The enhancement of PCR amplification by low molecular-weight sulfones

Gene 274 (2001) 293–298 www.elsevier.com/locate/gene

The enhancement of PCR amplification by low molecular-weight sulfones Raj Chakrabarti*, Clarence E. Schutt Department of Chemistry, Princeton University, Princeton, NJ 08544, USA Received 8 May 2001; received in revised form 19 June 2001; accepted 18 July 2001 Received by D. Schlessinger

Abstract DNA amplification by polymerase chain reaction (PCR) is frequently complicated by the problems of low yield and specificity, especially when the GC content of the target sequence is high. A common approach to the optimization of such reactions is the addition of small quantities of certain organic chemicals, such as dimethylsulfoxide (DMSO), betaine, polyethylene glycol and formamide, to the reaction mixture. Even in the presence of such additives, however, the amplification of GC-rich templates is often ineffective. In this paper, we introduce a novel class of PCR-enhancing compounds, the low molecular-weight sulfones, that are effective in the optimization of high GC template amplification. We describe here the results of an extensive structure-activity investigation in which we studied the effects of a series of six different sulfones on PCR amplification. We identify two sulfones, sulfolane and methyl sulfone, that are especially potent enhancers of high GC template amplification, and show that these compounds often outperform DMSO and betaine, two of the most effective PCR enhancers currently used. We conclude with a brief discussion of the role that the sulfone functional group may play in such enhancement. q 2001 Elsevier Science B.V. All rights reserved. Keywords: Structure-activity; Sulfolane; Methyl sulfone; Dimethylsulfoxide; Betaine

1. Introduction Polymerase chain reaction (PCR) is one of the most commonly used techniques in modern molecular biology. Its application, however, is often frustrated by inadequate yield of the target DNA sequence and the accompanying amplification of undesired nonspecific bands (Roux, 1995; Newton and Graham, 1994). These problems, in particular low yield, can be especially severe in the cases of targets with high GC contents (Varadaraj and Skinner, 1994; McDowell et al., 1998). Perhaps the most successful of the various methods of improving yield and specificity that have been attempted is the addition of certain organic additives, such as dimethylsulfoxide (DMSO), betaine, polyethylene glycol, glycerol and formamide, to the reaction mixture (Winship, 1989; Bachman et al., 1990; Pomp and Madrano, 1991; Smith et al., 1990; Weissensteiner and

Abbreviations: bp, base pair(s); DMSO, dimethylsulfoxide; dNTP, deoxynucleotide triphosphate; GTP, glycolipid transfer protein (bovine brain); n, normal; PSM, prostate-specific membrane antigen (human); Tm, melting temperature; U, polymerase unit(s) * Corresponding author. 9 Hoyt Laboratory, Princeton, NJ 08544, USA. Tel.: 11-609-258-2826; fax: 11-609-258-1980. E-mail address: [email protected] (R. Chakrabarti).

Lanchbury, 1996). Despite their general potency, the performance of these compounds in the case of GC-rich templates is quite unpredictable, with a particular compound often offering inadequate improvement over the control (Baskaran et al., 1996). The availability of a larger selection of additives that are capable of improving PCR amplification of high GC targets will help make the amplification of particular targets much more tractable. To this end, we undertook a thorough investigation of the effects of a novel class of compounds, the low molecular-weight sulfones, on the amplification of GC-rich templates. Sulfones are similar to sulfoxides with the important difference that the sulfur atom is double-bonded to two oxygen atoms, instead of one. Given the effectiveness of DMSO in PCR optimization, we were interested in determining whether these related compounds are also effective, and whether they offer any selective advantages in the cases of high GC amplicons. The study incorporated three high GC targets and examined the following compounds: methyl sulfone, ethyl sulfone, n-propyl sulfone, tetramethylene sulfone (sulfolane), butadiene sulfone (sulfolene), 2,4dimethylsulfolane, DMSO and betaine. We consider structure-activity correlations in the class of low molecularweight sulfones and identify several of these compounds as effective enhancers of GC-rich template amplification.

0378-1119/01/$ - see front matter q 2001 Elsevier Science B.V. All rights reserved. PII: S 0378-111 9(01)00621-7

294

R. Chakrabarti, C.E. Schutt / Gene 274 (2001) 293–298

2. Materials and methods 2.1. PCRs PCRs were carried out under the following conditions: 10 mM Tris–HCl (pH 8.8), 50 mM KCl, 1.5 mM MgCl2, 0.01% (w/v) gelatin, 0.2 mM primers, 0.06 ng/ml template, 0.2 mM of each dNTP, and 0.04 U/ml Taq polymerase. The templates used were a 996 bp segment of human myeloid leukocyte c-jun cDNA, a 511 bp segment of human prostate-specific membrane antigen (PSM) cDNA, and bovine brain glycolipid transfer protein (GTP) cDNA (660 bp). cDNA synthesis was carried out using the First-Strand RT-PCR kit from Stratagene on the respective mRNAs obtained from Clontech. All amplifications for each template were carried out using a single master batch of cDNA. Taq polymerase and dNTPs were purchased from Stratagene. Primers were obtained from Genosys. The sequences of the primers were as follows: c-jun primer j1: d(ATGACTGCAAAGATGGAAACG); primer j2: d(TCAAAATGTTTGCAACTGCTGCG); PSM primer p1: d(AAACACTGCTGTGGTGGA); primer p2: d(TAGCTCAACAGAATCCAGGC); GTP primer g1: d(GAATTCGAAATGGCGCTGCTGG); primer g2: d(CTCGAGGTCCAGAGTACCCGCTGTG). Primer melting temperatures (Tms) were calculated using the Genosys oligo calculator program. Calculated Tms of the primers were as follows: j1, 63.98C; j2, 70.88C; p1, 60.38C; p2, 61.98C; g1, 73.38C; g2, 74.48C. Additive compounds were purchased from the following sources. Methyl sulfone, ethyl sulfone, n-propyl sulfone, nbutyl sulfone, tetramethylene sulfone (sulfolane), 2,4dimethylsulfolane and butadiene sulfone (sulfolene) were acquired from Acros. DMSO was obtained from Fluka. Betaine was purchased from Sigma. Amplification reactions were carried out on a Robocycler Gradient 96 thermal cycler from Stratagene using 50 ml solutions in 200 ml thin-walled tubes. Before the addition of Taq polymerase, a hotstart procedure was conducted that consisted of an initial cycle of 958C for 5 min (Ivinson and Taylor, 1991) to ensure complete first-strand separation, followed by a cycle of 548C for 5 min. Amplifications were run for 30 cycles. Denaturation was done for 1 min at 928C for PSM and GTP, the minimum temperature that yielded discernable amplification of these targets in the presence of additives, and at either 92 or 958C for c-jun. Extension was done at 728C for 1 min. Annealings were carried out either at fixed concentrations of additives using a temperature gradient of 44–588C or at varying concentrations of additives using fixed temperatures of 488C for PSM, 508C for GTP, and 50 or 538C, depending on the additive, for c-jun. 2.2. Electrophoresis Electrophoresis of amplification products was done on 0.8% agarose gels in which 20 ml reaction products were

loaded with 4 ml loading buffer. Gels were run at 60 V for 80 min, stained with ethidium bromide, visualized on a UV transilluminator (Fisher), and documented by Polaroid photography. Quantitation of amplification products was carried out using an ImageScanner densitometer and ImageMaster Total Lab software from Amersham Pharmacia Biotech. Background correction was conducted using the software’s rolling disc method. Data were plotted using the Kaleida Graph application from Synergy Software. Interpolation of data points at intermediate concentrations was carried out using the software’s cubic spline method. 3. Results 3.1. Definition of terms The effects of sulfone additives on PCR amplification were studied in this work using three different GC-rich templates. Description of the effectiveness of the various additives was achieved in the case of each target through the assignment of two densitometric quantities, termed potency and specificity, to each compound. The potency of an additive is defined as the maximum densitometric volume of target band amplification over the concentration gradient tested for that additive. Maximal target band volumes were interpolated from the data sets by fitting cubic splines to the data. Potencies of the various compounds tested were normalized to that of DMSO (except where it failed to perform), which was assigned a value of 1. The specificity of an additive at a particular concentration is defined as the ratio of the volume of target band amplification to the total volume of all bands, including undesired nonspecific bands, expressed as a percent. In addition to these densitometric quantities, a third characteristic value, the effective range, was assigned to each compound in the case of each target. The effective range of an additive was defined as the interval of concentrations, determined from the additive’s cubic spline curve, over which the volume of target band amplification is at least 50% of the maximal volume. 3.2. PCR enhancement by additives The structures of the additives examined in this work are displayed in Fig. 1. Since a major focus of this study was to determine structure-activity correlations in the sulfone family, the group of compounds was chosen to include the simplest n-alkyl sulfones and the simple cyclic sulfone, sulfolane. In addition, a ring-substituted cyclic sulfone (2,4-dimethylsulfolane) and a cyclic alkene sulfone (sulfolene) were included to study the effects of these structural modifications on amplification. n-Butyl and higher alkyl sulfones were omitted because of their low water solubilities. For the sake of comparison, DMSO and betaine were included in the investigation. DMSO is the most widely used additive in PCR reactions, and is commonly considered

R. Chakrabarti, C.E. Schutt / Gene 274 (2001) 293–298

295

Fig. 1. Structures of the additives tested. Common names used in this paper are included in parentheses.

to be one of the most effective and versatile additives. Betaine has been described as a particularly potent enhancer of high GC template amplification; there is a growing belief that it is the best solution currently available for problems with GC-rich targets (Henke et al., 1997; Miller, 1996; Das and Ledbetter, 2000). A 996 bp segment of human myeloid leukocyte c-jun cDNA (64% GC) was selected as the central target for this investigation because of its particularly high GC content and because it was impossible to amplify in the absence of additives (Chakrabarti and Schutt, 2001). Even in the presence of additives, a 958C denaturing temperature was necessary in almost every case for discernable amplification. Each of the additives was initially tested with c-jun at a few evenlyspaced concentrations over a 44–588C annealing temperature gradient, using a conventional denaturing temperature of

928C. The only compound that yielded discernable amplification under these denaturing conditions was sulfolane. None of the other additives tested – DMSO, betaine, or the other sulfones – showed any amplification. Next, a denaturing temperature of 958C was employed in order to examine the capabilities of the other compounds in amplifying c-jun under less stringent conditions. Again, each additive was tested over a 44–588C annealing temperature gradient at a few concentrations that were chosen to provide a rough perception of the effective range of the compounds and also to determine whether the optimal annealing temperature is sensitive to additive concentration. It was found that the optimal annealing temperature of each compound, except betaine, was 508C and did not depend on concentration. In the case of betaine, the optimal annealing temperature was 538C. n-Propyl sulfone and dimethylsulfolane were found to

296

R. Chakrabarti, C.E. Schutt / Gene 274 (2001) 293–298

Table 1 Potency and effective range of additives (c-jun) Additive

Sulfolane Sulfolene Dimethylsulfolane Methyl sulfone Ethyl sulfone Propyl sulfone DMSO Betaine Control

928C denaturing 958C denaturing Potency a

Potency b Effective range (molar) c

1.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00

1.10 0.17 0.00 0.85 0.20 0.00 1.00 0.52 0.00

0.15–0.40 0.15–0.27 NA 0.57–1.03 0.15–0.33 NA 0.36–1.53 0.88–1.41 NA

a

Normalized maximum densitometric volume of target band: sulfolane ¼ 1. b Normalized maximum densitometric volume of target band: DMSO ¼ 1. c Concentration interval over which the densitometric volume of the target is at least 50% of maximum volume.

be ineffective at any of the concentrations tested in these initial screenings, and were omitted from further studies. Each remaining additive was subsequently tested over a range of closely spaced molar concentrations at their optimal annealing temperatures. These concentrations, chosen partly on the basis of the concentrations that were effective in the initial screenings, were as follows: methyl sulfone, 0.2–1.0 M at 0.1 M intervals; ethyl sulfone, 0.2, 0.3, 0.4 M; sulfolane, 0.05 M and 0.1–0.7 M at 0.1 M intervals; sulfolene, 0.05 M and 0.1–0.4 M at 0.1 M intervals; DMSO, 0.2–1.9 M at 0.1 M intervals; betaine, 0.3–1.0 M at 0.1 M intervals and 1.5–3.0 M at 0.5 M intervals. The additives that performed best in the c-jun studies – methyl sulfone, sulfolane and DMSO – were chosen for additional studies using two more DNA targets: a 511 bp segment of human prostate-specific membrane antigen (PSM) cDNA and bovine brain glycolipid transfer protein (GTP) cDNA (660 bp). These targets were also very difficult to amplify (Henke et al., 1997) due to their high GC contents: PSM, 52% GC with a 73% GC 158 bp region; GTP, 58% GC. In addition, their amplification is generally accompanied by the amplification of nonspecific bands.

Fig. 2. Enhancement of PSM amplification by select additives. Target band volume is normalized to the potency of DMSO. Interpolation was carried out by fitting cubic splines to the data.

Betaine was also included in this phase of the investigation, but was only tested against one template, PSM, due to its poorer performance with c-jun (Table 1). As in the case of cjun, the additives were first tested at a few concentrations over an annealing temperature gradient of 44–588C, and then at various concentrations at their optimal annealing temperatures (488C for PSM, 508C for GTP). A 928C denaturing temperature was used in all experiments. Potencies, best specificities and effective ranges of the additives tested in the case of these additional targets are shown in Table 2. The additive concentration that yielded the maximum target band amplification was found in each case to display a specificity that was within 2% of the best specificity. Figs. 2 and 3 plot the variation of target band amplification with additive concentration for PSM and GTP, respectively. Fig. 4 displays as an example the best results for each compound tested in the case of GTP.

Table 2 Potency a, specificity b and effective range c of select additives (PSM, GTP) Additive

Sulfolane Methyl sulfone DMSO Betaine Control a b c

PSM

GTP

Potency

Specificity (%)

Range (molar)

Potency

Specificity (%)

Range (molar)

1.64 1.40 1.00 0.21 0.21

93 91 88 34 34

0.25–0.50 0.85–1.15 0.73–1.35 NA NA

3.30 1.06 1.00 NA 0.06

100 100 89 NA 53

0.18–0.55 0.65–1.20 0.75–1.25 NA NA

Normalized maximum densitometric volume of target band: DMSO ¼ 1. Best specificity (densitometric volume of target as percent of total volume) over the effective range. Concentration interval over which the densitometric volume of the target is at least 50% of maximum volume.

R. Chakrabarti, C.E. Schutt / Gene 274 (2001) 293–298

Fig. 3. Enhancement of GTP amplification by select additives. Target band volume is normalized to the potency of DMSO. Interpolation was carried out by fitting cubic splines to the data.

Fig. 4. Enhancement of PCR amplification of bovine brain glycolipid transfer protein cDNA (660 bp) by sulfolane, methyl sulfone and DMSO. PCR products were analyzed by 0.8% agarose gel electrophoresis. Lane 1, 0.4 M sulfolane; lane 2, 0.9 M methyl sulfone; lane 3, 0.9 M DMSO; lane 4, control (no additive); lane 5, 100 bp DNA ladder (Gibco).

4. Discussion The objectives of this investigation were twofold: (1) to

297

identify novel enhancers of GC-rich template amplification that might function as well as or better than the current state of the art; and (2) to determine structure-activity correlations in PCR enhancement by the family of low molecularweight sulfones. The data regarding the potency, best specificity and effective range of each of the additives, listed in Tables 1 and 2, form the basis for the discussion and analysis of both of these issues. Comparison of the potencies of the various additives tested with c-jun (Table 1) shows that sulfolane performs best in the case of this particular gene, followed by DMSO, with methyl sulfone close behind. Sulfolane stands out as the sole effective additive at the conventional denaturing temperature of 928C. Betaine performs poorly compared to all of the above additives in the case of this template. In the series of n-alkyl sulfones, we observe the trend that potency decreases with increasing alkyl chain length: methyl sulfone is most effective, followed by ethyl sulfone, while n-propyl sulfone yields no discernable advantage over the control. Finally, the poor performance of sulfolene and the ineffectiveness of dimethylsulfolane, compared to the high potency of sulfolane, indicate that any major modification of the sulfolane ring may have a deleterious effect on PCR amplification. Turning to PSM and GTP (Table 2), we find that sulfolane once again performs best in the case of these targets with regard to both potency and specificity, followed by methyl sulfone, which in turn is followed by DMSO. As mentioned, the remaining sulfones were not tested with these templates. Betaine was completely ineffective in the amplification of PSM. Based on the collective results of the c-jun, PSM and GTP studies, we identify sulfolane as the most effective enhancer of GC-rich template amplification among the compounds studied in this work. In the case of each template, it performed better than any of the other additives tested. Methyl sulfone is less effective, but still seems to offer an advantage over DMSO with respect to high GC targets. Betaine has been previously reported to significantly enhance amplification of the same c-jun and PSM sequences that were used in the current investigation (Henke et al., 1997). Based on its poor performance with respect to sulfolane, methyl sulfone and even DMSO in these experiments, we believe that the importance placed on betaine in the enhancement of GC-rich template amplification needs to be reevaluated. It is known that many organic solvents that enhance PCR amplification can also unwind the DNA double-helix (Lee et al., 1981). A number of investigators have accordingly proposed that organic additives like DMSO enhance PCR by hydrogen bonding to the major and minor grooves of template DNA and destabilizing the double-helix (Varadaraj and Skinner, 1994; Cheng et al., 1994; and references therein). The extra oxygen in the sulfone functional group may be responsible for stronger hydrogen bonding to the grooves of template DNA, especially in the case of GC-rich templates where the number of hydrogen bond donors in the

298

R. Chakrabarti, C.E. Schutt / Gene 274 (2001) 293–298

grooves is on average higher. The fact that the dipole moment of methyl sulfone is greater than that of DMSO (4.49 vs. 3.96 D) is in concordance with this hypothesis (Weast, 1970). The outstanding performance of sulfolane, a simple cyclic sulfone, in these experiments recalls our recent finding that 2pyrrolidone, a simple cyclic amide, is an especially effective PCR enhancer (Chakrabarti and Schutt, 2001). There, we proposed that the particular effectiveness of 2-pyrrolidone may be due to the fact that its cyclic structure constrains the molecule in a conformation that is optimal for complementary hydrogen bonding with donor and acceptor moieties in the major and minor grooves, and perhaps minimizes steric repulsion with neighboring groups on the DNA backbone as well by restricting free rotation. The effectiveness of sulfolane may be attributable to similar factors. Though the sulfone oxygens do not lie in the plane of the ring, they are still likely to interact quite strongly with H-bond donors in the grooves and may, unlike the oxygens in DMSO and methyl sulfone, be constrained by the ring in their favorable orientations. If these speculations are correct, the ineffectiveness of dimethylsulfolane may very well be a result of its inability to fit properly within the grooves due to steric hindrance caused by the protruding methyl groups. Despite the significantly higher potency of sulfolane, its effective range is smaller than those of DMSO and methyl sulfone (Tables 1 and 2). Though a wider range is generally preferable in initial screenings of a compound, increasing the likelihood of identifying an effective additive, the fact that sulfolane’s effective range varies very little from target to target (0.2–0.5 molar in all cases) renders the magnitude of its range unimportant; if sulfolane is effective for a given template, it should be effective at one of these few concentrations. The differences in the effective ranges of these compounds may also be related to groove binding. In the case of the smaller additives, multiple additive molecules might bind in the grooves, especially in the major grooves. With larger molecules like sulfolane and the higher n-alkyl sulfones, the maximum number of molecules that can bind per groove would be expected to be less. The groove would then be saturated at lower concentrations, resulting in a smaller effective range. The decreasing potency of the nalkyl sulfones with increasing chain length could potentially also be a result of a decreasing effectiveness of packing in the template grooves. Of course, detailed comprehension of the structure-activity correlations in the family of low molecular-weight sulfones, and of the differing effective ranges of DMSO and the sulfones, will depend on further mechanistic and structural investigations. The comparative behavior of the low molecular-weight sulfoxides in PCR enhancement may be illuminating in this regard, and is currently the subject of ongoing investigation. In conclusion, we have shown that a number of low molecular-weight sulfones are effective in the enhancement of PCR amplification of GC-rich templates. Methyl sulfone was found to be at least as effective as DMSO in such

amplifications. Sulfolane was identified as being the most effective sulfone enhancer, and should prove to be a valuable addition to the repertoire of compounds which facilitate the amplification of high GC targets. Acknowledgements R.C. wishes to thank the National Science Foundation for its support in offering a 3 year research fellowship. C.E.S. is supported by a grant from the National Institutes of Health (GM 44038). References Bachman, B., Luke, W., Hunsmann, G., 1990. Improvement of PCR amplified DNA sequencing with the aid of detergents. Nucleic Acids Res. 18, 1309. Baskaran, N., Kandpal, R.P., Bhargava, A.K., Glynn, M.W., Bale, A., Weissman, S.M., 1996. Uniform amplification of a mixture of deoxyribonucleic acids with varying GC content. Genome Methods 6, 633– 638. Chakrabarti, R., Schutt, C.E., 2001. The enhancement of PCR amplification by low-molecular weight amides. Nucleic Acids Res. 29, 2377–2381. Cheng, S., Fockler, C., Barnes, W.M., Higuchi, R., 1994. Effective amplification of long targets from cloned inserts and human genomic DNA. Proc. Natl. Acad. Sci. USA 91, 5695–5699. Das, S., Ledbetter, D.H., 2000. Methods and compositions for the diagnosis of fragile X syndrome, United States Patent 6,143,504. Henke, W., Herdel, K., Jung, J., Schnorr, D., Loenig, S.A., 1997. Betaine improves the PCR amplification of GC-rich DNA sequences. Nucleic Acids Res. 19, 3957. Ivinson, A.J., Taylor, G.R., 1991. PCR in genetic diagnosis. In: McPherson, M.J., Quirke, P., Taylor, G.R. (Eds.), PCR: A Practical Approach. Oxford University Press, New York, p. 19. Lee, C.-H., Mizusawa, H., Kakefuda, T., 1981. Unwinding of doublestranded DNA helix by dehydration. Proc. Natl. Acad. Sci. USA 78, 2838–2842. McDowell, D.G., Burns, N.A., Parkes, H.C., 1998. Localised sequence regions possessing high melting temperatures prevent the amplification of a DNA mimic in competitive PCR. Nucleic Acids Res. 26, 3340– 3347. Miller, G.A., 1996. Method for nucleotide sequence amplification, United States Patent 5,545,539. Newton, C.R., Graham, A., 1994. PCR. Bios Scientific, Oxford. Pomp, D., Madrano, J.F., 1991. Organic solvents as facilitators of polymerase chain reaction. Biotechniques 10, 58–59. Roux, K.H., 1995. Optimization and troubleshooting in PCR. In: Dieffenbach, C.W., Dveksler, G.S. (Eds.), PCR Primer – A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 55– 66. Smith, T.K., Long, C.M., Bowman, B., Manos, M.M., 1990. Using cosolvents to enhance PCR amplification. Amplifications 5, 16–17. Varadaraj, K., Skinner, D.M., 1994. Denaturants or cosolvents improve the specificity of PCR amplification of a G 1 C rich DNA using genetically engineered DNA polymerases. Gene 140, 1–5. Weast, R.C. (Ed.), 1970. CRC Handbook of Chemistry and Physics The Chemical Rubber Company, Cleveland, OH, p. E70. Weissensteiner, T., Lanchbury, J.S., 1996. Strategy for controlling preferential amplification and avoiding false negatives in PCR typing reactions. Biotechniques 21, 1102–1108. Winship, P.R., 1989. An improved method for directly sequencing PCR amplified material using dimethylsulfoxide. Nucleic Acids Res. 17, 1266.