reported to promote the growth of sea urchins. It was found that C20related fatty acids were not present in D. tertiolecta, including C20:3 N3, C20:3 N6, C20:4 N6 (ARA) and C20:5 N3 (EPA), which is consistent with previous studies that reported that D. tertiolecta lacked all longchain fatty acids beyond C20 (Brown et al., 1997; Liu et al., 2007a; Payne and Rippingale, 2000). In this study, the EPA/DHA and EPA/ ARA ratios were significantly higher in C. muelleri than in I. galbana, which was similar to the trends in the final rates of metamorphosis for the S. intermedius and S. nudus larvae. The ratios of these three fatty acids in larvae have been tightly correlated with larval growth and development (Liu et al., 2007a); however, the EPA/DHA ratio had different effects on the development of larvae to juvenile growth. The larvae showed higher levels of HUFAs, particularly ARA (20:4 n-6) and EPA (20:5 n-3), although those HUFAs were present at lower levels in the diets. DHA (22:6 n-3) was not detected in D. tertiolecta but was present in the larvae fed with D. tertiolecta, which indicated that the larvae were able to produce these HUFAs through the elongation and desaturation of linoleic acid (18:2 n-6), linolenic acid (18:3 n-3) and stearidonic acid (18:4 n-3). These results are in accordance with other reports on D. excentricus larvae (Schiopu et al., 2006), juvenile S. droebachiensis (Castell et al., 2004), and adult P. miliaris (Bell et al., 2001; Pantazis et al., 2000). In this study, the contents of C16:0, C18:0, and C20:1 were significantly higher in the larvae fed with I. galbana than in larvae fed with D. tertiolecta and were lowest in the larvae fed with C. muelleri or the mixed microalgae; however, the contents of C18:1 N9, C18:3 N3, and

4.3. Protein content in microalgae and larvae There were no significant differences between the protein contents of the C. muelleri and I. galbana diets, and the protein content of D. tertiolecta was significantly lower than that of C. muelleri and I. galbana. In addition, the protein contents of the larvae fed with C. muelleri or the mixed diet were significantly higher than those of the larvae fed with D. tertiolecta, while the protein contents of the larvae fed with D. tertiolecta were significantly higher than those fed with I. galbana. 4.4. MYP gene expression in the larvae MYP is a reserve form of amino acids and is a nutrient source during

Fig. 6. The relationship between the relative MYP gene expression levels and developmental stages of S. intermedius and S. nudus larvae for each diet. a, S. intermedius; b, S. nudus. The different letters indicate significant (P < 0.05) differences among diets. 129

Aquaculture 492 (2018) 123–131

S. Qi et al.

References

embryonic development. There were no significant differences in the MYP gene expression levels between the larvae fed with C. muelleri and the larvae fed with mixed microalgae at each stage, but the expression levels in these two groups were significantly higher than those in the larvae fed with D. tertiolecta or I. galbana, which also showed no significant differences from each other. The low MYP gene expression level was probably due to poor development. With the prolongation of the period without adequate nutrition, the expression level of the MYP gene in the body cavity cells first decreased rapidly and then stabilized at a lower level (Qin et al., 2012). In the current study, the MYP gene expression levels in the larvae fed with unsuitable microalgae were significantly lower than those in the larvae fed with suitable microalgae, likely because the overall nutritional quality of the microalgae did not meet the needs of the larvae rather than because of the protein content of the microalgae. Many animals store yolk in their eggs to be used as an energy source until the embryo can develop the tissue specializations necessary to import food by feeding (Wessel et al., 2000). Moreover, Western blotting showed that the maternal EGMYP disappeared by the 4-arm stage (Unuma et al., 2009). Therefore, the protein produced by the MYP gene is CFMYP, which is speculated to transport zinc derived from food via the body cavities to various tissues. We found that there was a nonsignificant decrease from the fertilized eggs to the prismatic stage; thereafter, a significant increase was observed in the 4-arm individuals, and the highest value throughout the development process was observed at the 6-arm stage. The final stage showed a significant decrease compared to the 6-arm stage, but the MYP level was still significantly higher than those in the other 3 stages. However, although MYP gene expression was not detected at the 6-arm stage, it was detected at the 8arm stage (Unuma et al., 2009). It could be speculated that generation of CFMYP increased with the increased digestion during the development of the larval stages. CFMYP production is also consistent with good growth conditions in the stomach in the presence of a suitable diet.

Appelmans, N., 1994. Sites of particle selection determined from observations of individual feeding larvae of the sand dollar Dendraster excentricus. Limnol. Oceanogr. 39, 404–411. Archana, A., Babu, K.R., 2016. Nutrient composition and antioxidant activity of gonads of sea urchin Stomopneustes variolaris. Food Chem. 197, 597–602. Azad, A.K., Pearce, C.M., Mckinley, R.S., 2011. Effects of diet and temperature on ingestion, absorption, assimilation, gonad yield, and gonad quality of the purple sea urchin (Strongylocentrotus purpuratus). Aquaculture 317, 187–196. Bell, M.V., Dick, J.R., Kelly, M.S., 2001. Biosynthesis of eicosapentaenoic acid in the sea urchin Psammechinus miliaris. Lipids 36, 79–82. Brown, M.R., Jeffrey, S.W., Volkman, J.K., Dunstan, G.A., 1997. Nutritional properties of microalgae for mariculture. Aquaculture 151, 315–331. Brundu, G., Monleón, L.V., Vallainc, D., Carboni, S., 2016a. Effects of larval diet and metamorphosis cue on survival and growth of sea urchin post-larvae (Paracentrotus lividus; Lamarck, 1816). Aquaculture 465, 265–271. Brundu, G., Vallainc, D., Baroli, M., Figus, A.M., Pinna, A., Carboni, S., 2017. Effects of on-demand feeding on sea urchin larvae (Paracentrotus lividus; Lamarck, 1816), development, survival and microalgae utilization. Aquac. Res. 48, 1550–1560. Byrne, M., Villinski, J.T., Cisternas, P., Siegel, R.K., Popodi, E., Raff, R.A., 1999. Maternal factors and the evolution of developmental mode: evolution of oogenesis in Heliocidaris erythrogramma. Development Genes & Evolution 209, 275–283. Carboni, S., Vignier, J., Chiantore, M., Tocher, D.R., Migaud, H., 2012. Effects of dietary microalgae on growth, survival and fatty acid composition of sea urchin Paracentrotus lividus throughout larval development. Aquaculture 324-325, 250–258. Cárcamo, P.F., Candia, A.I., Chaparro, O.R., 2005. Larval development and metamorphosis in the sea urchin Loxechinus albus (Echinodermata: Echinoidea): effects of diet type and feeding frequency. Aquaculture 249, 375–386. Castell, J.D., Kennedy, E.J., Robinson, S.M., Parsons, G.J., Blair, T.J., Gonzalez-Duran, E., 2004. Effect of dietary lipids on fatty acid composition and metabolism in juvenile green sea urchins (Strongylocentrotus droebachiensis). Aquaculture 242, 417–435. Cervello, M., Arizza, V., Cammarata, M., Matranga, V., Parrinello, N., 1996. Properties of sea urchin coelomocyte agglutinins. Ital. J. Zool. 63, 353–356. Christie, W.W., 2003. Isolation, Separation, Identification and Structural Analysis of Lipids. Ding, J., Chang, Y., Wang, C., Cao, X., 2007. Evaluation of the growth and heterosis of hybrids among three commercially important sea urchins in China: Strongylocentrotus nudus, S. intermedius and Anthocidaris crassispina. Aquaculture 272, 273–280. Folch, J., Lees, M., Sloane, G.S., 1957. A simple method for the isolation and purification of total lipides from animal tissues. J. Biol. Chem. 226, 497–509. George, S.B., Fox, C., Wakeham, S., 2008. Fatty acid composition of larvae of the sand dollar Dendraster excentricus (Echinodermata) might reflect FA composition of the diets. Aquaculture 285, 167–173. Gisbert, E., Villeneuve, L., Zambonino-Infante, J.L., Quazuguel, P., Cahu, C.L., 2005. Dietary phospholipids are more efficient than neutral lipids for long-chain polyunsaturated fatty acid supply in European sea bass Dicentrarchus labrax larval development. Lipids 40, 609–618. Goksan, T., Durmaz, Y., Sevket, G., 2003. Effects of light path lengths and initial culture density on the cultivation of Chaetoceros muelleri (Lemmermann, 1898). Aquaculture 217, 431–436. Harel, M., Lund, E., Gavasso, S., Herbert, R., Place, A.R., 2000. Modulation of arachidonate and docosahexaenoate in Morone chrysops larval tissues and the effect on growth and survival. Lipids 35, 1269–1280. Harrington, F.E., Easton, D.P., 1982. A putative precursor to the major yolk protein of the sea urchin. Dev. Biol. 94, 505–508. Harrold, C., Reed, D.C., 1985. Food availability, sea urchin grazing, and kelp forest community structure. Ecology 66, 1160–1169. Hinegardner, R.T., 1969. Growth and development of the laboratory cultured sea urchin. Biol. Bull. 137, 465–475. Huggett, M.J., King, C.K., Williamson, J.E., Steinberg, P.D., 2005. Larval development and metamorphosis of the Australian diadematid sea urchin Centrostephanus rodgersii. Invertebr. Reprod. Dev. 47, 197–204. Jimmy, R.A., Kelly, M.S., Beaumont, A.R., 2003. The effect of diet type and quantity on the development of common sea urchin larvae Echinus esculentus. Aquaculture 220, 261–275. Kelly, M.S., Hunter, A.J., Scholfield, C.L., Mckenzie, J.D., 2000. Morphology and survivorship of larval Psammechinus miliaris (Gmelin) (Echinodermata: Echinoidea) in response to varying food quantity and quality. Aquaculture 183, 223–240. Liu, H., Kelly, M.S., Cook, E.J., Black, K., Orr, H., Zhu, J.X., Dong, S.L., 2007a. The effect of diet type on growth and fatty-acid composition of sea urchin larvae, I. Paracentrotus lividus (Lamarck, 1816) (Echinodermata). Aquaculture 264, 247–262. Liu, H., Kelly, M.S., Cook, E.J., Black, K., Orr, H., Zhu, J.X., Dong, S.L., 2007b. The effect of diet type on growth and fatty acid composition of the sea urchin larvae, II. Psammechinus miliaris (Gmelin). Aquaculture 264, 263–278. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25, 402–408. Lynch, J.M., Barbano, D.M., 1999. Kjeldahl nitrogen analysis as a reference method for protein determination in dairy products. J. AOAC Int. 82, 1389. McEdward, L.R., Herrera, J.C., 1999. Body form and skeletal morphometrics during larval development of the sea urchin Lytechinus variegatus Lamarck. J. Exp. Mar. Biol. Ecol. 232, 151–176. Pantazis, P.A., Kelly, M.S., Connolly, J.G., Black, K.D., 2000. Effect of artificial diets on growth, lipid utilization, and gonad biochemistry in the adult sea urchin Psammechinus miliaris. J. Shellfish Res. 19, 995–1002.

5. Conclusions C. muelleri and mixed microalgae were the best diets for S. intermedius and S. nudus. The stomach can be used to evaluate the general growth and condition of larvae, reflecting the digestive ability and whether the nutrition of a diet is suitable for the larvae. The growth and duration of the development of urchins are strongly affected by their species. Furthermore, the different capacities of fatty acid conversion or generation in different species of sea urchin suggested the differences in food demands. The levels of total n-6 PUFAs, n-3 PUFAs, and monounsaturated fatty acids in the larvae might be conducive to larval growth and metamorphosis, which is in line with a previous study that advised that larvae were able to produce these HUFAs through the elongation and desaturation of linoleic acid (18:2 n-6), linolenic acid (18:3 n-3) and stearidonic acid (18:4 n-3). The MYP gene expression levels in the larvae fed with unsuitable microalgae were significantly lower than those in the larvae fed with suitable microalgae, likely because the unsuitable microalgae could not meet their nutritional needs, not because of the protein content of the microalgae. The MYP gene expression levels in the different stages were observed to fit the following pattern: 6-arm stage > 8-arm stage > 4arm stage > fertilized eggs > prismatic stage. Acknowledgments Financial support was provided by the Jiangsu Collaborative Innovation Center for Solid Organic Waste Resource Utilization, Chinese National 863 project (2012AA10A412) and a grant for Chinese Outstanding Talents in Agricultural Scientific Research (for Chang Y). 130

Aquaculture 492 (2018) 123–131

S. Qi et al.

Unuma, T., Konishi, K., Kiyomoto, M., Matranga, V., Yamano, K., Ohta, H., Yokota, Y., 2009. The major yolk protein is synthesized in the digestive tract and secreted into the body cavities in sea urchin larvae. Mol. Reprod. Dev. 76, 142–150. Vagner, M., Robin, J.H., Zambonino-Infante, J.L., Tocher, D.R., Person-Le Ruyet, J., 2009. Ontogenic effects of early feeding of sea bass (Dicentrarchus labrax) larvae with a range of dietary n-3 highly unsaturated fatty acid levels on the functioning of polyunsaturated fatty acid desaturation pathways. Br. J. Nutr. 101, 1452–1462. Walker, C.W., 1982. Nutrition of gametes. Echinoderm. Nutrition 449–468. Walker, C.W., Harrington, L.M., Lesser, M.P., Fagerberg, W.R., 2005. Nutritive phagocyte incubation chambers provide a structural and nutritive microenvironment for germ cells of Strongylocentrotus droebachiensis, the green sea urchin. Biol. Bull. 209, 31–48. Walker, C.W., Unuma, T., Lesser, M.P., 2007. Chapter 2 Gametogenesis and Reproduction of Sea Urchins. Walker, C.W., Böttger, S., Unuma, T., Watts, S.A., Harris, L.G., Lawrence, A.L., Eddy, S.D., 2015. Enhancing the Commercial Quality of Edible Sea Urchin Gonads—Technologies Emphasizing Nutritive Phagocytes, Echinoderm Aquaculture. John Wiley & Sons, Inc., pp. 263–286. Wang, H., Ura, K., Takagi, Y., 2015. The major yolk protein in sea urchin egg yolk granules is a glycoprotein complex. Fish. Sci. 81, 1127–1134. Wessel, G.M., Zaydfudim, V., Hsu, Y.T.J., Laidlaw, M., Brooks, J.M., 2000. Direct molecular interaction of a conserved yolk granule protein in sea urchins. Develop. Growth Differ. 42, 507–517. Yamasaki, A., Higaki, H., Nakashima, K., Yamamoto, O., Hein, K.Z., Takahashi, H., Chinuki, Y., Morita, E., 2010. Identification of a major yolk protein as an allergen in sea urchin roe. Acta Derm. Venereol. 90, 235–238. Zhou, Z.C., Bao, Z.M., Dong, Y., Wang, L.M., He, C.B., Liu, W.D., 2008. MYP gene expressions at transcription level in different stages of gonad of sea urchin Strongylocentrotus intermedius and hybrids. Hereditas 30, 1453–1458.

Payne, M., Rippingale, R., 2000. Evaluation of diets for culture of the calanoid copepod Gladioferens imparipes. Aquaculture 187, 85–96. Pearse, J.S., 2006. Ecological role of purple sea urchins. Science 314, 940–941. Qin, Y., Sun, B., Xia, L.I., Wang, X., 2012. Effect of starvation on expression patterns of the MYP gene in Strongylocentrotus intermedius. Acta Ecol. Sin. 32, 1755–1761. Reitan, K.I., Rainuzzo, J.R., Øie, G., Olsen, Y., 1997. A review of the nutritional effects of algae in marine fish larvae. Aquaculture 155, 207–221. Richmond, A., 2008. Handbook of Microalgal Culture: Biotechnology and Applied Phycology. John Wiley & Sons. Sargent, J.R., Tocher, D.R., Bell, J.G., 2003. The Lipids. Schiopu, D., George, S.B., Castell, J., 2006. Ingestion rates and dietary lipids affect growth and fatty acid composition of Dendraster excentricus larvae. J. Exp. Mar. Biol. Ecol. 328, 47–75. Scott, L.B., Leahy, P.S., Decker, G.L., Lennarz, W.J., 1990. Loss of yolk platelets and yolk glycoproteins during larval development of the sea urchin embryo. Dev. Biol. 137, 368–377. Shyu, A.B., Blumenthal, T., Raff, R.A., 1987. A single gene encoding vitellogenin in the sea urchin Strongylocentrotus purpuratus: sequence at the 5′ end. Nucleic Acids Res. 15, 10405–10417. Sokal, R.R., Rohlf, F.J., 1995. Analysis of Frequencies, Biometry, Correlation, Linear Regression. Tocher, D.R., Harvie, D.G., 1988. Fatty acid compositions of the major phosphoglycerides from fish neural tissues; (n−3) and (n−6) polyunsaturated fatty acids in rainbow trout (Salmo gairdneri) and cod (Gadus morhua) brains and retinas. Fish Physiol. Biochem. 5, 229–239. Unuma, T., Okamoto, H., Konishi, K., Ohta, H., Mori, K., 2001. Cloning of cDNA encoding vitellogenin and its expression in red sea urchin, Pseudocentrotus depressus. Zool. Sci. 18, 559–565.

131