The expression of several pepper fatty acid desaturase genes is robustly activated in an incompatible pepper-tobamovirus interaction, but only weakly in a compatible interaction

Plant Physiology and Biochemistry 148 (2020) 347–358

Contents lists available at ScienceDirect

Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy

Research article

The expression of several pepper fatty acid desaturase genes is robustly activated in an incompatible pepper-tobamovirus interaction, but only weakly in a compatible interaction

T

Eszter Balogh, Csilla Juhász, Tamás Dankó, József Fodor, István Tóbiás, Gábor Gullner∗ Plant Protection Institute, Centre for Agricultural Research, Hungarian Academy of Sciences, 1022, Budapest, Herman Ottó út 15, Hungary

ARTICLE INFO

ABSTRACT

Keywords: Endoplasmic reticulum Fatty acid desaturase Hydrogen peroxide Linoleic acid Pepper Tobamovirus

The replication of positive strand RNA viruses in plant cells is markedly influenced by the desaturation status of fatty acid chains in lipids of intracellular plant membranes. At present, little is known about the role of lipid desaturation in the replication of tobamoviruses. Therefore, we investigated the expression of fatty acid desaturase (FAD) genes and the fatty acid composition of pepper leaves inoculated with two different tobamoviruses. Obuda pepper virus (ObPV) inoculation induced a hypersensitive reaction (incompatible interaction) while Pepper mild mottle virus (PMMoV) inoculation caused a systemic infection (compatible interaction). Changes in the expression of 16 FADs were monitored in pepper leaves following ObPV and PMMoV inoculations. ObPV inoculation rapidly and markedly upregulated seven Δ12-FADs that encode enzymes putatively located in the endoplasmic reticulum membrane. In contrast, PMMoV inoculation resulted in a weaker but rapid upregulation of two Δ12-FADs and a Δ15-FAD. The expression of genes encoding plastidial FADs was not influenced neither by ObPV nor by PMMoV. In accordance with gene expression results, a significant accumulation of linoleic acid was observed by gas chromatography-mass spectrometry in ObPV-, but not in PMMoV-inoculated leaves. ObPV inoculation led to a marked accumulation of H2O2 in the inoculated leaves. Therefore, the effect of H2O2 treatments on the expression of six tobamovirus-inducible FADs was also studied. The expression of these FADs was upregulated to different degrees by H2O2 that correlated with ObPV-inducibility of these FADs. These results underline the importance of further studies on the role of pepper FADs in pepper-tobamovirus interactions.

1. Introduction Infection of plants with positive-strand RNA viruses induces substantial alterations in the structure of intracellular membranes. Upon infection, these viruses stimulate lipid biosynthesis in host cells. The membrane lipid bilayer of specific organelles expands and pocket-like membrane structures (spherules) or double membrane vesicles are formed (Schwartz et al., 2004; Paul and Bartenschlager, 2013; Zhang et al., 2019). Virus replication occurs in these newly formed compartments by RNA replication complexes, which are bound to intracellular plant membranes. The specific organelle membranes upon which the viral replication complexes are formed vary from virus to virus (Ahlquist et al., 2003; Ishibashi et al., 2012). Membrane spherules or vesicles serve as protected viral replication compartments, where replication can go undetected by plant defense mechanisms. Doublestranded viral RNA intermediates formed during virus replication could otherwise be detected by the antiviral RNA silencing machinery of host

∗

plants (Stapleford and Miller, 2010; Chukkapalli et al., 2012). Importantly, the lipid composition of plant membranes substantially influences the rate of virus replication. Among other parameters, changes in the desaturation status of fatty acids can strongly modify virus multiplication (Lee et al., 2001; Ahlquist et al., 2003). Desaturation, i.e. the formation of double bonds at specific positions in the carbon chain of fatty acids is catalyzed by fatty acid desaturase (FAD) enzymes by using molecular oxygen. The oxygen molecule is activated by a di-iron cluster in the active site of FADs (Shanklin and Cahoon, 1998). In FAD protein sequences several histidine-rich motifs were identified that participate in iron binding (Okuley et al., 1994; Shanklin et al., 1994). FADs are encoded by large gene families in higher plants. In the genomes of soybean, cucumber and Medicago truncatula 29, 23 and 20 FAD genes were identified, respectively (Chi et al., 2011; Dong et al., 2016; Zhang et al., 2018). FAD enzymes play indispensable roles during the biosynthesis of unsaturated fatty acids in plants, which occurs in a three-step desaturation pathway. The

Corresponding author. E-mail address: [email protected] (G. Gullner).

https://doi.org/10.1016/j.plaphy.2020.01.023 Received 8 November 2019; Received in revised form 18 December 2019; Accepted 16 January 2020 Available online 20 January 2020 0981-9428/ © 2020 Elsevier Masson SAS. All rights reserved.

Plant Physiology and Biochemistry 148 (2020) 347–358

E. Balogh, et al.

Abbreviations BPMV BMV CMV DAB ER FAD FAME GC-MS hpi hrs

LOX mins ObPV PMMoV PUFA r.t. SA SAD TCV TMV TRV UBI

Bean pod mottle virus Brome mosaic virus Cucumber mosaic virus 3,3′-diaminobenzidine endoplasmic reticulum fatty acid desaturase fatty acid methyl ester gas chromatography-mass spectrometry hours post-inoculation hours

conversion of saturated fatty acids to mono-unsaturated fatty acids is catalyzed by soluble stearoyl-acyl-carrier-protein-desaturases (SADs) (Kachroo et al., 2007) or membrane-bound acyl-coenzyme A desaturases (Smith et al., 2013). The two subsequent desaturation steps take place in both the endoplasmic reticulum (ER) membrane and the chloroplast membrane by membrane-bound FADs (Ohlrogge and Browse, 1995). In the ER membrane of Arabidopsis thaliana, FAD2 introduces the second double bond into both 16:1 and 18:1 fatty acids while FAD3 catalyzes the formation of the third double bond (Okuley et al., 1994; Lou et al., 2014; Dar et al., 2017). Similarly, in the chloroplast membranes FAD6 catalyzes the formation of the second double bond in the carbon chain of fatty acids, while FAD7 and FAD8 introduce the third one (Román et al., 2015). The products of FAD-catalyzed reactions, the unsaturated fatty acids can serve as substrate for lipoxygenase (LOX) enzymes. LOXs catalyze the peroxidation of polyunsaturated fatty acids (PUFAs) to fatty acid hydroperoxides by using molecular oxygen. The fatty acid hydroperoxides are further converted by downstream enzymatic reactions to a wide variety of biologically active compounds. These fatty acid-derived metabolites are collectively called oxylipins, the most well known of which are jasmonic acid, hydroxy-fatty acids, divinyl ethers, and volatile C6 fragments (Mosblech et al., 2009). Oxylipins play important roles in various plant-pathogen interactions. Many oxylipins show direct antimicrobial effects, while others can stimulate defense gene expression, or participate in the regulation of plant cell death (Prost et al., 2005; Vicente et al., 2012). Limited information is available about the role of FADs in plant–virus interactions. Brome mosaic virus (BMV), a positive-strand RNA virus, replicates its RNA in ER-associated complexes in plant cells. The replication of BMV was severely inhibited in model yeast cells by a mutation in OLE1, an essential yeast chromosomal gene encoding a Δ9FAD, which is an integral ER membrane protein. These results showed that viral RNA synthesis is highly sensitive to lipid composition and particularly to the level of PUFAs (Lee et al., 2001). In A. thaliana, the mutation of the SSI2 gene encoding a plastid-localized SAD resulted in reduced oleic acid (18:1) level and conferred enhanced resistance to Cucumber mosaic virus (CMV). Compared with the wild-type plant, both viral multiplication and systemic spread were diminished in the ssi2 mutant (Sekine et al., 2004). The mutation in SSI2 increased also the transcript levels of the HRT resistance gene in A. thaliana, which conferred increased resistance to Turnip crinkle virus (TCV) (ChandraShekara et al., 2007). In transgenic tobacco plants constitutively expressing the antisense RNA of a plastidial Δ15-FAD gene (fad7) showed markedly reduced trienoic fatty acid levels and enhanced susceptibility against Tobacco mosaic virus (TMV) (Im et al., 2004). A Δ12-FAD gene was markedly induced in resistant pepper leaves 36 h following TMV-P0 inoculation. Silencing of this gene led to significantly elevated virus content, decreased lesion numbers and to the down-regulation of several pathogenesis-related (PR) genes (Kim et al., 2007). Increased FAD2 expression and repression of chloroplastic FAD5, FAD6 and FAD8 were observed during the compatible interaction between A. thaliana and

lipoxygenase minutes Obuda pepper virus Pepper mild mottle virus polyunsaturated fatty acid retention time salicylic acid stearoyl-acyl-carrier-protein-desaturases Turnip crinkle virus Tobacco mosaic virus Tobacco rattle virus ubiquitin-conjugating protein

Tobacco rattle virus (TRV). TRV levels were significantly lower in fad2 mutants as compared to wild-type plants indicating that the upregulation of FAD2 expression was related to a higher TRV susceptibility (Fernández-Calvino et al., 2014). During our earlier investigations we studied the possible role of FAD and LOX genes in the defense reactions of tobamovirus-inoculated pepper plants harboring an L3 resistance gene (Gullner et al., 2010; Juhász et al., 2015). Two different tobamoviruses were used. Inoculation of pepper leaves with Obuda pepper virus (ObPV) resulted in the induction of hypersensitive response mediated by the L3 resistance gene (incompatible interaction), while Pepper mild mottle virus (PMMoV) can systemically infect plants causing only very mild chlorotic symptoms (compatible interaction) (Tóbiás et al., 1989; Rys et al., 2014). We explored the massive upregulation of multiple 9-LOX genes, a divinyl ether synthase and a Δ12-FAD gene in ObPV-inoculated pepper leaves (Gullner et al., 2010; Juhász et al., 2015). In our further studies, declining chlorophyll a content and photosynthetic activity were observed in ObPV-inoculated leaves while electrolyte leakage and heat emission markedly increased (Rys et al., 2014). In addition, ObPV inoculation induced a strong accumulation of multiple defense hormones (Dziurka et al., 2016) as well as that of glucose, fructose and glucose-6-phosphate (Janeczko et al., 2018). PMMoV inoculations exerted much less influence on these biochemical parameters in pepper leaves than ObPV. In the present study we have further investigated the same pepper–virus pathosystems. To obtain a deeper knowledge about the role of FADs in tobamovirus replication and in antiviral resistance mechanisms, we have investigated the expression of 16 FAD genes in ObPV- and PMMoV-inoculated pepper leaves during an early phase of plant–tobamovirus interactions. In connection with FADs, we also analyzed the changes of fatty acid composition in virus-inoculated pepper leaves by gas chromatography with mass spectrometric detection (GC-MS). Finally, we investigated the accumulation of hydrogen peroxide in the tobamovirus-inoculated pepper leaves as well as the effects of exogenous hydrogen peroxide treatments on the expression of tobamovirus-inducible pepper FADs. 2. Materials and methods 2.1. Pepper variety, virus inoculations and H2O2 treatments The pepper (Capsicum annuum L.) cultivar TL 1791 harboring the L3 resistance gene was used for all experiments. Pepper plants were grown under normal greenhouse conditions (18–23 °C; 16 h daylight with 160 μmol m−2 s−1 supplemental light for 8 h per day; 75–80% relative humidity) and 55–60-day-old plants were used for the experiments. ObPV and PMMoV inoculations as well as mock-treatments were carried out as described earlier (Rys et al., 2014). The ObPV strain was isolated in Hungary (formerly used synonym: Ob strain of Tomato mosaic virus), whereas the L3-resistance-breaking strain of PMMoV was isolated in Louisiana, USA (formerly used synonym: Samsun latent strain of Tobacco mosaic virus) (Tóbiás et al., 1989; Rys et al., 2014). 348

Plant Physiology and Biochemistry 148 (2020) 347–358

E. Balogh, et al.

Table 1 Thirty-three pepper fatty acid desaturase (FAD) genes listed according to their sequential order on the 12 pepper chromosomes. Name

NCBI gene identifier

Nucleotide NCBI accession

Chromosome

Predicted function and localization

Literature

FAD1*

LOC107873633

1

Δ12-FAD, ER

Dar et al. (2017)

FAD2 FAD3 FAD4 FAD5 FAD6 FAD7 FAD8 FAD9*

LOC107855354 LOC107861959 LOC107863583 LOC107864646 LOC107867549 LOC107873041 LOC107873188 LOC107873310

1 3 3 3 4 6 6 6

SAD, cytosolic Δ7-FAD**, chl SAD, chl Δ6-desaturase, ER Δ6-desaturase, ER SAD, chl SAD, chl Δ15-FAD, chl

Kachroo et al. (2007) Heilmann et al. (2004) Kachroo et al. (2007) Sayanova et al. (1997) Sayanova et al. (1997) Kachroo et al. (2007) Kachroo et al. (2007) Kwon et al. (2000)

FAD10 FAD11*

LOC107873419 LOC107873420

6 6

Δ15-FAD, ER Δ15-FAD, ER

Wang et al. (2014) Wang et al. (2014)

FAD12 FAD13 FAD14 FAD15 FAD16 FAD17 FAD18*

LOC107877621 LOC107856304 LOC107843168 LOC107845637 LOC107845631 LOC107843501 LOC107851685

7 7 9 10 10 10 12

Δ12-FAD, chl Δ3-FAD, chl*** Δ12-FAD, ER Δ8-FAD, ER Δ8-FAD, ER Δ8-FAD, ER Δ12-FAD, ER

Zhang et al. (2009) Gao et al. (2009) Dar et al. (2017) García-Maroto et al. (2007) García-Maroto et al. (2007) García-Maroto et al. (2007) Dar et al. (2017)

FAD19a FAD19b*,1

LOC107851215 LOC107851251

12 12

Δ12-FAD, ER Δ12-FAD, ER

Kim et al. (2007) Kim et al. (2007)

FAD19c1 FAD19d1 FAD19e1 FAD20 FAD21 FAD22 FAD23 FAD24a FAD24b2 FAD25a*

LOC107851294 LOC107851256 LOC107850481 LOC107851473 LOC107851434 LOC107849596 LOC107849612 LOC107851810 LOC107851871 LOC107851421

12 12 12 12 12 12 12 12 12 12

Δ12-FAD, Δ12-FAD, Δ12-FAD, Δ12-FAD, Δ12-FAD, Δ12-FAD, Δ12-FAD, Δ12-FAD, Δ12-FAD, Δ12-FAD,

Kim et al. (2007) Kim et al. (2007) Kim et al. (2007) Dar et al. (2017) Dar et al. (2017) Dar et al. (2017) Dar et al. (2017) Dar et al. (2017) Dar et al. (2017) Dar et al. (2017)

FAD25b3 FAD26 FAD27

LOC107851811 LOC107851744 LOC107850471

XM_016720559 XM_016720568 XM_016700360 XM_016707378 XM_016709572 XM_016711074 XM_016713839 XM_016719747 XM_016719938 NM_001325029 XM_016720107 XM_016720263 XM_016720264 XM_016720265 XM_016724316 XM_016701288 XM_016687367 XM_016690068 XM_016690062 XM_016687806 XM_016696767 XM_016696768 XM_016696154 NM_001324688 XM_016696201 XM_016696252 XM_016696205 XM_016695018 XM_016696508 XM_016696442 XM_016694154 XM_016694168 XM_016696908 XM_016696968 XM_016696421 XM_016696422 XM_016696423 XM_016696424 XM_016696909 XM_016696828 XM_016695010

12 12 12

Δ12-FAD, ER Δ12-FAD, ER SAD, chl

ER ER ER ER ER ER ER ER ER ER

Dar et al. (2017) Dar et al. (2017) Kachroo et al. (2007)

Underlined nucleotide GenBank accession numbers indicate that these sequences were used to the design of gene-specific PCR primer pairs. Abbreviations: chl: chloroplastic; ER: endoplasmic reticulum; SAD: stearoyl-acyl-carrier-protein-9-desaturase. Remarks: *these genes express multiple transcript variants; **palmitoyl-monogalactosyl-diacylglycerol delta-7-desaturase (AtFAD5-like); ***AtFAD-4-like; 1nearly identical nucleotide sequences to FAD19a; 2almost identical nucleotide sequence to FAD24a (99.9%); 3partial nucleotide sequence closely identical to FAD25a.

Virus-inoculated, mock-treated and untreated plants were kept at 22 °C in a growth chamber with 16/8 h light/dark cycles. Leaf samples were taken from ObPV- and PMMoV-inoculated as well as mock-treated and untreated leaves at various time periods for total RNA extraction and fatty acid analysis. For all analyses samples were taken from the virusinfected third and fourth true leaves of three plants together with samples taken from corresponding mock-treated and untreated leaves. Samples were pooled for each treatment, frozen in liquid nitrogen and stored at −70 °C until use. In further experiments, leaf discs (diameter: 15 mm) were cut from middle leaves of two-month-old pepper plants and ten discs were floated on the surface of distilled water or 10, 20 and 50 mM hydrogen peroxide solutions in Petri dishes according to Wi et al. (2010). Leaf discs were incubated in a growth chamber at 22 °C under constant illumination (150 μE m−2 s−1). After different time periods samples were taken for total RNA extraction.

untreated pepper leaves ground in liquid nitrogen with the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). Reverse transcription (RT) of 1.5 μg total RNA was carried out in a total volume of 20 μl with a RevertAid H Minus First Strand cDNA Synthesis kit (Thermo Fisher, Waltham, MA, USA) using an oligo(dT)18 primer. Semiquantitative PCR assays were conducted with a T100 Thermal Cycler (Bio-Rad, Hercules, CA, USA). The PCR reaction mixtures contained 2 μl of 10 × DreamTaq Green buffer, 2 mM MgCl2, 0.2 mM of each dNTP, 0.2 μM of each primer, 0.5 U of DreamTaq Green DNA polymerase (Thermo Fisher, Waltham, MA, USA) and 1 μl of template cDNA in a total volume of 20 μl. All oligonucleotide primer pairs used in our studies are shown in Table 2. The PCR amplifications started with 3 min denaturation at 94 °C, followed by 25–28 cycles of 30 s at 94 °C, 30 s at specific annealing temperatures (see Table 2 for each primer pair), 30 s at 72 °C and terminated by 10 min extension at 72 °C. Expression of a pepper gene encoding an ubiquitin-conjugating protein (UBI-3) served as constitutive control (Table 2) (Wan et al., 2011). The amplified PCR products were separated by gel electrophoresis in 1.5% agarose gels and visualized by GelRed nucleic acid gel stain (Biotium Inc., Hayward, CA, USA). Specificity of the amplicons was further verified by sequencing. PCR products were extracted from agarose gels by GeneJet Gen Extraction Kit (Thermo Fisher, Waltham, MA, USA) and sequenced by

2.2. RNA extraction and gene expression analysis by RT-PCR To analyze the expression of pepper FAD genes a reverse transcription - polymerase chain reaction (RT-PCR) procedure was applied. Total RNA was extracted from 0.1 g virus-inoculated, mock-treated and 349

Plant Physiology and Biochemistry 148 (2020) 347–358

E. Balogh, et al.

Table 2 Sequences of gene specific primer pairs in 5′ to 3′ direction used for the detection of 16 pepper fatty acid desaturase (FAD) genes and the UBI-3 reference gene (GeneBank AY486137). GeneBank accession numbers of FAD genes used for the primer design are shown underlined in Table 1. Target gene

Forward primer

Reverse primer

Product length (bp)

Annealing temperature (°C)

FAD1 FAD3 FAD8 FAD9 FAD10 FAD11 FAD12 FAD14 FAD17 FAD18 FAD19 FAD20 FAD21 FAD24 FAD25 FAD26 UBI-3

gcaaaggcattttctggtaca tggtggcaacttgacatgact tgccaccaagaatcagg gaagtcagggcctctaccat tcttttccctcagataccaca tcagtaaagacaatccggtgc ggcttcatggaactggcgtct ccaaagctgtcaagccattac attttgctgtgtggatatggg gagcattctggagggagtcg gagggatacgaaggagtg aggcaactatagcaatcaagc caatggaggcaactaaagcta gctaccgaagctatcaagcc actaggagaatactaccaat aggaggcaaccaaagctat tgtccatctgctctctgttg

aaaaggaggtagaggatgcac cccgtgtgtgctcaatgtagt tcccacaaaggaacaataaca gggggagctgactcacttgtg atttgtcaagcgactactcat ttgcgcgggtattatacta ttgcatttgggcctcgac ttaggcttaacatttaaccaa cttgttagggagcgtgcttc ccccaagtgtctttgtaagat gatggacataacgatac cggaagaattcgacacgtacc aaaacattttgccaattccta caatgactcgcgttgaaca tctaaacaaggtgtaatcaac tttaggttgaacatttaccca caccccaagcacaataagac

210 208 231 248 249 190 253 211 210 255 196 248 215 219 235 220 204

60 63 60 54 60 55 60 57 60 60 55 60 60 57 55 60 60

the mixture was shaken vigorously. The upper organic phase was collected and washed with 5 ml of 2% KHCO3 solution with vigorous shaking. The organic phase was recovered, dried on 100 mg anhydrous Na2SO4 and stored at −70 °C in teflon-lined screw-capped glass vials until GC-MS analysis.

Macrogen Europe (Amsterdam, The Netherlands). The replication of ObPV and PMMoV was characterized by measuring the abundance of RNAs encoding their viral coat-proteins by semiquantitative RT-PCR as described earlier (Juhász et al., 2015). 2.3. Detection of FAD gene expression by quantitative real-time RT-qPCR

2.5. Analysis of fatty acid methyl esters by gas chromatography and mass spectrometry

Quantitative real-time RT-PCR (qPCR) assays were conducted with the same cDNA samples mentioned above by using a qPCRBIO SyGreen Blue Mix Separate-Rox kit (PCR Biosystems, London, UK). Reaction mixtures contained 7.5 μl SyGreen Blue Mix, 0.25 μM of each primer (see Tables 2) and 1 μl of 10-fold diluted cDNA template in a final volume of 15 μl. For the thermal amplification a CFX 96 Touch™ RealTime PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA) was used. Cycling parameters were: initial denaturation at 95 °C for 3 min, then 40 cycles of 95 °C for 10 s, 30 s at specific annealing temperatures (see Table 2 for each primer pair), and 72 °C for 30 s, followed by a cDNA dissociation program from 65 to 95 °C to create melting curves. Serial dilutions of the pooled cDNA samples were used to generate standard curves to obtain the amplification efficiencies of PCR reactions. Our preliminary evaluation indicated that expression of UBI-3 displays little variation across all samples tested, which is in line with previous results of other studies (Wan et al., 2011). Since all PCR amplification efficiencies were near 100%, changes in transcript abundance were calculated by the method of Livak and Schmittgen (2001) with UBI-3 as reference gene (Table 2).

FAMEs were analyzed by a Hewlett Packard GC 6890 gas chromatograph equipped with a VF-WAXms column (Agilent CP9207, 60 m × 0.25 mm internal diameter × 0.25 μm film thickness, Agilent Technologies, Santa Clara, CA, USA) and coupled to a HP MSD 5973 mass selective detector. An aliquot of 1 μl from each sample was injected in the splitless mode. Helium was used as a carrier gas at a flow rate of 1 ml/min. The GC oven program started at 50 °C for 1 min, followed by a continuous ramp to 240 °C (10 °C/min) that was held for 10 min. All data were recorded and edited with MSD ChemStation software D.01.02.16 (Agilent Technologies, Santa Clara, CA, USA). Chromatogram peaks were identified by comparing retention times with those of authentic FAME standards (Supelco 37 Component FAME Mix, Sigma, St. Louis, MO, USA) and by mass spectral data. The FAME standards 7,10-hexadecadienoic acid methyl ester and 7,10,13-hexadecatrienoic acid methyl ester were purchased from Larodan AB (Solna, Sweden). Quantification was performed by the internal standard method using methyl tetradecanoate (myristic acid methyl ester, 14:0-OMe, retention time 18.77 min) and by calibration curves with authentic FAME standards.

2.4. Extraction and derivatization of fatty acids from pepper leaves The lipid extraction procedure described by Weichert et al. (1999) was used with modifications. Leaf samples (0.2 g) from ObPV and PMMoV-inoculated or mock-treated pepper leaves were frozen in liquid nitrogen and immediately homogenized in 5 ml 3:2 v/v mixture of isohexane - isopropanol containing 0.0025% butylated hydroxytoluene as antioxidant and 0.5 mg myristic acid (14:0) as internal standard. The suspensions were shaken for 10 min and centrifuged at 5000 g for 10 min at 4 °C. The supernatant was collected, and the pellet was reextracted with 5 ml extraction medium. The two organic supernatants were combined and extracted twice with 5 ml of 6.7% (w/v) potassium sulfate solution with vigorous shaking. The organic phase was subsequently dried under a nitrogen stream. The dry residues were resuspended in 3 ml of 3 M HCl in methanol (Supelco, 33050-U) to prepare the methyl ester derivatives of fatty acids (FAMEs) (Christie, 1993). The suspensions were incubated in a 75 °C water bath for 45 min. Five ml 5% NaCl solution and 2 ml n-hexane were added and

2.6. Detection of hydrogen peroxide in pepper leaves A histochemical staining method with 3,3′-diaminobenzidine (DAB) was used for the in situ detection of hydrogen peroxide in ObPV- and PMMoV-inoculated as well as in mock-treated pepper leaves according to Thordal-Christensen et al. (1997). A 0.1% solution of 3,3′-diaminobenzidine tetrahydrochloride hydrate was vacuum-infiltrated into detached leaves, which were incubated for 3 h in water in Petri dishes. The stained leaves were decolorized overnight with a 5:1 mixture of ethanol-chloroform containing 0.15% trichloroacetic acid. The decolorization was repeated with a fresh solvent mixture then the leaves were stored in 50% glycerol. DAB staining was evaluated visually. Furthermore, DAB stained pepper leaves were mounted on microscope glass slides in 50% glycerol and examined with a Zeiss Axioskop 2 plus light microscope coupled to a digital camera. 350

Plant Physiology and Biochemistry 148 (2020) 347–358

E. Balogh, et al.

comparisons were performed using ClustalW and Muscle algorithms (http://www.ebi.ac.uk/Tools/msa). Phylogenetic analyses were carried out with a neighbor-joining clustering method by the online EMBL-EBI Simple Phylogeny tool (https://www.ebi.ac.uk/Tools/phylogeny/ simple_phylogeny). Phylogenetic trees were visualized by MEGA6 software. The transmembrane domains of FAD proteins were predicted by the online TMHMM Server v. 2.0 (http://www.cbs.dtu.dk/services/ TMHMM/), while their subcellular localization was predicted by the DeepLoc-1.0 software (http://www.cbs.dtu.dk/services/DeepLoc/). 2.8. Statistical analysis Three independent biological experiments were carried out. Numerical data represent the mean of three experiments ± standard error. Constant variance and normal distribution of data were verified prior to statistical analysis and the results were analyzed with Statistica 13.3 (TIBCO Software Inc.). Significant differences between mean values were determined by the Student's t-test in a pairwise manner. 3. Results 3.1. Classification of pepper FAD genes

Fig. 1. Dendrogram of 33 pepper fatty acid desaturase (FAD) protein sequences retrieved from NCBI and KEGG databases. The NCBI accession numbers of FADs are shown in Table 1. The predicted intracellular localization of FADs is highlighted by different colors: blue, cytosolic; green, chloroplastic; purple: endoplasmic reticulum membrane. Underlined FAD names indicate that the expression of their coding genes was analyzed in Obuda pepper virus (ObPV) and Pepper mild mottle virus (PMMoV)-infected pepper leaves. Symbols: * and ** indicate those FADs, whose gene expression levels were significantly induced by ObPV or PMMoV, respectively. Abbreviations: ER, endoplasmic reticulum; SADs, stearoyl-acyl-carrier protein-desaturases. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

By a bioinformatic search in the NCBI GenBank and RefSeq databases as well as in the KEGG database we retrieved 33 pepper FAD genes, which are presented in Table 1. The encoded FAD proteins can be classified as membrane bound acyl-lipid-desaturases (ER-localized or plastidic) and soluble SADs. One incomplete, partial FAD sequence was also found (FAD25b, see Table 1). The sequences of four FADs (FAD19b, FAD19c, FAD19d, FAD19e) were nearly identical to FAD19a, while FAD24b and FAD25b were almost identical to FAD24a and FAD25a, respectively (Table 1). We prepared the dendrogram of 33 FAD proteins that displayed the typical FAD classes (Fig. 1). Intriguingly, an unusually large clade of Δ12-FADs (Arabidopsis FAD2-like proteins) appeared in the dendrogram, comprising 17 proteins (Fig. 1). A further interesting observation was that the majority of the coding genes of these Δ12-FADs proteins resides on chromosome 12 (15 genes, see Table 1). The second largest clade in the FAD dendrogram comprised 5 SAD proteins. Furthermore, three Δ8-FADs, three Δ15-FADs, two Δ6FADs (also known as front-end desaturases or acyl-lipid-9-3-desaturases), a Δ3-FAD, a Δ7-FAD and a chloroplastic Δ12-FAD were also identified in the dendrogram (Fig. 1).

2.7. Bioinformatics Pepper FAD nucleotide and corresponding protein sequences were retrieved from the GenBank and RefSeq databases of the National Center for Biotechnology Information (NCBI) (https://www.ncbi.nlm. nih.gov) as well as from the KEGG database (https://www.genome.jp/ kegg-bin/show_organism?org=cann) by using 'desaturase' as keyword and by subsequent protein BLAST searches. Sequence alignments and

Fig. 2. Effects of Obuda pepper virus (ObPV) and Pepper mild mottle virus (PMMoV) inoculations on the expression of pepper FAD genes at varying time points following inoculation as detected by RT-PCR. The coding gene of ubiquitin-conjugating protein 3 (UBI-3) was used as control. NCBI accession numbers are shown in Table 1 and the specific primer pairs are shown in Table 2. Representative results of three independent experiments are shown.

351

Plant Physiology and Biochemistry 148 (2020) 347–358

E. Balogh, et al.

Fig. 3. Relative expression of six FAD genes in pepper leaves following inoculation with Obuda pepper virus (ObPV) or Pepper mild mottle virus (PMMoV) or after mock-treatment as determined by real-time RT-qPCR with gene-specific primer pairs. Expression values of FADs were normalized to those of the UBI-3 reference gene and then related to untreated leaf samples at each time point according to the method of Livak and Schmittgen (2001). NCBI accession numbers are shown in Table 1 and the specific primer pairs are shown in Table 2. Open, black and gray columns represent mock-treated, ObPV- and PMMoV-inoculated leaves, respectively. Mean values of three independent experiments are shown ± SD. The symbols *, ** and *** show significant differences between mock-treated and virusinoculated plants at P < 5%, < 1% and < 0.1%, respectively.

The bioinformatic prediction of subcellular localization of FAD proteins revealed that all 17 Δ12-FADs belonging to the largest clade in Fig. 1 are putatively located in the ER membrane. Similarly, two Δ15FADs (FAD10 and FAD11) as well as all Δ6- and Δ8-desaturases are presumably localized to the ER (Table 1, Fig. 1). Eight enzymes (FAD3, FAD4, FAD7, FAD8, FAD9, FAD12, FAD13 and FAD27) were predicted to be chloroplastic, while FAD2 may be cytosolic (Table 1, Fig. 1). A search for transmembrane domains revealed that the majority of FADs (28 proteins) are membrane bound enzymes and the five SADs were predicted to be soluble enzymes.

ObPV (Suppl. Fig. 1), which confirmed our earlier observations (Tóbiás et al., 1989; Juhász et al., 2015). We already reported the massive upregulation of a Δ12-FAD gene (FAD19 in Table 1) following ObPVinoculation (Juhász et al., 2015). In the present study, we designed gene-specific PCR primer pairs for 16 FADs representing various FAD classes (Table 2) and monitored the changes of their expression levels by RT-PCR in pepper leaves following ObPV- and PMMoV-inoculations as well as mock treatments. The expression of six further Δ12-FADs (FAD14, FAD18, FAD20, FAD21, FAD25, FAD26) was upregulated in ObPV-inoculated pepper leaves at 24 and 48 h post-inoculation (hpi) (Fig. 2). The activation was particularly robust in the case of FAD20, FAD21 and FAD25 (Fig. 2). All ObPV-activated genes encode putatively ER-localized, membrane-bound Δ12-FAD enzymes. PMMoV inoculation also increased the transcript abundance of FAD18 at 24 hpi and an ERlocalized Δ15-FAD (FAD10) as early as 4 hpi (Fig. 2). The expression of the remaining FADs was not affected neither by ObPV nor by PMMoV inoculation (data not shown). The amplified PCR products were sequenced and their sequences were identical to the expected ones.

3.2. Expression of FADs in tobamovirus-inoculated pepper leaves As shown earlier (Rys et al., 2014; Dziurka et al., 2016), ObPV inoculation resulted in the appearance of visible necrotic lesions at 3 days following inoculation, while PMMoV caused only very mild chlorotic symptoms or no visible symptoms at all. Nevertheless, PMMoV replicated much more efficiently in the inoculated pepper leaves than 352

Plant Physiology and Biochemistry 148 (2020) 347–358

E. Balogh, et al.

area), followed by 16:0-OMe (7–10%), 18:2-OMe (4–7%), 16:3-OMe (3–5%) and 18:0-OMe (3–5%) (Fig. 4). Next we investigated the changes in the contents of eight fatty acids following ObPV- and PMMoV-inoculations as well as mock-treatments. FAME levels in pepper leaves were analyzed quantitatively with GC-MS by using calibration curves with authentic FAME standards. ObPV inoculation led to a slight (1.4-fold) but significant rise of linoleic acid (18:2) content in pepper leaves at 72 hpi, but at 96 hpi the 18:2 level already declined and did not differ significantly from mock-treated control (Fig. 5). ObPV inoculation resulted also in an increased content of palmitic acid (16:0) at 72 and 96 hpi but this effect was statistically not significant. PMMoV inoculation did not exert any effect on linoleic acid or palmitic acid contents. The levels of all other fatty acids did not change significantly following neither ObPV- nor PMMoV-inoculation (Fig. 5). Fig. 4. Gas-chromatography-mass spectrometry (GC-MS) total ion chromatogram (TIC) of fatty acid methyl esters (FAMEs) from untreated pepper leaves. Identified peaks: 14:0, the internal standard tetradecanoic acid methyl ester (14:0-OMe, retention time: 18.83 min); 16:0, hexadecanoic acid methyl ester (16:0-OMe, r.t. 20.86 min); 16:1, hexadecenoic acid methyl ester (16:1-OMe, r.t. 21.38 min); 16:2, 7,10-hexadecadienoic acid methyl ester (16:2-OMe, r.t. 21.61 min); 16:3, 7,10,13-hexadecatrienoic acid methyl ester (16:3-OMe, r.t. 22.30 min); 18:0, octadecanoic acid methyl ester (18:0-OMe, r.t. 23.15 min); 18:1, 9-octadecenoic acid methyl ester (18:1-OMe, r.t. 23.40 min); 18:2, 9,12octadecadienoic acid methyl ester (18:2-OMe, r.t. 24.16 min) and 18:3, 9,12,15-octadecatrienoic acid methyl ester (18:3-OMe, r.t. 25.17 min).

3.4. Hydrogen peroxide production in tobamovirus-inoculated pepper leaves In plant cells the soluble DAB polymerizes in the presence of H2O2 producing an insoluble reddish-brown substance (Thordal-Christensen et al., 1997). We assessed the intensity and pattern of DAB staining both visually (Fig. 6) and by a light microscope (Suppl. Fig. 2). We observed a weak brownish staining showing the accumulation of H2O2 in ObPVinoculated pepper leaves as soon as 24 hpi. DAB staining was observed at discrete spots on the leaves (Fig. 6). The intensity of the brownish staining gradually increased at 48 and 72 hpi (Fig. 6, Suppl. Fig. 2). Distinct brown rings around the emerging lesions were also observed at these time points (Suppl. Fig. 2), which shows a marked accumulation of H2O2 around the sites of necrosis formation. In contrast to ObPV, no H2O2 accumulation was detectable in PMMoV-inoculated or mocktreated leaves (Fig. 6, Suppl. Fig. 2).

To quantify the changes in the expression of ObPV- and PMMoVinducible FAD genes we examined the expression of FAD10, FAD19, FAD20, FAD21, FAD25, FAD26 also by real-time RT-qPCR. We omitted FAD14 and FAD18 from these investigations, because their expressions did not differ markedly between compatible and incompatible peppertobamovirus interactions (Fig. 2). Therefore we presume that FAD14 and FAD18 do not play a significant role in the antiviral resistance of pepper. Four Δ12-FADs were massively upregulated in the ObPV inoculated pepper leaves at 24 hpi. Their induction rates were 385-fold (FAD19), 109-fold (FAD20), 201-fold (FAD21) and 5.8-fold (FAD25) as compared to mock-treated leaves (Fig. 3). At 48 hpi the transcript abundance of these four FADs increased further and the expression of FAD26 (also a Δ12-FAD) was also markedly elevated (8.8-fold) as compared to the mock treatment (Fig. 3). PMMoV inoculation led to a significant induction of FAD10 (a Δ15-FAD) and FAD20 as early as 4 hpi (26- and 6.7-fold, respectively). At 8 hpi, only the expression of FAD10 was still significantly upregulated by PMMoV (4.8-fold) (Fig. 3). The expression of the reference gene UBI-3 was not modified significantly by ObPV- or PMMoV-inoculation (data not shown).

3.5. Induction of FADs by exogenous hydrogen peroxide Since we observed a significant accumulation of hydrogen peroxide in the ObPV-inoculated leaves, we examined the effects of exogenous H2O2 on the expression of six tobamovirus-inducible FAD genes. Leaf discs were floated on the surface of aqueous solutions of H2O2 and the expression of FADs was analyzed at 8 and 24 hrs after exposure to H2O2. Following 8 hrs treatments with different H2O2 concentrations the transcript abundance of FAD19, FAD20, FAD21 and FAD25 significantly increased in a H2O2 concentration-dependent manner, while the expression of FAD10 and FAD26 did not change. Treatments with 50 mM H2O2 for 8 hrs resulted in 28-, 20-, 12- and 3.3-fold increases in the transcript abundance of FAD19, FAD20, FAD21 and FAD25, respectively (Fig. 7). After 24 hrs of exposure to H2O2 the expressions of these FADs were still activated but generally to a lesser extent than after 8 hrs of exposure and the effect was not dependent on the H2O2 concentration. Furthermore, after 24 hrs of H2O2 treatments the expressions of FAD10 and FAD26 were also markedly upregulated, but these changes were not proportional to the H2O2 concentrations (Fig. 7). Interestingly, the inducibility of the six individual FAD genes by ObPV inoculations (i.e. their relative expression levels determined by RT-qPCR) strongly correlated with their inducibility by 8-hrs-long hydrogen peroxide treatments (Suppl. Fig. 3). Such correlations were not observed when the ObPV-inducibility of FADs were compared with their inducibility by 24hrs-long hydrogen peroxide treatments (data not shown).

3.3. Fatty acid composition of pepper leaves following virus inoculations To investigate whether the marked upregulation of FADs following ObPV or PMMoV inoculation results in any alteration in the fatty acid composition of pepper leaves, we prepared total lipid extracts from virus infected and mock-treated leaves at several time points following virus inoculations. We analyzed the fatty acid levels by an acid-catalyzed transmethylation method with methanol as methylating agent. This method measures both the free (unesterified) and lipid-bound forms of fatty acids together. Fatty acids were derivatized to FAMEs, which were analyzed by GC-MS. The following eight FAMEs were identified and quantified in untreated pepper leaves: hexadecanoic acid methyl ester (16:0-OMe), hexadecenoic acid methyl ester (16:1-OMe), 7,10-hexadecadienoic acid methyl ester (16:2-OMe), 7,10,13-hexadecatrienoic acid methyl ester (16:3-OMe), octadecanoic acid methyl ester (18:0-OMe), 9-octadecenoic acid methyl ester (18:1-OMe), 9,12octadecadienoic acid methyl ester (18:2-OMe) and 9,12,15-octadecatrienoic acid methyl ester (18:3-OMe) (Fig. 4). The predominant fatty acid component of pepper leaves was 18:3-OMe (17–19% of total peak

4. Discussion In our previous studies we observed the marked upregulation of a divinyl ether synthase and several LOX genes in ObPV-inoculated pepper leaves, which suggested that LOX-derived oxylipins participate in signaling processes during the activation of antiviral defense reactions (Gullner et al., 2010; Juhász et al., 2015). As FADs provide the substrates (16 and 18 carbon length PUFAs) for LOX enzymes, we set 353

Plant Physiology and Biochemistry 148 (2020) 347–358

E. Balogh, et al.

Fig. 5. Changes in the fatty acid composition of pepper leaves following ObPV- and PMMoV-inoculations or mock treatments. The methyl ester derivatives of fatty acids (FAMEs) were quantitatively analyzed by using GC-MS and with calibration curves of standard FAMEs. The list of analyzed FAMEs is shown in the caption of Fig. 4. Open circles, full circles and full triangles represent mock-treated, ObPV-inoculated and PMMoV-inoculated pepper leaves, respectively. Means of three independent parallel experiments are shown ± SD. The symbol * shows a significant difference between mock-treated and ObPV-inoculated plants at P < 5%.

out to investigate the regulation of various FAD genes during compatible and incompatible pepper-tobamovirus interactions. Until now only limited information has been reported about pepper FADs. A woundinducible gene (identical to FAD9 in Table 1) encoding a chloroplastic Δ15-FAD was cloned from pepper leaves (Kwon et al., 2000). Furthermore, a TMV-P0-inducible Δ12-FAD gene (FAD19 in Table 1) was identified in a microarray analysis (Kim et al., 2007). Recently, the expression of five FADs was monitored in bell peppers exposed to chilling injury (Ge et al., 2019). The pepper genome has been sequenced by three independent research teams (Kim et al., 2014; Qin et al., 2014; Hulse-Kemp et al., 2018) and the protein coding genes were annotated in the NCBI database (RefSeq assembly accession:

GCF_000710875). This allowed us to carry out a more comprehensive investigation of pepper FADs. First we conducted a bioinformatic search for FAD genes in NCBI GenBank, RefSeq and KEGG databases and we retrieved 33 pepper FADs (Table 1). We prepared the dendrogram of the corresponding 33 FAD proteins, which represented all major FAD classes. Intriguingly, the dendrogram contained a large cluster comprising 17 putatively ER-localized, membrane-bound Δ12-FADs (Fig. 1). Their amino acid sequences contain transmembrane domains and typical histidine-rich motifs (Okuley et al., 1994; Shanklin et al., 1994). The biological significance of this outstandingly large number of Δ12FADs is not known. The smaller FAD clusters comprised only 5, 3, 3 and 2 members of SADs, Δ15-FADs, Δ8- and Δ6-desaturases, respectively. 354

Plant Physiology and Biochemistry 148 (2020) 347–358

E. Balogh, et al.

rapid accumulation of FAD2 transcript was described in parsley cell cultures treated with a fungal elicitor (Kirsch et al., 1997). During some plant-virus interactions, the mutation or silencing of FAD genes decreased the virus replication rate. Thus, an ER-localized Δ12-FAD encoded by an Arabidopsis FAD2-like gene proved to be a negative regulator of virus resistance during the compatible interaction between A. thaliana and TRV. Accordingly, TRV levels were significantly lower in fad2 mutants as compared to wild-type plants (Fernández-Calvino et al., 2014). In contrast, the replication rate of the TMV-P0 strain was markedly higher in transgenic pepper plants, in which the expression of an ER-localized Δ12-FAD gene (identical to the strongly ObPV-inducible FAD19 in our studies) was silenced than in wild type plants. These results demonstrated that this FAD enzyme markedly contributes to antiviral resistance in pepper (Kim et al., 2007). Further functional studies are necessary to elucidate the role of ObPV-inducible pepper FADs to identify further positive regulators of tobamovirus resistance. PMMoV inoculation of pepper leaves resulted in the rapid upregulation of two Δ12-FADs (FAD18 and FAD20) and a Δ15-FAD (FAD10) (Figs. 2 and 3), all of which encode ER-localized enzymes. PMMoV could rapidly replicate in our pepper cultivar (compatible pepperPMMoV interaction) (Juhász et al., 2015), which suggests that the accumulation of FAD10, FAD18 and FAD20 probably does not contribute to virus resistance. In contrast to pepper FAD10, several Δ15-FADs were shown to enhance virus resistance in other plant-virus interactions. The silencing of a plastidial Δ15-FAD gene in tobacco increased the susceptibility against TMV (Im et al., 2004). Similarly, the silencing of three microsomal Δ15-FADs in soybean enhanced the accumulation of Bean pod mottle virus (BPMV), suggesting that these FADs are positive factors in virus resistance (Singh et al., 2011). The fatty acid composition of pepper tissues has already been investigated by several research groups. According to these earlier studies, the main fatty acid components of pepper leaves are α-linolenic acid (18:3) (39–55%), palmitic acid (16:0) (14–26%), linoleic acid (18:2) (13–26%), hexadecatrienoic acid (16:3) (8%) and stearic acid (18:0) (1.8–6.4%) (Jemal et al., 2000; Kwon et al., 2000). Our GC-MS investigations confirmed these earlier results (Fig. 4). The fatty acid composition of pepper leaves was markedly modified by ObPV-, but not by PMMoV-inoculation. The linoleic acid (18:2) content of ObPV-inoculated leaves significantly rose at 72 hpi as compared to mock-treated ones (Fig. 5). As the conversion of oleic acid (18:1) to linoleic acid (18:2) is catalyzed by Δ12-FAD enzymes (Dar et al., 2017), this results is in accordance with the massive upregulation of Δ12-FADs by ObPV. The observed accumulation of linoleic acid (18:2) might compensate for the loss of PUFAs caused by extensive peroxidation of intracellular membranes during oxidative burst (Kirsch et al., 1997). The levels of other fatty acids were not influenced significantly by ObPV or PMMoV inoculation (Fig. 5). In plant cells, fatty acids are present predominantly in bound form, esterified to the glycerol backbone of various phospholipids or galactolipids (Christie, 1993). Therefore we hypothesize that the activation of Δ12-FADs by tobamoviruses leads to the desaturation of 18:1 fatty acid carbon chains of phospholipids to 18:2 fatty acids chains in the ER membrane. As 9-LOX genes are also markedly activated in ObPV-inoculated pepper leaves (Gullner et al., 2010; Juhász et al., 2015), the accumulated free or bound linoleic acid may be converted to biologically activated oxylipins (Mosblech et al., 2009; Vicente et al., 2012). Endogenous hydrogen peroxide plays an important role in signaling processes eliciting antiviral defense reactions in virus infected plants (Hernández et al., 2016). To our knowledge, the role of hydrogen peroxide has not been investigated yet in the pepper-ObPV or pepperPMMoV interactions. Therefore we examined the production of hydrogen peroxide in ObPV- and PMMoV-inoculated as well as in mocktreated pepper leaves by histochemical DAB staining. A gradual and strong accumulation of hydrogen peroxide was observed at discrete sites in ObPV-inoculated leaves from 24 hpi to 72 hpi (Fig. 6, Suppl. Fig. 2), which shows that an oxidative stress indeed occurred at the

Fig. 6. Production of hydrogen peroxide in ObPV- and PMMoV-inoculated pepper leaves as detected by in situ histochemical staining with 3,3′-diaminobenzidine (DAB). The hydrogen peroxide formation was examined and photographed at different time points following tobamovirus inoculations. Representative results of three independent experiments are shown. Hydrogen peroxide accumulation was not detectable in mock-treated leaves (data not shown). Abbreviation: dpi, days post-inoculation.

All other typical FAD classes were represented by one protein (Fig. 1). Thus, we found only one chloroplast-localized Δ12-FAD (FAD12). Next, we investigated the expression of 16 FAD genes during an incompatible and a compatible pepper-tobamovirus interactions (ObPV- and PMMoV-inoculation, respectively). An important observation of this study was the early and massive upregulation of seven Δ12FAD genes in ObPV-inoculated pepper leaves, which encode putatively ER-localized, membrane-bound FAD enzymes. In contrast, PMMoV inoculation resulted in an early, but much weaker induction of two Δ12FADs and a Δ15-FAD (Figs. 2 and 3). These results suggest that ER membranes play a substantial role in the early phase of tobamovirus infections, mostly in the case of ObPV. The replication of positive strand RNA viruses often occurs in ER-membrane-bound viral replication complexes (Park and Park, 2019). The pivotal role of ER membranes in virus replication was also demonstrated in the case of TMV, which is the representative member of the genus Tobamovirus. Fluorescence microscopic studies showed that the ER of Nicotiana benthamiana cells undergoes dramatic morphological changes early after TMV infection that include the conversion of tubular ER into large aggregates (Reichel and Beachy, 1998). The intracellular targeting of TMV RNA was visualized also by in situ hybridization in TMV-infected tobacco protoplasts. The viral RNA was shown to co-localize with the ER, including perinuclear ER, in the early phase of infection (Más and Beachy, 1999). A later report showed that TMV locates to the cortical actin/ER network within seconds upon infection and forms motile granules that are anchored to this network in tobacco cells (Christensen et al., 2009). An interesting recent study investigated the effect of tunicamycin, a chemical inducer of ER-stress, on various fad mutants of A. thaliana. Among the mutants examined, the fad2-1 showed an outstandingly high sensitivity to tunicamycin (Nguyen et al., 2019). This result demonstrated that Arabidopsis FAD2, which catalyzes the desaturation of oleic acid (18:1) side chains of ER membrane phospholipids to linoleic acid (18:2) (Smith et al., 1990; Dar et al., 2017), is an important factor in ER membranes to cope with ER stress (Nguyen et al., 2019). It is well-known that the number and position of double bonds in fatty acids profoundly affects their physiological properties. Thus, the increase of membrane fluidity is also mediated by higher ratios of unsaturated fatty acids in membrane lipids. Adjustment of membrane fluidity maintains an environment suitable for the function of critical integral proteins during abiotic and biotic stress (Upchurch, 2008). A 355

Plant Physiology and Biochemistry 148 (2020) 347–358

E. Balogh, et al.

Fig. 7. Induction of six FAD genes in pepper leaf discs floated on the surface of 0, 10, 20 and 50 mM hydrogen peroxide solutions as determined by real-time RT-qPCR with gene-specific primer pairs. Expression levels of FADs were normalized to those of the UBI-3 reference gene and then related to leaf discs treated with distilled water. Mean values of three independent experiments are shown ± SD. Open, hatched, gray and black columns represent 0, 10, 20 and 50 mM H2O2 solutions, respectively. The symbols *, ** and *** show significant differences between hydrogen peroxide-treated and water-treated leaf discs at P < 5%, < 1% and < 0.1%, respectively.

appearing necrotic spots. In contrast to ObPV, no hydrogen peroxide accumulation was detectable in PMMoV-inoculated or mock-treated leaves (Fig. 6, Suppl. Fig. 2). Based on these results, we investigated the effects of exogenous hydrogen peroxide treatments on the expression of six tobamovirus-inducible pepper FAD genes. By these experiments we attempted to define the role of hydrogen peroxide in the regulation of FAD expression. The results indicated that H2O2 treatments differentially activated the six individual Δ12-FAD genes. The expression of four ObPV-inducible Δ12-FADs (FAD19, FAD20, FAD21 and FAD25) encoding ER membrane-localized enzymes was markedly upregulated after 8 hrs exposure to exogenous H2O2 in a concentration-dependent manner (Fig. 7). The expression of FAD10 and FAD26 was also induced after a longer, 24 hrs exposure to H2O2, but this effect was not proportional to the H2O2 concentration probably due to unknown secondary effects (Fig. 7). Interestingly, the H2O2-inducibility of the six FADs strongly correlated with their induciblity by ObPV inoculation

(Suppl. Fig. 3). These results showed that during the incompatible pepper-ObPV interaction H2O2 may participate in the activation of Δ12FADs. Exogenous hydrogen peroxide treatment was already shown to enhance FAD enzyme activity and upregulate the expression of a Δ12FAD in avocado fruits (Wang et al., 2004). However, contrasting results have also been reported showing that H2O2 treatment can also lead to a down-regulation of FAD expression (Li et al., 2011). In summary, we found that the pepper genome harbors a large group of Δ12-FAD genes that encode putatively ER-membrane localized enzymes. The expression of seven such Δ12-FADs was markedly upregulated during the incompatible pepper-ObPV interaction. In accordance with these gene expression results, a marked rise of linoleic acid level was also observed in ObPV-inoculated leaves. In contrast to ObPV, PMMoV infection results in a rapid but weak activation of three FADs. Furthermore, exogenous hydrogen peroxide treatments were shown to activate the ObPV-inducible FAD genes. These results warrant 356

Plant Physiology and Biochemistry 148 (2020) 347–358

E. Balogh, et al.

further studies on the role of FADs in pepper-tobamovirus interactions.

Hernández, J.A., Gullner, G., Clemente-Moreno, M.J., Künstler, A., Juhász, C., DíazVivancos, P., Király, L., 2016. Oxidative stress and antioxidative responses in plantvirus interactions. Physiol. Mol. Plant Pathol. 94, 134–148. Hulse-Kemp, A.M., Maheshwari, S., Stoffel, K., Hill, T.A., Jaffe, D., Williams, S.R., Weisenfeld, N., Ramakrishnan, S., Kumar, V., Shah, P., Schatz, M.C., Church, D.M., Van Deynze, A., 2018. Reference quality assembly of the 3.5-Gb genome of Capsicum annuum from a single linked-read library. Hortic. Res. 5, 4. Im, Y., Kim, M.S., Yang, K.Y., Kim, Y., Back, K., Cho, B.H., 2004. Antisense expression of a omega-3 fatty acid desaturase gene in tobacco plants enhances susceptibility against pathogens. Can. J. Bot. 82, 297–303. Ishibashi, K., Miyashita, S., Katoh, E., Ishikawa, M., 2012. Host membrane proteins involved in the replication of tobamovirus RNA. Curr. Opin. Virol. 2, 699–704. Janeczko, A., Dziurka, M., Gullner, G., Kocurek, M., Rys, M., Saja, D., Skoczowski, A., Tóbiás, I., Kornas, A., Barna, B., 2018. Comparative studies of compatible and incompatible pepper–Tobamovirus interactions and the evaluation of effects of 24epibrassinolide. Photosynthetica 56, 763–775. Jemal, F., Zarrouk, M., Ghorbal, M.H., 2000. Effect of cadmium on lipid composition of pepper. Biochem. Soc. Trans. 28, 907–910. Juhász, C., Tóbiás, I., Ádám, A.L., Kátay, G., Gullner, G., 2015. Pepper 9- and 13-lipoxygenase genes are differentially activated by two tobamoviruses and by hormone treatments. Physiol. Mol. Plant Pathol. 92, 59–69. Kachroo, A., Shanklin, J., Whittle, E., Lapchyk, L., Hildebrand, D., Kachroo, P., 2007. The Arabidopsis stearoyl-acyl carrier protein-desaturase family and the contribution of leaf isoforms to oleic acid synthesis. Plant Mol. Biol. 63, 257–271. Kim, K.J., Lim, J.H., Lee, S., Kim, Y.J., Choi, S.B., Lee, M.K., Choi, D., Paek, K.H., 2007. Functional study of Capsicum annuum fatty acid desaturase 1 cDNA clone induced by Tobacco mosaic virus via microarray and virus-induced gene silencing. Biochem. Biophys. Res. Commun. 362, 554–561. Kim, S., Park, M., Yeom, S.I., Kim, Y.M., Lee, J.M., Lee, H.A., Seo, E., Choi, J., Cheong, K., Kim, K.T., Jung, K., Lee, G.W., Oh, S.K., Bae, C., Kim, S.B., Lee, H.Y., Kim, S.Y., Kim, M.S., Kang, B.C., Jo, Y.D., Yang, H.B., Jeong, H.J., Kang, W.H., Kwon, J.K., Shin, C., Lim, J.Y., Park, J.H., Huh, J.H., Kim, J.S., Kim, B.D., Cohen, O., Paran, I., Suh, M.C., Lee, S.B., Kim, Y.K., Shin, Y., Noh, S.J., Park, J., Seo, Y.S., Kwon, S.Y., Kim, H.A., Park, J.M., Kim, H.J., Choi, S.B., Bosland, P.W., Reeves, G., Jo, S.-H., Lee, B.W., Cho, H.T., Choi, H.S., Lee, M.S., Yu, Y., Do Choi, Y., Park, B.S., van Deynze, A., Ashrafi, H., Hill, T., Kim, W.T., Pai, H.S., Ahn, H.K., Yeam, I., Giovannoni, J.J., Rose, J.K.C., Sørensen, I., Lee, S.J., Kim, R.W., Choi, I.Y., Choi, B.S., Lim, J.S., Lee, Y.H., Choi, D., 2014. Genome sequence of the hot pepper provides insights into the evolution of pungency in Capsicum species. Nat. Genet. 46, 270–278. Kirsch, C., Hahlbrock, K., Somssich, I.E., 1997. Rapid and transient induction of a parsley microsomal Δ12 fatty acid desaturase mRNA by fungal elicitor. Plant Physiol. 115, 283–289. Kwon, J.H., Lee, Y.M., An, C.S., 2000. cDNA cloning of chloroplast omega-3 fatty acid desaturase from Capsicum annuum and its expression upon wounding. Mol. Cell 10, 493–497. Lee, W.M., Ishikawa, M., Ahlquist, P., 2001. Mutation of host delta 9 fatty acid desaturase inhibits brome mosaic virus RNA replication between template recognition and RNA synthesis. J. Virol. 75, 2097–2106. Li, A., Zhang, R., Pan, L., Tang, L., Zhao, G., Zhu, M., Chu, J., Sun, X., Wei, B., Zhang, X., Jia, J., Mao, L., 2011. Transcriptome analysis of H2O2-treated wheat seedlings reveals a H2O2-responsive fatty acid desaturase gene participating in powdery mildew resistance. PloS One 6, e28810. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2-ΔΔCt method. Methods 25, 402–408. Lou, Y., Schwender, J., Shanklin, J., 2014. FAD2 and FAD3 desaturases form heterodimers that facilitate metabolic channeling in vivo. J. Biol. Chem. 289, 17996–18007. Más, P., Beachy, R.N., 1999. Replication of tobacco mosaic virus on endoplasmic reticulum and role of the cytoskeleton and virus movement protein in intracellular distribution of viral RNA. J. Cell Biol. 147, 945–958. Mosblech, A., Feussner, I., Heilmann, I., 2009. Oxylipins: structurally diverse metabolites from fatty acid oxidation. Plant Physiol. Biochem. 47, 511–517. Nguyen, V.C., Nakamura, Y., Kanehara, K., 2019. Membrane lipid polyunsaturation mediated by FATTY ACID DESATURASE 2 (FAD2) is involved in endoplasmic reticulum stress tolerance in Arabidopsis thaliana. Plant J. 99, 478–493. Ohlrogge, J., Browse, J., 1995. Lipid biosynthesis. Plant Cell 7, 957–970. Okuley, J., Lightner, J., Feldmann, K., Yadav, N., Lark, E., Browse, J., 1994. Arabidopsis FAD2 gene encodes the enzyme that is essential for polyunsaturated lipid synthesis. Plant Cell 6, 147–158. Park, C.J., Park, J.M., 2019. Endoplasmic reticulum plays a critical role in integrating signals generated by both biotic and abiotic stress in plants. Front. Plant Sci. 10, 399. Paul, D., Bartenschlager, R., 2013. Architecture and biogenesis of plus-strand RNA virus replication factories. World J. Virol. 2, 32–48. Prost, I., Dhondt, S., Rothe, G., Vicente, J., Rodriguez, M.J., Kift, N., Carbonne, F., Griffiths, G., Esquerré-Tugayé, M.T., Rosahl, S., Castresana, C., Hamberg, M., Fournier, J., 2005. Evaluation of the antimicrobial activities of plant oxylipins supports their involvement in defense against pathogens. Plant Physiol. 139, 1902–1913. Qin, C., Yu, C., Shen, Y., Fang, X., Chen, L., Min, J., Cheng, J., Zhao, S., Xu, M., Luo, Y., Yang, Y., Wu, Z., Mao, L., Wu, H., Ling-Hu, C., Zhou, H., Lin, H., González-Morales, S., Trejo-Saavedra, D.L., Tian, H., Tang, X., Zhao, M., Huang, Z., Zhou, A., Yao, X., Cui, J., Li, W., Chen, Z., Feng, Y., Niu, Y., Bi, S., Yang, X., Li, W., Cai, H., Luo, X., Montes-Hernández, S., Leyva-González, M.A., Xiong, Z., He, X., Bai, L., Tan, S., Tang, X., Liu, D., Liu, J., Zhang, S., Chen, M., Zhang, L., Zhang, L., Zhang, Y., Liao, W., Zhang, Y., Wang, M., Lv, X., Wen, B., Liu, H., Luan, H., Zhang, Y., Yang, S., Wang, X., Xu, J., Li, X., Li, S., Wang, J., Palloix, A., Bosland, P.W., Li, Y., Krogh, A., RiveraBustamante, R.F., Herrera-Estrella, L., Yin, Y., Yu, J., Hu, K., Zhang, Z., 2014. Wholegenome sequencing of cultivated and wild peppers provides insights into Capsicum

Author contributions GG, JF and IT conceived the experiments, CJ, EB and IT carried out the virus inoculations, CJ and EB carried out the chemical treatments and the molecular biological experiments, GG, JF and TD carried out the lipid extractions and fatty acid analyses, GG and JF prepared the manuscript. Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Acknowledgments The financial support of the Hungarian National Research, Development and Innovation Office (NKFIH K 124131) is gratefully acknowledged. Seeds were kindly provided by Dr. Lajos Zatykó (Research Institute of Vegetable Crops, Budatétény, Hungary). Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.plaphy.2020.01.023. References Ahlquist, P., Noueiry, A.O., Lee, W.M., Kushner, D.B., Dye, B.T., 2003. Host factors in positive-strand RNA virus genome replication. J. Virol. 77, 8181–8186. Chandra-Shekara, A.C., Venugopal, S.C., Barman, S.R., Kachroo, A., Kachroo, P., 2007. Plastidial fatty acid levels regulate resistance gene-dependent defense signaling in Arabidopsis. Proc. Natl. Acad. Sci. U.S.A. 104, 7277–7282. Chi, X.Y., Yang, Q.L., Lu, Y.D., Wang, J.Y., Zhang, Q.F., Pan, L.J., Chen, M.N., He, Y.N., Yu, S.L., 2011. Genome-wide analysis of fatty acid desaturases in soybean (Glycine max). Plant Mol. Biol. Rep. 29, 769–783. Christensen, N., Tilsner, J., Bell, K., Hammann, P., Parton, R., Lacomme, C., Oparka, K., 2009. The 5' cap of tobacco mosaic virus (TMV) is required for virion attachment to the actin/endoplasmic reticulum network during early infection. Traffic 10, 536–551. Christie, W.W., 1993. Preparation of ester derivatives of fatty acids for chromatographic analysis. In: Christie, W.W. (Ed.), Advances in Lipid Methodology – Two. Oily Press, Dundee, pp. 69–111. Chukkapalli, V., Heaton, N.S., Randall, G., 2012. Lipids at the interface of virus–host interactions. Curr. Op. Microbiol. 15, 512–518. Dar, A.A., Choudhury, A.R., Kancharla, P.K., Arumugam, N., 2017. The FAD2 gene in plants: occurrence, regulation, and role. Front. Plant Sci. 8, 1789. Dong, C.J., Cao, N., Zhang, Z.G., Shang, Q.M., 2016. Characterization of the fatty acid desaturase genes in cucumber: structure, phylogeny, and expression patterns. PloS One 11, e0149917. Dziurka, M., Janeczko, A., Juhász, C., Gullner, G., Oklestková, J., Novák, O., Saja, D., Skoczowski, A., Tóbiás, I., Barna, B., 2016. Local and systemic hormonal responses in pepper leaves during compatible and incompatible pepper-tobamovirus interactions. Plant Physiol. Biochem. 109, 355–364. Fernández-Calvino, L., Osorio, S., Hernández, M.L., Hamada, I.B., del Toro, F.J., Donaire, L., Yu, A., Bustos, R., Fernie, A.R., Martínez-Rivas, J.M., Llave, C., 2014. Virus-induced alterations in primary metabolism modulate susceptibility to Tobacco rattle virus in Arabidopsis. Plant Physiol. 166, 1821–1838. Gao, J., Ajjawi, I., Manoli, A., Sawin, A., Xu, C., Froehlich, J.E., Last, R.L., Benning, C., 2009. FATTY ACID DESATURASE4 of Arabidopsis encodes a protein distinct from characterized fatty acid desaturases. Plant J. 60, 832–839. García-Maroto, F., Garrido-Cárdenas, J.A., Michaelson, L.V., Napier, J.A., Alonso, D.L., 2007. Cloning and molecular characterisation of a delta-8-sphingolipid-desaturase from Nicotiana tabacum closely related to delta-6-acyl-desaturases. Plant Mol. Biol. 64, 241–250. Ge, W., Kong, X., Zhao, Y., Wei, B., Zhou, Q., Ji, S., 2019. Insights into the metabolism of membrane lipid fatty acids associated with chilling injury in post-harvest bell peppers. Food Chem. 295, 26–35. Gullner, G., Künstler, A., Király, L., Pogány, M., Tóbiás, I., 2010. Up-regulated expression of lipoxygenase and divinyl ether synthase genes in pepper leaves inoculated with Tobamoviruses. Physiol. Mol. Plant Pathol. 74, 387–393. Heilmann, I., Mekhedov, S., King, B., Browse, J., Shanklin, J., 2004. Identification of the Arabidopsis palmitoyl-monogalactosyldiacylglycerol delta7-desaturase gene FAD5, and effects of plastidial retargeting of Arabidopsis desaturases on the fad5 mutant phenotype. Plant Physiol. 136, 4237–4245.

357

Plant Physiology and Biochemistry 148 (2020) 347–358

E. Balogh, et al. domestication and specialization. Proc. Natl. Acad. Sci. U.S.A. 111, 5135–5140. Reichel, C., Beachy, R.N., 1998. Tobacco mosaic virus infection induces severe morphological changes of the endoplasmic reticulum. Proc. Natl. Acad. Sci. U.S.A. 95, 11169–11174. Román, Á., Hernández, M.L., Soria-García, Á., López-Gomollón, S., Lagunas, B., Picorel, R., Martínez-Rivas, J.M., Alfonso, M., 2015. Non-redundant contribution of the plastidial FAD8 omega-3 desaturase to glycerolipid unsaturation at different temperatures in Arabidopsis. Mol. Plant 8, 1599–1611. Rys, M., Juhász, C., Surówka, E., Janeczko, A., Saja, D., Tóbiás, I., Skoczowski, A., Barna, B., Gullner, G., 2014. Comparison of a compatible and an incompatible pepper-tobamovirus interaction by biochemical and non-invasive techniques: chlorophyll a fluorescence, isothermal calorimetry and FT-Raman spectroscopy. Plant Physiol. Biochem. 83, 267–278. Sayanova, O., Smith, M.A., Lapinskas, P., Stobart, A.K., Dobson, G., Christie, W.W., Shewry, P.R., Napier, J.A., 1997. Expression of a borage desaturase cDNA containing an N-terminal cytochrome b5 domain results in the accumulation of high levels of delta-6-desaturated fatty acids in transgenic tobacco. Proc. Natl. Acad. Sci. U.S.A. 94, 4211–4216. Schwartz, M., Chen, J., Lee, W.M., Janda, M., Ahlquist, P., 2004. Alternate, virus-induced membrane rearrangements support positive-strand RNA virus genome replication. Proc. Natl. Acad. Sci. U.S.A. 101, 11263–11268. Sekine, K.T., Nandi, A., Ishihara, T., Hase, S., Ikegami, M., Shah, J., Takahashi, H., 2004. Enhanced resistance to Cucumber mosaic virus in the Arabidopsis thaliana ssi2 mutant is mediated via an SA-independent mechanism. Mol. Plant Microbe Interact. 17, 623–632. Shanklin, J., Whittle, E., Fox, B.G., 1994. Eight histidine residues are catalytically essential in a membrane-associated iron enzyme, stearoyl-CoA desaturase, and are conserved in alkane hydroxylase and xylene monooxygenase. Biochemistry 33, 12787–12794. Shanklin, J., Cahoon, E.B., 1998. Desaturation and related modifications of fatty acids. Annu. Rev. Plant Physiol. Plant Mol. Biol. 49, 611–641. Singh, A.K., Fu, D.Q., El-Habbak, M., Navarre, D., Ghabrial, S., Kachroo, A., 2011. Silencing genes encoding omega-3 fatty acid desaturase alters seed size and accumulation of Bean pod mottle virus in soybean. Mol. Plant Microbe Interact. 24, 506–515. Smith, M.A., Cross, A.R., Jones, O.T., Griffiths, W.T., Stymne, S., Stobart, K., 1990. Electron-transport components of the 1-acyl-2-oleoyl-sn-glycero-3-phosphocholine Δ12-desaturase (Δ12-desaturase) in microsomal preparations from developing safflower (Carthamus tinctorius L.) cotyledons. Biochem. J. 272, 23–29. Smith, M.A., Dauk, M., Ramadan, H., Yang, H., Seamons, L.E., Haslam, R.P., Beaudoin, F., Ramirez-Erosa, I., Forseille, L., 2013. Involvement of Arabidopsis ACYL-COENZYME A DESATURASE-LIKE2 (At2g31360) in the biosynthesis of the very-long-chain

monounsaturated fatty acid components of membrane lipids. Plant Physiol. 161, 81–96. Stapleford, K.A., Miller, D.J., 2010. Role of cellular lipids in positive-sense RNA virus replication complex assembly and function. Viruses 2, 1055–1068. Thordal-Christensen, H., Zhang, Z., Wei, Y., Collinge, D.B., 1997. Subcellular localization of H2O2 in plants. H2O2 accumulation in papillae and hypersensitive response during barley–powdery mildew interaction. Plant J. 11, 1187–1194. Tóbiás, I., Fraser, R.S.S., Gerwitz, A., 1989. The gene-for-gene relationship between Capsicum annuum L. and tobacco mosaic virus: effects on virus multiplication, ethylene synthesis and accumulation of pathogenesis-related proteins. Physiol. Mol. Plant Pathol. 35, 271–286. Upchurch, R.G., 2008. Fatty acid unsaturation, mobilization, and regulation in the response of plants to stress. Biotechnol. Lett. 30, 967–977. Vicente, J., Cascón, T., Vicedo, B., García-Agustín, P., Hamberg, M., Castresana, C., 2012. Role of 9-lipoxygenase and α-dioxygenase oxylipin pathways as modulators of local and systemic defense. Mol. Plant 5, 914–928. Wan, H., Yuan, W., Ruan, M., Ye, Q., Wang, R., Li, Z., Zhou, G., Yao, Z., Zhao, J., Liu, S., Yang, Y., 2011. Identification of reference genes for reverse transcription quantitative real-time PCR normalization in pepper (Capsicum annuum L.). Biochem. Biophys. Res. Commun. 416, 24–30. Wang, X., Beno-Moualem, D., Kobiler, I., Leikin-Frenkel, A., Lichter, A., Prusky, D., 2004. Expression of Δ12-fatty acid desaturase during the induced accumulation of the antifungal diene in avocado fruits. Mol. Plant Pathol. 5, 575–585. Wang, H.S., Yu, C., Tang, X.F., Zhu, Z.J., Ma, N.N., Meng, Q.W., 2014. A tomato endoplasmic reticulum (ER)-type omega-3 fatty acid desaturase (LeFAD3) functions in early seedling tolerance to salinity stress. Plant Cell Rep. 33, 131–142. Weichert, H., Stenzel, I., Berndt, E., Wasternack, C., Feussner, I., 1999. Metabolic profiling of oxylipins upon salicylate treatment in barley leaves - preferential induction of the reductase pathway by salicylate. FEBS Lett. 464, 133–137. Wi, S.J., Jang, S.J., Park, K.Y., 2010. Inhibition of biphasic ethylene production enhances tolerance to abiotic stress by reducing the accumulation of reactive oxygen species in Nicotiana tabacum. Mol. Cell 30, 37–49. Zhang, J.T., Zhu, J.Q., Zhu, Q., Liu, H., Gao, X.S., Zhang, H.X., 2009. Fatty acid desaturase-6 (Fad6) is required for salt tolerance in Arabidopsis thaliana. Biochem. Biophys. Res. Commun. 390, 469–474. Zhang, Z., Wei, X., Liu, W., Min, X., Jin, X., Ndayambaza, B., Wang, Y., 2018. Genomewide identification and expression analysis of the fatty acid desaturase genes in Medicago truncatula. Biochem. Biophys. Res. Commun. 499, 361–367. Zhang, Z., He, G., Filipowicz, N.A., Randall, G., Belov, G.A., Kopek, B.G., Wang, X., 2019. Host lipids in positive-strand RNA virus genome replication. Front. Microbiol. 10, 286.

358