The extracellular matrix protein Del1 induces apoptosis via its epidermal growth factor motif

Biochemical and Biophysical Research Communications 393 (2010) 757–761

Contents lists available at ScienceDirect

Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc

The extracellular matrix protein Del1 induces apoptosis via its epidermal growth factor motif Hisataka Kitano a, Shinichiro Kokubun b, Chiaki Hidai b,* a b

Division of Dental Surgery, Nihon University School of Medicine, Tokyo 173-8610, Japan Division of Physiology, Department of Biomedical Science, Nihon University School of Medicine, Tokyo 173-8610, Japan

a r t i c l e

i n f o

Article history: Received 6 February 2010 Available online 18 February 2010 Keywords: Apoptosis Epidermal growth factor motif Extracellular matrix

a b s t r a c t Mouse Del1 is an extracellular matrix protein mainly expressed in the developing embryo. Del1 has three EGF motifs and two discoidin domains. The second EGF motif reportedly contains an RGD sequence that binds to integrin receptors. Here, we provide evidence that Del1 protein induces cell death in vitro. Chromatin condensation and DNA laddering were observed, suggestive of apoptosis. The results of analysis using the TUNEL method and annexin V staining were also consistent with apoptosis. The apoptosisinducing activity of Del1 could be mapped to the third EGF motif, which fitted the consensus sequence CX(D/N)XXXX(F/Y)XCXC, wherein the aspartic acid residue (D) could be b-hydroxylated. As little as twenty-five picomolar of recombinant E3 could induce apoptosis. Ó 2010 Elsevier Inc. All rights reserved.

Introduction

Materials and methods

Most cells cannot survive without adhering to the extracellular matrix (ECM) via integrins. However, some ECM proteins induce cell death [1]. For example, CCN1 protein induces apoptosis in fibroblasts via integrin a6b1 and syndecan-4 [2,3]. In addition, Elastin Microfibril Interface Located Protein-2 (EMILIN2) induces cell death through DR4 and DR5, the receptors for TNF-related apoptosis-inducing ligand (TRAIL) [4]. ECM controls cell behavior by providing either pro-survival or pro-death signals to cells. Del1 is observed at branchless cavities such as the heart and umbilical veins, and in avascular tissue with hypertrophic chondrocytes in developing embryos [5]. In transgenic mice, constitutive expression of Del1 results in a decrease in the total volume of the vascular bed [6]. These data suggest that Del1 protein is anti-angiogenic. However, there is some evidence that Del1 is pro-angiogenic. Zhong et al. have reported that Del1 can stimulate angiogenesis in ischemic model animals [7]. Additionally, it has been found that Del1 accelerates tumor growth by enhancing vascular formation [8]. Del1 consists of five domains: three epidermal growth factor (EGF) repeat domains (E1, E2, and E3) and two Discoidin domains (C1, C2). E2 contains an RGD sequence, which has been reported to bind to integrin avb3 or a5b3. In the present study, we provide evidence that E3 induces apoptosis in vitro.

DNA constructs. Mouse Del1 cDNA in pcDNA3 (Invitrogen, Carlsbad, CA) was a gift from Dr. Quertermous. Del1 cDNA was amplified by polymerase chain reaction (PCR) using primers (Table 1) containing BglII or BamHI restriction sites and cloned into pEYFP (Takara, Ohts, Japan). The plasmid, pEYFP/Del1 expresses recombinant Del1 protein with the enhanced yellow–green fluorescent protein fused to the N-terminus of Del1. Several alkaline phosphatase (AP) fusion proteins were generated as previously described [9]. Full-length mouse Del1 cDNA and cDNA fragments were amplified by PCR using primers (Table 1) containing BglII or XhoI restriction sites. The amplified cDNAs were then digested using BglII and XhoI, and inserted into the pAPtag-4 vector (GenHunter, Nashville, TN). The resulting constructs encode the cDNA fragments fused to the C-terminus of the heat-stable placental alkaline phosphatase, which contains an N-terminal signal peptide for secretion. The constructs were named according to region of the Del1 coding region present in the construct. Mutant constructs for Del1 and E3 were generated using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) according to the manufacturer’s protocol. Aspartic acid residues at position 136 of Del1 and E3 were replaced by glutamic acid in pAP-Del1D136E and pAP-E3D136E, respectively. An aspartic acid residue at position 136 and a tyrosine at position 141 of E3 were replaced by an asparagine and a phenylalanine residue in pAP-E3D136 N and pAP-E3Y141F, respectively. The cDNA encoding E3 was amplified by PCR using the primer pair shown in Table 1 and subcloned into the pET SUMO vector (Invitrogen), generating an open reading frame encoding His-SUMO-tagged E3.

* Corresponding author. Division of Physiology, Department of Biomedical Science, University School of Medicine, 30-1 Oyaguchikami-cho, Itabashi-ku, Tokyo 162-8666, Japan. Fax: +81 3 3972 8292. E-mail address: [email protected] (C. Hidai). 0006-291X/$ - see front matter Ó 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2010.02.076

758

H. Kitano et al. / Biochemical and Biophysical Research Communications 393 (2010) 757–761

Table 1 Primers pairs for PCR. Fragment

Forward primer

Reverse primer

Del1 E1 E2 E3 C1C2

tgcaacccgaaccctgtgaaaatggt tgcaacccgaacccctgtgaaaatggt tgcatccctaacccatgccataacggag tgtgaagctgagccttgcagaatggcgga aaatgctctgggccattgggaatcgaag

ttcctcctctgcgcagcccagcagc ccctggacgacttcatccgaaaagaa aagtaaatataacacgactgtcacttag tataactgttaaagcagggtatttaaga ttcctcctctgcgcagcccagcagc

His-SUMO-tagged chloramphenicol acetyl transferase (His-SUMOCAT) was used as a negative control. All constructs were confirmed by sequencing. Cell culture. COS-7 and CHO cells were purchased from ATCC. Pro5 cells (a yolk sac cell line with endothelial cell characteristics) [5] were kindly provided by Dr. Quertermous and CRL cells (a human melanoma-derived cell line) were kindly provided by Dr. Hayashido. The cells were grown in a-minimum essential medium (Invitrogen) supplemented with 10% fetal bovine serum (FBS) and 0.2% mM b-mercaptoethanol at 37 °C in an atmosphere containing 5% CO2. MEL cells (a Murine erythroleukemia cell line), a gift from Dr. Yamanaka, were cultured in Dulbecco’s minimum essential medium (Invitrogen) supplemented with 10% fetal bovine serum (FBS) at 37 °C in an atmosphere containing 5% CO2. Reagents. His-SUMO-tagged proteins were isolated using the Ni–NTA purification system (Invitrogen) according to the manufacturer’s protocol. Conditioned medium containing Del1 or AP fusion proteins was prepared using CHO cells as previously described [10]. Because AP activities varied according to the DNA constructs, the amount of conditioned medium used for experiments was standardized to AP activity. Medium from cells transfected with pAPtag-4 was used as a negative control conditioned medium. Anti-vinculin and anti-a-tubulin antibodies were purchased from Chemicom (Billerica, MA) and Oncogene (Cambridge, MA), respectively. Anti-caspase-3, anti-caspase-7, anti-caspase-8, anticaspase-9, anti-FAK (focal adhesion kinase), and anti-pFAK antibodies were purchased from Cell Signaling Technology (Beverly, MA). The anti-caspase antibodies can recognize both full-length and cleaved active fragments. The caspase inhibitor Z-VAD-FMK was purchased from R&D systems (Minneapolis, MN). Induction and analysis of apoptosis with Del1: COS-7 cells were cultured at 30% confluency in 24-well plates for 2 days, during which time cells are able to generate and make contact with an endogenous ECM. The cells were transfected with pcDNA3/Del1 using jet-PEI (PolyPlus-transfection; San Marcos, CA). Mock vector was used as a negative control. Cells were cultured for 24 h prior to analysis. Because the efficiency of transfection into Pro5 or CRL cells was not efficient, we used the conditioned medium by CHO cells with the over-expression vector pcDNA3 to drive expression of Del1 at high levels. Pro5 and CRL cells were cultured for 24 h after addition of Del1 conditioned medium and were then analyzed. In the experiments with Z-VAD-FMK, 10 mM of Z-VADFMK was used with His-SUMO-tagged E3 protein or control protein. To stain apoptotic cells with annexin V, cells were incubated with Alexa fluor 568 conjugated annexin V (Invitrogen) for 20 min at room temperature and fixed with 4% PFA before microscopic examination. To detect condensed chromatin in the nuclei of apoptotic cells, cells were stained with Hoechst 33342 (Invitrogen) for 20 min at room temperature. For in situ detection of DNA fragmentation, TACS2 TdT-blue label in situ apoptosis detection kit (Trevigen, Gaithersburg, MD) was used according to the manufacturer’s protocol. Cells were counterstained with Nuclear Fast Red. To detect laddering of genomic DNA, the TACS apoptotic DNA laddering kit (Trevigen) was used to extract genomic DNA; then, the DNA was separated by electrophoresis on a 5–20% gradient

polyacrylamide gel and stained using an Ez silver stain kit (Atto, Tokyo, Japan). An LDH cytotoxicity detection kit (Takara) was used for semiquantitative analysis of cell death [11,12]. Released lactate dehydrogenase (LDH) in the medium was measured according to the manufacturer’s protocol. The value obtained with an untreated negative control sample was set to 0 and the value obtained with the positive control sample treated with 1% Triton-X100 was set to 100. To count the number of surviving cells, cells were harvested with trypsin EDTA, stained with Trypan blue, and counted using a counting chamber. The influence of Del1 transfection on adjacent cells was examined as follows. COS-7 cells were plated at 30% confluence, cultured for 48 h, and then transfected with pEFYP/Del1. Twentyfour hours post-transfection, cells were fixed with 4% PFA and stained with Hoechst 33342. Identification of the active center. To identify a domain responsible for induction of apoptosis, we tested a set of AP fusion proteins constructs corresponding to full-length Del1, specific sub-regions of Del1, and mutant forms of Del1. COS-7 cells were cultured in a 24-well dish and transfected with 1 lg of DNA encoding an AP fusion protein. To standardize transfection efficiency, 0.1 lg of cDNA for LacZ was co-transfected with the experimental plasmid. Fortyeight hours post-transfection, media were harvested to measure LDH, and cells were lysed to measure b-galactosidase activity using a b-galactosidase enzyme assay system (Promega, Madison, WI). The value of b-galactosidase activity in the negative control sample transfected with pAPtag-4 was set to 1. Released LDH levels were standardized to b-galactosidase activity. The apoptosis-inducing activity of E3 was confirmed by treatment of COS-7 cells with 500 pM of a recombinant protein, His-SUMO-tagged E3 and staining with Hoechst 33342 to visualize nuclei. COS-7, CRL, Pro5, and MEL cells were plated at 30% confluency and cultured for 24 h in the presence of various concentrations of His-SUMO-tagged E3. His-SUMO-tagged CAT protein was used as a negative control. The levels of released LDH were measured as described above. Immunoblotting. Because the antibodies we had available detected human caspases and FAK, CRL cells were employed for experiments. The cells were cultured for 48 h to allow them to reach 50% confluency and then, 10 ng/ml of the His-SUMO-tagged E3 protein were added. His-SUMO-tagged CAT protein was used as a negative control. The cells were cultured for 24 h (to detect caspases) or 1 to 30 min (FAK). The cells were washed with 1 mM of sodium orthovanadate and harvested with Laemmli’s sample buffer. The protein samples were separated by SDS–PAGE and transferred to a PVDF membrane (Atto, Tokyo, Japan). The membrane was treated with anti-caspase, anti-FAK, or anti-a-tubulin antibodies, followed by incubation with a horseradish peroxidase-conjugated secondary antibody, and immunoreactive proteins were detected using the ECL Advance Western Blotting Detection Kit (Amersham, Piscataway, NJ). Densitometric analysis was performed with a CS analyzer 3 (Atto). The experiment was repeated three times and representative data are shown. Statistical analysis. Results are expressed as mean ± SEM. Dunn test or the Wilcoxon test were performed as appropriate and statistical significance was defined as P < 0.01.

Results We first asked if transfection of COS-7 cells with a cDNA that encodes Del1 could induce cell death. We found that some cells treated with Del1 cDNA underwent cell death within 24 h (Fig. 1A, B). Staining with Hoechst 33342 showed that detaching, round cells had condensed chromosomes, suggesting that these cells were going into apoptosis (Fig. 1C, D). Additional evidence for apoptosis

H. Kitano et al. / Biochemical and Biophysical Research Communications 393 (2010) 757–761

Fig. 1. Induced apoptosis in COS-7 cells transfected with Del1 cDNA. COS-7 cells transfected with pcDNA3 vector (A, C, E, G) or cDNA of Del1 (B, D, F, H). Panels A and C, and B and D, are the same views by phase contrast microscopy (A, B) or fluorescent microscopy (C, D). Cells were stained with Hoechst 33342 (blue) and annexin V (red) (E, F). Results of in situ detection of DNA fragmentation is shown in panels G and H. Arrows indicate positively stained nuclei (G, H). (I), laddering of genomic DNA. (J), release of LDH, which is indicative of cell death and (K), the number of surviving cells. COS-7 cells were transfected with pEYFP/Del1 (L) and stained with Hoechst 33342 (M). (N), merged image. CRL (O) and Pro5 cells (P) were treated with Del1 conditioned medium and then stained with Hoechst 33342 (blue) and annexin V (red).Bars indicate 20 lm. The results are reported as mean ± SEM (n = 6). *P < 0.01.

759

came from staining cells with annexin V. Consistent with apoptotic cell death, the cell membranes of the detaching cells were positive for annexin V (Fig. 1E, F). The results of a TUNEL assay also suggest that Del1 can induce apoptosis (Fig. 1G, H). Furthermore, we looked at DNA laddering, another hallmark of apoptotic cell death. Transfection of Del1 cDNA into cells led to laddering of the genomic DNA (Fig. 1I). Based on these results, we conclude that ectopic expression of Del1 leads to apoptotic cell death. A remaining concern, however, was the observation that transfection reagents can be cytotoxic. To confirm that the cell death we observed was not simply due to an adverse effect of the transfection reagent, we compared the levels of LDH that had leaked into the cell culture supernatant among cells transfected with mock vector or pcDNA3/Del1. The amount of released LDH activity into medium is correlated with the number of apoptotic cells to an extent [11]. The activity of the released LDH was 34% of that found for positive control cells treated with 1% Triton-X100. To directly quantitate the proportion of cell death in the cell population, the number of surviving cells was counted. The level of survival was 20% less in cells transfected with Del1 cDNA than for mock-transfected cells (Fig. 1K). There remained the possibility that the cell death observed in Del1-treated cells was induced by gross over-expression of an exogenous protein. To ask if apoptosis was due to secreted Del1, the cells adjacent to transfected cells were observed using a plasmid encoding Del1 fused with EYFP. We observed that not only the cells expressing EYFP-Del1 fusion protein but also adjacent cells show chromosome condensation, consistent with induction of cell death via Del1 secreted by EYFP-Del1-expressing cells (Fig. 1L, M, N). To determine if the effect we observed with Del1 is cell type specific, the effects of Del on other cell types were tested. Specifically, we tested CRL cells (human melanoma-derived cells) (Fig. 1O) and Pro5 cells (mouse yolk sac-derived cells) (Fig. 1P). As transfection is inefficient in both cell types, treatment with culture medium conditioned by CHO cells that had been transfected with Del1 cDNA was used instead of transfection. After 24 h of treatment with Del1 conditioned medium, chromosome condensation and annexin V staining were observed in some cells. Laddering of the genomic DNA was detected in both cell types (data not shown). We next used a set of deletion constructs to experimentally determine the location of the apoptosis-inducing activity in Del1 (Fig. 2A). For the assay, a rise in LDH activity in the culture medium was used as a semi-quantitative indicator of cell death. The third EGF motif of Del1, the E3 fragment, was essential and sufficient to induce cell death (Fig. 2B). E3 includes a sequence, CTDLVANYSCEC, fits the consensus sequence CX(D/N)XXXX(F/Y)XCXC, wherein the aspartic acid residue (D) can be b-hydroxylated. Replacement of this aspartic acid by a glutamic acid (E) in E3 resulted in a lower level of apoptosis-inducing activity (Fig. 2B). Replacement of aspartic acid 136 with asparagine (N) or of tyrosine (Y) 141 with phenylalanine (F) also resulted in loss of the apoptosis-inducing activity of E3 (Fig. 3C). The apoptosis-inducing activity of E3 was further confirmed by observation of chromatin condensation. A recombinant E3 protein generated in Escherichia coli caused cell deformation and condensation of chromatin as visualized with Hoechst 33342 (Fig. 2D, E, F, G). Next, the relationship between dose and effect was examined. The E3 recombinant protein leads to a significant effect at 0.4 ng/ ml (25 pM) (Fig. 3A). Treatment with concentrations higher than 1 ng/ml did not lead to further increase in released LDH levels. Recombinant E3 was also effective on CRL and Pro5 cells; however, the treatment was not effective with a non-adherent (floating) cell type, MEL, even at high concentrations (Fig. 3B).

H. Kitano et al. / Biochemical and Biophysical Research Communications 393 (2010) 757–761

E1 E2 E3

A

C2

C1

AP-Del1 AP-E1 AP-E2 AP-E3 AP-C1C2 AP-Del1D136E AP-E3D136E

*

* *

10

0 0

0.1 0.2 0.4 0.6 0.8 1.0 2.0 Concentration (ng/ml) * *

E3 C1 l1 C2 D1 E3 36 D1 E 36 E

E2

De

Co

nt

E1

0

Release of LDH (%)

B

10

30

20 * * 10

0

CRL

P5

MEL

Fig. 3. The dose response of E3 recombinant protein. Cytotoxicity was evaluated via LDH release. (A), dose response of COS-7 cells. Open columns, a control protein; closed columns, E3 recombinant protein. (B), the response of CRL, Pro5 and MEL cells to E3. Open columns, 5 lg/ml of a control protein; closed columns, 1 lg/ml of E3 recombinant protein; shaded columns, 5 lg/ml of E3 recombinant protein. The results are reported as mean ± SEM (n = 6). *P < 0.01.

*

30

*

* 20

*

20

20 10

D

E

F

G

1F

6N E3

-Y

14

13

E3

-D

-D

13

E3

E3

ro nt Co

6E

0

l

Release of LDH (%)

C

30

*

30

ro l De l1

Release of LDH (%)

D136E

B

A Release of LDH (%)

760

with E3. The extrinsic apoptosis pathway was examined by immunoblotting with antibodies that detect the shortened, active forms of caspases; however, these activated forms of caspase-3, 7, 8, or 9 were not detected (Fig. 4A). It could be that the small apoptotic fraction results from the activity of undetectable levels of activated caspases. Notably, the caspase inhibitor Z-VAD-FMK inhibits apoptosis in the presence of E3, suggesting that apoptosis by E3 is indeed caspase dependent (Fig. 4B). The total FAK and phosphorylated FAK (p-FAK) were examined by immunoblotting (Fig. 4C, D). After 30 min of E3 administration, the total amount of FAK decreased. FAK was degraded from 125 kd to 75 kd in conjunction with apoptosis induced by the E3 domain of Del1. We hypothesized that the specific route to apoptosis induced by E3 was anoikis. To test this, CRL cells were cultured in uncoated dishes and examined for anoikis, which can occur when cells are grown in suspension. However, CRL cells did not undergo apoptosis even 48 after floating in culture (data not shown). Discussion

Fig. 2. Mapping of the apoptosis-inducing activity of Del1 using AP fusions to fulllength Del1 or mutant forms. (A), diagram of AP fusions with Del1 and mutant forms. (B) and (C), cytotoxicity was evaluated via release of LDH activity. The aspartic acid 136 was replaced for a glutamic acid in AP-Del1D136E and APE3D136E (B), and replaced with asparagine in AP-E3D136 N (C). The tyrosine 141 was replaced with phenylalanine in AP-E3Y141F (C). The results are reported as mean ± SEM (n = 6). *P < 0.01. Apoptosis-inducing activity of E3 was confirmed by phase contrast microscopy (D, E) and fluorescent microscopy to detect Hoechst 33342 (F, G). Panels D and E, and F and G, are the same views, respectively. Arrows in E and G, apoptotic cells. Bars indicate 20 lm.

We used biochemical analysis to study the molecular mechanism of apoptosis in CRL cells (human melanoma cells) treated

We have found that ectopic expression of Del1 induces apoptosis in COS-7 cells (Fig. 1). Additionally, we found evidence that Del1 protein secreted from transfected cells could lead adjacent cells to also undergo cell death. Thus, Del1 appears to work by both autocrine and paracrine mechanisms. The apoptosis-inducing activity of Del1 is located in domain E3 (Fig. 3) and bacterially expressed, purified E3 domain alone is sufficient to induce apoptosis in some cells. Even when COS-7 cells were treated with a high concentration of E3, only a sub-set of cells underwent apoptosis (Figs. 1, 3 and 4). LDH levels suggest that 34% of cells die following transfection of Del1 cDNA. Examination by microscopy, however, suggests that 20% fewer cells in dishes survived after treatment with Del1 than in the control (Fig. 1). The discrepancy between these two results

761

B 3 C E3

kD 35

7 C E3

8 kD 35

9

C E3

kD 57 41

C E3

kD 47 37

20

17

C

Control 0

1 10 30

D

E3 1 10 30 min

p-FAK FAK Tubulin

75 125 54 kD

Relative density

A

Release of LDH (%)

H. Kitano et al. / Biochemical and Biophysical Research Communications 393 (2010) 757–761

30

*

20 10 0

C -

E3 C - +

E3 +

1 *

0 0 1 10 30 min

Fig. 4. Immunoblotting analysis of cells treated with E3 recombinant protein. (A), immunoblotting analysis of cells treated with E3 recombinant protein (E3) or a control protein (C) to detect caspase-3 (left), caspase-7, caspase-8 and caspase-9 (right). (B), effects of a caspase inhibitor on apoptosis induced by E3. Released LDH activity was measured with (+) or without ( ) Z-VAD-FMK. (C), immunoblotting analysis to detect phosphorylated FAK (p-FAK), FAK and a-Tubulin. (D), Densitometric analysis for FAK. Closed and open circles indicate the control and E3 recombinant proteins, respectively. The results are reported as mean ± SEM (n = 6). *P < 0.01.

might reflect a difference in sensitivity of the assays. However, if we could rule out a technical reason for the discrepancy, then the findings could reflect an aspect of Del1 biology. For example, it could be that Del1 induces apoptosis in some cell types or under some conditions, whereas it stimulates growth of other cells. It will be interesting to further examine this question. Because Del1 binds to integrins via the RGD sequence in E2, the target of E3 is expected to be integrins or integrin-related molecules. Degradation of FAK following addition of E3 is consistent with idea that integrins are involved in signal transduction via E3. FAK degradation, may be detected during apoptosis, is catalyzed by caspase-3, calpain-2 or other unknown molecules [13,14]. FAK has been known to have anti-apoptotic effects [15,16]. The degradation of FAK may be involved in the induction apoptosis by E3. A very low concentration of E3 was effective, similar to what is observed for cytokines (Fig. 3). Growth factor receptors might be involved in transduction of the E3 signal, as there is direct interaction between some receptors and integrins [17]. The RGD amino acid sequence in ECM supports cell viability and growth [18]. In Del1, there is a cell death-inducing domain, E3, adjacent to the RGD. The presence of domains with opposing activities next to one another in the same protein could account for the seemingly ambiguous characteristics of Del1 activity in various cells. Multi-modal molecules like Del1 do not seem to be powerful growth factors or potent cytotoxic factors. Consistent with this, over-expression or gene targeting of Del1 does not result in severe damage to cells [6,19]. Nonetheless, Del1-/-mice are vulnerable under inflammatory stress. Thus, it seems possible that Del1 functions as a balancing factor.

Conclusion Del1 protein induced apoptosis in vitro. The apoptosis-inducing activity of Del1 was mapped to the third EGF motif. References [1] S. Marastoni, G. Ligresti, E. Lorenzon, A. Colombatti, M. Mongiat, Extracellular matrix: a matter of life and death, Connect. Tissue Res. 49 (2008) 203–206. [2] V. Todorovicc, C.C. Chen, N. Hay, L.F. Lau, The matrix protein CCN1 (CYR61) induces apoptosis in fibroblasts, J. Cell. Biol. 171 (2005) 559–568. [3] Y. Chen, X.Y. Du, Functional properties and intracellular signaling of CCN1/ Cyr61, J. Cell. Biochem. 100 (2007) 1337–1345.

[4] M. Mongiat, G. Ligresti, S. Marastoni, E. Lorenzon, R. Doliana, A. Colombatti, Regulation of the extrinsic apoptotic pathway by the extracellular matrix glycoprotein EMILIN2, Mol. Cell. Biol. 27 (2007) 7176–7187. [5] C. Hidai, T. Zupancic, K. Penta, A. Mikhail, M. Kawana, E.E. Quertermous, Y. Aoka, M. Fukagawa, Y. Matsui, D. Platika, R. Auerbach, B.L. Hogan, R. Snodgrass, T. Quertermous, Cloning and characterization of developmental endothelial locus-1: an embryonic endothelial cell protein that binds the alphavbeta3 integrin receptor, Gene. Dev. 12 (1998) 21–33. [6] C. Hidai, M. Kawana, K. Habu, H. Kazama, Y. Kawase, T. Iwata, H. Suzuki, T. Quertermous, S. Kokubun, Overexpression of the Del1 gene causes dendritic branching in the mouse mesentery, Anat. Rec. A Discov. Mol. Cell. Evol. Biol. 287 (2005) 1165–1175. [7] J. Zhong, B. Eliceiri, D. Stupack, K. Penta, G. Sakamoto, T. Quertermous, M. Coleman, N. Boudreau, J.A. Varner, Neovascularization of ischemic tissues by gene delivery of the extracellular matrix protein Del-1, J. Clin. Invest. 112 (2003) 30–41. [8] Y. Aoka, F.L. Johnson, K. Penta, K. Hirata Ki, C. Hidai, R. Schatzman, J.A. Varner, T. Quertermous, The embryonic angiogenic factor Del1 accelerates tumor growth by enhancing vascular formation, Microvasc. Res. 64 (2002) 148–161. [9] C. Hidai, M. Kawana, H. Kitano, S. Kokubun, Discoidin domain of Del1 protein contributes to its deposition in the extracellular matrix, Cell Tissue Res. 330 (2007) 83–95. [10] H. Kitano, C. Hidai, M. Kawana, S. Kokubun, An epidermal growth factor-like repeat of Del1 protein increases the efficiency of gene transfer in vitro, Mol. Biotechnol. 39 (2008) 179–185. [11] T. Decker, M.L. Lohmann-Matthes, A quick and simple method for the quantitation of lactate dehydrogenase release in measurements of cellular cytotoxicity and tumor necrosis factor (TNF) activity, J. Immunol. Methods 115 (1988) 61–69. [12] C. Legrand, J.M. Bour, C. Jacob, J. Capiaumont, A. Martial, A. Marc, M. Wudtke, G. Kretzmer, C. Demangel, D. Duval, et al., Lactate dehydrogenase (LDH) activity of the cultured eukaryotic cells as marker of the number of dead cells in the medium [corrected], J. Biotechnol. 25 (1992) 231–243. [13] S. Franco, B. Perrin, A. Huttenlocher, Isoform specific function of calpain 2 in regulating membrane protrusion, Exp. Cell Res. 299 (2004) 179–187. [14] J. Halder, C.N. Landen Jr., S.K. Lutgendorf, Y. Li, N.B. Jennings, D. Fan, G.M. Nelkin, R. Schmandt, M.D. Schaller, A.K. Sood, Focal adhesion kinase silencing augments docetaxel-mediated apoptosis in ovarian cancer cells, Clin. Cancer Res. 11 (2005) 8829–8836. [15] A.P. Gilmore, A.D. Metcalfe, L.H. Romer, C.H. Streuli, Integrin-mediated survival signals regulate the apoptotic function of Bax through its conformation and subcellular localization, J. Cell Biol. 149 (2000) 431–446. [16] J.E. Hungerford, M.T. Compton, M.L. Matter, B.G. Hoffstrom, C.A. Otey, Inhibition of pp125FAK in cultured fibroblasts results in apoptosis, J. Cell Biol. 135 (1996) 1383–1390. [17] N. Alam, H.L. Goel, M.J. Zarif, J.E. Butterfield, H.M. Perkins, B.G. Sansoucy, T.K. Sawyer, L.R. Languino, The integrin-growth factor receptor duet, J. Cell. Physiol. 213 (2007) 649–653. [18] P.C. Brooks, R.A. Clark, D.A. Cheresh, Requirement of vascular integrin alpha v beta 3 for angiogenesis, Science 264 (1994) 569–571. [19] E.Y. Choi, E. Chavakis, M.A. Czabanka, H.F. Langer, L. Fraemohs, M. Economopoulou, R.K. Kundu, A. Orlandi, Y.Y. Zheng, D.A. Prieto, C.M. Ballantyne, S.L. Constant, W.C. Aird, T. Papayannopoulou, C.G. Gahmberg, M.C. Udey, P. Vajkoczy, T. Quertermous, S. Dimmeler, C. Weber, T. Chavakis, Del-1, an endogenous leukocyte-endothelial adhesion inhibitor, limits inflammatory cell recruitment, Science 322 (2008) 1101–1104.