- Email: [email protected]
The expression pattern of Follistatin-like 1 in mouse central nervous system development
Gene Expression Patterns 9 (2009) 532–540
Contents lists available at ScienceDirect
Gene Expression Patterns journal homepage: www.elsevier.com/locate/gep
The expression pattern of Follistatin-like 1 in mouse central nervous system development Yang Yang a,b, Junhua Liu a,b, Huihua Mao a,b, Yu-An Hu a,b,c, Yan Yan a,b, Chunjie Zhao a,b,* a
Key Laboratory of Developmental Genes and Human Diseases, MOE, School of Medicine, Southeast University, 87 Dingjiaoqiao Road, Nanjing, Jiangsu 210009, China Institute of Brain Science, School of Medicine, Southeast University, China c Institute of Laboratory Medicine, Jinling Hospital, 305 East Zhongshan Road, Nanjing 210002, PR China b
a r t i c l e
i n f o
Article history: Received 4 March 2009 Received in revised form 30 June 2009 Accepted 2 July 2009 Available online 10 July 2009 Keywords: Follistatin-like 1 Follistatin Telencephalon Cortex Hippocampus Cortical hem Diencephalon Midbrain Cerebellum Spinal cord Expression pattern Mouse
a b s t r a c t Follistatin-like 1 (Fstl1), also named TSC-36 (TGF-b-stimulated clone 36), was first cloned from the mouse osteoblastic MC3T3-E1 cell line and can be up-regulated by TGF-b. To better study the function of Fstl1 during the development of the mouse central nervous system (CNS), we examined Fstl1 expression in the developing mouse CNS, in detail, by in situ hybridization. Our results show that Fstl1 is strongly expressed in the telencephalon, diencephalon, brainstem, limbic system and spinal cord. In the telencephalon, Fstl1 positive cells are mainly located in the ventricular zone (VZ) and the subventricular zone (SVZ); a relatively weak signal was observed in layers II and III of the neocortex at postnatal stages. Fstl1 expression is robust in the developing hippocampus and persists to P20. In the developing diencephalon and hindbrain, abundant Fstl1 signals were also detected in nuclei including the medial habenular nucleus, the medial dorsal nucleus, the cochlear nuclei and so on. In addition, a strong expression of Fstl1 was detected in the thalamencephalic signal center, as well as in the olfactory cortex from E14.5 to P0. Meanwhile, Fstl1 was expressed in the septal area and the cingulate gyrus of the limbic system after birth. A high level of expression was also observed in the ventral horn of the spinal cord. These results indicate that Fstl1 may play an important role during CNS development in the mouse. Ó 2009 Elsevier B.V. All rights reserved.
1. Results and discussion Fstl1, a secreted extracellular glycoprotein, which is also called TGF-b stimulated clone 36 (TSC-36) (Shibanuma et al., 1993), was first cloned in a cDNA library constructed from mouse osteoblastic MC3T3-E1 cells. The sequence of Fstl1 is quite homologous to Follistatin. Fstl1 is highly conserved in vertebrates. Its Xenopus homologue, xFRP, has about 70% similarity to the mammalian Fstl1, while chicken Flik (avian) has 93% homology. The mRNA of xFRP has been detected in developing neural signal centers such as the Spemann organizer, the notochord and the neural floor plate, suggesting the important role of xFRP in the process of neurulation (Okabayashi et al., 1999). The gene occ1, the homologue of Fstl1 in the macaque, is expressed in the visual cortex and hippocampus (Tochitani et al., 2003a,b; Tochitani et al., 2001). Previous studies show that Flik
* Corresponding author. Address: Key Laboratory of Developmental Genes and Human Diseases, MOE, School of Medicine, Southeast University, 87 Dingjiaoqiao Road, Nanjing, Jiangsu 210009, China. Tel./fax: +86 25 83272340. E-mail address: [email protected] (C. Zhao). 1567-133X/$ - see front matter Ó 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.gep.2009.07.001
is involved in gastrular dorsalization and neural induction and maintaining midline sonic hedgehog signaling. Flik can modulate the activities of bone morphogenetic proteins (BMPs) or act as an inhibitor of the TGF-b signal pathway in a similar way to Follistatin (Towers et al., 1999). Regarding the data of Fstl1 expression in mouse CNS development, some histological information can be found in the Allen Brain Atlas of the adult (http://www.brain-map.org) and the gene paint for E14.5 (http://www.genepaint.org). Adams et al. (2007) reported that Fstl1 was expressed in the choroid plexi and floor plate at E9.5 and E12.5. Fstl1 is also detected in the primary visual cortex in the adult mouse (Takahata et al., 2008). However, a detailed spatial and temporal expression analysis of Fstl1 in the mouse nervous system has not yet been conducted. In order to better understand the role of Fstl1, we examined its expression in detail by in situ hybridization during the development of the CNS in the mouse from E9.5 to adulthood. We have also contributed to the understanding of Fstl1 expression during limb development. Our data will be beneficial to understanding the important role of Fstl1 in the development of the mouse central nervous system.
Y. Yang et al. / Gene Expression Patterns 9 (2009) 532–540
1.1. The expression in the telencephalon At E9.5, a strong expression of Fstl1 was observed in signal centers such as the roof plate and floor plate (Fig. 1A–A00 ), as well as in the neuroepithelium in the forth ventricle at E10.5 (Fig. 1B–B00 ), which coincides with the previous study reported by Adams et al. (2007). From E12.5 to P0, Fstl1 is prominently expressed in the ventricular zone in the anterior telencephalon (Fig. 1C–F). Furthermore, Fstl1 is strongly expressed in the corticostriatal junction, which is located between the ventral pallium and the lateral ganglionic eminence (LGE) (Fig. 1E0 and F0 ) from E14.5 to P0. From E12.5 onwards, a high level of Fstl1 mRNA was also detected mainly in the hippocampal neuroepithelium (Fig. 2A, A0 , B and B0 ), and the expression in the hippocampus (H) was maintained through P20 (Fig. 1D, Fig. 2D00 , E00 and Fig. 3A00 , B00 and C00 ). The level of Fstl1 mRNA was higher in the CA3 region than in CA1 and CA2. However, in the dentate gyrus, the Fstl1 signals were only detected in scattered cells (data not shown). In the adult hippocampus, the expression of Fstl1 was weak (data not shown). In contrast to the high expression level in the hippocampus, moderate hybridization signals of Fstl1 expression were detected in layers II and III of the postnatal neocortex, while staining was weak in layers V and VI from P4 (Fig. 3A) to P20. In the primary
533
visual cortex (VI) and the cingulate cortex (Cg), Fstl1 was expressed in layers II and III from P4 to P20 (Fig. 3A00 0 , B00 0 , C0 00 , D, D0 and E).
1.2. The expression in the diencephalon Fstl1 was remarkably expressed in the epithalamic and hypothalamic neuroepithelium in the diencephalon from E10.5 to E12.5 (Fig. 4A–A00 and B–B00 ). Fig. 4C–C00 shows that the expression of Fstl1 was mainly detected in the anterior thalamic neuroepithelium (atn) at E14.5 in the dorsal thalamus. In the epithalamus, strong hybridization signals could be observed in the medial habenular nucleus (MHb) from E16.5 to P20 (Fig. 2D0 , E0 and Fig. 3A0 , B0 ). Meanwhile, we found that Fstl1 was also expressed in the medial dorsal nucleus (MD) at P4 (Fig. 3C0 ) and was maintained until adulthood. In the dorsal thalamus, nuclei such as the ventrolateral thalamic nucleus (VM), the ventromedial thalamic nucleus (VL) and the ventral postero thalamic nucleus (VP) revealed high levels of Fstl1 mRNA at P20 (Fig. 2C and C0 ), but the expression was not detected in the adult thalamus, except in the medial dorsal nucleus (data not shown). In addition, Fstl1 mRNA was remarkably detected in the pineal recess from E14.5 to P0 (Fig. 4D–F0 ).
Fig. 1. Fstl1 expression in the ventricular zone (VZ) and the subventricular zone (SVZ) at early stages of development. Fstl1 is strongly expressed in the ventricular zone during early developmental stages (A–F). (A0 and B0 ) are high magnification views of the black-boxed regions in (A and B), respectively, showing the high expression of Fstl1 in the roof plates of the forebrain and midbrain. (A0 0 and B0 0 ) are the blue-boxed regions in (A and B), respectively, which indicate a high level of Fstl1 mRNA in the fourth ventricular floor plate. (E, E0 , F and F0 ) show the expression in the corticostriatal junction (CS) at E16.5 and P0. (E0 and F0 ) are the high magnification views of the boxed regions in (E and F), respectively. Abbreviations: F, forebrain; M, mesencephalon; 4V, fourth ventricle; H, hippocampus; AO, anterior olfactory nucleus; LV, lateral ventricle; and ncn, neocortical neuroepithelium. Scale bar: (A and B): 450 lm; (A0 , A0 0 , B0 , B0 0 , E0 and F0 ): 150 lm; (C and D): 600 lm.
534
Y. Yang et al. / Gene Expression Patterns 9 (2009) 532–540
Fig. 2. Fstl1 expression in the early developing telecephalon and diencephalon. (A–B0 ) show highly expressed Fstl1 in the E10.5 and E12.5 midwall. In the telecephalon, Fstl1 was expressed remarkably in the hippocampal plate/hippocampus (H) from E10.5 to P0 (A0 , B0 , D0 0 and E0 0 ). (C0 ) The signal in the cortial hem (hem) at E14.5. In the diencephalon, the Fstl1 staining was found in the medial habenular nucleus (MHb) at E16.5 and P0 (D0 and E0 ). Abbreviations: H, hippocampus; MHb, medial habenular nucleus; hem, cortial hem. Scale bar: (A and B): 450 lm; (A0 and B0 ): 100 lm; (C, D and E): 1000 lm; (D0 , E0 and E0 0 ):200 lm; (C0 , D0 0 and I0 ): 300 lm.
1.3. The expression in the developing brainstem In the developing midbrain, the expression of Fstl1 was observed in the central gray (CG) at E14.5, and could not be detected by P0 (Fig. 5G0 and H). However, an in situ signal was found in the mesencephalic nucleus of the trigeminal nerve (Me5) from P8 to adult (Fig. 5L and M). Strong hybridization signals were evident throughout the pons and the hindbrain, and were especially strong in the facial nucleus (7N) from E16.5 up through adult (Fig. 5A–F0 ). High expression of Fstl1 was also detected in the gigantocellular reticular nucleus (Gi) at E14.5 (Fig. 5G) and was maintained to adult (Fig. 5H L and N). Meanwhile, the Fstl1 mRNA was remarkably observed in the cochlear nucleus from P4 to adult (Fig. 5C, K0 , L0 and M). A recent study also reported that Fstl1 was detected in the adult cochlear nucleus (Takahata et al., 2008). In addition, the expression of Fstl1
in the trigeminal motor nucleus (Mo5) could be observed from P8 to P20 (Fig. 5K and L). 1.4. The expression in the olfactory cortex and limbic system The limbic system includes the hypothalamus, the hippocampus, the amygdala, olfactory cortex and several others nearby areas. The expression of Fstl1 in the hippocampus is described in Section 1.1. Within the olfactory cortex, Fstl1 expression was detected in the anterior olfactory nucleus (AO) from E16.5 to P8 (Fig. 1E, Fig. 6B and C). The expression in the olfactory tubercle (Tu) and the piriform cortex (pir) was first observed at P0 and persisted to adulthood (Fig. 6D00 0 , E000 and F00 ). Outside the olfactory cortex, Fstl1 was also expressed in regions of the limbic system. Our data showed that Fstl1 was positive in the septal area from E16.5 up to adult (Fig. 6A0 , D0 , E0 and F0 ). Strong
Y. Yang et al. / Gene Expression Patterns 9 (2009) 532–540
535
Fig. 3. Fstl1 expression in the developing telecephalon and diencephalon. In the telecephalon, Fstl1 was expressed remarkably in the hippocampus (H) at P4, P8 and p20 (A0 0 , B0 0 and C0 0 ). The expression of Fstl1 was also detected in the layer II and III of the cingulate cortex (Cg) at P4 and P8 (A0 0 0 , B0 0 0 C0 0 0 and F). (D, D0 and E) show the weak signal in the primary visual cortex (VI) at P4 and P8. In the diencephalon, Fstl1 mRNA was prominently detected in the medial habenular nucleus (MHb) at P4 and P8 (A0 and B0 ). In the dorsal thalamic regions, nuclei such as the medial dorsal nucleus (MD), the ventrolateral thalamic nucleus (VL), the ventromedial thalamic nucleus (VM) and the ventral posterior thalamic nucleus (VP) strongly expressed Fstl1 at P20 (C and C0 ). (A0 –D0 ) are the high magnification views of the black-boxed regions in (A–D), respectively. (A0 0 –C0 0 ) are the high magnification views of the blue-boxed regions in (A–C). The high magnifications of the white-boxed regions in (A–C) were reviewed in (A0 0 0 –C0 0 0 ), respectively. Abbreviations: C, cerebral cortex; H, hippocampus; MHb, medial habenular nucleus; Cg, cingulate cortex; VI, primary visual cortex; MD, medial dorsal nucleus; VM, ventromedial thalamic nucleus; VL, ventrolateral thalamic nucleus; VP, ventral postero thalamic nucleus. Scale bar: (A and B): 1000 lm; (A0 , B0 , A0 0 0 , B0 0 0 , C0 0 and C0 0 0 ): 200 lm; (A0 0 , B0 0 , C0 and D0 ):300 lm; (C, D, E and F): 1500 lm.
expression of Fstl1 in the limbic system was observed in the ventrolateral preoptic nucleus (VLPO) as well as the ventromedial preoptic nucleus (VMPO) at P8 and maintained to P20 (Fig. 6D00 and E00 ). It could not be detected in adult.
Adams et al. (2007). We have also found that the Fstl1 mRNA was abundant in the rapid growth zone of the limb from E15.5 to P0 (Fig. 7J, K and K0 ). 2. Experimental procedures
1.5. The expression in the developing spinal cord, dorsal root ganglia and limb In the developing spinal cord, the expression of Fstl1 was restricted to the ventricular zone (VZ) from E12.5 to E16.5, specifically in the floor plate (Fig. 7A0 , B and C), and was not detected in the VZ at P0, while the expression of Fstl1 was observed in the cells of the ventral horn, which was maintained to P4 (Fig. 7D and E). From P8 up to P20, Fstl1 is expressed in cells scattered in the gray substance of the spinal cord (Fig. 7G and I). Additionally, the strong expression of Fstl1 was noted in the dorsal root ganglia (DRG) from E14.5 to P20 (Fig. 7B0 , C0 , F and H), but it was not observed at E12.5 (Fig. 7A). At E9.5 and E12.5, the expression of Fstl1 was observed in limb mesenchyme which is consistent with previously described by
2.1. Animals All experiments were performed using CD-1 mice. The day of vaginal plug detection was defined as embryonic day 0.5 (E0.5), and the day of birth as postnatal day 0 (P0). 2.2. Probe preparation The probe was prepared as previously described in detail (Hu et al., 2008). Briefly, total RNA was isolated from E14.5 CD-1 mouse brain and a 1,141-bp fragment containing all CDS of Fstl1 was amplified by RT-PCR using the following primers: 50 AAGGAAAAAA GCGGCCGCCCCACCTTCGCCTCTA30 and 50 ACGCGTCGACATAAGAT TCGCTGCCATACA30 .
536
Y. Yang et al. / Gene Expression Patterns 9 (2009) 532–540
Fig. 4. Fstl1 expression in the early developing diencephalon. The Fstl1 mRNA was detected in the epithalamic and hypothalamic neuroepitelium at E10.5 and E12.5 (A–B0 0 ). At E14.5, Fstl1 was strongly expressed in the anterior dorsal thalamic neuroepithelium (C0 and C0 0 ). From E14.5 to P0, the expression of Fstl1 was strong in the pineal recess (D–F0 ). High magnifications of the black-boxed regions in (A–F) were reviewed in (A0 –F0 ), respectively. (B0 0 and C0 0 ) are the high magnification views of the blue-boxed regions in (B and C), respectively. Abbreviations: atn, anterior thalamic neuroepithelium; D, dorsal thalamus; V3, third ventricle; and LV, lateral ventricle. Scale bar: (A, B, C, D, E and F): 450 lm; (A0 , A0 0 , B0 and B0 0 ): 100 lm; (C0 , C0 0 , D0 , E0 and F0 ): 200 lm.
Y. Yang et al. / Gene Expression Patterns 9 (2009) 532–540
537
Fig. 5. Fstl1 expression in the developing brainstem. From the early developmental stages up to adulthood, Fstl1 is strongly expressed in the facial nucleus (7N) (A0 –F0 ) and the gigantocellular reticular nucleus (Gi) (G, H0 –J0 , K, L and N). The high magnifications of the black-boxed regions in (A–L) were reviewed in (A0 –L0 ), respectively. The Fstl1 expression was also detected in the central gray (CG) at E14.5 and E16.5 (G0 and H). Positive hybridization signals were found in the mesencephalic nucleus of the trigeminal nerve (Me5) at P20 and also in the adult (L and M). K and L showed the expression of Fstl1 in the trigeminal motor nucleus (Mo5) at P8 and P20. Meanwhile, Fstl1 mRNA was observed in the cochlear nucleus at the postnatal stages of P4, P8, P20 and adult (C, K0 , L0 and M). Abbreviations: CG, central gray; Gi, gigantocellular reticular nucleus; Me5, mesencephalic nucleus of trigeminal nerve; Mo5, trigeminal motor nucleus; and 7N, facial nucleus. Scale bar: (A–N): 1000 lm; (A0 –L0 ): 200 lm.
538
Y. Yang et al. / Gene Expression Patterns 9 (2009) 532–540
Fig. 6. Fstl1 expression in the olfactory cortex and limbic system. The Fstl1 mRNA could be detected in the septal area of the limbic system (A, A0 , D, D0 , E, E0 , F and F0 ). (A0 , D0 , E0 and F0 ) are high magnification views of the black-boxed regions in (A, D, E and F), respectively. The expression of Fstl1 was also observed in the anterior olfactory nucleus (AO) at P0 and P8 (B and C), in the olfactory tubercle (Tu) and in the piriform cortex (Pir) at P8, P20 and adulthood (D0 0 0 , E0 0 0 and F0 0 ). The high magnifications of the blue-boxed regions in (D–F) were reviewed in (D0 –F0 ), respectively. (D0 0 and E0 0 ) show the signals in the ventrolateral preoptic nucleus (VLPO) and the ventromedial preoptic nucleus (VMPO) at P8 and P20. Abbreviations: AO, anterior olfactory nucleus; Tu, olfactory tubercle; Pir, piriform cortex; VMPO, ventromedial preoptic nu and VLPO, ventrolateral preoptic nu. Scale bar: (A, B, C, D, E and F): 1000 lm; (A0 , E0 , E0 0 and F0 ): 200 lm; (D0 –D0 0 0 ): 300 lm; (E0 0 0 ): 100 lm.
2.3. In situ hybridization on cryosections
Acknowledgments
Brains were fixed in 4% paraformaldehyde overnight, cryoprotected in 30% sucrose/DEPC-PBS at 4 °C and then embedded in OCT. Coronal sections (thickness: E11-E16.5: 16 lm, P0: 20 lm, P4-adult: 30 lm) were obtained with a Leica CM 3050S cryostat and stored at 70 °C until use. In situ hybridization was performed as previously described (Zhao et al., 2006). A sense probe was used as a negative control.
We thank Yiquan Wei, Li Liu and Xiaoxuan Lu for technical assistance, as well as Yiping Li and other members in the laboratory for valuable discussions. This work was supported by funds 30525017, 30770696 from The National Nature Science Foundation of China and The National Basic Research Program of China 2007CB512303 from The Ministry of Science and Technology of China to C. Z.
Y. Yang et al. / Gene Expression Patterns 9 (2009) 532–540
539
Fig. 7. Fstl1 expression in the developing spinal cord, dorsal root ganglia and limb. Fstl1 expression was confined to the floor plate of the developing spinal cord at the stages of E12.5, E14.5 and E16.5 (A0 , B and C). At P0 and P4, Fstl1 was examined in the ventral horn (D and E). Fstl1 mRNA was abundant in cells in the gray substance (G and I) at P8 and P20. At E12.5, no in situ labeling was observed in the dorsal root ganglia (DRG) (A). The Fstl1 expression was first detected at E14.5 in the DRG and persisted to P20 (B0 , C0 , F and H). The high magnifications of the blue-boxed regions in (B and C) were reviewed in (B0 and C0 ), respectively. During the development of the limb, at E15.5 and P0, Fstl1 expression was mainly located in the rapid growth zone (J, K and K0 ). Abbreviations: DRG: dorsal root ganglia. Scale bar: (A and B0 ): 300 lm; (B–I): 450 lm; (A0 and J): 200 lm; (K): 1000 lm;(C0 and K0 ): 100 lm.
540
Y. Yang et al. / Gene Expression Patterns 9 (2009) 532–540
References Adams, D., Larman, B., Oxburgh, L., 2007. Developmental expression of mouse Follistatin-like 1 (Fstl1): dynamic regulation during organogenesis of the kidney and lung. Gene Expr. Patterns 7, 491–500. Hu, Y.A., Gu, X., Liu, J., Yang, Y., Yan, Y., Zhao, C., 2008. Expression pattern of Wnt inhibitor factor 1(Wif1) during the development in mouse CNS. Gene Expr. Patterns 8, 515–522. Okabayashi, K., Shoji, H., Onuma, Y., Nakamura, T., Nose, K., Sugino, H., Asashima, M., 1999. CDNA cloning and distribution of the Xenopus follistatin-related protein. Biochem. Biophys. Res. Commun. 254, 42–48. Shibanuma, M., Mashimo, J., Mita, A., Kuroki, T., Nose, K., 1993. Cloning from a mouse osteoblastic cell line of a set of transforming-growth-factor-beta 1regulated genes, one of which seems to encode a follistatin-related polypeptide. Eur. J. Biochem. 217, 13–19. Takahata, T., Hashikawa, T., Higo, N., Tochitani, S., Yamamori, T., 2008. Difference in sensory dependence of occ1/Follistatin-related protein expression between macaques and mice. J. Chem. Neuroanat. 35, 146–157.
Tochitani, S., Hashikawa, T., Yamamori, T., 2003a. Expression of occ1 mRNA in the visual cortex during postnatal development in macaques. Neurosci. Lett. 337, 114–116. Tochitani, S., Hashikawa, T., Yamamori, T., 2003b. Occ1 mRNA expression reveals a characteristic feature in the hippocampal CA2 field of adult macaques. Neurosci. Lett. 346, 105–108. Tochitani, S., Liang, F., Watakabe, A., Hashikawa, T., Yamamori, T., 2001. The occ1 gene is preferentially expressed in the primary visual cortex in an activity-dependent manner: a pattern of gene expression related to the cytoarchitectonic area in adult macaque neocortex. Eur. J. Neurosci. 13, 297–307. Towers, P., Patel, K., Withington, S., Isaac, A., Cooke, J., 1999. Flik, a chick follistatinrelated gene, functions in gastrular dorsalisation/neural induction and in subsequent maintenance of midline Sonic hedgehog signalling. Dev. Biol. 214, 298–317. Zhao, C., Guan, W., Pleasure, S.J., 2006. A transgenic marker mouse line labels CajalRetzius cells from the cortical hem and thalamocortical axons. Brain Res. 1077, 48–53.
Contents lists available at ScienceDirect
Gene Expression Patterns journal homepage: www.elsevier.com/locate/gep
The expression pattern of Follistatin-like 1 in mouse central nervous system development Yang Yang a,b, Junhua Liu a,b, Huihua Mao a,b, Yu-An Hu a,b,c, Yan Yan a,b, Chunjie Zhao a,b,* a
Key Laboratory of Developmental Genes and Human Diseases, MOE, School of Medicine, Southeast University, 87 Dingjiaoqiao Road, Nanjing, Jiangsu 210009, China Institute of Brain Science, School of Medicine, Southeast University, China c Institute of Laboratory Medicine, Jinling Hospital, 305 East Zhongshan Road, Nanjing 210002, PR China b
a r t i c l e
i n f o
Article history: Received 4 March 2009 Received in revised form 30 June 2009 Accepted 2 July 2009 Available online 10 July 2009 Keywords: Follistatin-like 1 Follistatin Telencephalon Cortex Hippocampus Cortical hem Diencephalon Midbrain Cerebellum Spinal cord Expression pattern Mouse
a b s t r a c t Follistatin-like 1 (Fstl1), also named TSC-36 (TGF-b-stimulated clone 36), was first cloned from the mouse osteoblastic MC3T3-E1 cell line and can be up-regulated by TGF-b. To better study the function of Fstl1 during the development of the mouse central nervous system (CNS), we examined Fstl1 expression in the developing mouse CNS, in detail, by in situ hybridization. Our results show that Fstl1 is strongly expressed in the telencephalon, diencephalon, brainstem, limbic system and spinal cord. In the telencephalon, Fstl1 positive cells are mainly located in the ventricular zone (VZ) and the subventricular zone (SVZ); a relatively weak signal was observed in layers II and III of the neocortex at postnatal stages. Fstl1 expression is robust in the developing hippocampus and persists to P20. In the developing diencephalon and hindbrain, abundant Fstl1 signals were also detected in nuclei including the medial habenular nucleus, the medial dorsal nucleus, the cochlear nuclei and so on. In addition, a strong expression of Fstl1 was detected in the thalamencephalic signal center, as well as in the olfactory cortex from E14.5 to P0. Meanwhile, Fstl1 was expressed in the septal area and the cingulate gyrus of the limbic system after birth. A high level of expression was also observed in the ventral horn of the spinal cord. These results indicate that Fstl1 may play an important role during CNS development in the mouse. Ó 2009 Elsevier B.V. All rights reserved.
1. Results and discussion Fstl1, a secreted extracellular glycoprotein, which is also called TGF-b stimulated clone 36 (TSC-36) (Shibanuma et al., 1993), was first cloned in a cDNA library constructed from mouse osteoblastic MC3T3-E1 cells. The sequence of Fstl1 is quite homologous to Follistatin. Fstl1 is highly conserved in vertebrates. Its Xenopus homologue, xFRP, has about 70% similarity to the mammalian Fstl1, while chicken Flik (avian) has 93% homology. The mRNA of xFRP has been detected in developing neural signal centers such as the Spemann organizer, the notochord and the neural floor plate, suggesting the important role of xFRP in the process of neurulation (Okabayashi et al., 1999). The gene occ1, the homologue of Fstl1 in the macaque, is expressed in the visual cortex and hippocampus (Tochitani et al., 2003a,b; Tochitani et al., 2001). Previous studies show that Flik
* Corresponding author. Address: Key Laboratory of Developmental Genes and Human Diseases, MOE, School of Medicine, Southeast University, 87 Dingjiaoqiao Road, Nanjing, Jiangsu 210009, China. Tel./fax: +86 25 83272340. E-mail address: [email protected] (C. Zhao). 1567-133X/$ - see front matter Ó 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.gep.2009.07.001
is involved in gastrular dorsalization and neural induction and maintaining midline sonic hedgehog signaling. Flik can modulate the activities of bone morphogenetic proteins (BMPs) or act as an inhibitor of the TGF-b signal pathway in a similar way to Follistatin (Towers et al., 1999). Regarding the data of Fstl1 expression in mouse CNS development, some histological information can be found in the Allen Brain Atlas of the adult (http://www.brain-map.org) and the gene paint for E14.5 (http://www.genepaint.org). Adams et al. (2007) reported that Fstl1 was expressed in the choroid plexi and floor plate at E9.5 and E12.5. Fstl1 is also detected in the primary visual cortex in the adult mouse (Takahata et al., 2008). However, a detailed spatial and temporal expression analysis of Fstl1 in the mouse nervous system has not yet been conducted. In order to better understand the role of Fstl1, we examined its expression in detail by in situ hybridization during the development of the CNS in the mouse from E9.5 to adulthood. We have also contributed to the understanding of Fstl1 expression during limb development. Our data will be beneficial to understanding the important role of Fstl1 in the development of the mouse central nervous system.
Y. Yang et al. / Gene Expression Patterns 9 (2009) 532–540
1.1. The expression in the telencephalon At E9.5, a strong expression of Fstl1 was observed in signal centers such as the roof plate and floor plate (Fig. 1A–A00 ), as well as in the neuroepithelium in the forth ventricle at E10.5 (Fig. 1B–B00 ), which coincides with the previous study reported by Adams et al. (2007). From E12.5 to P0, Fstl1 is prominently expressed in the ventricular zone in the anterior telencephalon (Fig. 1C–F). Furthermore, Fstl1 is strongly expressed in the corticostriatal junction, which is located between the ventral pallium and the lateral ganglionic eminence (LGE) (Fig. 1E0 and F0 ) from E14.5 to P0. From E12.5 onwards, a high level of Fstl1 mRNA was also detected mainly in the hippocampal neuroepithelium (Fig. 2A, A0 , B and B0 ), and the expression in the hippocampus (H) was maintained through P20 (Fig. 1D, Fig. 2D00 , E00 and Fig. 3A00 , B00 and C00 ). The level of Fstl1 mRNA was higher in the CA3 region than in CA1 and CA2. However, in the dentate gyrus, the Fstl1 signals were only detected in scattered cells (data not shown). In the adult hippocampus, the expression of Fstl1 was weak (data not shown). In contrast to the high expression level in the hippocampus, moderate hybridization signals of Fstl1 expression were detected in layers II and III of the postnatal neocortex, while staining was weak in layers V and VI from P4 (Fig. 3A) to P20. In the primary
533
visual cortex (VI) and the cingulate cortex (Cg), Fstl1 was expressed in layers II and III from P4 to P20 (Fig. 3A00 0 , B00 0 , C0 00 , D, D0 and E).
1.2. The expression in the diencephalon Fstl1 was remarkably expressed in the epithalamic and hypothalamic neuroepithelium in the diencephalon from E10.5 to E12.5 (Fig. 4A–A00 and B–B00 ). Fig. 4C–C00 shows that the expression of Fstl1 was mainly detected in the anterior thalamic neuroepithelium (atn) at E14.5 in the dorsal thalamus. In the epithalamus, strong hybridization signals could be observed in the medial habenular nucleus (MHb) from E16.5 to P20 (Fig. 2D0 , E0 and Fig. 3A0 , B0 ). Meanwhile, we found that Fstl1 was also expressed in the medial dorsal nucleus (MD) at P4 (Fig. 3C0 ) and was maintained until adulthood. In the dorsal thalamus, nuclei such as the ventrolateral thalamic nucleus (VM), the ventromedial thalamic nucleus (VL) and the ventral postero thalamic nucleus (VP) revealed high levels of Fstl1 mRNA at P20 (Fig. 2C and C0 ), but the expression was not detected in the adult thalamus, except in the medial dorsal nucleus (data not shown). In addition, Fstl1 mRNA was remarkably detected in the pineal recess from E14.5 to P0 (Fig. 4D–F0 ).
Fig. 1. Fstl1 expression in the ventricular zone (VZ) and the subventricular zone (SVZ) at early stages of development. Fstl1 is strongly expressed in the ventricular zone during early developmental stages (A–F). (A0 and B0 ) are high magnification views of the black-boxed regions in (A and B), respectively, showing the high expression of Fstl1 in the roof plates of the forebrain and midbrain. (A0 0 and B0 0 ) are the blue-boxed regions in (A and B), respectively, which indicate a high level of Fstl1 mRNA in the fourth ventricular floor plate. (E, E0 , F and F0 ) show the expression in the corticostriatal junction (CS) at E16.5 and P0. (E0 and F0 ) are the high magnification views of the boxed regions in (E and F), respectively. Abbreviations: F, forebrain; M, mesencephalon; 4V, fourth ventricle; H, hippocampus; AO, anterior olfactory nucleus; LV, lateral ventricle; and ncn, neocortical neuroepithelium. Scale bar: (A and B): 450 lm; (A0 , A0 0 , B0 , B0 0 , E0 and F0 ): 150 lm; (C and D): 600 lm.
534
Y. Yang et al. / Gene Expression Patterns 9 (2009) 532–540
Fig. 2. Fstl1 expression in the early developing telecephalon and diencephalon. (A–B0 ) show highly expressed Fstl1 in the E10.5 and E12.5 midwall. In the telecephalon, Fstl1 was expressed remarkably in the hippocampal plate/hippocampus (H) from E10.5 to P0 (A0 , B0 , D0 0 and E0 0 ). (C0 ) The signal in the cortial hem (hem) at E14.5. In the diencephalon, the Fstl1 staining was found in the medial habenular nucleus (MHb) at E16.5 and P0 (D0 and E0 ). Abbreviations: H, hippocampus; MHb, medial habenular nucleus; hem, cortial hem. Scale bar: (A and B): 450 lm; (A0 and B0 ): 100 lm; (C, D and E): 1000 lm; (D0 , E0 and E0 0 ):200 lm; (C0 , D0 0 and I0 ): 300 lm.
1.3. The expression in the developing brainstem In the developing midbrain, the expression of Fstl1 was observed in the central gray (CG) at E14.5, and could not be detected by P0 (Fig. 5G0 and H). However, an in situ signal was found in the mesencephalic nucleus of the trigeminal nerve (Me5) from P8 to adult (Fig. 5L and M). Strong hybridization signals were evident throughout the pons and the hindbrain, and were especially strong in the facial nucleus (7N) from E16.5 up through adult (Fig. 5A–F0 ). High expression of Fstl1 was also detected in the gigantocellular reticular nucleus (Gi) at E14.5 (Fig. 5G) and was maintained to adult (Fig. 5H L and N). Meanwhile, the Fstl1 mRNA was remarkably observed in the cochlear nucleus from P4 to adult (Fig. 5C, K0 , L0 and M). A recent study also reported that Fstl1 was detected in the adult cochlear nucleus (Takahata et al., 2008). In addition, the expression of Fstl1
in the trigeminal motor nucleus (Mo5) could be observed from P8 to P20 (Fig. 5K and L). 1.4. The expression in the olfactory cortex and limbic system The limbic system includes the hypothalamus, the hippocampus, the amygdala, olfactory cortex and several others nearby areas. The expression of Fstl1 in the hippocampus is described in Section 1.1. Within the olfactory cortex, Fstl1 expression was detected in the anterior olfactory nucleus (AO) from E16.5 to P8 (Fig. 1E, Fig. 6B and C). The expression in the olfactory tubercle (Tu) and the piriform cortex (pir) was first observed at P0 and persisted to adulthood (Fig. 6D00 0 , E000 and F00 ). Outside the olfactory cortex, Fstl1 was also expressed in regions of the limbic system. Our data showed that Fstl1 was positive in the septal area from E16.5 up to adult (Fig. 6A0 , D0 , E0 and F0 ). Strong
Y. Yang et al. / Gene Expression Patterns 9 (2009) 532–540
535
Fig. 3. Fstl1 expression in the developing telecephalon and diencephalon. In the telecephalon, Fstl1 was expressed remarkably in the hippocampus (H) at P4, P8 and p20 (A0 0 , B0 0 and C0 0 ). The expression of Fstl1 was also detected in the layer II and III of the cingulate cortex (Cg) at P4 and P8 (A0 0 0 , B0 0 0 C0 0 0 and F). (D, D0 and E) show the weak signal in the primary visual cortex (VI) at P4 and P8. In the diencephalon, Fstl1 mRNA was prominently detected in the medial habenular nucleus (MHb) at P4 and P8 (A0 and B0 ). In the dorsal thalamic regions, nuclei such as the medial dorsal nucleus (MD), the ventrolateral thalamic nucleus (VL), the ventromedial thalamic nucleus (VM) and the ventral posterior thalamic nucleus (VP) strongly expressed Fstl1 at P20 (C and C0 ). (A0 –D0 ) are the high magnification views of the black-boxed regions in (A–D), respectively. (A0 0 –C0 0 ) are the high magnification views of the blue-boxed regions in (A–C). The high magnifications of the white-boxed regions in (A–C) were reviewed in (A0 0 0 –C0 0 0 ), respectively. Abbreviations: C, cerebral cortex; H, hippocampus; MHb, medial habenular nucleus; Cg, cingulate cortex; VI, primary visual cortex; MD, medial dorsal nucleus; VM, ventromedial thalamic nucleus; VL, ventrolateral thalamic nucleus; VP, ventral postero thalamic nucleus. Scale bar: (A and B): 1000 lm; (A0 , B0 , A0 0 0 , B0 0 0 , C0 0 and C0 0 0 ): 200 lm; (A0 0 , B0 0 , C0 and D0 ):300 lm; (C, D, E and F): 1500 lm.
expression of Fstl1 in the limbic system was observed in the ventrolateral preoptic nucleus (VLPO) as well as the ventromedial preoptic nucleus (VMPO) at P8 and maintained to P20 (Fig. 6D00 and E00 ). It could not be detected in adult.
Adams et al. (2007). We have also found that the Fstl1 mRNA was abundant in the rapid growth zone of the limb from E15.5 to P0 (Fig. 7J, K and K0 ). 2. Experimental procedures
1.5. The expression in the developing spinal cord, dorsal root ganglia and limb In the developing spinal cord, the expression of Fstl1 was restricted to the ventricular zone (VZ) from E12.5 to E16.5, specifically in the floor plate (Fig. 7A0 , B and C), and was not detected in the VZ at P0, while the expression of Fstl1 was observed in the cells of the ventral horn, which was maintained to P4 (Fig. 7D and E). From P8 up to P20, Fstl1 is expressed in cells scattered in the gray substance of the spinal cord (Fig. 7G and I). Additionally, the strong expression of Fstl1 was noted in the dorsal root ganglia (DRG) from E14.5 to P20 (Fig. 7B0 , C0 , F and H), but it was not observed at E12.5 (Fig. 7A). At E9.5 and E12.5, the expression of Fstl1 was observed in limb mesenchyme which is consistent with previously described by
2.1. Animals All experiments were performed using CD-1 mice. The day of vaginal plug detection was defined as embryonic day 0.5 (E0.5), and the day of birth as postnatal day 0 (P0). 2.2. Probe preparation The probe was prepared as previously described in detail (Hu et al., 2008). Briefly, total RNA was isolated from E14.5 CD-1 mouse brain and a 1,141-bp fragment containing all CDS of Fstl1 was amplified by RT-PCR using the following primers: 50 AAGGAAAAAA GCGGCCGCCCCACCTTCGCCTCTA30 and 50 ACGCGTCGACATAAGAT TCGCTGCCATACA30 .
536
Y. Yang et al. / Gene Expression Patterns 9 (2009) 532–540
Fig. 4. Fstl1 expression in the early developing diencephalon. The Fstl1 mRNA was detected in the epithalamic and hypothalamic neuroepitelium at E10.5 and E12.5 (A–B0 0 ). At E14.5, Fstl1 was strongly expressed in the anterior dorsal thalamic neuroepithelium (C0 and C0 0 ). From E14.5 to P0, the expression of Fstl1 was strong in the pineal recess (D–F0 ). High magnifications of the black-boxed regions in (A–F) were reviewed in (A0 –F0 ), respectively. (B0 0 and C0 0 ) are the high magnification views of the blue-boxed regions in (B and C), respectively. Abbreviations: atn, anterior thalamic neuroepithelium; D, dorsal thalamus; V3, third ventricle; and LV, lateral ventricle. Scale bar: (A, B, C, D, E and F): 450 lm; (A0 , A0 0 , B0 and B0 0 ): 100 lm; (C0 , C0 0 , D0 , E0 and F0 ): 200 lm.
Y. Yang et al. / Gene Expression Patterns 9 (2009) 532–540
537
Fig. 5. Fstl1 expression in the developing brainstem. From the early developmental stages up to adulthood, Fstl1 is strongly expressed in the facial nucleus (7N) (A0 –F0 ) and the gigantocellular reticular nucleus (Gi) (G, H0 –J0 , K, L and N). The high magnifications of the black-boxed regions in (A–L) were reviewed in (A0 –L0 ), respectively. The Fstl1 expression was also detected in the central gray (CG) at E14.5 and E16.5 (G0 and H). Positive hybridization signals were found in the mesencephalic nucleus of the trigeminal nerve (Me5) at P20 and also in the adult (L and M). K and L showed the expression of Fstl1 in the trigeminal motor nucleus (Mo5) at P8 and P20. Meanwhile, Fstl1 mRNA was observed in the cochlear nucleus at the postnatal stages of P4, P8, P20 and adult (C, K0 , L0 and M). Abbreviations: CG, central gray; Gi, gigantocellular reticular nucleus; Me5, mesencephalic nucleus of trigeminal nerve; Mo5, trigeminal motor nucleus; and 7N, facial nucleus. Scale bar: (A–N): 1000 lm; (A0 –L0 ): 200 lm.
538
Y. Yang et al. / Gene Expression Patterns 9 (2009) 532–540
Fig. 6. Fstl1 expression in the olfactory cortex and limbic system. The Fstl1 mRNA could be detected in the septal area of the limbic system (A, A0 , D, D0 , E, E0 , F and F0 ). (A0 , D0 , E0 and F0 ) are high magnification views of the black-boxed regions in (A, D, E and F), respectively. The expression of Fstl1 was also observed in the anterior olfactory nucleus (AO) at P0 and P8 (B and C), in the olfactory tubercle (Tu) and in the piriform cortex (Pir) at P8, P20 and adulthood (D0 0 0 , E0 0 0 and F0 0 ). The high magnifications of the blue-boxed regions in (D–F) were reviewed in (D0 –F0 ), respectively. (D0 0 and E0 0 ) show the signals in the ventrolateral preoptic nucleus (VLPO) and the ventromedial preoptic nucleus (VMPO) at P8 and P20. Abbreviations: AO, anterior olfactory nucleus; Tu, olfactory tubercle; Pir, piriform cortex; VMPO, ventromedial preoptic nu and VLPO, ventrolateral preoptic nu. Scale bar: (A, B, C, D, E and F): 1000 lm; (A0 , E0 , E0 0 and F0 ): 200 lm; (D0 –D0 0 0 ): 300 lm; (E0 0 0 ): 100 lm.
2.3. In situ hybridization on cryosections
Acknowledgments
Brains were fixed in 4% paraformaldehyde overnight, cryoprotected in 30% sucrose/DEPC-PBS at 4 °C and then embedded in OCT. Coronal sections (thickness: E11-E16.5: 16 lm, P0: 20 lm, P4-adult: 30 lm) were obtained with a Leica CM 3050S cryostat and stored at 70 °C until use. In situ hybridization was performed as previously described (Zhao et al., 2006). A sense probe was used as a negative control.
We thank Yiquan Wei, Li Liu and Xiaoxuan Lu for technical assistance, as well as Yiping Li and other members in the laboratory for valuable discussions. This work was supported by funds 30525017, 30770696 from The National Nature Science Foundation of China and The National Basic Research Program of China 2007CB512303 from The Ministry of Science and Technology of China to C. Z.
Y. Yang et al. / Gene Expression Patterns 9 (2009) 532–540
539
Fig. 7. Fstl1 expression in the developing spinal cord, dorsal root ganglia and limb. Fstl1 expression was confined to the floor plate of the developing spinal cord at the stages of E12.5, E14.5 and E16.5 (A0 , B and C). At P0 and P4, Fstl1 was examined in the ventral horn (D and E). Fstl1 mRNA was abundant in cells in the gray substance (G and I) at P8 and P20. At E12.5, no in situ labeling was observed in the dorsal root ganglia (DRG) (A). The Fstl1 expression was first detected at E14.5 in the DRG and persisted to P20 (B0 , C0 , F and H). The high magnifications of the blue-boxed regions in (B and C) were reviewed in (B0 and C0 ), respectively. During the development of the limb, at E15.5 and P0, Fstl1 expression was mainly located in the rapid growth zone (J, K and K0 ). Abbreviations: DRG: dorsal root ganglia. Scale bar: (A and B0 ): 300 lm; (B–I): 450 lm; (A0 and J): 200 lm; (K): 1000 lm;(C0 and K0 ): 100 lm.
540
Y. Yang et al. / Gene Expression Patterns 9 (2009) 532–540
References Adams, D., Larman, B., Oxburgh, L., 2007. Developmental expression of mouse Follistatin-like 1 (Fstl1): dynamic regulation during organogenesis of the kidney and lung. Gene Expr. Patterns 7, 491–500. Hu, Y.A., Gu, X., Liu, J., Yang, Y., Yan, Y., Zhao, C., 2008. Expression pattern of Wnt inhibitor factor 1(Wif1) during the development in mouse CNS. Gene Expr. Patterns 8, 515–522. Okabayashi, K., Shoji, H., Onuma, Y., Nakamura, T., Nose, K., Sugino, H., Asashima, M., 1999. CDNA cloning and distribution of the Xenopus follistatin-related protein. Biochem. Biophys. Res. Commun. 254, 42–48. Shibanuma, M., Mashimo, J., Mita, A., Kuroki, T., Nose, K., 1993. Cloning from a mouse osteoblastic cell line of a set of transforming-growth-factor-beta 1regulated genes, one of which seems to encode a follistatin-related polypeptide. Eur. J. Biochem. 217, 13–19. Takahata, T., Hashikawa, T., Higo, N., Tochitani, S., Yamamori, T., 2008. Difference in sensory dependence of occ1/Follistatin-related protein expression between macaques and mice. J. Chem. Neuroanat. 35, 146–157.
Tochitani, S., Hashikawa, T., Yamamori, T., 2003a. Expression of occ1 mRNA in the visual cortex during postnatal development in macaques. Neurosci. Lett. 337, 114–116. Tochitani, S., Hashikawa, T., Yamamori, T., 2003b. Occ1 mRNA expression reveals a characteristic feature in the hippocampal CA2 field of adult macaques. Neurosci. Lett. 346, 105–108. Tochitani, S., Liang, F., Watakabe, A., Hashikawa, T., Yamamori, T., 2001. The occ1 gene is preferentially expressed in the primary visual cortex in an activity-dependent manner: a pattern of gene expression related to the cytoarchitectonic area in adult macaque neocortex. Eur. J. Neurosci. 13, 297–307. Towers, P., Patel, K., Withington, S., Isaac, A., Cooke, J., 1999. Flik, a chick follistatinrelated gene, functions in gastrular dorsalisation/neural induction and in subsequent maintenance of midline Sonic hedgehog signalling. Dev. Biol. 214, 298–317. Zhao, C., Guan, W., Pleasure, S.J., 2006. A transgenic marker mouse line labels CajalRetzius cells from the cortical hem and thalamocortical axons. Brain Res. 1077, 48–53.