The Elav-like protein HuR exerts translational control of viral internal ribosome entry sites

Virology 392 (2009) 178–185

Contents lists available at ScienceDirect

Virology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / y v i r o

The Elav-like protein HuR exerts translational control of viral internal ribosome entry sites Andrea Rivas-Aravena a, Pablo Ramdohr a, Maricarmen Vallejos a, Fernando Valiente-Echeverría a, Virginie Dormoy-Raclet c, Felipe Rodríguez b, Karla Pino a, Cristian Holzmann a, J. Pablo Huidobro-Toro b, Imed-Eddine Gallouzi c, Marcelo López-Lastra a,⁎ a

Laboratorio de Virología Molecular, Instituto Milenio de Inmunología e Inmunoterapia, Jeune Equipe Associée à l'IRD, Centro de Investigaciones Médicas, Facultad de Medicina, Pontificia Universidad Católica de Chile, Marcoleta 391, Santiago, Chile b Centro de Regulación Celular y Patología, J. V. Luco e Instituto Milenio de Biología Fundamental y Aplicada, MIFAB, Departamento de Fisiología, Facultad de Ciencias Biológicas, Pontificia Universidad Católica de Chile, Santiago, Chile c Department of Biochemistry, Faculty of Medicine, McGill University, Montreal, Quebec, Canada

a r t i c l e

i n f o

Article history: Received 24 March 2009 Returned to author for revision 28 April 2009 Accepted 29 June 2009 Available online 3 August 2009 Keywords: HuR ITAF IRES HIV-1 HCV Translation initiation

a b s t r a c t The human embryonic-lethal abnormal vision (ELAV)-like protein, HuR, has been recently found to be involved in the regulation of protein synthesis. In this study we show that HuR participates in the translational control of the HIV-1 and HCV IRES elements. HuR functions as a repressor of HIV-1 IRES activity and acts as an activator of the HCV IRES. The effect of HuR was evaluated in three independent experimental systems, rabbit reticulocyte lysate, HeLa cells, and Xenopus laevis oocytes, using both overexpression and knockdown approaches. Furthermore, results suggest that HuR mediated regulation of HIV-1 and HCV IRESes does not require direct binding of the protein to the RNA nor does it need the nuclear translocation of the IRES-containing RNAs. Finally, we show that HuR has a negative impact on post-integration steps of the HIV1 replication cycle. Thus, our observations yield novel insights into the role of HuR in the post-transcriptional regulation of HCV and HIV-1 gene expression. © 2009 Elsevier Inc. All rights reserved.

Introduction Initiation of protein synthesis in the eukaryotic cell is a complex process that leads to the assembly of the 80S ribosome at the start codon of the mRNA (Pestova et al., 2001; Sonenberg and Hinnebusch, 2009). Eukaryotic cells and their viruses have evolved at least two mechanisms for recruiting and positioning ribosomes during initiation. The primary mechanism involves the recognition of the 5′cap structure (m7GpppN) of mRNAs by eukaryotic translation initiation factors (eIFs) which is followed by the binding of the 40S ribosomal subunit and scanning downstream along the 5′untranslated region (5′UTR) until the initiation codon is encountered (Pestova et al., 2001; Sonenberg and Hinnebusch, 2009). Alternatively, numerous viruses including, among others, Picornaviridae (Jackson et al., 1994; Jang et al., 1988; Pelletier and Sonenberg, 1988), members of the Flaviviridae (Hellen and Pestova, 1999; Pestova and Hellen, 1999), and the Retroviridae (Balvay et al., 2007), as well as some eukaryotic mRNAs utilize a cap-independent pathway (Hellen and Sarnow,

⁎ Corresponding author. E-mail address: [email protected] (M. López-Lastra). 0042-6822/$ – see front matter © 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.virol.2009.06.050

2001). In this mechanism, that bypasses the conventional scanning pathway, an RNA element, the internal ribosome entry site (IRES), drives ribosome recruitment and positioning on the message, either at or just upstream of the start site (Hellen and Sarnow, 2001; Jackson, 2005; Lopez-Lastra et al., 2005). The precise molecular mechanism by which the cellular translational apparatus recognizes and modulates IRES activity is unknown (Hellen and Sarnow, 2001; Jackson, 2005; Lopez-Lastra et al., 2005). However, accumulating data strongly suggest that the IRES activity is under the control of the canonical eIFs, as well as IRES-specific transacting factors (ITAFs) (Belsham and Sonenberg, 1996; Semler and Waterman, 2008; Spriggs et al., 2005; Stoneley and Willis, 2004). A number of recent reports show that the ubiquitously expressed member of the Elav (embryonic-lethal abnormal visual in Drosophila melanogaster) family of RNA-binding proteins, HuR, participates in the regulation of translation initiation and functions as an IRES regulatory protein (Galban et al., 2008; Korf et al., 2005; Meng et al., 2005). HuR inhibits IRES-mediated protein synthesis from the mRNAs of the thrombomodulin (Yeh et al., 2008) and the type I insulin-like growth factor receptor (IGF-IR) (Meng et al., 2005), while it enhances IRESmediated translation from the mRNA coding the hypoxia-inducible factor (HIF)-1alpha (Galban et al., 2008). Interestingly, the human

A. Rivas-Aravena et al. / Virology 392 (2009) 178–185

179

HuR protein has been reported to participate in the replication cycle of the hepatitis C virus (HCV) and the human immunodeficiency virus type 1 (HIV-1) (Korf et al., 2005; Lemay et al., 2008), two viruses known to harbor IRES elements (Brasey et al., 2003; Buck et al., 2001; Tsukiyama-Kohara et al., 1992). Furthermore, during HIV-1 antiviral therapy HuR is responsible for inducing TNF-alpha and IL-6 expression, suggesting that the protein might have a direct impact on atherosclerosis induced by HIV protease inhibitors (Zhou et al., 2007). Jointly, these observations prompted us to explore whether HuR had an additional role in HCV and HIV-1 IRES-mediated translation initiation. Results presented in this study confirm a previous report showing that HuR is required for optimal HCV IRES activity (Korf et al., 2005). Additionally, we show that HuR acts as a negative modulator of the HIV-1 IRES and that its overexpression negatively impacts the late stages of HIV-1 replication. Thus, this study yields novel insights into the role of HuR in the post-transcriptional regulation of HCV and HIV1 gene expression. Results and discussion HIV-1 IRES activity is suppressed by HuR while HCV IRES activity is enhanced Since the ubiquitously expressed protein HuR has recently been linked to the HIV-1 replication cycle (Lemay et al., 2008), and has also been implicated in the regulation of IRES-driven translation (Galban et al., 2008; Korf et al., 2005; Meng et al., 2005; Yeh et al., 2008), we sought to investigate its potential role on protein synthesis mediated by the HIV-1 IRES. This study was extended to include the HCV IRES as it has been shown to require HuR for optimal activity (Korf et al., 2005). In these assays the dual luciferase (dl) reporter construct containing an upstream Renilla luciferase gene (RLuc) and a downstream Firefly luciferase gene (FLuc) were used. Bicistronic constructs harboring the HIV-1 (dl HIV-1 IRES) or the HCV (dl HCV IRES) IRES have been previously described (Barria et al., 2009; Brasey et al., 2003). In this bicistronic context IRES activity was monitored using the FLuc activity as the readout, while the RLuc reporter gene served as an upstream translational control. The use of these artificial bicistronic mRNAs provides important advantages in this particular study. First, they allow the HIV-1 IRES to be studied in the absence of virus infection, thus eliminating potential interference from other functions observed during the viral replication cycle where the RNA region that harbors the IRES may also be involved (Berkhout, 1996; Brasey et al., 2003). In addition, as the HIV-1 full-length mRNA possesses a 5′cap structure and two IRES elements, all of which have been reported capable of directing translation initiation from the same initiation codon (Brasey et al., 2003; Buck et al., 2001; Ricci et al., 2008), the isolation of each element seems necessary to characterize their individual function and regulation. Secondly, bicistronic mRNAs are ideal when studying the effect on translation initiation of a protein such as HuR that can exert its function by affecting overall RNA stability (Brennan and Steitz, 2001; Fan and Steitz, 1998; Gorospe, 2003), since variations in overall RNA concentration are not expected to impact on the molar ratio between both cistrons (Jackson et al., 1995). Thus, any variation in the FLuc/RLuc ratio (protein levels) will directly reflect translation activity and not RNA stability (Jackson et al., 1995). In the first series of experiments in vitro transcribed uncapped RNA encoding HuR, synthesized from the pcDNA3-HuR plasmid (Fan and Steitz, 1998), was co-translated in the rabbit reticulocyte lysate system (RRL), as described in Materials and methods, with capped RNAs generated from either the dl HIV-1 IRES (Fig. 1A) or the dl HCV IRES (Fig. 1B) plasmids. The FLuc/RLuc ratio was used as an index of IRES activity, with the mean translation efficiency of the control dl RNA without HuR being arbitrarily set at 1 (±standard error). The addition of 8 or 16 ng/μl of HuR RNA to the in vitro translation reaction reduced

Fig. 1. HuR represses translation initiation mediated by the HIV-1 IRES, while it stimulated HCV IRES-driven protein synthesis. (A) The capped dl HIV-1 IRES RNA (Brasey et al., 2003) was used to program G2/M (160 ng/μl) supplemented RRL in the presence of increasing amounts (8 and 16 ng/μl) of in vitro transcribed, uncapped RNA encoding HuR (Fan and Steitz, 1998). Luciferase activity was measured as indicated in Material and methods. The FLuc/RLuc ratio was used as an index of IRES activity and expressed as relative translational efficiency. The relative translational efficiency of the dl HIV-1 IRES translated in supplemented RRL in the absence of HuR RNA was arbitrarily defined as 1. (B) RRL was programmed with capped dl HCV IRES RNA (Barria et al., 2009) and translated in the presence of increasing amounts (8 and 16 ng/μl) of in vitro transcribed uncapped RNA encoding HuR. The FLuc/RLuc ratio was used as an index of IRES activity and expressed as relative translational efficiency. The relative translational efficiency of the dl HCV IRES translated in the absence of HuR RNA was arbitrarily defined as 1. (A and B) Values are the means ± SEM from four independent experiments. (C) HuR protein expression was detected in RRL by Western blotting using monoclonal antibodies (Gallouzi et al., 2000; Voeltz et al., 2001). Actin was detected by Western blotting as a loading control.

HIV-1 IRES activity by about 53% and 63%, respectively (Fig. 1A), while it stimulated translation from the HCV IRES by about 42% and 120%, respectively (Fig. 1B). HuR expression in RRL was visualized by Western blot analysis (Fig. 1C). These findings confirm a previous report showing that HuR stimulates translation from the HCV IRES (Korf et al., 2005) and suggest that in vitro overexpression of HuR has antagonistic effects over the activities of the HIV-1 and HCV IRESes.

180

A. Rivas-Aravena et al. / Virology 392 (2009) 178–185

Although the reduction in HIV-1 IRES activity might seem marginal, results are comparable to what has been reported for other IRESes which are negatively regulated by HuR (Meng et al., 2005; Yeh et al., 2008). We next sought to validate our observations in a different experimental model. To this end Xenopus laevis oocytes nuclei were microinjected with DNA corresponding to either the pcDNA3-HuR or pcDNA3 plasmids 24 h prior to microinjection into the cytoplasm of capped and polyadenylated dl ΔEMCV, dl HIV-1 IRES or dl HCV IRES RNAs (Fig. 2A). The RLuc/FLuc bicistronic vector dl ΔEMCV, that harbors a defective encephalomyocarditis virus (Δ-EMCV) IRES known to inhibit ribosome reinitiation and readthrough, inserted upstream of the FLuc reporter, was used as a negative control (Barria et al., 2009; Brasey et al., 2003; Wilson et al., 2000b). Expression of the human HuR protein in oocytes was confirmed by Western blotting

using a well-characterized antibody known to specifically detect the human version of the protein (Gallouzi et al., 2000; Voeltz et al., 2001). As shown in Fig. 2B expression of HuR was not equal in all injected oocytes; thus, all oocytes that by Western blot analysis revealed detectable amounts of human HuR were used in the assay. RLuc and FLuc activities were measured and expressed as relative values (see explanation in the legend of Fig. 2). In agreement with what was observed in RRL, cap-dependent translation initiation, monitored by RLuc activity, was not affected by HuR expression (Fig. 2C). However, and as shown above in our in vitro experiments, the expression of HuR in X. laevis oocytes had a negative impact on HIV-1 IRES activity, while it stimulated HCV IRES-mediated translation initiation (Fig. 2C). It seems reasonable to discard the possibility that the effect of HuR over FLuc protein synthesis is due, in the case of the HIV-1 IRES, to mRNA destabilization or relocation to translationally

Fig. 2. Human HuR negatively impacts HIV-1 IRES translation initiation while it stimulated HCV IRES activity in Xenopus laevis oocytes. The pcDNA3 or pcDNA3-HUR plasmid (35 ng) were microinjected into Xenopus laevis oocyte nuclei (Fan and Steitz, 1998), followed, 24 h later, by microinjection into the oocyte cytoplasm of capped and polyadenylated RNA corresponding to the dl ΔEMCV, dl HIV-1 IRES, or dl HCV IRES vectors (25 ng) as described in Material and methods. Oocytes were harvested 24 h after the last microinjection and processed. (A) Schematic representation of the experimental procedure is represented. Overexpression of HuR was evaluated in each egg by Western blotting using monoclonal HuR antibodies that recognize only the human version of the protein (Voeltz et al., 2001). (B) A representative Western blot showing the variations of HuR expression in 5 different oocytes (O-2 to O-6) is shown. Actin was detected by Western blotting and used as a loading control. (C) Renilla luciferase (RLuc) and Firefly luciferase (FLuc) activities were determined and data are expressed as relative luciferase activities, where the RLuc and FLuc activities of the dl HIV-1 IRES (left panel), and dl HCV IRES (right panel) RNAs in the oocytes microinjected with pcDNA 3 plasmid (not expressing human HuR protein) were arbitrarily set to 1. Each value is the mean ± SEM from at least 6 oocytes obtained from two different animals.

A. Rivas-Aravena et al. / Virology 392 (2009) 178–185

181

silent cytoplasmic compartments, or to mRNA stabilization in the case of HCV IRES, as HuR has no discernable effect over the protein levels of RLuc, the upstream cistron of our bicistronic mRNA. Importantly, as these RNAs were directly microinjected into the cytoplasm of oocytes, our data not only confirm that HuR has opposite effects on the translational activities of the HIV-1 and HCV IRESes, but also suggest that HuR does not require the targeted RNA to have prior exposure to the nucleus. We next assessed whether HuR can function as a regulator of protein synthesis mediated by the HIV-1 and HCV IRESes in cells. We reasoned that if endogenous HuR participates in the modulation of HIV-1 and HCV IRES activity in cells its knockdown would impact positively on HIV-1 IRES activity, while it would have a negative effect on the HCV IRES. Experiments were conducted in HeLa cells as both IRESes are active in these cells (Borman et al., 1997; Brasey et al., 2003), and endogenous expression of HuR in HeLa cells is relatively high (Fan and Steitz, 1998). The dual luciferase plasmid dl ΔEMCV, dl HIV-1 IRES, or dl HCV IRES was transfected into HeLa cells while endogenous HuR mRNA was targeted using a specific siRNA. An earlier study showed that the HCV 5′UTR displays a promoter activity (Dumas et al., 2003). Thus, we first evaluated the presence of the fulllength bicistronic RNA in transfected cells. To achieve this, total RNA was extracted from cells and analyzed by RT-PCR (Fig. 3A) as previously described (Herbreteau et al., 2005; Kazadi et al., 2008). Even though results do not rule out the presence of other RNA species, they do confirm, in all cases, the presence of the full-length bicistronic mRNA in cells expressing or not HuR protein (Fig. 3A). Western blot analysis revealed that transfection of HuR siRNA (siRNA-HuR; Fig. 3B, lanes 4–6) resulted in a dramatic decrease in the levels of endogenous HuR (Fig. 3B, compare lanes 1–3 with lanes 4–6). Consistent with our in vitro data siRNA-mediated knockdown of endogenous HuR was accompanied by an increase in HIV-1 IRES-mediated protein synthesis (Fig. 3C). While predictably and conversely, reduction of endogenous HuR resulted in decreased HCV IRES activity (Fig. 3C). Thus, we concluded that endogenous HuR differentially modulates HIV-1 and HCV IRES activities, acting as a negative regulator of HIV-1 IRES-driven translation initiation while positively affecting the activity of HCV IRES. HuR overexpression impairs post-integration steps of the HIV-1 replication cycle HuR is one of the best-studied examples of an ARE-binding protein (Brennan and Steitz, 2001). ARE elements have been classified into three groups based on distinct sequence features and functional properties (Barreau et al., 2005). Close analysis of the HIV-1 and HCV 5′UTR sequences do not reveal any of the well-characterized ARE element targets for HuR. Consistent with this observation and in agreement with previous reports (Lemay et al., 2008; Spangberg et al., 2000), we were unable to demonstrate the direct binding of HuR to the HIV-1 5′UTR, to the HCV 5′UTR, or to the ΔEMCV regions in isolation or in the context of RLuc/FLuc bicistronic mRNA. This whether using recombinant HuR protein, RRL-synthesized HuR protein or overexpression of HuR in X. laevis oocytes and in HeLa cells (data not shown). These findings suggest that the effect of HuR on HIV-1 and HCV IRES-mediated translation initiation does not involve direct binding to the IRES or to the vector RNA. Alternatively, this could imply that HuR requires specific conditions to bind the HIV and HCV IRES elements (Meng et al., 2008). Modulation of the IGF-IR IRES by HuR is differentially regulated by dynamic, competitive interactions of HuR with other specific RNA-binding proteins that occur under particular physiological conditions (Meng et al., 2008). Next we sought to determine the biological relevance of our findings. For this, we examined if HuR protein influences HIV-1 virus replication. In this series of experiments we exclusively focused on HIV-1 as we lack an adequate system to replicate HCV in cell culture.

Fig. 3. HeLa cell endogenous HuR negatively affects translation mediated by the HIV-1 IRES, while it is required for optimal HCV IRES-driven protein synthesis. HeLa cells were transfected with either the control (siRNA-C) or the siRNA-HuR small interfering RNAs. Cells were then transfected 48 h later with 1.5 μg of dl ΔEMCV, dl HIV-1 IRES, or dl HCV IRES plasmids (Barria et al., 2009; Brasey et al., 2003; Wilson et al., 2000b). Cells were processed 24 h after the second transfection. (A) Total RNA was extracted from cells and used as template in a non-quantitative one-step RT-PCR designed to amplify the fulllength bicistronic RNAs [(+) RT-reaction; bottom panel]. As a control for DNA contamination the same reaction was conducted without a step of reverse transcription [(−) RT-reaction; bottom panel]. A schematic representation of the experimental procedure indicating the used primers (arrows) is presented (top panel). (B) HuR and tubulin proteins were detected by Western blotting using monoclonal antibodies (Voeltz et al., 2001). Gaps indicate where intervening lanes have been spliced out. (C) RLuc and FLuc activities were measured and the [(FLuc/RLuc)/total protein] ratio was used as an index of IRES activity. The use of the (FLuc/RLuc) ratio makes the analysis independent from the concentration of bicistronic RNA in each independent repetition (Jackson et al., 1995). The [(FLuc/RLuc)/total protein] of the dl ΔEMCV vector was arbitrarily set to 1. Values are the means ± SEM from three independent experiments.

182

A. Rivas-Aravena et al. / Virology 392 (2009) 178–185

HuR has been suggested to play a role in the early steps of HIV-1 replication (Lemay et al., 2008); direct binding to the HIV-1 reverse transcriptase (RT) enhances its activity (Lemay et al., 2008). Interestingly, and in agreement with the results presented herein, Lemay et al. (2008) showed that siRNA directed against endogenous HuR slightly increases the generation of infectious particles from HIV1 producing HeLa cell lines (Fig. 4C in reference (Lemay et al., 2008)). Based on these findings we decided to do the opposite experiment and evaluated HIV-1 production in HeLa cells under conditions in which the HuR protein was overexpressed. HeLa cells were co-transfected with the pNL4.3 provirus, with the vector alone or expressing HuR.

Direct transfection of pNL4.3 enabled us to bypass the reverse transcription step and focus exclusively on the post-integration steps of the HIV-1 replication cycle. The HeLa cells used in these assays lack the receptors and co-receptors required for de novo HIV-1 infection. Virus production was assessed by a standard ELISA quantification of the Gag CA-p24 antigen in the cell supernatant (Fig. 4A), and data were confirmed by direct visualization of viral CA-p24 by Western blot analysis (Fig. 4B). Co-transfection of pNL4.3 provirus and the vector expressing HuR caused an important reduction in Gag CA-p24 antigen concentration in supernatants (Fig. 4A). To further challenge our observations total protein and RNA was extracted from cells

Fig. 4. HuR protein overexpression negatively impacts on post-integration steps of the HIV-1 replication cycle in HeLa cells. HeLa cells were co-transfected with the HIV-1 provirus pNL4.3 (200 ng) together with vector alone (400 ng) or the vector expressing HuR protein (200 ng and 400 ng) (Fan and Steitz, 1998). (A) Gag CA-p24 antigen of the viral particles produced by HeLa cells in the cell supernatant was quantified 24 h post-transfection using a commercial ELISA kit and are expressed in international units (UI) per ml (Vironostika HIV-1 Antigen, Biomérieux). The negative control (−) corresponds to the supernatant of HeLa cells that were not transfected with the pNL4.3 vector. Data represent three independent DNA transfection experiments (± standard deviation). (B) Total virus was concentrated from the supernatants of HeLa cells co-transfected with pNL4.3 (200 ng) and vector alone (200 ng) or the vector expressing HuR (200 ng) by ultracentrifugation as described in Materials and methods. HIV-1 CA-p24 was detected by Western blotting using a polyclonal antibody as indicated in Materials and methods. The negative control (−) corresponds to the supernatant of HeLa cells that were not transfected with the pNL4.3 vector. (C) Total protein was extracted from HeLa cells co-transfected with pNL4.3 (200 ng) and vector alone (200 ng) or the vector expressing HuR (200 ng), 20 μg of total protein was resolved on a 12% SDS-PAGE as described in Materials and methods and actin was detected by Western blotting. (D) Total RNA was isolated from HeLa cells co-transfected with pNL4.3 (200 ng) and vector alone (200 ng) or the vector expressing HuR (200 ng or 400 ng). HIV-1 RNA was quantified using a specific qRTPCR as indicated in Materials and methods. The viral RNA (vRNA) quantity in pNL4.3 cells transfected with vector alone was arbitrarily set to 1. Values are the means ± SEM from three independent experiments.

A. Rivas-Aravena et al. / Virology 392 (2009) 178–185

expressing HIV-1 while overexpressing or not human HuR protein (Figs 4C and D). Actin was detected by Western blot as shown in Fig. 4C. Viral RNA was quantified by a specific qRT-PCR reaction as described in Materials and methods. An apparent increase of viral RNA was observed when HuR was overexpressed however data revealed not to be statistically significant (one-way ANOVA followed by Bonferroni post-ANOVA test). Therefore, the results presented in Figs. 4C and D suggest that the effect of HuR over HIV-1 replication is not exerted at the level of cell viability nor HIV-1 RNA transcription. Thus, despite being unable to demonstrate protein–RNA interaction, in agreement with our previous results generated using bicistronic mRNAs, HuR overexpression exerts a negative impact on postintegration steps of the HIV-1 replication cycle. In cells HuR engages in several protein–protein complexes that are not mediated by RNA (Brennan et al., 2000). Interestingly, the function of RNA-binding proteins such as HuR is altered depending of the partner-protein to which it binds (Brennan et al., 2000). Thus, it is conceivable that HuR–ligand interaction may alter the affinity of both proteins for their target RNAs. Based on this possibility we propose that the regulation of HIV-1 IRES-driven protein synthesis by HuR is mediated by an as yet unidentified HuR–ligand that would act as an ITAF for the HIV-1 IRES (depicted as L in Fig. 5). A similar ligand-model has been proposed to explain the HuR induced activation of the IRES present within the 5′UTR of the IGF-IR mRNA (Meng et al., 2008; Meng et al., 2005). Thus, IRES function would be differentially regulated by dynamic, competitive interactions with multiple specific RNA-binding proteins (Meng et al., 2008). In the case of the HIV-1 IRES we speculate that the HuR–L complex (Fig. 5) cannot act as an ITAF for the HIV-1 IRES. Interestingly, a similar model has been proposed to explain the effect of HuR on early steps of HIV-1 replication (Lemay et al., 2008). The human HuR protein interacts with HIV-1 reverse transcriptase and modulates reverse transcription in infected cells (Lemay et al., 2008). Interestingly, stimulation of reverse transcription is not mediated by HuR binding to the viral RNA (Lemay et al., 2008). In consequence, our study suggests that the human HuR protein modulates the HIV-1 replication cycle through protein– protein and not protein–RNA interactions.

183

Materials and methods Plasmids Vector dl HIV-1 IRES corresponds to the dual luciferase plasmid harboring the full HIV-1 5′UTR (nt 1-336) described in Brasey et al. (2003) (Brasey et al., 2003). Plasmid dl HCV IRES and dl ΔEMCV plasmids were described in earlier reports (Barria et al., 2009; Brasey et al., 2003; Wilson et al., 2000a; Wilson et al., 2000b), as well as plasmids used for HuR expression pcDNA3-HuR and pGEX-5X-2/HuR (Fan and Steitz, 1998; Gallouzi et al., 2000). Cell culture, cell cycle arrest and virus production HeLa cells were cultured in Dulbecco's modified Eagle's medium (Gibco-BRL, Invitrogen, Life Technologies Corporation, Carlsbad, California, USA, or Sigma-Aldrich, St. Louis, MO, USA), supplemented with 10% (v/v) fetal bovine serum (Hyclone, Logan, UT, USA, or SigmaAldrich, St. Louis, MO, USA), 50 U of penicillin–streptomycin/ml (Gibco-BRL, Invitrogen, Life Technologies Corporation, Carlsbad, California, USA, or Sigma-Aldrich, St. Louis, MO, USA), and when needed with sodium pyruvate (Sigma-Aldrich, St. Louis, MO, USA) at 37 °C in 5% CO2 humidified air. To induce G2/M arrest, HeLa cells were incubated for 18 h in medium containing 0.4 μg/ml of nocodazole (Sigma-Aldrich, St Louis, MO, USA) as previously described (Brasey et al., 2003). Cell cycle arrest was evaluated by flow cytometry (Brasey et al., 2003). HIV-1 particles were produced by transfecting HeLa cells (CCL 2.2, ATCC) with the pNL4.3 provirus (gene bank accession: AF324493). Viral particle production in the cell supernatant was evaluated with the anti-p24 ELISA kit from Biomérieux (Vironostika HIV-1 Antigen; bioMérieux SA, Marcy l'Etoile, France) following the manufacturer's protocol. Total virus present in 1.5 ml of supernatant was concentrated by ultracentrifugation at 200,000 ×g for 1 h. The virus-containing pellet was resuspended in 25 μl of diluting buffer (60 mM Tris/HCl pH 80, 180 mM KCl; 6 mM MgCl2, 0,6 mM EGTA ph8, 1% Triton X-100). A total volume of 5 μl of resuspended viral particles were directly mixed with standard Leamli buffer and resolved on a 12% SDS-PAGE. HIV-1

Fig. 5. HuR indirectly blocks HIV-1 IRES-mediated translation. Results presented in this study suggest that HuR exerts its effect on HIV-1 IRES activity without binding the viral RNA. Our current working model posits that a yet unidentified HuR–ligand protein (depicted as L) is required for HIV-1 IRES activity (A). However, when in complex with HuR the L protein is unable to act as an ITAF for the HIV-1 IRES hampering viral IRES-mediated translation initiation (B). This model is based on the herein presented data (Figs. 1–4), observations indicating that the function of RNA-binding protein is altered depending of the partner-protein to which they bind (Brennan et al., 2000), and on data showing that in cells HuR engages in several protein–protein complexes that are not mediated by RNA (Brennan et al., 2000).

184

A. Rivas-Aravena et al. / Virology 392 (2009) 178–185

CA-p24 was detected by Western blotting using a polyclonal antibody kindly provided by Dr. A. Mouland (McGill University). Blots were developed as described below. In vitro RNA synthesis and in vitro translation The dual luciferase plasmids dl ΔEMCV, dl HIV-1 IRES digested with BamHI (Fermentas) and the dl HCV IRES digested with NotI (Fermentas, Vilnius, Lithuania) served as templates to generate bicistronic RNAs used in the in vitro translation assays. Capped RNAs were synthesized using the mMessage mMachine T7 System (Applied Biosystems/Ambion, Austin, TX, USA), while capped and polyadenylated RNA transcripts were synthesized using the complete mMessage mMachine T7 Ultra Kit which includes the reagents for poly(A) tailing (Applied Biosystems/Ambion, Austin, TX, USA) according to the manufacturer's protocol. The integrity of the RNAs was confirmed by electrophoresis on denaturing agarose gels and their concentration quantified by spectrophotometry (GeneQuant, GE Healthcare, Piscataway, NJ, USA.). In vitro transcribed dl HIV-1 IRES RNAs (10 ng/μl except otherwise indicated) were translated in 25% (v/v) nuclease treated rabbit reticulocyte lysate (RRL; Promega Corporation, Madison, WI, USA) supplemented with cell extracts at adequate salt concentrations (Anderson and Lever, 2006; Brasey et al., 2003). HeLa cell extracts from G2/M arrested cells were prepared as previously described (Brasey et al., 2003) maintaining final salt concentrations, but without addition of creatine kinase, creatine phosphate, spermidine, GTP, ATP, and amino acids. G2/M-HeLa extracts were preincubated with RNA for 5 min prior addition of the RRL mix. The dl HCV IRES and dl ΔEMCV RNA were translated in RRL according to Barria et al. (2009). The translation reactions were conducted for 90 min at 30 °C, unless otherwise specified in the figure legends. siRNA induced HuR knockdown and immunoblotting To knockdown endogenous HuR in HeLa cells, we used the small interfering RNA (siRNA) duplexes as described (Dormoy-Raclet et al., 2007). Cells plated in six-well plates were grown overnight. The following day, cells were transiently transfected with 0.12 μM of either the control (siRNA-C) or the siRNA-HuR in OPTI-MEM I Reduced Serum Medium (Invitrogen, Life Technologies Corporation, Carlsbad, California, USA) using Lipofectamine Plus (Invitrogen, Life Technologies Corporation, Carlsbad, California, USA) according to the manufacturer's instructions. After 48 h, cells were transfected with 1.5 μg of dl ΔEMCV, dl HIV-1 IRES, and dl HCV IRES plasmids. Samples were processed 24 h after plasmid transfection. To confirm HuR knockdown 5 μg of total cell extracts were resolved on a 12% SDS-polyacrylamide gel. Total cell extracts were prepared as described in Dormoy-Raclet et al. (2007). For immunoblotting, proteins were transferred to nitrocellulose membranes (Bio-Rad Laboratories Headquarters, Hercules, CA, USA) and probed with HuR monoclonal (1:10,000 dilution) (Voeltz et al., 2001), and anti-tubulin monoclonal (Sigma-Aldrich, St. Louis, MO, USA; 1:5000 dilution), or anti-actin monoclonal (MP Biomedicals, Solon, OH, USA; 1:5000 dilution) with horseradish peroxidase-conjugated goat anti-mouse as secondary antibodies (GE Healthcare, Piscataway, NJ, USA). Blots were developed with the Amersham enhanced chemiluminescence system. Luciferase assays The activities of Firefly and Renilla luciferases in lysates prepared from RRL, X. laevis oocyte, or transfected cells were measured using a dual luciferase reporter system assay (Promega Corporation, Madison, WI, USA), on 30 μl of cell lysates, or 1–5 μl of X. laevis oocyte lysate (see below), or 1 μl of complemented RRL using a Berthold DS Sirius luminometer.

Oocyte harvesting, and microinjection Oocytes were isolated from X. laevis ovarian fragments by manual dissection as previously described (Acuna-Castillo et al., 2002). To evaluate viral IRES activity in oocytes, 25 ng of in vitro transcribed, capped and polydenylated RNA (see above) was microinjected into each oocyte with glass micropipettes calibrated to deliver a final volume of 50 nl. Control injections were conducted for each experimental set using oocytes from the same animals. To assess the effect of HuR, oocytes were first microinjected with 35 ng of either pcDNA3 control vector (Invitrogen, Life Technologies Corporation, Carlsbad, California, USA) or pcDNA3-HuR and microinjected 24 h later with 25 ng of in vitro transcribed, capped and polyadenylated bicistronic RNA generated from either dl ΔEMCV, dl HIV-1 IRES or dl HCV IRES plasmids. Oocytes were incubated for 24 h at 15 °C in standard Barth's solution supplemented with 10 UI/ l penicillin–streptomycin and 2 mM pyruvate. Oocyte lysates were prepared in 1× Passive Lysis Buffer (Promega Corporation, Madison, WI, USA), centrifuged at 16,000 ×g for 5 min, and 1–5 μl of supernatant was used in the detection assay (see above). Western bots were conducted using 20 μg of total protein as described above. Protein expression and purification The fusion protein GST-HuR and protein GST were expressed and purified as previously described (Brennan et al., 2000; Gallouzi et al., 2000). Plasmids for bacterial expression pGEX-5X-2/HuR (Brennan et al., 2000; Gallouzi et al., 2000), and pGEX-5X-2 (Amersham Pharmacia Biotech AB) were transformed into Escherichia coli BL21 (DE3) cells. Cell growth, induction and lysis were performed following well established procedures (Frangioni and Neel, 1993). The purification of GST and HuR-GST fusion protein was conducted according to Brennan et al. (2000) and Gallouzi et al. (2000). RNA extraction, RT-PCR and real time RT-PCR Cells were collected by centrifugation at 710 ×g for 5 min and washed three times in phosphate-buffered saline (PBS; 137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4·7H2O, 1.4 mM KH2PO4, pH 7.4) at 4 °C. RNA was extracted from cells using the Trizol reagent (Invitrogen, Life Technologies Corporation, Carlsbad, California, USA), treated with RNase free DNase RQ1 (Promega Corporation, Madison, WI, USA), and its integrity was monitored by electrophoresis on denaturing agarose gels and quantified by spectrophotometry (NanoDrop Technology, Wilmington, Delaware, USA). The RT-PCR assay to confirm the presence of the bicistronic RNA was carried out using the SuperScript™ III One-Step RT-PCR System with Platinum® Taq DNA polymerase kit (Invitrogen, Life Technologies Corporation, Carlsbad, California, USA) according to the manufacturer's protocol, using 3 μg of total RNA and primers p2anti (5′TCTCTTCATAGCCTTATGCAGTTG-3′) and Pforluc (5′-CATGACTTCGAAAGTTTATGATC-3′). As a control for DNA contamination the same reaction was conducted without the step of RT. The amount of viral RNA present within cells was evaluated by a quantitative real time RT-PCR reaction (qRT-PCR) using the forward primer 5′ GCGCTGCTAGCGGGTCTCTCTGGTTAGACCAGATCTGAGC ′3 and the reverse primer 5′ GCGCTACCGGTCTCTCTCCTTCTAGCCTCCGCTAGTCAA ′3, designed to specifically amplify the 5′UTR of the HIV-1 RNA (based on pNL4.3; AF324493). qRT-PCR reaction were programmed with 3 μg of total cellular RNA and conducted on a Stratagene MX 3000 instrument (Stratagene, La Jolla, CA, USA), using the Brilliant® II SYBR® Green QRT-PCR Master Mix KIT (Stratagene). The number of HIV-1 RNA copies were normalized to those of human 18S RNA by an external standard curve showing a linear distribution (r: 0.99) between 10 and 1 × 106 copies. The 18S RNA was amplified using the

A. Rivas-Aravena et al. / Virology 392 (2009) 178–185

forward primer 5′ GATATGCTCATGTGGTGTTG ′3 and reverse primer 5′ AATCTTCTTCAGTCGCTCCA ′3. Acknowledgments We thank Dr. M. Rau for critical reading and editing of the manuscript. We thank Drs. N. Sonenberg (McGill University) and P. Sarnow (Stanford University) for kindly providing plasmids used in this study. We thank Dr. A. Mouland (McGill University) for kindly providing the anti-HIV-1 CA-p24 polyclonal antibody. The present study was supported by grants FONDECYT 1060655 and 1090318 to MLL, FONDAP 13980001 and PFB12/2007 to JPH-T, and a NCIC (National Cancer Institute of Canada) operating grant (018125) to IEG. ARA was a recipient of a VRAID Pontificia Universidad Católica de Chile doctoral fellowship, PR was supported by a MECESUP-Universidad Andrés Bello doctoral fellowship, FR was funded by the MIFAB Institute, and MV and FVE are recipients of CONICYT doctoral fellowships. VDR is a Research Fellow of the Terry Fox Foundation through an award from the National Cancer Institute of Canada. References Acuna-Castillo, C., Villalobos, C., Moya, P.R., Saez, P., Cassels, B.K., Huidobro-Toro, J.P., 2002. Differences in potency and efficacy of a series of phenylisopropylamine/ phenylethylamine pairs at 5-HT(2A) and 5-HT(2C) receptors. Br. J. Pharmacol. 136 (4), 510–519. Anderson, E.C., Lever, A.M., 2006. Human immunodeficiency virus type 1 Gag polyprotein modulates its own translation. J. Virol. 80 (21), 10478–10486. Balvay, L., Lopez Lastra, M., Sargueil, B., Darlix, J.L., Ohlmann, T., 2007. Translational control of retroviruses. Nat. Rev. Microbiol. 5 (2), 128–140. Barreau, C., Paillard, L., Osborne, H.B., 2005. AU-rich elements and associated factors: are there unifying principles? Nucleic. Acids. Res. 33 (22), 7138–7150. Barria, M.I., Gonzalez, A., Vera-Otarola, J., Leon, U., Vollrath, V., Marsac, D., Monasterio, O., Perez-Acle, T., Soza, A., Lopez-Lastra, M., 2009. Analysis of natural variants of the hepatitis C virus internal ribosome entry site reveals that primary sequence plays a key role in cap-independent translation. Nucleic. Acids. Res. 37 (3), 957–971. Belsham, G.J., Sonenberg, N., 1996. RNA–protein interactions in regulation of picornavirus RNA translation. Microbiol. Rev. 60 (3), 499–511. Berkhout, B., 1996. Structure and function of the human immunodeficiency virus leader RNA. Prog. Nucleic. Acid. Res. Mol. Biol. 54, 1–34. Borman, A.M., Le Mercier, P., Girard, M., Kean, K.M., 1997. Comparison of picornaviral IRES-driven internal initiation of translation in cultured cells of different origins. Nucleic. Acids. Res. 25 (5), 925–932. Brasey, A., Lopez-Lastra, M., Ohlmann, T., Beerens, N., Berkhout, B., Darlix, J.L., Sonenberg, N., 2003. The leader of human immunodeficiency virus type 1 genomic RNA harbors an internal ribosome entry segment that is active during the G2/M phase of the cell cycle. J. Virol. 77 (7), 3939–3949. Brennan, C.M., Steitz, J.A., 2001. HuR and mRNA stability. Cell. Mol. Life. Sci. 58 (2), 266–277. Brennan, C.M., Gallouzi, I.E., Steitz, J.A., 2000. Protein ligands to HuR modulate its interaction with target mRNAs in vivo. J. Cell. Biol. 151 (1), 1–14. Buck, C.B., Shen, X., Egan, M.A., Pierson, T.C., Walker, C.M., Siliciano, R.F., 2001. The human immunodeficiency virus type 1 gag gene encodes an internal ribosome entry site. J. Virol. 75 (1), 181–191. Dormoy-Raclet, V., Menard, I., Clair, E., Kurban, G., Mazroui, R., Di Marco, S., von Roretz, C., Pause, A., Gallouzi, I.E., 2007. The RNA-binding protein HuR promotes cell migration and cell invasion by stabilizing the beta-actin mRNA in a U-rich-elementdependent manner. Mol. Cell. Biol. 27 (15), 5365–5380. Dumas, E., Staedel, C., Colombat, M., Reigadas, S., Chabas, S., Astier-Gin, T., Cahour, A., Litvak, S., Ventura, M., 2003. A promoter activity is present in the DNA sequence corresponding to the hepatitis C virus 5′ UTR. Nucleic Acids Res. 31 (4), 1275–1281. Fan, X.C., Steitz, J.A., 1998. Overexpression of HuR, a nuclear-cytoplasmic shuttling protein, increases the in vivo stability of ARE-containing mRNAs. Embo. J. 17 (12), 3448–3460. Frangioni, J.V., Neel, B.G., 1993. Solubilization and purification of enzymatically active glutathione S-transferase (pGEX) fusion proteins. Anal. Biochem. 210 (1), 179–187. Galban, S., Kuwano, Y., Pullmann Jr., R., Martindale, J.L., Kim, H.H., Lal, A., Abdelmohsen, K., Yang, X., Dang, Y., Liu, J.O., Lewis, S.M., Holcik, M., Gorospe, M., 2008. RNAbinding proteins HuR and PTB promote the translation of hypoxia-inducible factor 1alpha. Mol. Cell. Biol. 28 (1), 93–107. Gallouzi, I.E., Brennan, C.M., Stenberg, M.G., Swanson, M.S., Eversole, A., Maizels, N., Steitz, J.A., 2000. HuR binding to cytoplasmic mRNA is perturbed by heat shock. Proc. Natl. Acad. Sci. U. S. A. 97 (7), 3073–3078. Gorospe, M., 2003. HuR in the mammalian genotoxic response: post-transcriptional multitasking. Cell Cycle 2 (5), 412–414.

185

Hellen, C.U., Pestova, T.V., 1999. Translation of hepatitis C virus RNA. J. Viral. Hepat. 6 (2), 79–87. Hellen, C.U., Sarnow, P., 2001. Internal ribosome entry sites in eukaryotic mRNA molecules. Genes Dev. 15 (13), 1593–1612. Herbreteau, C.H., Weill, L., Decimo, D., Prevot, D., Darlix, J.L., Sargueil, B., Ohlmann, T., 2005. HIV-2 genomic RNA contains a novel type of IRES located downstream of its initiation codon. Nat. Struct. Mol. Biol. 12 (11), 1001–1007. Jackson, R.J., 2005. Alternative mechanisms of initiating translation of mammalian mRNAs. Biochem. Soc. Trans. 33 (Pt 6), 1231–1241. Jackson, R.J., Hunt, S.L., Gibbs, C.L., Kaminski, A., 1994. Internal initiation of translation of picornavirus RNAs. Mol. Biol. Rep. 19 (3), 147–159. Jackson, R.J., Hunt, S.L., Reynolds, J.E., Kaminski, A., 1995. Cap-dependent and capindependent translation: operational distinctions and mechanistic interpretations. Curr. Top. Microbiol. Immunol. 203, 1–29. Jang, S.K., Krausslich, H.G., Nicklin, M.J., Duke, G.M., Palmenberg, A.C., Wimmer, E., 1988. A segment of the 5′ nontranslated region of encephalomyocarditis virus RNA directs internal entry of ribosomes during in vitro translation. J. Virol. 62 (8), 2636–2643. Kazadi, K., Loeuillet, C., Deutsch, S., Ciuffi, A., Munoz, M., Beckmann, J.S., Moradpour, D., Antonarakis, S.E., Telenti, A., 2008. Genomic determinants of the efficiency of internal ribosomal entry sites of viral and cellular origin. Nucleic Acids Res. 36 (21), 6918–6925. Korf, M., Jarczak, D., Beger, C., Manns, M.P., Kruger, M., 2005. Inhibition of hepatitis C virus translation and subgenomic replication by siRNAs directed against highly conserved HCV sequence and cellular HCV cofactors. J. Hepatol. 43 (2), 225–234. Lemay, J., Maidou-Peindara, P., Bader, T., Ennifar, E., Rain, J.C., Benarous, R., Liu, L.X., 2008. HuR interacts with human immunodeficiency virus type 1 reverse transcriptase, and modulates reverse transcription in infected cells. Retrovirology 5 (1), 47. Lopez-Lastra, M., Rivas, A., Barria, M.I., 2005. Protein synthesis in eukaryotes: the growing biological relevance of cap-independent translation initiation. Biol. Res. 38 (2–3), 121–146. Meng, Z., King, P.H., Nabors, L.B., Jackson, N.L., Chen, C.Y., Emanuel, P.D., Blume, S.W., 2005. The ELAV RNA-stability factor HuR binds the 5′-untranslated region of the human IGF-IR transcript and differentially represses cap-dependent and IRESmediated translation. Nucleic Acids Res. 33 (9), 2962–2979. Meng, Z., Jackson, N.L., Choi, H., King, P.H., Emanuel, P.D., Blume, S.W., 2008. Alterations in RNA-binding activities of IRES-regulatory proteins as a mechanism for physiological variability and pathological dysregulation of IGF-IR translational control in human breast tumor cells. J. Cell. Physiol. 217 (1), 172–183. Pelletier, J., Sonenberg, N., 1988. Internal initiation of translation of eukaryotic mRNA directed by a sequence derived from poliovirus RNA. Nature 334 (6180), 320–325. Pestova, T.V., Hellen, C.U., 1999. Internal initiation of translation of bovine viral diarrhea virus RNA. Virology 258 (2), 249–256. Pestova, T.V., Kolupaeva, V.G., Lomakin, I.B., Pilipenko, E.V., Shatsky, I.N., Agol, V.I., Hellen, C.U., 2001. Molecular mechanisms of translation initiation in eukaryotes. Proc. Natl. Acad. Sci. U. S. A. 98 (13), 7029–7036. Ricci, E.P., Soto Rifo, R., Herbreteau, C.H., Decimo, D., Ohlmann, T., 2008. Lentiviral RNAs can use different mechanisms for translation initiation. Biochem. Soc. Trans. 36 (Pt 4), 690–693. Semler, B.L., Waterman, M.L., 2008. IRES-mediated pathways to polysomes: nuclear versus cytoplasmic routes. Trends Microbiol. 16 (1), 1–5. Sonenberg, N., Hinnebusch, A.G., 2009. Regulation of translation initiation in eukaryotes: mechanisms and biological targets. Cell 136 (4), 731–745. Spangberg, K., Wiklund, L., Schwartz, S., 2000. HuR, a protein implicated in oncogene and growth factor mRNA decay, binds to the 3′ ends of hepatitis C virus RNA of both polarities. Virology 274 (2), 378–390. Spriggs, K.A., Bushell, M., Mitchell, S.A., Willis, A.E., 2005. Internal ribosome entry segment-mediated translation during apoptosis: the role of IRES-trans-acting factors. Cell Death Differ. 12 (6), 585–591. Stoneley, M., Willis, A.E., 2004. Cellular internal ribosome entry segments: structures, trans-acting factors and regulation of gene expression. Oncogene 23 (18), 3200–3207. Tsukiyama-Kohara, K., Iizuka, N., Kohara, M., Nomoto, A., 1992. Internal ribosome entry site within hepatitis C virus RNA. J. Virol. 66 (3), 1476–1483. Voeltz, G.K., Ongkasuwan, J., Standart, N., Steitz, J.A., 2001. A novel embryonic poly(A) binding protein, ePAB, regulates mRNA deadenylation in Xenopus egg extracts. Genes Dev. 15 (6), 774–788. Wilson, J.E., Pestova, T.V., Hellen, C.U., Sarnow, P., 2000a. Initiation of protein synthesis from the A site of the ribosome. Cell 102 (4), 511–520. Wilson, J.E., Powell, M.J., Hoover, S.E., Sarnow, P., 2000b. Naturally occurring dicistronic cricket paralysis virus RNA is regulated by two internal ribosome entry sites. Mol. Cell. Biol. 20 (14), 4990–4999. Yeh, C.H., Hung, L.Y., Hsu, C., Le, S.Y., Lee, P.T., Liao, W.L., Lin, Y.T., Chang, W.C., Tseng, J.T., 2008. RNA-binding protein HuR interacts with thrombomodulin 5′UTR and represses IRES-mediated translation under IL-1{beta} treatment. Mol. Biol. Cell. 19 (9), 3812–3822. Zhou, H., Jarujaron, S., Gurley, E.C., Chen, L., Ding, H., Studer, E., Pandak Jr., W.M., Hu, W., Zou, T., Wang, J.Y., Hylemon, P.B., 2007. HIV protease inhibitors increase TNF-alpha and IL-6 expression in macrophages: involvement of the RNA-binding protein HuR. Atherosclerosis 195 (1), e134–e143.