The expression pattern of APC2 and APC7 in various cancer cell lines and AML patients

Advances in Medical Sciences 60 (2015) 259–263

Contents lists available at ScienceDirect

Advances in Medical Sciences journal homepage: www.elsevier.com/locate/advms

Original Research Article

The expression pattern of APC2 and APC7 in various cancer cell lines and AML patients Hamzeh Rahimi a, Ahmad Ahmadzadeh b, Shamseddin Yousef-amoli a, Leila Kokabee a, Mohammad-Ali Shokrgozar c, Reza Mahdian a,*, Mortaza Karimipoor a,** a b c

Molecular Medicine Department, Biotechnology Research Center, Pasteur Institute of Iran, Tehran, Iran Thalassemia and Hemoglobinopathy Research Center, Shafa Hospital, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran National Cell Bank of Iran, Pasteur Institute of Iran, Tehran, Iran

A R T I C L E I N F O

A B S T R A C T

Article history: Received 11 March 2014 Accepted 30 April 2015 Available online 13 May 2015

Purpose: Anaphase promoting complex (APC/C) is an E3 ligase enzyme, which ubiquinates various proteins involved in the cell cycle. This protein complex may have a pivotal role in the cell cycle control affecting pathological conditions such as cancer. APC7 and APC2 subunits of the APC/C complex are involved in the substrate recognition and the catalytic reaction, respectively. Materials and methods: In this study, quantitative Real-time PCR was used to analyse APC2 and APC7 expression in different cancer cell lines as well as AML patient’s blood cells. Results: The results showed that APC2 and APC7 subunits were both over expressed in cancer cell lines (p = 0.008). The mean expression ratio of APC2 and APC7 in different cancer cells were 2.60  0.22 and 4.83  0.11, respectively. An increase in expression of APC2 and APC7 was seen among 12 out of 14 AML patients (85%). There was a significant positive correlation between APC2 upregulation and the detection of splenomegaly in the patients (r = 0.808, p = 0.001). Conclusion: This was the first study suggesting that APC/C upregulation may contribute to the pathogenesis of cancer and can be used as a molecular biomarker to predict the progression and the prognosis of AML. ß 2015 Medical University of Bialystok. Published by Elsevier Sp. z o.o. All rights reserved.

Keywords: Anaphase promoting complex Cell cycle Real-time PCR AML

1. Introduction Cancer is often caused by imbalanced cell proliferation and cell death, the two important aspects of ‘‘cell cycle’’ regulation. The ubiquitination pathway plays a critical role in cell cycle control and cell maintenance [1]. Two checkpoints have been discovered in the cell cycle regulation until now: anaphase promoting complex (APC/C) and SKP1-CUL1-F-boxprotein (SCF) [2]. The APC/C activation occurs from the anaphase to the end of the G1 phase [3], while the SCF controls other steps of the cell cycle [4].

* Corresponding author at: Molecular Medicine Department, Biotechnology Research Center, Pasteur Institute of Iran, 12 Farvardin, Tehran, Iran. Tel.: +98 9127988388; fax: +98 2166480780. ** Corresponding author at: Molecular Medicine Department, Biotechnology Research Center, Pasteur Institute of Iran, 12 Farvardin, Tehran, Iran. Tel.: +98 9122806133; fax: +98 2166480780. E-mail addresses: [email protected] (R. Mahdian), [email protected] (M. Karimipoor).

The APC/C, 1700-kDa protein complex, is the largest E3 ligase enzyme in human cells. The complex contains more than 13 subunits in three sub-complexes (catalytic, TPR, and scaffold complex) [5]. The catalytic subcomplex includes APC2, APC10/ Doc1 and APC11 subunits [6,7]. The tetratrico-peptide repeat (TPR) subcomplex contains APC3, APC6, APC7, and APC8 subunits [8,9]. These subunits play an important role in complex assembly and acceleration the interaction between catalytic subunits and its substrates [10,11]. The scaffold subcomplex is comprised of the largest subunits APC1, APC4 and APC5 [12]. The APC/C complex is activated by binding of a co-activator (Cdh1 and Cdc20) and phosphorylation of APC/C subunits [13,14]. The APC/C functions are divided into two groups: cellcycle dependant and non-mitotic functions [15]. The APC/C also correlates the cell cycle with other pathways in cells, such as chromosome segregation [16], transcription machinery [17], DNA replication [18], TGF-beta signaling [19], and glycolysis [20]. This correlation guarantees that the cell growth and division occur at appropriate time. The APC/C complex performs its functions by

http://dx.doi.org/10.1016/j.advms.2015.04.007 1896-1126/ß 2015 Medical University of Bialystok. Published by Elsevier Sp. z o.o. All rights reserved.

H. Rahimi et al. / Advances in Medical Sciences 60 (2015) 259–263

260

adding ubiquitin to substrates via processivity of multiubiquitination mechanism [21]. The APC/C co-activators, CDH1 and CDC20, recognize substrates via D-box or KEN box motifs and introduce them to the catalytic site of the complex [22]. The ubiquitin system plays a very important role in the pathogenesis of many diseases [23]. Tissue microarray analysis of 1600 cancer tissues revealed over-expression of the APC/C activators and substrates in different cancer tissues [24]. Overexpression of APC/C activator (CDC20) in oral squamous cell carcinoma (OSCC) accelerates genome instability [25]. On the other hand, another study indicated that the APC/C is very crucial in cancer-causing processes [26]. The over expression of APC/C has been observed in different cancer types such as breast, bladder, ovarian, oral and lung cancers [27,28]. Moreover, it has been shown that disruption of the APC/C CDH1-SKP2 cascade in breast cancer is correlated with aggressive clinical behavior and poor prognosis [29]. Microarray on clinical samples of gastric cancer revealed that CDC20 is a potential marker of human gastric cancer [30]. In this study, the expression of APC/C subunits was investigated in various cancer cell lines and 14 AML patients to assess the correlations of APC2 and APC7 expression as well as to evaluate the potential association of APC2 and APC7 expression with clinicopathological characteristics. Most of the leukemia-associated antigens (LAAs) are linked either to the cell cycle or cell proliferation regulation. Therefore AML cases were chosen to study the APC/C expression pattern. The expression profile of APC/C has been previously studied in different cancer cell lines [31]. However, to the best of our knowledge, there has been no report on APC/C expression analysis by Real-time PCR method, which is a very sensitive (<5 copies) and precise (<2% standard deviation) assay [32]. This study showed that APC/C subunits are highly expressed in the studied cell lines and AML patients. This over-expression suggests the involvement of APC/C in cancer biology, which may be used as a biomarker or drug target in cancer treatment. 2. Materials and methods 2.1. Cell culture 11 human cancer cell lines (Table 1) were investigated in this study. Apart from MCF7 and A-375 cell lines which were cultured in DMEM medium (invitrogen, Germany) using 10% FBS, 1% penicillin + streptomycin and 5% CO2 in 37 8C, the other cell lines were cultured in RPMI medium culture (invitrogen, Germany). HFFF-PI6 and HNCF cell lines were used as normal cell lines.

Table 1 Investigated cell lines in this study. ATCC code for each cell identified and origin and cell type for each item is summarized. Cell name

Cancer type

Cell type

ATCC ID/Cell line origin

MCF-7 Hela U-373 MG BT-20 PC-3 RPMI 8866 CCRF-CEM

Breast Cervix Brain Breast Prostate Blood Blood

Epithelial-like Epithelial-like Epithelial-like Epithelial-like Epithelial Lymphoblastoid T lymphoblast

K562

Bone marrow Brain Lung Skin Skin Cervix

lymphoblast

HTB-22; adenocarcinoma CCL-2; adenocarcinoma HTB-17; glioblastoma CRL-1435; adenocarcinoma CRl-1435; adenocarcinoma HTB-56; anaplastic carcinoma CCL-119; acute lymphoblastic leukemia CCL-243; chronic myelogenous leukemia CRL 1619; malignant melanoma HTB-56; anaplastic carcinoma Normal CRL-1619; malignant melanoma Normal

1321N1 Calu-6 HFFF-PI6 A-375 HNCF

Glial-like Epithelial-like Fibroblast-like Epithelial-like Fibroblast-like

2.2. Patients Blood samples were collected from 14 AML (acute myeloid leukemia) patients referred to Imam-Khomeni Hospital from August to October 2012 and seven healthy volunteers. The diagnosis was verified by clinical, hematologic and histological examination. After obtaining the written informed consent from the patients, five ml of peripheral blood was collected in tubes containing EDTA as anticoagulant. The blood samples were obtained before drug treatment and radiotherapy and were transferred to laboratory (4 8C). 2.3. RNA extraction and cDNA preparation Total RNA was extracted from the cell lines using RNeasy Mini Kit according to the Kit protocol (QIAGEN, Germany). Trizol (Cinnagen, Iran) was used for RNA extraction from whole blood sample according to the manufacturer instruction. The quality and concentration of the RNA samples were measured by NanoDrop_ND-1000 Spectrophotometer (NanoDrop Technologies, USA). cDNA synthesis was performed for each cell line and patient sample using 500 pg of the RNA in reverse transcription reaction. Real-time PCR primers were designed using PRIMER EXPRESS software V.3.0 (Applied Biosystems, Foster City, CA, USA), based on the complete cDNA sequence. The primer specificity was verified by primer-blast tool (www.ncbi.nlm.nih.gov/blast) against NR and Refseq mRNA databases. Because APC7 has more than one isoform, exon 3 and 4 (common in all isoforms) were used as the representative regions of the gene. GAPDH (Glyceraldehyde-3phosphate Dehydrogenase) was applied as internal reference gene. The characteristics of the designed primers are shown in Table 2. A SYBR Green I Real-time PCR assay was performed in optical grade 96-well plate at final volume of 25 ml containing 12.5 ml of SYBR Green I Master mix (Applied Biosystems, USA), 7 pmol of each forward and reverse primers, 500 ng cDNA. Thermal cycling was carried out on ABI 7300 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) using the following cycling conditions: 10 min at 95 8C, then, followed by 40 cycles at 95 8C for 15 s and 60 8C for 30 s. The amplification step was followed by dissociation step and melting curve analysis. 2.4. Data analysis Data analysis was performed using the ABI PRISM 7300 Sequence Detection System and SDS V.1.2.3 software (Applied Biosystems, UK). The intensity of fluorescence emission was determined at the end of each amplification cycle. The CT value was determined as the cycle number at which amplification plot crossed threshold line (minimum detection level). In this study, the relative analysis method was used to calculate the gene expression ratio. For each sample, mean of CT values (mCT) was calculated from triplicate experiments. DDCT values for APC2 or APC7 were calculated according to the formula DDCT = (CTTarget CTReference) test (CTTarget CTReference) control. The gene expression ratio DDCT was calculated by the formula ratio = 2 [33]. Table 2 Designed oligonucleotide primers for real-time PCR reaction. Gene

Primer

Sequence

Tm

%GC

Amplicon size (bp)

Apc2

Apc2F Apc2R Apc7F Apc7R GAPDHF GAPDHR

CAGCTCAGCCAGGTCTTACACAG CGTCCTGCAGGAACACCTTG CATGATGCTGGCAAACCTGTAC TGATCCACACAGAGAGCCAGTC TCCACCACCCTGTTGCTGTAG ACACCCACTCCTCCACCTTTG

60.1 60.3 59.1 58.1 59.6 59.8

57 60 50 55 57 57

199

Apc7 GAPDH

206 111

H. Rahimi et al. / Advances in Medical Sciences 60 (2015) 259–263

Fig. 1. APC subunits expression in cancer cell lines. Expression of these cell lines showed based on expression in HFFF-PI6 and HNCF as normal cell lines. The result of 1321N1 cell line expression has not been shown because its expression ratio was not significantly different.

2.5. Statistical analysis All of the quantitative data were presented as means  SD and were analyzed by the statistical software package SPSS 16. The correlation of the expression ratio of APC2 and APC7 in AML patients with age, sex, cancer subtype, and other clinicopathological characteristics was studied by Spearman test. The differences in the values of APC2 and APC7 mRNA expression were evaluated by the non-parametric Mann–Whitney test. Only variables with a P value less than 0.05 were included in the final results. The survival curve was calculated according to the Kaplan–Meier method. 3. Results 3.1. Upregulation of APC/C subunits in the cancer cell lines The specificity of the quantitative Real-time PCR assay was verified by melting curve analysis after each amplification stage. The PCR efficiency of the target and reference genes was set up at 94–96% based on the standard curves which were produced using serially diluted cDNA template. APC2, APC7 and the reference gene (GAPDH) showed single specific peaks on the dissociation graph (data not shown). A wide range of APC2 and APC7 mRNA expression levels were detected in the examined cancer cell lines (Fig. 1). The mean expression ratio of APC2 and APC7 in the cancer cell lines was 2.60  0.22 and 4.83  0.11, respectively. Three cell lines (e.g. U373,

261

Fig. 2. The comparison of APC subunits expression ratio between normal samples and AML patients. Box plots resulted from APC2 and APC7 subunits expression ratio in normal controls (n = 5) and AML patient (n = 14). This analysis showed that the both APC subunits were over-expressed in the patients. The Y axis shows the fold change of expression ratio and the X axis represents the investigated groups. ‘‘min = minimum, max = maximum, q1 = the first quartile, median = the second quartile and q3 = the third quartile’’.

MCF-7 and K562) had remarkable high expression of either both or one of the APC/C subunits. The 1321N1 cell line expression ratio isn’t significant and don’t shown in Fig. 1. 3.2. Overexpression of APC/C subunits in AML patients The demographic characteristics of the patients are listed in Table 3. The blood samples from AML patients (n = 14) and normal individuals (n = 7) were analyzed for APC2 and APC7 mRNA expression. The mean expression ratio of APC2 and APC7 in normal individuals was 1.35  0.88 and 1.28  0.81, respectively. There was a significant over expression (P = 0.001) of APC2 and APC7 genes in 85% (12/14) of the patients as shown in Fig. 2. Overall, mean expression ratio of 1.81  0.9 (APC2) and 2.00  1.9 (APC7) was observed in the patients. The both genes were simultaneously upregulated in most of the patients. However, in two patients (patient 2 and 10) the expression level of APC7 was remarkably higher than that of APC2. 3.3. Correlation of APC/C subunits expression with overall survival of the patients The patient-survival curve generated using Kaplan–Meier analysis showed that 58% of the patients were expired during

Table 3 Clinicopathological characteristics of patients with AML. ID

Diagnosis

Age (year)

Sex

WBC (mm3)

RBC (*106/mm3)

HGB (g/dL)

HCT (%)

MCV (fL)

MCH (pg)

MHCH (g/dL)

PLT (mm3)

Splenomegaly

Expire time (week)

1 2 3 4 5 6 7 8 9 10 11 12 13 14

AML M3 AML AML AML M4 AML M3 AML AML-M3 AML AML AML AML M4 AML AML AML

70 25 59 23 44 39 28 68 65 22 49 32 13 15

M M M M F F M F F F M M M M

1900 16,700 7000 8000 90,000 5100 1400 8200 17,400 12,490 1100 84,000 4200 5300

2.8 3.2 3.45 3.5 2.4 3.4 2.3 3.22 3.55 3.21 2.6 2.57 3.85 2.85

8.2 9.11 10.8 11.2 7.8 10 8.2 10.9 11 10.1 9 8.7 9.8 11.8

23 34 31 33.3 21.8 31 32.35 12.4 32 31.6 27.5 26.8 30.3 26.3

81 83 92 93 90.8 91 92.45 98.5 90.4 98.4 87.5 104.3 25.5 95.5

28 30.3 31.23 31.3 32 30.5 30.4 33.1 31 31.5 30.9 33.9 31 30

35.5 33.1 34.7 33.6 35.8 33.4 35.56 33.6 34.3 32 35.3 32.9 32.3 35.3

9000 31,000 13,000 18,000 8000 15,000 18,000 32,000 21,000 35,000 7000 18,000 379,000 1,79,000

No Yes Yes No Yes Yes Yes No Yes Yes No No – –

16 16 1 16 3 3 16 16 4 16 2 3 16 16

262

H. Rahimi et al. / Advances in Medical Sciences 60 (2015) 259–263

Fig. 3. Survival curve of AML patient. The Kaplan–Meier method was used to draw survival curve of AML patients during 16 weeks.

16 weeks after diagnosis (Fig. 3). The association between the expression of APC2 and APC7 and clinical characteristics including: gender, age, spelonomagaly, infection, cancer sub-type (M3 and Non-M3) and history of chemotherapy was calculated by Mann– Whitney nonparametric test. The expression level of APC2 had significant (r = 0.808, p = 0.001) association with splenomegaly, but not with other clinicopathological characteristics. In addition, no correlation was found between the APC7 expression and the clinical findings (Spearman’s correlation analysis, P = 0.087). 4. Discussion Considering the crucial role of APC/C complex in the cell cycle regulation, the study of its expression pattern may reveal changes which cause irregular cell proliferation and differentiation in malignancies. In this study, the expression of two major APC/C subunits was investigated in different cancer cells as well as AML patient’s blood samples. Most of these cell lines were originated from epithelial or epithelial-like tissues, whereas RPMI and CCRFCEM cell lines were from lymphoblastic origin. APC2 and APC7 were selected as indicators of APC/C expression because APC2 plays an important role in ubiqutination reaction on the substrates gained by APC7 [34–37]. In fact, APC2 is the main component of the active site which is supported by APC7 via substrate engagement. The results of this study showed that the mean expression ratios of APC2 and APC7 in tumor cells were significantly higher than that in normal fibroblasts. However, various levels of APC/C expression were found in different cancer cell lines (Fig. 1). Two alternative APC/C regulatory pathways provide the APC/C complex needed in the status of high-rate cell proliferation. Either increase of APC/C expression or hyper-phosphorylation of the APC/ C subunits provides the active form of the protein [38,39]. One can assume that in tumor cells with high level of kinase activity, APC/C is hyperphosphorylated so that APC/C expression might remain unchanged. In agreement with this hypothesis, a study on different breast cancer cell lines revealed high level of tyrosine kinase expression in MDA-MB-361 cells but not in MCF-7 cells [27]. It was observed APC/C over expression in MCF-7 cells which was consistent to the low level of the kinase activity. The results reported by Park et al. on 180 breast cancer cases with invasive ductal carcinoma (IDC) showed downregulation of APC7 in cases with poor prognostic parameters [31]. In contrast, another study on breast cancer showed that APC7 expression was raised consistent to the malignant status of the tumor [28]. The dissimilar level of APC/C subunits expression in different tissues contributed to the heterogeneity of APC/C subunits expression in different

cancers. Wan and colleagues shown that deregulated expression of APC/cdc20 play role in T cell leukemia [40]. Furthermore, there was a significant over expression (P = 0.001) of APC2 and APC7 genes in 85% of the AML patients included in this study. AML cases were chosen to study the APC/C expression pattern because most of the leukemia-associated antigens (LAAs) are linked either to the cell cycle or cell proliferation regulation [41]. The expression of other cell cycle regulatory factors has been previously studied in AML [41,42]. Upregulation of survivin, which is one of the LAAs involved in the cell cycle regulation, has been reported to be associated with poor clinical outcome in AML patients [43]. Moreover, high expression of hyaluronic acidmediated motility (RHAMM) protein, which also affects the cell cycle, differentiation, and proliferation, has been observed in 70% of AML patients [42]. A tissue microarray analysis on 1600 tissue samples involving many types of cancer tissue has showed that APC/C substrates (e.g., securin, Plk1, SKP2, and aurora A) and activator (CDH1) were upregulated in different cancer types. Moreover, a direct correlation between the absence of APC/C substrates and the benign status of the lesions was observed [24]. This was in agreement to our results in patients with progressive AML which showed a high level of APC/C expression. The APC/C complex is composed of 13 different subunits as mention in the introduction which some of them have more than one monomer in the complex [44]. Using Cryo-immuno-EM study, Herzog et al. showed that APC7 and CDC16 contribute to more than one copy in the APC/C complex [45]. In this study, the mean expression ratio between APC2 and APC7 was 1.85 in the cancer cell lines. This may reflect the presence of more than one copy of APC7 in the APC/C complex. In the present study, the expression level of APC/C in patients tumor cells was associated with spelonomagaly (r = 0.808, p = 0.001). This finding provides evidence that high levels of APC/C expression might be associated with AML pathogenesis and cancer progression. However, more comprehensive studies should be conducted on the pattern of APC/C expression in AML. In fact, there are other prognostic markers such as cytogenetic abnormalities and white cell count, which are associated with poor survival in AML patients [41]. 5. Conclusions In conclusion, we found that the expression of two major subunits of the APC/C complex had been up-regulated in various cancer cell lines and AML patients. APC/C plays a major role in two critical phases in the cell cycle (M and G1). The study of APC/C expression in the synchronized cells in these stages may improve our understanding of APC/C function in cancer. Also, the simultaneous study of thyrosin Kinase activity and APC/C expression could help to find the relation between the kinase activity and APC/C expression. Moreover, microarray expression analysis of APC/C substrates, activators and inhibitors in combination with DNA replication and genome stability factors could determine the role of each component in cell cycle changes. Acknowledgments The authors would like to thank the patients for giving the blood samples. Conflict of interests The authors declare that they have no competing interests. Financial disclosure This work was funded by a grant from Pasteur Institute of Iran awarded to PhD student Hamzeh Rahimi.

H. Rahimi et al. / Advances in Medical Sciences 60 (2015) 259–263

References [1] Clijsters L, Ogink J, Wolthuis R. The spindle checkpoint, APC/C(Cdc20), and APC/C(Cdh1) play distinct roles in connecting mitosis to S phase. J Cell Biol 2013;201(June (7)):1013–26. [2] Benanti JA. Coordination of cell growth and division by the ubiquitin-proteasome system. Semin Cell Dev Biol 2012;23(July (5)):492–8. [3] Nakayama KI, Nakayama K. Ubiquitin ligases: cell-cycle control and cancer. Nat Rev Cancer 2006;6(May (5)):369–81. [4] Frescas D, Pagano M. Deregulated proteolysis by the F-box proteins SKP2 and beta-TrCP: tipping the scales of cancer. Nat Rev Cancer 2008;8(June (6)): 438–49. [5] Thornton BR, Ng TM, Matyskiela ME, Carroll CW, Morgan DO, Toczyski DP. An architectural map of the anaphase-promoting complex. Genes Dev 2006;20(February (4)):449–60. [6] Schreiber A, Stengel F, Zhang Z, Enchev RI, Kong EH, Morris EP, et al. Structural basis for the subunit assembly of the anaphase-promoting complex. Nature 2011;470(7333):227–35. [7] Da Fonseca PCA, Kong EH, Zhang Z, Schreiber A, Williams MA, Morris EP, et al. Structures of APC/CCdh1 with substrates identify Cdh1 and Apc10 as the D-box co-receptor. Nature 2011;470(7333):274–80. [8] Yu HT, Peters JM, King RW, Page AM, Hieter P, Kirschner MW. Identification of a cullin homology region in a subunit of the anaphase-promoting complex. Science 1998;279(5354):1219–22. [9] Wang J, Dye BT, Rajashankar KR, Kurinov I, Schulman BA. Insights into anaphase promoting complex TPR subdomain assembly from a CDC26APC6 structure. Nat Struct Mol Biol 2009;16(9):987–9. [10] Lamb JR, Michaud WA, Sikorski RS, Hieter PA. Cdc16p, Cdc23p and Cdc27p form a complex essential for mitosis. EMBO J 1994;13(September (18)): 4321–8. [11] Passmore LA, Booth CR, Venien-Bryan C, Ludtke SJ, Fioretto C, Johnson LN, et al. Structural analysis of the anaphase-promoting complex reveals multiple active sites and insights into polyubiquitylation. Mol Cell 2005;20(December (6)):855–66. [12] Jorgensen PM, Graslund S, Betz R, Stahl S, Larsson C, Hoog C. Characterisation of the human APC1, the largest subunit of the anaphase-promoting complex. Gene 2001;262(1–2):51–9. [13] Primorac I, Musacchio A. Panta rhei: the APC/C at steady state. J Cell Biol 2013;201(April (2)):177–89. [14] Uzunova K, Dye BT, Schutz H, Ladurner R, Petzold G, Toyoda Y, et al. APC15 mediates CDC20 autoubiquitylation by APC/C(MCC) and disassembly of the mitotic checkpoint complex. Nat Struct Mol Biol 2012;19(November (11)): 1116–23. [15] Eguren M, Manchado E, Malumbres M. Non-mitotic functions of the Anaphase-Promoting Complex. Semin Cell Dev Biol 2011;22(August (6)):572–8. [16] Reddy SK, Rape M, Margansky WA, Kirschner MW. Ubiquitination by the anaphase-promoting complex drives spindle checkpoint inactivation. Nature 2007;446(7138):921–5. [17] Turnell AS, Stewart GS, Grand RJA, Rookes SM, Martin A, Yamano H, et al. The APC/C and CBP/p300 cooperate to regulate transcription and cell-cycle progression. Nature 2005;438(7068):690–5. [18] Mailand N, Diffley JFX. CDKs promote DNA replication origin licensing in human cells by protecting Cdc6 from APC/C-dependent proteolysis. Cell 2005;122(6):915–26. [19] Zhang L, Fujita T, Wu G, Xiao X, Wan Y. Phosphorylation of the anaphasepromoting complex/Cdc27 is involved in TGF-beta signaling. J Biol Chem 2011;286(March (12)):10041–50. [20] Colombo SL, Palacios-Callender M, Frakich N, De Leon J, Schmitt CA, Boorn L, et al. Anaphase-promoting complex/cyclosome-Cdh1 coordinates glycolysis and glutaminolysis with transition to S phase in human T lymphocytes. Proc Natl Acad Sci U S A 2010;107(November (44)):18868–73. [21] Jin L, Williamson A, Banerjee S, Philipp I, Rape M. Mechanism of ubiquitinchain formation by the human anaphase-promoting complex. Cell 2008; 133(4):653–65. [22] Pfleger CM, Kirschner MW. The KEN box: an APC recognition signal distinct from the D box targeted by Cdh1. Genes Dev 2000;14(March (6)):655–65. [23] Petroski MD. The ubiquitin system, disease, and drug discovery. BMC Biochem 2008;9(Suppl. 1):S7.

263

[24] Lehman NL, Tibshirani R, Hsu JY, Natkunam Y, Harris BT, West RB, et al. Oncogenic regulators and substrates of the anaphase promoting complex/ cyclosome are frequently overexpressed in malignant tumors. Am J Pathol 2007;170(May (5)):1793–805. [25] Mondal G, Sengupta S, Panda CK, Gollin SM, Saunders WS, Roychoudhury S. Overexpression of Cdc20 leads to impairment of the spindle assembly checkpoint and aneuploidization in oral cancer. Carcinogenesis 2007;28(1):81–92. [26] Smolders L, Teodoro JG. Targeting the anaphase promoting complex: common pathways for viral infection and cancer therapy. Expert Opin Ther Targets 2011;15(June (6)):767–80. [27] Meric F, Lee WP, Sahin A, Zhang H, Kung HJ, Hung MC. Expression profile of tyrosine kinases in breast cancer. Clin Cancer Res 2002;8(February (2)):361–7. [28] Kang Y, Kim JH, Lee TH, Kim TS, Jung WH, Chung HC, et al. Expression of anaphase-promoting complex7 in fibroadenomas and phyllodes tumors of breast. Hum Pathol 2009;40(January (1)):98–107. [29] Fujita T, Liu W, Doihara H, Date H, Wan Y. Dissection of the APCCdh1-Skp2 cascade in breast cancer. Clin Cancer Res 2008;14(April (7)):1966–75. [30] Kim JM, Sohn HY, Yoon SY, Oh JH, Yang JO, Kim JH, et al. Identification of gastric cancer-related genes using a cDNA microarray containing novel expressed sequence tags expressed in gastric cancer cells. Clin Cancer Res 2005;11(January (2 Pt 1)):473–82. [31] Park KH, Choi SE, Eom M, Kang Y. Downregulation of the anaphase-promoting complex (APC)7 in invasive ductal carcinomas of the breast and its clinicopathologic relationships. Breast Cancer Res 2005;7(2):R238–47. [32] Klein D. Quantification using Real-time PCR technology: applications and limitations. Trends Mol Med 2002;8(June (6)):257–60. [33] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using Realtime quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 2001;25(4):402–8. [34] Vodermaier HC, Gieffers C, Maurer-Stroh S, Eisenhaber F, Peters JM. TPR subunits of the anaphase-promoting complex mediate binding to the activator protein CDH1. Curr Biol 2003;13(September (17)):1459–68. [35] Tang Z, Li B, Bharadwaj R, Zhu H, Ozkan E, Hakala K, et al. APC2 Cullin protein and APC11 RING protein comprise the minimal ubiquitin ligase module of the anaphase-promoting complex. Mol Biol Cell 2001;12(December (12)): 3839–51. [36] Leverson JD, Joazeiro CA, Page AM, Huang H, Hieter P, Hunter T. The APC11 RING-H2 finger mediates E2-dependent ubiquitination. Mol Biol Cell 2000;11(July (7)):2315–25. [37] Han D, Kim K, Kim Y, Kang Y, Lee JY. Crystal structure of the N-terminal domain of anaphase-promoting complex subunit 7. J Biol Chem 2009;284(May (22)):15137–46. [38] Kraft C, Herzog F, Gieffers C, Mechtler K, Hagting A, Pines J, et al. Mitotic regulation of the human anaphase-promoting complex by phosphorylation. EMBO J 2003;22(December (24)):6598–609. [39] Kramer ER, Scheuringer N, Podtelejnikov AV, Mann M, Peters JM. Mitotic regulation of the APC activator proteins CDC20 and CDH1. Mol Biol Cell 2000;11(May (5)):1555–69. [40] Wan L, Tan M, Yang J, Inuzuka H, Dai X, Wu T, et al. APC(Cdc20) suppresses apoptosis through targeting Bim for ubiquitination and destruction. Dev Cell 2014;29(May (4)):377–91. [41] Greiner J, Bullinger L, Guinn BA, Dohner H, Schmitt M. Leukemia-associated antigens are critical for the proliferation of acute myeloid leukemia cells. Clin Cancer Res 2008;14(November (22)):7161–6. [42] Greiner J, Ringhoffer M, Taniguchi M, Li L, Schmitt A, Shiku H, et al. mRNA expression of leukemia-associated antigens in patients with acute myeloid leukemia for the development of specific immunotherapies. Int J Cancer 2004;108(February (5)):704–11. [43] Tamm I, Richter S, Oltersdorf D, Creutzig U, Harbott J, Scholz F, et al. High expression levels of x-linked inhibitor of apoptosis protein and survivin correlate with poor overall survival in childhood de novo acute myeloid leukemia. Clin Cancer Res 2004;10(June (11)):3737–44. [44] Zhang Z, Kulkarni K, Hanrahan SJ, Thompson AJ, Barford D. The APC/C subunit Cdc16/Cut9 is a contiguous tetratricopeptide repeat superhelix with a homodimer interface similar to Cdc27. EMBO J 2010;29(November (21)):3733–44. [45] Herzog F, Primorac I, Dube P, Lenart P, Sander B, Mechtler K, et al. Structure of the anaphase-promoting complex/cyclosome interacting with a mitotic checkpoint complex. Science 2009;323(5920):1477–81.