The effects of CD59 gene as a target gene on breast cancer cells

Cellular Immunology 272 (2011) 61–70

Contents lists available at SciVerse ScienceDirect

Cellular Immunology journal homepage: www.elsevier.com/locate/ycimm

The effects of CD59 gene as a target gene on breast cancer cells Bing Li a,⇑,1, Xianming Chu b,1,2, Meihua Gao c, Yingjie Xu a a

Department of Biology, Medical College of Qingdao University, Qingdao 266021, PR China Affiliated Hospital of Medical College of Qingdao University, Qingdao 266101, PR China c Department of Immunology, Medical College of Qingdao University, Qingdao 266021, PR China b

a r t i c l e

i n f o

Article history: Received 20 April 2011 Accepted 19 September 2011 Available online 22 September 2011 Keywords: CD59 Breast cancer Target gene MCF-7 cells RNAi

a b s t r a c t The retroviral-vector-targeted CD59 gene (pSUPER-siCD59) was constructed and transfected into breast cells (MCF-7). The results demonstrated that the retroviral vector-mediated RNAi successfully suppressed human CD59 gene. The expression of CD59 decreased at both mRNA and protein levels. Knockdown of CD59 abrogated its protective effect on complement-mediated cytolysis. Fas and caspase-3 were remarkably upregulated, which induced apoptosis and tumor growth suppression in MCF-7 cells. In addition, overexpression of CD59 promoted the proliferation of MCF-7 cells and inhibited anti-apoptotic Bcl-2 expression. In conclusion, CD59 may be a promising target in the gene therapy of breast cancer. Ó 2011 Elsevier Inc. All rights reserved.

1. Introduction Breast cancer is by far the most frequent cancer among women with an estimated 1.38 million new cases diagnosed in 2008 (23% of all malignancies in women) and ranks second overall (10.9%), after lung carcinoma, of all malignancies in both sexes [1]. The estimated incidence of breast cancer in 2008 worldwide has been 39 new cases/100,000 women. The incidence has been estimated to vary from 19.3 in Eastern Africa to 89.9 in Western Europe, and is generally high (>80) in developed countries (except Japan) and low (<40) in most of the developing countries [1]. Breast carcinoma has been estimated to cause 458,000 deaths in 2008 worldwide (13.7% of all cancer deaths in women and 6% of all cancer deaths in both sexes), with an estimated mortality rate of 12.5/100,000. Alterations of genes are known to be critical for the induction of tumorigenesis, but the mechanism of carcinogenesis is poorly understood and remains to be elucidated. BRCA1 is a human tumor suppressor gene that produces a protein called breast cancer type 1 susceptibility protein. It has been reported that concurrent inactivation of Rb and p53 genes contributes to the initiation of ovarian cancer development [2]. BRCA1/2 and p53 are known to play important roles in DNA repair and the cell cycle. Recent evidence has shown that the mutation of the BRCA1 gene increases the incidence of preneoplastic changes in murine ovarian surface ⇑ Corresponding author. Address: Department of Biology, Medical College of Qingdao University, 38 Dengzhou Road, Qingdao 266021, PR China. E-mail address: [email protected] (B. Li). 1 These authors equally contributed to this work. 2 Co-first author. 0008-8749/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.cellimm.2011.09.006

epithelium (OSE) and the inactivation of p53 reverses the increase of apoptosis induced by the loss of function of BRCA1 in vivo [3]. This indicates that concurrent knockout of BRCA1 and p53 may be involved in critical changes responsible for the induction of ovarian carcinogenesis [4]. The cluster of differentiation 59 (CD59), also called protectin, is one kind of complement regulate proteins (CRPs) that inhibits the cytolytic activity of complement by binding to C8 and C9, thereby blocking the assembly of the membrane attack complex (MAC) [5]. CD59 is widely expressed in a variety of tissues. Under normal conditions, it locates on the surface of most tissue cells including heart, liver, spleen, kidney, monocytes, red cells, granular cells and vena umbilicalis endothelial cells [6]. Studies have shown that the density of CD59 molecules on the cell surface changes in some diseases. The absence or low level expression of CD59 may be partially responsible for the pathogenesis of diabetes, multiple sclerosis and acquired immune deficiency syndrome (AIDS) [7–11], whereas up-regulation of expression of CD59 is also reported in various inflammatory diseases such as Alzheimer’s disease, ulcerative colitis and rheumatoid arthritis [12–14]. RNA interference (RNAi) technique that specifically silences the target gene by double-stranded RNA (dsRNA) has been successfully employed in gene function study and therapeutic research in mammalian cells. Recently, siRNA-encoding plasmids delivered by virus has been developed and applied widely in mammalian cells [15–17]. Up to date, little is known on the relationship of CD59 gene expression and breast cancer cells (MCF-7 cells) growth. Our study demonstrated the CD59 gene might be a target gene in breast cancer gene therapy.

62

B. Li et al. / Cellular Immunology 272 (2011) 61–70

2. Materials and methods 2.1. Materials MCF-7 cells and Escherichia coli DH5a were preserved in our lab. pALTER-MAX plasmid was from Promega (Madison, WI, USA). PcDNA plasmid was a generous gift by Dr. halperin (Harvard Medical School, Boston, MA, USA). Lipofectamine 2000 were from Invitrogen (Carlsbad, USA); All restriction endonucleases and Taq polymerase were from Sigma (St. Louis, MO, USA); T4 DNA ligase and DMEM, GIBCO BRL life Technologies (Gaithersburg, MD, USA); Trypsin and G418 antibiotic (Amersco); Lipfectamine-2000 (Invitrogen™ Life Technologies); FITC-conjugated CD59 fluorescence antibody and FITC-conjugated goat anti-mouse IgG (COULTER). FBS (Hyclone, Logan, USA). BCA assay (Pierce, Rockford, USA). 2.2. Cell culture The MCF-7 cell line was maintained in DMEM growth medium. All the media were supplemented with 10% fetal bovine serum and antibiotics (100 mg/ml streptomycin and 100 U/ml penicillin) at 37 °C with 5% CO2.

into six well plates at 3  105 cells/well. Twenty-four hours later, the cells were infected with viral supernatants (MOI = 120:1) in the presence of polybrene for 12 h, followed by the addition of fresh medium. After 24 h, the cells were incubated with fresh viral supernatant for an additional 12 h. Forty-eight hours later, the five groups of MCF-7 cells were harvested. 2.5. Screening of positive cell by reverse transcriptional (RT)-PCR Total RNA from different groups of MCF-7 cells was isolated using Trizol Reagent (Invitrogen). Two microgram of total RNA was reverse-transcribed in a 20 ll reaction using reverse-transcription system (Promega). Primers were designed based on sequences of human CD59 and GAPDH. The forward primer of CD59 was 50 ACAACTGTCCTAACCCAA30 , and the reverse primer was 50 GAGTCACCAGCAGAAGAA30 . The forward primer of GAPDH was 50 CGTGGAAGGACTCATGACCA30 , and the reverse primer was 50 TCCAGGGGTCTTACTCCTTG30 . The amplified sequence was 267 and 509 bp, respectively. Thermo cycling was carried out as follows: 48 °C for 45 min, 94 °C for 2 min, then 40 cycles of 94 °C for 30 s, 47 °C for 1 min and 68 °C for 2 min, followed by 68 °C for 7 min. PCR products were quantified using Tanon Image Software; CD59 levels were normalized with respect to GAPDH levels.

2.3. Sequence design of targeted human CD59 gene 2.6. Determination of CD59 protein expression by Western blot Three 19-nt target sequences were designed to identify different locations on the mRNA of CD59 using Oligo Engine Technologies software. A missense sequence was designed as the control group. The 60 bp oligonucleotides were synthesized (Table 1) according to the instruction manual of the pSUPER retro neo + gfp vector (Oligo Engine). A pair of primers was designed to identify the recombinant vectors. The primers were as follows: pSUPER-a: 50 -CCTTTATCCAGCCCTCACTC-30 , pSUPER-s: 50 -AGACTGCCTTGGGA AAAGCG-30 . 2.4. Construction of retroviral vectors and transfection into MCF-7 cells To construct pSUPER-siCD59, the 983 bp fragment of 30 long terminal repeat in the human H1 promoter were deleted from the retroviral vectors pSUPER via BglII/HindIII double digestion. Then, the aforementioned four pairs of synthetic oligonucleotides were annealed, respectively, and cloned into the downstream of the H1 promoter in pSUPER. The configuration of the pSUPER-siCD59 was verified by DNA sequencing. In addition, the MCF-7 cells in 60 mm dishes were cotransfected by Lipofectamine 2000 and 10 lg empty vector or recombinant retroviral vector (pSUPER or pSUPER-siCD59) for 24 h. After transfection, the cells were incubated at 32 °C to increase viral titer. Forty-eight hours later, the supernatant containing the retroviral particles was collected, filtered through the 0.45 lm low protein binding syringe filter, and used to infect target cells. MCF-7 cells maintained in DMEM medium were plated

Six groups of MCF-7 cells (including group T0 which was transfected by empty pSUPER, groups T1, T2, T3 and T0 (empty pSUPER transfected cells), group C and uninfected group N) were harvested at the indicated time points, washed twice with cold phosphatebuffered saline, lysed in fresh cell lysis buffer for 2 h on ice, and centrifuged at 15,000g for 15 min at 4 °C to remove insoluble materials. Protein concentrations were determined by BCA assay. Sixty micrograms of lysate supernatant was separated using 12% and 5% sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transferred to PVDF membranes. The membrane was incubated with anti-CD59 and anti-b-actin antibodies, respectively, followed by incubation with horseradish peroxidase-conjugated goat anti-mouse secondary antibody. Western blots were developed using Western blotting luminal reagent. 2.7. Complement-mediated cytolysis by ELESA assay Transfected MCF-7 cells and uninfected cells were harvested after 36 h, washed with medium and resuspended in 1  105/ml in DMEM medium. Cells were incubated with anti-MCF-7 antibody and serial dilutions of fresh human serum in DMEM medium for 60 min at 37 °C. Triplicated wells were used for each dilution. MTT was dissolved in PBS at 5 mg/ml, and 20 ll stock MTT solution was added to each well. The plates were incubated at 37 °C for 4 h, and then centrifuged at 1500 rpm for 10 min. The supernatant was

Table 1 The sequence of S and AS strands. Groups

S and AS strands

T1

50 -GATCCCCGCGTGTCTCATTACCAAAGttcaagagaCTTTGGTAATGAGACACGCTTTTTA-30 50 -AGCTTAAAAAGCGTGTCTCATTACCAAAGtctcttgaaCTTTGGTAATGAGACACGCGGG-30 50 -GATCCCCGTGTTGGAAGTTTGAGCATttcaagagaTGCTCAAACTTCCAACACTTTTTA-30 50 -AGCTTAAAAAGTGTTGGAAGTTTGAGCATtctcttgaaATGCTCAAACTTCCAACACGGG-30 50 -GATCCCCTGAGCTAACGTACTACTGCttcaagagaGCAGTAGTACGTTAGCTCATTTTTA-30 50 -AGCTTAAAAATGAGCTAACGTACTACTGCtctcttgaaGCAGTAGTACGTTAGCTCAGGG-30 50 -GATCCCCAGACTTGACTCCTGTCGAAttcaagagaATCTGAACTGAGGACAGCTTTTTTTA-30 50 -AGCTTAAAAAAGACTTGACTCCTGTCGAAtctcttgaaTCTGAACTGAGGACAGCTTGGG-30

T2 T3 Control

Sequence 1 (T1 group) begins and ends at 218–236 bp; sequence 2 (T2 group), begins and ends at 261–279 bp; sequence 3 (T3 group), begins and ends at 318–336 bp; sequence 4 (control group, C), missense sequence of 19-nt target sequences of T1. The bold values indicate the sequence pairs in order to form hairpin structure.

B. Li et al. / Cellular Immunology 272 (2011) 61–70

discarded. DMSO was added to each well to dissolve the dark blue crystals. After a few minutes at room temperature, the plates were read on a multi-well scanning spectrophotometer with a test wavelength of 490 nm. 2.8. Effects of CD59 gene silencing on MCF-7 cell proliferation ability Transfected MCF-7 cells were cultured for 3 days in 96-well plates, and then incubated in 5% MTT at 37 °C for 4 h. DMSO (100 ll/well) was added, and the light absorption value at 490 nm was measured. 2.9. Fas and caspase-3 protein expression of MCF-7 cells Transfected MCF-7 cells were dropped on microscope slides disposed by 0.1% poly-lysine solution and fixed at room temperature by 4% polyformadehyde/0.1 M PBS for 20–30 min. After washed with distilled water, the cells were treated with 30% H2O2: methanol at room temperature for 30 min and washed with distilled water. The Fas and caspase-3 protein expression levels were measured by immunohistochemical staining. In brief, MCF-7 cells were incubated in blocking buffer at room temperature for 20 min, followed by the first antibody (rabbit antihuman Fas/caspase antibody) at 37 °C for 1–2 h, then by second antibody (biotinylated goat antirabbit IgG) at 37 °C for 20 min, SABC at 37 °C for 20 min and DAB at room temperature for 5–30 min, and the results were observed under light microscope. Positive cells were stained brownish yellow. Protein expressions of Fas and caspase-3 were determined by positive index = positive percentage (%)  mean optical density  100.

63

having a strip standing for a fragment of 500 bp may be positive colonies that will be further identified by enzyme digestion. The plasmid pALTER-MAX-CD59 was extracted from positive colonies and then digested with EcoR I at 37 °C overnight. The transformed colonies containing empty plasmid pALTER-MAX were used as a control. Furthermore, the obtained DNA fragment was sequenced, and bacterial clones with correct insert plasmid were analyzed and identified. Plasmid was selected, amplified and kept for use in next step.

2.12. The transfection of recombinant expression vector pALTER-MAXCD59 into MCF-7 cells MCF-7 cells were transfected with pALTER-MAX-CD59 and selective marker plasmid PcDNA by cationic liposome (Lipfectamine-2000)-mediated transgene method. In brief, one day before transfection, cells were cultured in DMEM medium containing 10% fatal calf serum (FCS) without antibiotics and reached 90–95% confluence at the time of transfection. Appropriate quantities of DNA (pALTER-MAX-CD59/pALTER-MAX and PcDNA) and Lipofectamine 2000 were diluted in 50 ll of DMEM medium without serum, mixed gently, and incubated for 20 min at room temperature to allow the DNA–Lipofectamine 2000 complexes to form. The complexes were added to each well, incubated at 37 °C, 5%CO2 for 24–48 h, and then transferred into bigger cell culture plates to amplify culture. When each cell grew into a clone, the positive transfectants probably containing desired recombinant plasmid pALTER-MAX-CD59 were filtrated by adding G418 antibiotic into DMEM complete medium. After 8–14 days, the monoclonal cells were sorted out and cultured.

2.10. CD59 cDNA cloning and construction of recombinant vector pALTER-MAX-CD59 A pair of oligonucleotide primers 50 -TAATACGACTCACTATAGGC (upstream primer, sense) and 5’-ATTAACCCTCACTAAAGGGA (downstream primer, anti-sense) were designed according to the peptide sequences of CD59 cDNA. PCR was performed under the following conditions: pre-denaturation at 94 °C for 3 min; 35 cycles of denaturation at 94 °C for 45 s, annealing at 56 °C for 1 min and extension at 72 °C for 1 min; and a final extension at 72 °C for 7 min. The resulting PCR products were separated by electrophoresis on a 1% agarose gel in the presence of 0.5% ethidium bromide and the amplicon of 600 bp that encodes human CD59 was purified with DNA Gel Extraction Kit (Sigma, USA) and sequenced. Moreover, purified PCR product (CD59 cDNA) and eukaryotic expression plasmid pALTER-MAX were both digested with EcoR I in water bath at 37 °C for 1–2 h. The length of digestion products of CD59 cDNA was near 500 bp. Then the enzyme digesed pALTER-MAX and CD59 cDNA were ligated with T4 ligase at 16 °C overnight. The CD59 cDNA fragment was subcloned into the EcoR I site in the pALTER-MAX plasmid. 2.11. The transformation of pALTER-MAX-CD59 into DH5a, and the screening and identification of recombinant bacterial colonies The recombinant vector pALTER-MAX-CD59 transformed E. coli DH5a and the bacterial colonies containing the desired plasmid were screened and identified by PCR and enzymatic digestion. By taking bacterial liquid as template, T7 and T3 sequence as primers, in situ PCR was performed with the following program: enzyme activation at 94 °C for 10 min; 35 cycles with denaturation at 94 °C for 1 min, annealing at 56 °C for 1 min and extension at 72 °C for 1 min; and a final extension at 72 °C for 7 min. The resulting amplicons were separated by 1% agarose gel electrophoresis. The strips of every bacterial colony were observed and the colonies

2.13. Screening of stable positive cell clones by CD59 mRNA in situ hybridization Corresponding to CD59mRNA, a 27 bp oligonucleotide probe labeled with digoxin at 50 end (50 -AAGTGTTGGAAGCATGAGCAGTG CAATT-30 ) was synthesized. Transfected MCF-7 cells were dropped on a microscope slide and fixed at room temperature for 20– 30 min by 4% polyformadehyde/0.1 mol/L PBS, washed with distilled water, treated with 30% H2O2: methanol at room temperature for 30 min to block endogenous peroxidase activities and washed with distilled water. Prehybridization was performed by adding 20 lL prehybridization solution on microscope slide and incubated in a wet box at 38–42 °C for 2–4 h. Followed by overnight incubation in 40 ll of hybridization solution containing 40 ng probe, the cells were washed with SSC. Because of digoxin, the CD59 mRNA expression could be determined by immunocytochemical staining. In brief, the cells were incubated in blocking buffer followed by the biotinylated polyclonal anti-mouse IgG, avidin-biotin complex and diaminobenzidine. The results were observed under light microscope. Upon the positive MCF-7 cell clones with CD59 gene were screened and cultured, stable transfected cell lines were established. Comparison was made to cell lines derived by transfection with pALTERMAX.

2.14. Immunofluorescence measurement of CD59 protein expression on MCF-7 cell surface Transfected MCF-7 cells were dropped on microscope slides and fixed in 95% alcohol for 5 min, and then incubated in FITC-goat anti-human CD59McAb at 37 °C for 45 min, washed twice with PBS and observed light-microscopically. Negative control was designed and PBS was substituted for primary antibody.

64

B. Li et al. / Cellular Immunology 272 (2011) 61–70

Fig. 1. Constructions and identification of recombinant plasmids. (a) The retroviral vectors pSUPER has the human H1 promoter in which the 983 bp fragment of 30 long terminal repeat (LTR) were deleted by BglII/HindIII digestion. Four counter-part synthetic oligonucleotides were respectively annealed and cloned downstream of the H1 promoter in pSUPER to construct pSUPER-siCD59. (b) Enzyme digestion by BglII and HindIII. (c) PCR Identification of recombinant plasmids. M: DL2000 DNA marker; (1–4): pSUPER-siCD59-T1, T2, T3, C; (5 and 6): Empty pSUPER. pSUPER-siCD59 was about 395 bp, pSUPER was about 1318 bp. (d) Identification of enzyme digestion of recombinant plasmids. M: DL2000 DNA marker; (1 and 2): pSUPER; (3–6): pSUPER-siCD59-T1, T2, T3, C; digested by EcoR I and HindIII. pSUPER-siCD59 was about 281 bp, pSUPER was about 1204 bp.

2.15. Effects of CD59 overexpression on MCF-7 cells proliferation ability by MTT

3. Results 3.1. Construction of pSUPER-siCD59 vectors

Transfected MCF-7 cells were cultured for 3 days in 96-well plates, and then incubated in 5% MTT at 37 °C for 4 h. DMSO (100 ll/well) was added with light shaking, and the light absorption value at 490 nm was measured.

2.16. Bcl-2 protein expression in MCF-7 cells Transfected MCF-7 cells were dropped on microscope slides disposed with 0.1% poly-lysine solution and fixed at room temperature by 4% polyformadehyde/0.1 M PBS for 20–30 min. After washed with distilled water, the cells were treated with 30% H2O2: methanol at room temperature for 30 min and washed with distilled water. The Bcl-2 protein expression was measured by immunocytochemical staining.

The retroviral vector backbones were generated by digestion with BglII and HindIII to delete the 983 bp fragment in 30 LTR (Fig. 1a and b). Subsequently, the synthesized inverted repeats with an identical sequence to the human CD59 gene was inserted downstream of the H1 promoter, using five thymidines as the terminal signal. The empty and recombinant vectors were used as the templates for PCR. The positive clone was 395 bp, however, the negative clone was 1318 bp (Fig. 1c). Furthermore, the empty and recombinant vectors were digested with EcoRI (site 2645) and HindIII restriction enzymes, the removed fragment of the empty vector was 1204 bp (2645  1441), and the fragment of the recombinant vectors was 281 bp (1204  983 + 60) (Fig. 1d). DNA sequencing demonstrated that the recombinant plasmid vectors pSUPER-siCD59 was successfully constructed. 3.2. Fluorescence measurement of infection efficiency

2.17. Statistical analysis Results were expressed as means ± standard error of the mean (SEM). Student’s t-test was used for comparison between means. The difference was considered statistically significant when P < 0.05. All the statistical analyses were performed using SPSS software.

Because the MCF-7 cell expresses a high basal level of endogenous wild-type CD59, the cell was used as a model to explore whether the retrovirus-mediated RNAi could knock down the expression of endogenous CD59 and what role it may play in the progression of cancer under the inactivation or loss of CD59. The recombinant retroviruses were delivered by cotransfection of the

B. Li et al. / Cellular Immunology 272 (2011) 61–70

65

Fig. 2. Expression of GFP fluorescence was monitored after infection by confocal microscope. MCF-7 cells transfected with either pSUPER-siCD59 or pSUPER expressed green fluorescent protein (GFP) reporter gene, which allowed us to measure infection efficiency of MCF-7 cells. Forty-eight hours after infection, 60% of MCF-7 cells gave off fluorescence. (a) GFP expression in MCF-7 cells after transfection with pSUPER for 48 h; (b) GFP expression in MCF-7 cells after infection with pSUPER-siCD59 for 48 h.

PER both have green fluorescent protein (GFP) reporter gene, which enables the measurement of infection efficiency of MCF-7 cells. Forty-eight hours after infection of MCF-7 cells, the infection efficiency reached about 60% (Fig. 2). 3.3. Determination of CD59 expression levels by RT-PCR and Western blots Fig. 3 showed that CD59 mRNA and protein level decreased in groups T1, T2 and T3 compared with that in empty pSUPER transfected cells (group T0), group C or uninfected group N. Furthermore CD59 decreased the most in group T3, and the difference was significant compared with group N (Fig. 3a and b). This suggested that retrovirus-delivered shRNA could efficiently suppress CD59 gene expression in a sequence-specific manner in MCF-7 cells. The results also demonstrated that there was obvious difference in the inhibitory efficiency of the four groups. Group T3 had the highest inhibitory efficiency. 3.4. Determination of complement-mediated cytolysis by ELESA In order to demonstrate the cytolysis protective effect of CD59 antigen on MCF-7 cells by human complement attack, the sensitivity to complement-mediated cytolysis was compared between pSUPER-siCD59, pSUPER and the uninfected group. The results showed that the percentage of cell cytolysis in pSUPER-siCD59 groups is consistently higher than that of control, which indicated that the protective effect of CD59 was functionally degraded against complement lysis (Table 1). The protective effect was poorest in group T3. 3.5. CD59 silencing inhibited the growth of MCF-7 cells In order to determine the effect of CD59 silencing on the growth of MCF-7 cells, MTT assay was adopted. Results demonstrated that

Fig. 3. Detections of CD59 mRNA and CD59 protein expression levels. CD59 mRNA and protein level decreased in group T1, T2, T3 compared with that in empty pSUPER transfected cells (group T0), group C or uninfected group N (⁄P < 0.05). Furthermore CD59 decreased the most in group T3, and the difference was significant compared with N group (⁄⁄P < 0.01). (a) CD59 mRNA levels. CD59 mRNA levels decreased after infection in T1, T2, T3 group compared with that of control. (b) CD59 protein levels. The protein levels of group T3 were lower in infected cells than that of control.

Lipofectamine 2000, which confers pSUPER or pSUPER-siCD59 into MCF-7 cells. MCF-7 cells transfected with pSUPER-siCD59 or pSU-

Fig. 4. Comparison of proliferation ability of MCF-7 cells in five groups. MCF-7 cells transfected by pSUPER-siCD59 were significantly fewer than those untransfected or transfected by pSUPER. ⁄P < 0.05, ⁄⁄P < 0.01, compared with the control uninfected group.

66

B. Li et al. / Cellular Immunology 272 (2011) 61–70

MCF-7 cells transfected by pSUPER-siCD59 were significantly fewer than those untransfected and transfected by pSUPER, implicating that CD59 might be the target gene in cancer therapy (Fig. 4). 3.6. Fas and caspase-3 proteins activities detected by immunocytochemical staining To verify whether the downregulation of CD59 expression in pSUPER-siCD59 infected MCF-7 cells could induce cells apoptosis, protein expression of Fas and caspase-3 were measured by immunocytochemical staining. As shown in Fig. 5a and b, compared with pSUPER infected cells or uninfected cells, Fas and caspase-3 protein levels in pSUPER-siCD59-T1, T2, T3 infected MCF-7 cells markedly increased. These results indicated that decreased CD59 expression could promote Fas expression and activate caspase-3, and then induced MCF-7 cells apoptosis. 3.7. The construction of recombinant plasmid pALTER-MAX-CD59 and transfection into MCF-7 cells PCR amplified CD59 cDNA was inserted into eukaryotic expression vector pALTER-MAX and transformed into E. coli DH5a. Positive recombinants were primarily screened with in situ PCR and plasmid was digested with EcoR I for further identification. The plasmid pALTER-MAX is 5533 bp and the inserted CD59 cDNA fragment was 495 bp, so the full length of recombinant plasmid

pALTER-MAX-CD59 was about 6 kb and a segment of 500 bp was obtained after EcoR I digestion. 3.8. Measurement of CD59 mRNA by in situ hybridization and CD59 protein expression by immunofluorescence Synthesized CD59 oligonucleotide probe was applied to determine the expression of CD59 mRNA. The results of in situ nucleic acid hybridization observed by confocal microscope showed that positive cell clones, namely pALTER-MAX-CD59 transfected MCF7 cells were stained brownish yellow, and the staining resided in cell membrane and cytoplasm. While none of the control groups, namely pALTER-MAX transfected MCF-7 cells and untransfected MCF-7 cells, had positive signal expression and the staining was hypochromic (Fig. 6a). The intensity of fluorescence represents the expression quantities of CD59 protein on cell surface. The results indicated the CD59 in cells transfected with pALTER-MAX were markedly higher than untransfected MCF-7 cells and MCF-7 cells transfected by pALTERMAX, so the CD59 gene were successfully transfected into MCF-7 cells and expressed (Fig. 6b). 3.9. Overexpression of CD59 promotes the proliferation of MCF-7 cells In order to determine the effect of CD59 overexpression on the growth of MCF-7 cells, MTT assay was adopted. Results

Fig. 5. Comparison of Fas and caspase-3 protein quantities in five groups. (a) Compared with pSUPER infected cells or uninfected cells, Fas protein quantities in pSUPERsiCD59-T1, T2, T3 infected MCF-7 cells markedly increased. ⁄P < 0.05, ⁄⁄P < 0.01, compared with the control uninfected group. (b) Compared with pSUPER infected cells or uninfected cells, caspase-3 protein quantities in pSUPER-siCD59-T1, T2, T3 infected MCF-7 cells markedly increased. (A) Uninfected cells; (B) pSUPER transfected cells; (C) pSUPER-siCD59-T1; (D) pSUPER-siCD59-T3; (E) pSUPER-siCD59-T3.

B. Li et al. / Cellular Immunology 272 (2011) 61–70

67

Fig. 6. Measurement of CD59 mRNA and CD59 protein. (a) pALTER-MAX-CD59 transfected MCF-7 cells were dyed brownish yellow, dying site resided on cytomembrane and in cytoplasm. While the control groups, namely pALTER-MAX transfected MCF-7 cells and untransfected MCF-7 cells both had no positive signal expression and staining was hypochromic. (A) pALTER-MAX-CD59 transfected MCF-7 cells; (B) pALTER-MAX transfected MCF-7 cells; (C) Untransfected MCF-7 cells. (b) The intensity of fluorescence represents the expression quantities of CD59 protein on cell surface. The quantities of CD59 protein in cells transfected with pALTER-MAX were evidently higher than untransfected MCF-7 cells and MCF-7 cells transfected by pALTER-MAX. (A) pALTER-MAX-CD59 transfected MCF-7 cells; (B) pALTER-MAX transfected MCF-7 cells; (C) untransfected MCF-7 cells.

4. Discussion

Fig. 7. Overexpression of CD59 promotes growth of MCF-7 cells. The number of MCF-7 cells transfected by pALTER-MAX-CD59 was more than untransfected or transfected MCF-7 cells containing empty plasmid pALTER-MAX. ⁄P < 0.05 compared with the untransfected group.

demonstrated that the numbers of MCF-7 cells transfected by pALTER-MAX-CD59 are more than untransfected and transfected MCF-7 cells containing empty plasmid pALTER-MAX (Fig. 7). 3.10. Overexpression of CD59 up-regulates Bcl-2 protein expression MCF-7 cells transfected with pALTER-MAX-CD59 had a significant higher (P < 0.05) Bcl-2 expression levels than untransfected cells and pALTER-MAX transfercted cells (Table 2). Table 2 Absorption value of each group cells mean ± SEM). Groups

OD

Uninfected pSUPER pSUPER-siCD59-T1 pSUPER-siCD59-T2 pSUPER-siCD59-T3

0.317 ± 0.021 0.262 ± 0.033 0.156 ± 0.012* 0.150 ± 0.018* 0.115 ± 0.017**

The percentage of cell cytolysis in pSUPER-siCD59 groups is consistently higher than that of control, which indicated that the protective effects of CD59 was functionally degraded against complement lysis. The protective effect was poorest in group T3. * P < 0.05 compared with the control uninfected cells. ** P < 0.01 compared with the control uninfected cells.

Human CD59 is a 18–20 kDa protein and anchored through glycanphosphatidylinositol (GPI) to the cell membrane [18]. CD59 belongs to the members of Ly6 superfamily [19]. The precursor of human CD59 is a single peptide composed of 128 amino acids deduced from its cDNA sequence [19,20], and the amino-terminal 25 amino acids and the carboxyl-terminal 26 amino acids are truncated in the process of expression at the cell surface. The mature form of the CD59 polypeptide is comprised of 77 amino acids starting with leucine (Leu) and terminating with asparagine (Leu) [21,22], folded through five intra-chain disulfide bonds. CD59 is modified by N-linked glycosylation (at Asn18) and by addition of a GPI anchor at Asn 77 [18,23]. The functions of CD59 protein are mainly involved in three aspects. First, CD59 functions as an inhibitor of the C5b-9 membrane attack complex (MAC) of human complement [22]. Through these interactions, CD59 protects human blood and vascular cells from injury or lysis by human complement [24,5]. Further, CD59 acts as the second signal stimulant, inducing the activation of T lymphocytes and taking part in the regulatory course of immunoreactions [25]. Third, CD59 is the ligand of CD2 that can conglutinate with CD59. CD59–CD2 complex activates T cells and then guides adhesion of T and T cells or T and other tissue cells, and further regulates the growth of tissue cells [26]. Our studies focused on what role CD59 plays in the progression of breast cancer cells (MCF-7) under the silencing or overexpression of CD59. In mammalian cells, retroviral vector-mediated RNAi can be further applied to functional genomics studies, so that a group of related individual genes can be silenced simultaneously and their synergic functions can be systematically assessed [27–29]. In addition, viral vector-mediated RNAi holds promises in gene therapy for cancers and infectious diseases because it can result in lossof-function phenotypes of disease-related genes [30,31]. Because the MCF-7 cell contains a high level of endogenous wild-type CD59, in present studies retrovirus-mediated RNAi was used to knock down the expression of endogenous CD59. A retroviral vector system that permits delivery of stem-loop cassettes was used and three sequences from different location of CD59 mRNA sequence were designed. Retroviral vectors targeted CD59 gene

68

B. Li et al. / Cellular Immunology 272 (2011) 61–70

Table 3 The Bcl-2 protein expression on MCF-7 cells. Groups

Positive percentage (%)

Average OD

Positive index

P

Untransfected cells pALTER-MAX pALTER-MAX-CD59

33.5 ± 1.3 40.7 ± 1.8 57.8 ± 2.1

0.29 ± 0.006 0.34 ± 0.011 0.50 ± 0.008

9.715 ± 0.310 13.838 ± 0.983 28.9 ± 1.101

– – <0.05

MCF-7 cells transfected with pALTER-MAX-CD59 had a significant higher Bcl-2 expression level than untransfected cells and pALTER-MAX transfected cells, P < 0.05.

(pSUPER-siCD59) were successfully constructed (Fig. 1), and then transfected into MCF-7 cells (Fig. 2). RT-PCR and Western blots results indicated that three sequences achieved high efficiency of siRNA-dependent gene silencing in MCF-7 cell. pSUPER-siCD59T3 was the highest suppression sequence (Fig. 3), which is in accordance with the property of RNAi [32]. Overexpression of complement inhibitors mRNA and of the corresponding proteins may contribute to tumor cell resistance to complement-mediated cytotoxicity [33–36]. It is envisaged that treatment of cancer patients with CD59 blockers targeted specifically to cancer cells will improve the therapeutic efficacy [37–40]. Neutralization of CD59 with mAb produced efficient sensitization to complement-mediated lysis of ovarian, breast and cervix carcinoma cell lines. However, as these mAbs are usually poor activators of complement on their own, they may be used together with complement-fixing antibodies or other complement activators [41–44]. To the best of our knowledge, this study is the first to employ viral vector-mediated RNAi to decrease CD59 expression and found that complement-mediated cytolysis increased (Table 2). Furthermore, pSUPER-siCD59 infected MCF-7 cells may lead to apoptosis by antibody-dependent complement, and cells viability reduced when treated with complement in pSUPER-siCD59 infected MCF-7 cells (Fig. 4). This suggested that down-regulation of CD59 expression could cause complement-mediated cytolysis, suppress tumor cells growth and may lead to apoptosis. Complement influences apoptosis at two distinct levels: first, in deciding the fate of the cell, and secondly, in helping phagocytes to dispose of the corpses of apoptotic cells [45–47]. MAC-triggered cell death occurred through a caspase-dependent pathway, specifically via caspase-3, and the cells displayed characteristic features of apoptosis. Evidence from animal models of renal disease also implicates the MAC in triggering apoptosis [48–50]. Korty demonstrated the signaling capacity of CD59 in experiments where human CD59 was cross-linked with specific monoclonal antibodies, and shown to generate a calcium flux, and make the cytoplasmic calcium concentration higher [51]. With the increase of calcium concentration, the mitochondria began to ingest calcium. Too much calcium can damage mitochondria, triggering the release of cytochrome c that can activate caspases and induce apoptosis. Cell apoptosis has an affinity with the occurrence, development and regression of tumor, therefore an important mechanism to prevent tumorigenesis is the induction of cell apoptosis that takes places continuously in many tissues of our body to remove unwanted, damaged or aberrant cells [52]. In an effort to gain insight into effects of CD59 silencing and to understand the biochemical mechanism underlying CD59 inactivation induced apoptosis, in the present study we have determined the effects of CD59 on the proliferation and apoptosis of MCF-7 cells. These studies have clearly shown the inhibition in the growth of MCF-7 cells (Fig. 4). This reduction in the growth of MCF-7 cells in the absence of CD59 might be due to either apoptosis or necrosis. In order to test the factors responsible for reduced growth of MCF-7 cells, further studies were undertaken on the apoptosis related factors. Plenty of evidences suggest that blocks in the process of apoptosis may be closely associated with carcinogenesis and that many cancer cells have defective machinery for self-destruction [53].

Apoptosis occurs spontaneously in malignant tumors, often markedly retarding their growth, and it is increased in tumors responding to irradiation, cytotoxic chemotherapy, heating and hormone ablation. However, much of the current interest in the process stems from the discovery that tumor can be regulated by certain proto-oncogenes and the tumor suppressor genes. Fas expression has been shown to be involved in the initiation of apoptosis under some conditions. These hinted that in the courses of cellular apoptosis, Fas antigen and ICAM-1 molecule probably hold a certain synergistic effect [54]. Bcl-2 has emerged as a new type of protooncogene interfered with programmed cell death independent of promoting cell division [55]. So we explored the effects of CD59 on the apoptosis signals of MCF-7 cells. Results suggested that, compared with normal cells, the expression of Fas protein were obviously higher. This confirms CD59 silencing potently up regulated pro-apoptosis Fas protein expression levels (Fig. 5a). It might be through the continuous transduction of tumoral apoptosis signals result in the apoptosis of MCF-7 tumor cells. Since caspase plays a central role in virtually all known apoptotic signal pathways, we analyzed the caspase activation in pSUPERsiCD59 transfected MCF-7 cells. Activation of caspase-3 was detected in pSUPER-siCD59 transfected MCF-7 cells. Caspases were initiators of apoptosis, and they were regulated by Fas/TNF-R1, mitochondria dysfunction, and TNF-related apoptosis-inducing ligand (TRAIL). When Fas/TNF-R1 combined with ligand, caspase-3 would be activated (Fig. 5b). The present data suggests that CD59 loss induces caspase-dependent apoptosis in cultured cells. Caspase activation results in the cleavage of cellular substrates and eventually leads to apoptosis. This paper also discussed the effect of CD59 gene overexpression on MCF-7 cells growth. Above all, CD59 cDNA was inserted into the eukaryotic expression plasmid vector pALTER-MAX, and the recombinant eukaryotic expression vector system was successfully constructed. Then through cationic lipisome (Lipfectamine2000)-mediated transfection, recombinant plasmid pALTER-MAXCD59 and the selective marker PcDNA were cotransfected into MCF-7 cells. Stable positive cell clones were sorted out by adding G418 antibiotic into medium and CD59 mRNA in situ nucleic acid hybridization (Fig. 6A). The expression of CD59 protein on the surface of cells was determined by immunofluorescence (Fig. 6b). In addition, the effect of CD59 overexpression on the proliferation of MCF-7 cells was determined by MTT methods. Results showed that excessive expression of CD59 protein in MCF-7 cells could elevate the reproduction numbers of MCF-7 cells (Fig. 7). Table 3 showed CD59 overexpression promoted anti-apoptosis Bcl-2 protein expression. In a word, the present study illustrated that CD59 loss or inactivation can lead to MCF-7 cell death. The mechanism is probably that decreased expression of CD59 protein can induce Fas protein expression on the surface of MCF-7 cells. Combining with Fas antigen, which can activate death domain, Fas will then activate the conduction of pro-apoptosis signal such as caspase-3 in MCF-7 cells. In the end the increased function of complement resulted in MCF-7 cells apoptosis and tumor cells growth suppression. This may give a new therapy method for cancer patients and need further study in vivo. While excessive expressed CD59 protein can

B. Li et al. / Cellular Immunology 272 (2011) 61–70

promote anti-apoptosis protein bcl-2 expression. This study puts forward a new idea on the molecular mechanism of the anti-tumor activity of CD59 silencing and provides us a theoretic basis about CD59 acting as a target gene exploit in cancer therapy.

5. Conclusion A successful anti-tumor therapy consists of decreasing uncontrolled cell growth and/or inducing of apoptosis. The big challenge in the future will be translating the understanding of the underlying mechanism of tumorigenesis into the development of more acute and specific anti-tumor therapies. We have sufficient reasons to believe CD59 may be exploited to function as a kind of novel targeted gene in tumor therapeutic agent and widely used in the future. Furthermore, the success of construction of retroviral vector-mediated RNAi system targeting human CD59 gene provides platform for all high expression of CD59 gene such as ovarian, prostate carcinoma, some inflammation and transplant operation. Acknowledgments This work was supported by Grants from the National Natural Science Foundation of China (No. 81001346), the Science Research Award Foundation of Middle-age and Young Scientist of Shandong Province (No. 2007BS03016) and Science Research Development Foundation of Shandong Province Education Department (No. J07YE16-2). References [1] J. Ferlay, H.R. Shin, F. Bray, D. Forman, C. Mathers, D.M. Parkin, Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008, Int. J. Cancer 127 (2010) 2893–2917. [2] A. Flesken-Nikitin, K.C. Choi, J.P. Eng, E.N. Shmidt, A.Y. Nikitin, Induction of carcinogenesis by concurrent inactivation of p53 and Rb1 in the mouse ovarian surface epithelium, Cancer Res. 63 (2003) 3459–3463. [3] K.V. Clark-Knowles, K. Garson, J. Jonkers, B.C. Vanderhyden, Conditional inactivation of Brca1 in the mouse ovarian surface epithelium results in an increase in preneoplastic changes, Exp. Cell Res. 313 (2007) 133–145. [4] K.Y. Kim, D.W. Park, E.B. Jeung, K.C. Choi, Conditional knockout of brca1/2 and p53 in mouse ovarian surface epithelium: do they play a role in ovarian carcinogenesis?, J Vet. Sci. 11 (2010) 291–297. [5] S. Meri, B.P. Morgan, A. Davies, R.H. Daniels, M.G. Olavesen, H. Waldmann, et al., Human protectin (CD59), an 18, 000–20, 000 MW complement lysis restricting factor, inhibits C5b–8 catalysed insertion of C9 into lipid bilayers, Immunology 71 (1990) 1–9. [6] T. Hideshima, N. Okada, H. Okada, Expression of HRF20, a regulatory molecule of complement activation, on peripheral blood mononuclear cells, Immunology 69 (1990) 396–401. [7] P.S. Seifert, I. Roth, W. Schmiedt, H. Oelert, N. Okada, H. Okada, et al., CD59 (homologous restriction factor 20), a plasma membrane protein that protects against complement C5b–9 attack, in human atherosclerotic lesions, Atherosclerosis 96 (1992) 135–145. [8] A. Vakeva, P. Laurila, S. Meri, Regulation of complement membrane attack complex formation in myocardial infarction, Am. J. Pathol. 143 (1993) 65–75. [9] T. Seya, H. Tejima, H. Fukuda, T. Hara, M. Matsumoto, M. Hatanaka, et al., Acute promyelocytic leukemia with CD59 deficiency, Leuk. Res. 17 (1993) 895–896. [10] L. Weiss, N. Okada, N. Haeffner-Cavaillon, T. Hattori, C. Faucher, M.D. Kazatchkine, et al., Decreased expression of the membrane inhibitor of complement-mediated cytolysis CD59 on T-lymphocytes of HIV-infected patients, AIDS 6 (1992) 379–385. [11] G.T. Venneker, P.K. Das, M.M. Meinardi, J. van Marle, H.A. van Veen, J.D. Bos, et al., Glycosylphosphatidylinositol (GPI)-anchored membrane proteins are constitutively down-regulated in psoriatic skin, J. Pathol. 172 (1994) 189–197. [12] P.L. McGeer, D.G. Walker, H. Akiyama, T. Kawamata, A.L. Guan, C.J. Parker, et al., Detection of the membrane inhibitor of reactive lysis (CD59) in diseased neurons of Alzheimer brain, Brain Res. 544 (1991) 315–319. [13] T. Uesu, M. Mizuno, H. Inoue, J. Tomoda, T. Tsuji, Enhanced expression of decay accelerating factor and CD59/homologous restriction factor 20 on the colonic epithelium of ulcerative colitis, Lab. Invest. 72 (1995) 587–591. [14] M.E. Davies, A. Horner, B.E. Loveland, I.F. McKenzie, Upregulation of complement regulators MCP (CD46), DAF (CD55) and protectin (CD59) in arthritic joint disease, Scand. J. Rheumatol. 23 (1994) 316–321. [15] T.R. Brummelkamp, R. Bernards, R. Agami, A system for stable expression of short interfering RNAs in mammalian cells, Science 296 (2002) 550–553.

69

[16] G. Sui, C. Soohoo, B. Affar el, F. Gay, Y. Shi, W.C. Forrester, A DNA vector-based RNAi technology to suppress gene expression in mammalian cells, Proc. Natl. Acad. Sci. USA 99 (2002) 5515–5520. [17] H. Ninomiya, B.H. Stewart, S.A. Rollins, J. Zhao, A.L. Bothwell, P.J. Sims, Contribution of the N-linked carbohydrate of erythrocyte antigen CD59 to its complement-inhibitory activity, J. Biol. Chem. 267 (1992) 8404–8410. [18] N. Geis, S. Zell, R. Rutz, W. Li, T. Giese, S. Mamidi, et al., Inhibition of membrane complement inhibitor expression (CD46, CD55, CD59) by siRNA sensitizes tumor cells to complement Attack in vitro, Curr. Cancer Drug Targets 10 (2010) 922–931. [19] T.J. Fleming, C. O’HUigin, T.R. Malek, Characterization of two novel Ly-6 genes. Protein sequence and potential structural similarity to alpha-bungarotoxin and other neurotoxins, J. Immunol. 150 (1993) 5379–5390. [20] A. Davies, D.L. Simmons, G. Hale, R.A. Harrison, H. Tighe, P.J. Lachmann, et al., CD59, an LY-6-like protein expressed in human lymphoid cells, regulates the action of the complement membrane attack complex on homologous cells, J. Exp. Med. 170 (1989) 637–654. [21] Y. Sugita, T. Mazda, M. Tomita, Amino-terminal amino acid sequence and chemical and functional properties of a membrane attack complexinhibitory factor from human erythrocyte membranes, J. Biochem. 106 (1989) 589–592. [22] Y. Sugita, Y. Nakano, E. Oda, K. Noda, T. Tobe, N.H. Miura, et al., Determination of carboxyl-terminal residue and disulfide bonds of MACIF (CD59), a glycosylphosphatidylinositol-anchored membrane protein, J. Biochem. 114 (1993) 473–477. [23] A. Davies, P.J. Lachmann, Membrane defence against complement lysis: the structure and biological properties of CD59, Immunol. Res. 12 (1993) 258– 275. [24] S.A. Rollins, P.J. Sims, The complement-inhibitory activity of CD59 resides in its capacity to block incorporation of C9 into membrane C5b–9, J. Immunol. 144 (1990) 3478–3483. [25] S.P. Treon, Y. Shima, M.L. Grossbard, F.I. Preffer, A.R. Belch, L.M. Pilarski, et al., Treatment of multiple myeloma by antibody mediated immunotherapy and induction of myeloma selective antigens, Ann. Oncol. 11 (Suppl. 1) (2000) 107–111. [26] A.B. Zaltzman, C.W. Van den Berg, V.R. Muzykantov, B.P. Morgan, Enhanced complement susceptibility of avidin-biotin-treated human erythrocytes is a consequence of neutralization of the complement regulators CD59 and decay accelerating factor, Biochem. J. 307 (Pt 3) (1995) 651–656. [27] C.M. Liu, D.P. Liu, W.J. Dong, C.C. Liang, Retrovirus vector-mediated stable gene silencing in human cell, Biochem. Biophys. Res. Commun. 313 (2004) 716–720. [28] D.L. Hao, C.M. Liu, W.J. Dong, H. Gong, X.S. Wu, D.P. Liu, et al., Knockdown of human p53 gene expression in 293-T cells by retroviral vector-mediated short hairpin RNA, Acta Biochim. Biophys. Sin. (Shanghai) 37 (2005) 779–783. [29] L. Zhang, N. Yang, A. Mohamed-Hadley, S.C. Rubin, G. Coukos, Vector-based RNAi, a novel tool for isoform-specific knock-down of VEGF and antiangiogenesis gene therapy of cancer, Biochem. Biophys. Res. Commun. 303 (2003) 1169–1178. [30] W.S. Park, N. Miyano-Kurosaki, M. Hayafune, E. Nakajima, T. Matsuzaki, F. Shimada, et al., Prevention of HIV-1 infection in human peripheral blood mononuclear cells by specific RNA interference, Nucleic Acids Res. 30 (2002) 4830–4835. [31] B.L. Davidson, H.L. Paulson, Molecular medicine for the brain: silencing of disease genes with RNA interference, Lancet Neurol 3 (2004) 145–149. [32] D.J. Shuey, D.E. McCallus, T. Giordano, RNAi: gene-silencing in therapeutic intervention, Drug Discov. Today 7 (2002) 1040–1046. [33] S.B. Hosch, P. Scheunemann, M. Luth, S. Inndorf, N.H. Stoecklein, A. Erbersdobler, et al., Expression of 17–1A antigen and complement resistance factors CD55 and CD59 on liver metastasis in colorectal cancer, J. Gastrointest. Surg. 5 (2001) 673–679. [34] J. Yu, T. Caragine, S. Chen, B.P. Morgan, A.B. Frey, S. Tomlinson, Protection of human breast cancer cells from complement-mediated lysis by expression of heterologous CD59, Clin. Exp. Immunol. 115 (1999) 13–18. [35] T. You, W. Hu, X. Ge, J. Shen, X. Qin, Application of a novel inhibitor of human CD59 for the enhancement of complement-dependent cytolysis on cancer cells, Cell. Mol. Immunol. 8 (2011) 157–163. [36] W. Hu, X. Ge, T. You, T. Xu, J. Zhang, G. Wu, et al., Human CD59 inhibitor sensitizes rituximab-resistant lymphoma cells to complement-mediated cytolysis, Cancer Res. 71 (2011) 2298–2307. [37] J.M. Li, M.H. Gao, B. Zhang, Inhibition of mutant CD59 protein on proliferation of ovarian cancer A2780 cells, Ai Zheng 28 (2009) 379–383. [38] B. Sivasankar, M.P. Longhi, K.M. Gallagher, G.J. Betts, B.P. Morgan, A.J. Godkin, et al., CD59 blockade enhances antigen-specific CD4+ T cell responses in humans: a new target for cancer immunotherapy?, J Immunol. 182 (2009) 5203–5207. [39] X.X. Shi, M.H. Gao, X.P. Li, B. Zhang, Q.B. Wang, Knocking down human CD59 gene expression decreased protection to complement-mediated cytolysis, Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi 24 (2008) 1164–1166. [40] R.M. Donev, L.C. Gray, B. Sivasankar, T.R. Hughes, C.W. van den Berg, B.P. Morgan, Modulation of CD59 expression by restrictive silencer factor-derived peptides in cancer immunotherapy for neuroblastoma, Cancer Res. 68 (2008) 5979–5987. [41] Y. Huang, C.A. Smith, H. Song, B.P. Morgan, R. Abagyan, S. Tomlinson, Insights into the human CD59 complement binding interface toward engineering new therapeutics, J. Biol. Chem. 280 (2005) 34073–34079.

70

B. Li et al. / Cellular Immunology 272 (2011) 61–70

[42] J. Golay, L. Zaffaroni, T. Vaccari, M. Lazzari, G.M. Borleri, S. Bernasconi, et al., Biologic response of B lymphoma cells to anti-CD20 monoclonal antibody rituximab in vitro: CD55 and CD59 regulate complement-mediated cell lysis, Blood 95 (2000) 3900–3908. [43] N. Donin, K. Jurianz, L. Ziporen, S. Schultz, M. Kirschfink, Z. Fishelson, Complement resistance of human carcinoma cells depends on membrane regulatory proteins, protein kinases and sialic acid, Clin. Exp. Immunol. 131 (2003) 254–263. [44] K.A. Gelderman, V.T. Blok, G.J. Fleuren, A. Gorter, The inhibitory effect of CD46, CD55, and CD59 on complement activation after immunotherapeutic treatment of cervical carcinoma cells with monoclonal antibodies or bispecific monoclonal antibodies, Lab. Invest. 82 (2002) 483–493. [45] I. Farkas, L. Baranyi, Z.S. Liposits, T. Yamamoto, H. Okada, Complement C5a anaphylatoxin fragment causes apoptosis in TGW neuroblastoma cells, Neuroscience 86 (1998) 903–911. [46] N.C. Riedemann, R.F. Guo, I.J. Laudes, K. Keller, V.J. Sarma, V. Padgaonkar, et al., C5a receptor and thymocyte apoptosis in sepsis, FASEB J. 16 (2002) 887–888. [47] R.F. Guo, M. Huber-Lang, X. Wang, V. Sarma, V.A. Padgaonkar, R.A. Craig, et al., Protective effects of anti-C5a in sepsis-induced thymocyte apoptosis, J. Clin. Invest. 106 (2000) 1271–1280. [48] T. Niculescu, S. Weerth, L. Soane, F. Niculescu, V. Rus, C.S. Raine, et al., Effects of membrane attack complex of complement on apoptosis in experimental autoimmune encephalomyelitis, Ann. NY Acad. Sci. 1010 (2003) 530–533.

[49] A.J. Nauta, M.R. Daha, O. Tijsma, B. van de Water, F. Tedesco, A. Roos, The membrane attack complex of complement induces caspase activation and apoptosis, Eur. J. Immunol. 32 (2002) 783–792. [50] J. Hughes, M. Nangaku, C.E. Alpers, S.J. Shankland, W.G. Couser, R.J. Johnson, C5b–9 membrane attack complex mediates endothelial cell apoptosis in experimental glomerulonephritis, Am. J. Physiol. Renal. Physiol. 278 (2000) F747–F757. [51] P.E. Korty, C. Brando, E.M. Shevach, CD59 functions as a signal-transducing molecule for human T cell activation, J. Immunol. 146 (1991) 4092–4098. [52] D.R. Green, R.P. Bissonnette, T.G. Cotter, Apoptosis and cancer, Important Adv. Oncol. (1994) 37–52. [53] H. Yano, A. Mizoguchi, K. Fukuda, M. Haramaki, S. Ogasawara, S. Momosaki, et al., The herbal medicine sho-saiko-to inhibits proliferation of cancer cell lines by inducing apoptosis and arrest at the G0/G1 phase, Cancer Res. 54 (1994) 448–454. [54] P. Moller, C. Henne, F. Leithauser, A. Eichelmann, A. Schmidt, S. Bruderlein, et al., Coregulation of the APO-1 antigen with intercellular adhesion molecule1 (CD54) in tonsillar B cells and coordinate expression in follicular center B cells and in follicle center and mediastinal B-cell lymphomas, Blood 81 (1993) 2067–2075. [55] R. Grobholz, H. Zentgraf, K.U. Kohrmann, U. Bleyl, Bax, Bcl-2, fas and Fas-L antigen expression in human seminoma: correlation with the apoptotic index, APMIS 110 (2002) 724–732.