- Email: [email protected]
The first molluscan acute phase serum amyloid A (A-SAA) identified from oyster Crassostrea hongkongensis: Molecular cloning and functional characterization
Fish & Shellfish Immunology 39 (2014) 145e151
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
The first molluscan acute phase serum amyloid A (A-SAA) identified from oyster Crassostrea hongkongensis: Molecular cloning and functional characterization Fufa Qu a, b, 1, Zhiming Xiang a, 1, Ziniu Yu a, * a b
Key Laboratory of Tropical Marine Bio-resources and Ecology, Chinese Academy of Sciences, 164 West Xingang Road, Guangzhou 510301, China Graduate School of the Chinese Academy of Sciences, 19A Yuquan Road, Beijing 100049, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 20 February 2014 Received in revised form 4 May 2014 Accepted 13 May 2014 Available online 22 May 2014
Serum amyloid A (SAA), a major evolutionarily conserved acute-phase protein, participates in many biological processes in eukaryotic cells, including innate immunity. However, little information regarding the relationship between SAA and innate immunity in mollusks is currently available. In this report, the first bivalve SAA (referred to as ChSAA) gene was identified and characterized from the Hong Kong oyster Crassostrea hongkongensis. Its full-length cDNA is 623 bp, including a 50 -UTR of 147 bp, a 30 -UTR of 56 bp containing a poly(A) tail and an open reading frame (ORF) of 420 bp that encodes a polypeptide of 139 amino acids. The predicted amino acid sequence of ChSAA comprises characteristic motifs of the SAA family, including a typical signal peptide and a conserved SAA domain. Comparison and phylogenetic analyses suggested that ChSAA shares a high identity to known acute-phase SAA proteins (A-SAAs). In addition, quantitative real-time PCR analysis revealed that ChSAA is constitutively expressed in all tissues examined, with the highest expression level in the mantle, and that its expression was acutely and significantly up-regulated in hemocytes following challenge by Vibrio alginolyticus (G), Staphylococcus haemolyticus (Gþ) or Saccharomyces cerevisiae (fungus). Furthermore, over-expression of ChSAA via transfection with a ChSAA expression vector led to significantly increased NF-kB activity in HEK293T cells. These results suggest that ChSAA is likely to constitute a member of the A-SAA family involved in anti-pathogen responses in C. hongkongensis. © 2014 Elsevier Ltd. All rights reserved.
Keywords: Crassostrea hongkongensis Acute phase serum amyloid A (A-SAA) Innate immunity NF-kB
1. Introduction The innate immune system is a rapid and non-specific mechanism that fulfills an important role in the early defense of eukaryotic organisms against pathogens. The acute phase response (APR), a core component of the innate immune response found in many animal species [1], is the response of the organism to infection, tissue injury or immunological disorders [2,3]. The APR is responsible for minimizing tissue damage, destroying microbes and promoting repair processes, thereby permitting the homeostatic mechanisms of the host to rapidly restore a healthy state [2,4,5]. Acute phase proteins (APPs) are a group of plasma proteins that are produced and released predominantly by hepatocytes [6], and their
* Corresponding author. Tel./fax: þ86 20 8910 2507. E-mail address: [email protected] (Z. Yu). 1 These authors contributed equally to the work. http://dx.doi.org/10.1016/j.fsi.2014.05.013 1050-4648/© 2014 Elsevier Ltd. All rights reserved.
plasma concentrations can increase (positive APP) or decrease (negative APP) within hours or days during the APR [7,8]. Serum amyloid A (SAA) is a major positive acute-phase protein that is reported to be involved in the modulation of numerous immunological responses during the inflammatory response to infection, trauma or stress [5]. Several differentially expressed apolipoproteins constitute the SAA family, which can be categorized into two major classes based on their responsiveness to inflammatory stimuli: acute-phase serum amyloid A proteins (ASAAs) and constitutive serum amyloid A proteins (C-SAAs). The former have been identified as the major acute-phase response factors among all vertebrates [3], whose expression can be induced from resting plasma levels by more than1000-fold during inflammation, and the expression level of A-SAAs is often used as a potential biomarker to monitor the health status of animals exhibiting an acute or chronic immune response [3,5]; unlike A-SAAs, C-SAAs, whose expression is at most minimally induced during the APR, have only been found in humans and mice [9,10].
146
F. Qu et al. / Fish & Shellfish Immunology 39 (2014) 145e151
In recent years, SAA homologs have been identified and characterized from major vertebrates, such as Homo sapiens, Mus musculus, Danio rerio, Oncorhynchus mykiss and Epinephelus coioides [3,8,11e13]. Numerous previous studies have revealed that SAA, a key factor of vertebrate innate immunity, is involved in LPS- and pathogen-mediated APRs [3,13e16]. Up to now, SAA homologs only in a few invertebrates, including Amblyomma triste, Ornithodoros parkeri and Ixodes scapularis, have been reported in the NCBI database. However, these reports provide limited information of SAAs in invertebrates. To the best of our knowledge, SAA homolog in mollusk, a second most diverse group of animals, has not been reported yet. In the current study, we report the successful cloning and characterization of a full-length cDNA of the SAA gene (ChSAA) from Crassostrea hongkongensis, one of the most economically important and extensively cultured bivalve mollusks along the coastal waters of the South China Sea. The expression of the ChSAA gene in tissues and its expression profiles were investigated in hemocytes challenged by bacterial or fungal pathogens. Moreover, the functional role of ChSAA in the NF-kB signaling pathway was analyzed in HEK293T cells. These data may help improve our understanding of the evolution of SAAs and the possible role of ChSAA in the innate immune response of oysters. 2. Materials and methods 2.1. Cloning the full-length cDNA of ChSAA The homologs of ChSAA were obtained using the BLAST database (Error! Hyperlink reference not valid. www.ncbi.nlm.nih.gov/ blast) to screen the C. hongkongensis hemocyte EST library (unpublished). To prepare RNA for RACE reactions, total RNA samples were extracted from hemocytes of C. hongkongensis using TRIzol (Invitrogen, USA). Gene-specific primers for ChSAAF1, ChSAAF2, ChSAAR1 and ChSAAR2 were designed to amplify the full-length cDNA of ChSAA using the BD SMART RACE cDNA Amplification kit (Clontech, USA). For the 50 - and 30 -ends used for RACE-PCR, the primer pairs Takara5P/ChSAAR1 and Takara3P/ChSAAF1, respectively, were used in the first PCR reaction, and Takara5NP/ChSAAR2 and Takara3NP/ChSAAF2, respectively, were used for the nested PCR reaction (listed in Table 1). All of the specific PCR products were cloned into the pMD™ 18-T Vector (TaKaRa, Japan) for sequencing using an Applied Biosystems (ABI) 3730 DNA Sequencer. 2.2. Sequence analysis The deduced amino acid sequences of ChSAA were compared with previously published sequences of representative
Table 1 Sequences of designed primers used in this study. Primer
Sequence (50 to 30 )
Comment
Takara5P Takara5NP Takara3P Takara3NP ChSAAR1 ChSAAR2 ChSAAF1 ChSAAF2 ChSAAF3 ChSAAR3 GAPDH-F GAPDH-R ChSAAF4 ChSAAR4
CATGGCTACATGCTGACAGCCTA CGCGGATCCACAGCCTACTGATGATCAGTCGATG TACCGTCGTTCCACTAGTGATTT CGCGGATCCTCCACTAGTGATTTCACTATAGG GGTATCTATCTGGTAACCCGTC ATAACTTCCGCTGCCCAACG TATCAGAGCGGATTGAGTGGAC CCGACGGGTTACCAGATAGATA ATTCTCAGTATTGTCGGTGCTTT GTCTGGCGGCGTCATAGTTA GGATTGGCGTGGTGGTAGAG GTATGATGCCCCTTTGTTGAGTC AAAAAGCTTCCATGAGGGTATTCT TTTCTCGAGTCGGTATCTATCTGGT
50 Adaptor
“F” indicates forward primers and “R” indicates reverse primers.
30 Adaptor 50 RACE 30 RACE qPCR of SAA qPCR of GAPDH SAA-His
invertebrate and vertebrate SAAs, and the identity and similarity between these amino acid sequences was calculated using MatGAT2.02 software [17]. The sequences were analyzed based on nucleotide and protein databases using BLASTN and BLASTX, respectively (http://www.ncbi.nlm.nih.gov/BLAST/). The molecular weight and the theoretical isoelectric point were calculated using the compute Mw/pI tool (http://www.expasy.ch/tools/pi_tool. html). The protein secondary structure and domains were predicted using ExPASy (http://www.biogem.org/tool/chou-fasman/) and SMART (http://smart.embl-heidelberg.de/), respectively. The signal sequence was identified using SignalP (http://www.cbs.dtu. dk/services/SignalP/). Multiple sequence alignments and the phylogenetic tree were constructed using the Megalign program of DNAstar based on the alignment of the complete amino acid sequences. 2.3. Animals, tissue collection and pathogen challenge Individual samples of C. hongkongensis (two years of age, average shell height of 90 mm) were collected from Zhanjiang, Guangdong Province, China, and maintained at 25 C in tanks containing circulating seawater (20‰) for one week prior to the experiments. The oysters were fed twice daily with Tetraselmis chui. For the tissue distribution analysis, eight tissues (including hemocytes, heart, gill, labial palps, mantle, adductor muscle, digestive gland and gonads) were collected from five healthy Hong Kong oysters. In the pathogen challenge experiments, 200 oysters were randomly separated into pathogen-challenged and control groups. The individuals in the pathogen-challenged group were injected with 100 ml of Staphylococcus haemolyticus, Vibrio alginolyticus or Saccharomyces cerevisiae (suspended in 0.1 M phosphate buffered saline (PBS) at a concentration of 1.0 109 cells/ml) into the adductor muscle, and the individuals in the control group were injected with 100 ml of PBS. The hemolymph from five randomly sampled individuals in each group was collected at each of seven time points: 0, 3, 6, 12, 24, 48, and 72 h after the injection. 2.4. Isolation of total RNA and real-time quantitative RT-PCR analysis of ChSAA Total RNA from different tissues and hemocytes of C. hongkongensis was extracted using TRIzol reagent (Invitrogen, USA) according to the manufacturer's instructions. Genomic DNA was removed from the RNA samples via DNase I treatment (Promega, USA). The concentration and the purity of the RNA samples were examined at 260 nm and 280 nm using a Biophotometer, and its quality was assessed via electrophoresis using a 1.0% agarose gel. The first-strand cDNA synthesis was performed using 1 mg of total RNA template and an SYBR Premix Ex Taq™ kit (TOYOBO, Japan). The ChSAA mRNA expression levels in various tissues and during pathogen challenge were determined via quantitative realtime PCR using gene-specific ChSAAF3/ChSAAR3 primer pairs (Table 1). The GAPDH gene was used as a reference gene to normalize the initial quantity of RNA. Quantitative real-time PCR reactions were performed using the Light-Cycler 480 II System (Roche, USA) with a volume of 20 ml containing 10 ml of 2 SYBR Green PCR Master Mix (TOYOBO, Japan), 1 ml of 10 mM primers, 8 ml of nuclease-free water, and 1 ml of cDNA template. The PCR thermal cycle protocol was an initial denaturation cycle at 95 C for 5 min, followed by 40 cycles of 95 C for 15 s, 57 C for 15 s and 72 C for 15 s. Melting curve analysis was performed at the end of the reaction to assess the specificity of the PCR amplification.
F. Qu et al. / Fish & Shellfish Immunology 39 (2014) 145e151
147
The relative expression level of ChSAA was determined using 2DDCt method based on the Ct values of the target and reference genes to calculate the fold-change in expression [18]. The amplification efficiencies of the target and reference genes were verified and found to be approximately equal. All data obtained from RTPCR were analyzed using SPSS 13.0 for Windows software. 2.5. Construction of the eukaryotic expression plasmid, cell culture and the dual-luciferase reporter assay To examine the effect of ChSAA on NF-kB transcriptional activity, recombinant pcDNA3.1-ChSAA vectors were constructed. The entire ORF of ChSAA was inserted into the pcDNA3.1 vector (Invitrogen, USA) and amplified using the primers pair ChSAAF4/ChSAAR4 (Table 1). This primer pair contained the restriction sites HindIII at the 50 end and XhoI at the 30 end. The target PCR products were purified, digested, and then inserted into the pcDNA3.1 plasmid. The resulting colonies were verified via DNA sequencing, and the confirmed recombinant plasmids were transformed into HEK293T cells. The HEK293T cells were cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum (FBS, Gibco BRL) and antibiotics (100 mg/L streptomycin and 105 U/L penicillin, Gibco) in a humidified incubator containing 5% CO2 maintained at 37 C. Due to the lack of bivalve mollusk cell lines, the analysis of the influence of ChSAA on (human) NF-kB-mediated promoter activation was performed on HEK293T cells using a luciferase reporter gene. The cells were seeded on 48-well plates (105 cells/well) for 24 h and transiently co-transfected with the NF-kB reporter vector (Promega, USA), pRL-TK (Clontech, USA), pcDNA3.1 (Promega, USA) and pcDNA3.1-ChSAA in a serum-free culture medium using Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer's protocol. The luciferase activity of the total cell lysates was measured using a luciferase reporter assay system (Promega, USA) at 48 h post-transfection. Briefly, the HEK293T cells in 48-well plates were washed twice with 100 ml PBS, followed by treatment with 30 ml 1 passive lysis buffer at room temperature for 10 min. The cell lysates were transferred to a plate, and 50 ml of luciferase assay reagent II and 50 ml of 1 stop & glo reagent were added sequentially. Then, both the firefly and renilla luciferase activities were measured. The values were expressed as the means ± S.E. for three separate experiments, each performed in duplicate. 3. Results 3.1. cDNA cloning and sequence analysis of the ChSAA gene A 400 bp EST sharing high similarity with the SAA gene of M. musculus was identified in the hemocyte EST library of C. hongkongensis. Based on the sequence of the EST, two fragments of ChSAA measuring 204 bp and 84 bp were amplified via 50 - and 30 RACE, respectively. A 623 bp nucleotide sequence representing the full-length cDNA sequence of ChSAA was obtained by overlapping the EST sequences and the RACE fragments, as described above. The complete cDNA sequence of the ChSAA gene (GenBank accession no. KF156832) contains a 50 -UTR of 147 bp, a 30 -UTR of 56 bp containing a polyadenylation signal sequence (AATAAA) and a poly(A) tail, and an open reading frame (ORF) of 420 bp. The ORF is predicted to encode a polypeptide of 139 amino acids (Fig. 1A), with a calculated molecular mass of 15.86 kDa and a theoretical isoelectric point of 9.75. A signal peptide of 22 amino acids was predicted using the SignalP program (Fig. 1B). The conserved domains of ChSAA were revealed based on secondary structure predictions and analysis using the SMART program, including a signal
Fig. 1. The complete cDNA and deduced amino acid sequences of ChSAA. (A) The initiation and stop codons are in bold. The polyadenylation signal sequence (AATAAA) is in bold and underlined. The 22 amino acid signal peptide is indicated by the box, and the predicted SAA domain is shaded. (B) Domain organization of ChSAA.
peptide “MRVFSVLSVLLIGLVLTEQTLA” (positions 1e22 aa) and a conserved SAA domain (positions 36e138 aa), with the typical features of SAA family proteins (Fig. 2). The multiple sequence alignment revealed that the deduced amino acid sequence of ChSAA shares 51.1e59.6% identity to published A-SAAs from other species and 41.1e43.8% identity to CSAAs, including H. sapiens SAA4 and M. musculus SAA5 (Table 2). A phylogenetic tree constructed using the Megalign tool in DNAstar software using the amino acid sequences of the SAA from C. hongkongensis and other species indicates its clear evolutionary relationship. As shown in Fig. 3, the analysis classified the SAA sequences into two major clusters; the ChSAA sequences from C. hongkongensis were grouped into a single branch, while the SAAs from other spices formed a distinct branch. 3.2. Distribution patterns and time-dependent expression of ChSAA mRNA in response to pathogen challenge The mRNA expression of ChSAA was detected via quantitative RT-PCR for all examined tissues of C. hongkongensis, including the labial palps, the digestive gland, the gonad, the adductor muscle, the mantle, the gill, the heart, and hemocytes. The results revealed relatively high expression levels in the labial palps and the mantle and relatively low expression levels in hemocytes (Fig. 4). The expression levels of ChSAA in hemocytes were significantly increased in response to pathogen challenge based on quantitative
148
F. Qu et al. / Fish & Shellfish Immunology 39 (2014) 145e151
Fig. 2. Multiple alignment analysis of ChSAA amino acid sequences and other known SAA proteins. The GenBank accession numbers corresponding to the SAA protein sequences examined are listed in Table 2.
RT-PCR. When challenged by V. alginolyticus, the expression level initially significantly increased at 6 h post-challenge (24-fold), peaking (425-fold) at 72 h post-infection, compared to treatment with PBS (Fig. 5A). When challenged by S. haemolyticus, the level of ChSAA mRNA rose up to 14-fold at 6 h post-challenge, peaking at 493-fold at 48 h post-challenge, and then decreased to 116-fold at 72 h (Fig. 5B). Under challenge by S. cerevisiae, the expression initially rose at 3 h post-infection (91-fold), peaking at 222-fold at 48 h post-infection, and then declined to 46-fold at 72 h postchallenge (Fig. 5C). 3.3. The activating effect of ChSAA on the NF-kB signaling pathway Dual-luciferase reporter assays were performed to determine the immune signaling pathways that ChSAA activates. The results revealed that the NF-kB luciferase reporter was activated by ChSAA in a dose-dependent manner, with a maximum increase of 5-fold relative to transfection of HEK293T cells with pcDNA3.1 alone (P < 0.05) (Fig. 6). These results suggest that ChSAA could trigger the activation of the NF-kB signaling pathway in HEK293T cells. 4. Discussion As a major immune effector molecule during the acute phase, SAAs are functionally important for host defense and the immune
Table 2 Amino acid identity comparison of the ChSAA with other known SAA homologs. Species
GenBank accession no.
Amino acid identity (%)
Homo sapiens SAA1 Homo sapiens SAA2 Homo sapiens SAA4 Pongo abelii Gallus gallus Mus musculus SAA1 Mus musculus SAA2 Mus musculus SAA3 Mus musculus SAA5 Ornithorhynchus anatinus Danio rerio Tetraodon nigroviridis Apostichopus japonicus Crassostrea hongkongensis
AAA64799.1 NP_110381.2 NP_006503.2 NP_001127066 XP_003641381.1 NP_033143.1 NP_035444.1 NP_035445.1 AAB17555.1 XP_001513428.1 NP_001005599.1 CAF99678 ABX55830.2 KF156832
54.0 55.4 43.8 57.6 57.6 53.2 51.1 53.2 41.1 58.3 54.0 56.1 59.6 100.0
response in animals from teleosts to mammals [1,2]. However, information regarding SAA homologs in invertebrates remains limited. To the best of our knowledge, this new SAA-homologous gene cloned from C. hongkongensis (ChSAA) was the first SAA gene sequence identified in mollusks. The present ChSAA displays structural characteristics typical of SAA family proteins: A signal peptide and a conserved SAA domain. Sequence analysis reveals that the deduced amino acid sequence of ChSAA displays a higher degree of sequence identity and similarity to known A-SAAs than CSAAs. Similar to other known A-SAAs, the typical C-SAA sequence contains an octapeptide located in the middle region that does not exist in the ChSAA sequence. Phylogenetically, ChSAA is certainly considered to be an evolutionarily conserved protein from lower invertebrates to higher mammals. In recent reports, it has been demonstrated that the size of known SAA family genes ranges from one to five copies, with a single copy in teleosts and invertebrates, two in hamsters, three in horses, dogs and rabbits, four in humans and five in mice [3,8]. Our study reveals only one SAA-encoding gene, equivalent to that of teleosts and other non-mammalian organisms, present in C. hongkongensis, suggesting that the multigene SAA family may be specific to mammals. Moreover, the known non-mammalian SAA proteins, including ChSAA, are highly similar to those from humans, which are encoded by the inducible acute phase SAA (A-SAA) genes. These characteristics appear to indicate that the primordial SAA gene was an inducible and constitutively expressed SAAencoding gene (C-SAA) that recently differentiated exclusively within the mammalian lineage [12]. Furthermore, the known non-
Fig. 3. Phylogenetic analysis of SAA homologs from invertebrates to vertebrates using the Megalign program of DNAstar software based on the alignment of the complete amino acid sequences. The GenBank accession numbers included are listed in Table 2.
F. Qu et al. / Fish & Shellfish Immunology 39 (2014) 145e151
149
Fig. 4. Relative expression levels of ChSAA in different tissues: hemocytes, heart, gill, labial palps, mantle, adductor muscle, digestive gland and gonads. Each bar represents the mean of the normalized expression levels of replicates (N ¼ 3).
mammalian SAA proteins, including ChSAA, are highly similar to the human SAA proteins. Together, the significant homology between ChSAA and other known A-SAA sequences and the presence of characteristics important for SAA function suggests that ChSAA is a functionally conserved protein that may play important roles in the innate immune response in C. hongkongensis. In vertebrates, SAA was previously demonstrated to be ubiquitously expressed in many tissues, typically at the highest level in the liver, which is the primary organ that synthesizes SAA proteins [3,19]. In this study, mRNA transcripts corresponding to ChSAA were detected in all eight examined tissues, suggesting that ChSAA is ubiquitously and constitutive expressed. These results are agreement with that in other species. The highest expression level of ChSAA in the mantle may be somewhat different from that of vertebrate animals [13], implying that the mantle may play a role in some biological processes related to ChSAA. In mammals, SAA is detected at low plasma concentrations under non-immune challenged conditions. However, in the inflammatory state, the serum SAA concentration may increase up to 1000-fold due to the stimulation of inflammatory cytokines, including IL-1, IL-6, and TNF-a, compared to the non-inflammatory state [3,5,20]. The low expression level of ChSAA in hemocytes may indicate that the expression pattern of ChSAA in bivalve mollusks is similar to that of the vertebrates under normal conditions. It is generally believed that all organisms are exposed to challenging environments comprising various biotic and abiotic components and require a highly coordinated system for contending with immune challenges. The acute phase response (APR) is a complex systemic early defense system activated by tissue injury, infection and inflammation [1,3] that induces a remarkable alteration in the concentrations of many acute phase proteins (APPs) [7]. APPs, essential components of the innate immune system [2,21], play important roles in a variety of host defense-related activities, such as destroying infectious microbes, repairing damaged tissue and restoring the healthy state [22]. In vertebrates, APPs have been categorized based on the extent to which their plasma level changes (major, moderate, or minor) and the direction of this change (positive or negative) during the APR. The APP types include major APPs (concentrations increasing from 10- to 100-fold or up to 1000-fold), moderate APPs (concentrations increasing from 2- to 10-fold), minor APPs (concentrations increasing only slightly), positive APPs (concentrations increasing) and negative APPs (concentrations decreasing) [1,6,8,23]. As a major positive APP, SAA has been demonstrated to play important roles in the host defense against extracellular pathogens in vertebrates [3]. In the present study, the temporal expression of ChSAA in hemocytes under pathogen challenge indicates that ChSAA mRNA expression was
Fig. 5. The expression of ChSAA after pathogen challenge in hemocytes. (A) The expression patterns of ChSAA mRNA in C. hongkongensis after challenge by V. alginolyticus, (B) S. haemolyticus and (C) S. cerevisiae. Each bar represents the mean of the normalized expression levels of replicates (N ¼ 3); significant differences were indicated by an asterisk (* and ** represent p < 0.05 and p < 0.01, respectively).
quickly and drastically triggered by V. alginolyticus, S. haemolyticus and, to a lesser extent, S. cerevisiae (Fig. 5). This result is similar to the changes in SAA expression in E. coioides upon pathogen infection [13], which showed us that SAAs both in C. hongkongensis and E. coioides have a stronger and wider responsiveness to Gþ bacteria, G bacteria and fungus challenges, suggesting that ChSAA is involved in related pathways of innate immune defense against bacterial and fungal pathogens. The acute phase expression patterns of ChSAA, the expression levels in hemocytes increased up to hundreds of times compared to the control group in response to pathogen challenge, strongly indicate that ChSAA, similar to other SAA proteins of vertebrates, is a major positive APP in C. hongkongensis. Combined with the computerized analysis of the ChSAA sequence described above, this result may also suggest that
150
F. Qu et al. / Fish & Shellfish Immunology 39 (2014) 145e151
the NF-kB signaling pathway in HEK293T cells. These results strongly support that ChSAA is a major positive APP involved in the APR against bacterial and fungal pathogens in C. hongkongensis and provide new insights into the innate immune defense system of oysters against pathogens. However, further study is required to elucidate the specific functions of ChSAA and its involvement in the innate immune response pathways in mollusks. For example, RNAi approach could be used to knock down the ChSAA gene expression in C. hongkongensis to study the function of ChSAA in regulating TLR-mediated NF-kB signaling pathway post-bacteria challenge. In addition, microbial-binding assays could also be used to test binding of recombinant ChSAA fusion protein from prokaryotic expression system to pathogenic microorganisms. Fig. 6. Effects of ChSAA expression on the activity of the NF-kB reporter gene. The cells were transiently co-transfected with an NF-kB reporter vector, pRL-TK and the ChSAA expression vector. The pcDNA3.1 vector was used as a control in the HEK293T cells. Significant differences are indicated by different letters (p < 0.05).
ChSAA is a member of the A-SAA family rather than the C-SAA family. Furthermore, it may be concluded that the dramatic upregulation of A-SAAs in response to pathogenic stimuli is common and has a shared protective biological function among vertebrates and invertebrates. Toll-like receptors (TLRs) have been established to play an essential role in the activation of the innate immune response by acting as pattern recognition receptors that recognize specific patterns of microorganisms [24]. Except for microbial pathogens, there are several endogenous TLR ligands that have been identified; one of these ligands is the acute serum amyloid A protein (A-SAA) [25e27], which has been proposed to be an endogenous ligand for TLR2 [25] and an effector molecule for TLR4 [26]. Upon infection and inflammation, the expression of A-SAA is induced by proinflammatory cytokines, such as IL-1, IL-6 and TNF-a [3]. The secreted SAA could enhance the innate immune response to pathogens by acting as a potent endogenous ligand binding to TLRs, stimulating inflammatory cytokine expression via the TLRmediated NF-kB signaling pathway [25,27]. Previous studies revealed that TLR-induced NF-kB activation is important in the ancient innate host defense system, which is phylogenetically conserved and has been proven to exist in bivalve mollusks [28e32]. The activation of the NF-kB signaling pathway is essential for the induction of immune response-related genes and is typically measured to assess the extent of activation of immune responses [33]. The NF-kB reporter gene (human) assay performed using HEK293T cells indicated that the activation of NF-kB was clearly induced by ChSAA (Fig. 6), suggesting that ChSAA could activate the NF-kB reporter gene in mammalian cells. Combined with the results of the ChSAA mRNA expression level under pathogen challenge, we deduce that ChSAA may be involved in and activate the NF-kB signaling pathway against extracellular pathogens in C. hongkongensis. However, further study is required to confirm this hypothesis. Further results are expected to provide additional evidence for the involvement of ChSAA in the TLR-induced NF-kB cellular immune response pathway in mollusks. In conclusion, a molluscan functional SAA homolog (ChSAA), a major member of the APP family, was identified for the first time from C. hongkongensis. Sequence and phylogenetic analyses indicate that the ChSAA protein shares a high degree of sequence identity and similarity to known A-SAAs. Furthermore, the expression profiles of ChSAA were demonstrated to be constitutively expressed in the oyster. The acute response patterns in hemocytes under pathogen challenge suggest that ChSAA may perform a protective biological function in the host immune defense. Additional studies revealed that ChSAA acts as an inducer of
Acknowledgments This research was supported by the National Natural Science Foundation of China (No. 31202021), the National Science Foundation of China (41176150) and the National Basic Research Program of China (No. 2010CB126404). References [1] Cray C, Zaias J, Altman NH. Acute phase response in animals: a review. Comp Med 2009;59:517e26. [2] Baumann H, Gauldie J. The acute phase response. Immunol today 1994;15: 74e80. [3] Uhlar CM, Whitehead AS. Serum amyloid A, the major vertebrate acute-phase reactant. Eur J Biochem 1999;265:501e23. [4] Kushner I. The phenomenon of the acute phase response. Ann N Y Acad Sci 1982;389:39e48. [5] Jensen LE, Whitehead AS. Regulation of serum amyloid A protein expression during the acute-phase response. Biochem J 1998;334:489e503. [6] Bayne CJ, Gerwick L. The acute phase response and innate immunity of fish. Dev Comp Immunol 2001;25:725e43. [7] Epstein FH, Gabay C, Kushner I. Acute-phase proteins and other systemic responses to inflammation. N Engl J Med 1999;340:448e54. [8] Steel DM, Whitehead AS. The major acute phase reactants: C-reactive protein, serum amyloid P component and serum amyloid A protein. Immunol today 1994;15:81e8. [9] De Beer M, Kindy MS, Lane WS, De Beer F. Mouse serum amyloid A protein (SAA5) structure and expression. J Biol Chem 1994;269:4661e7. [10] Whitehead A, De Beer M, Steel D, Rits M, Lelias J, Lane W, et al. Identification of novel members of the serum amyloid A protein superfamily as constitutive apolipoproteins of high density lipoprotein. J Biol Chem 1992;267:3862e7. [11] Lin B, Chen S, Cao Z, Lin Y, Mo D, Zhang H, et al. Acute phase response in zebrafish upon Aeromonas salmonicida and Staphylococcus aureus infection: striking similarities and obvious differences with mammals. Mol Immunol 2007;44:295e301. €llner B, Seyfert H-M. Characterization of [12] Rebl A, Goldammer T, Fischer U, Ko two key molecules of teleost innate immunity from rainbow trout (Oncorhynchus mykiss): MyD88 and SAA. Vet Immunol Immunopathol 2009;131: 122e6. [13] Wei J, Guo M, Ji H, Qin Q. Molecular cloning, characterization of one key molecule of teleost innate immunity from orange-spotted grouper (Epinephelus coioides): serum amyloid A. Fish Shellfish Immunol 2012;34: 296e304. [14] Yiangou M, Papaconstantinou J. The differential induction of a-acid glycoprotein and serum amyloid A genes by heavy metals. Biochim Biophys Acta BBA e Gene Struct Expr 1993;1174:123e32. [15] Teles M, Mackenzie S, Boltana S, Callol A, Tort L. Gene expression and TNFalpha secretion profile in rainbow trout macrophages following exposures to copper and bacterial lipopolysaccharide. Fish Shellfish Immunol 2011;30: 340e6. [16] Shah C, Hari-Dass R, Raynes JG. Serum amyloid A is an innate immune opsonin for Gram-negative bacteria. Blood 2006;108:1751e7. [17] Campanella JJ, Bitincka L, Smalley J. MatGAT: an application that generates similarity/identity matrices using protein or DNA sequences. BMC Bioinformatics 2003;4:29. [18] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2DDCT method. Methods 2001;25:402e8. [19] Meek R, Urieli-Shoval S, Benditt E. Expression of apolipoprotein serum amyloid A mRNA in human atherosclerotic lesions and cultured vascular cells: implications for serum amyloid A function. Proc Natl Acad Sci 1994;91: 3186e90. [20] Kushner I. The acute phase response: an overview. Method Enzymol 1988;163:373e83.
F. Qu et al. / Fish & Shellfish Immunology 39 (2014) 145e151 [21] Revathy KS, Umasuthan N, Whang I, Lee Y, Lee S, Oh M-J, et al. A novel acute phase reactant, serum amyloid A-like 1, from Oplegnathus fasciatus: genomic and molecular characterization and transcriptional expression analysis. Dev Comp Immunol 2012;37:294e305. [22] Murata H, Shimada N, Yoshioka M. Current research on acute phase proteins in veterinary diagnosis: an overview. Veterinary J 2004;168:28e40. [23] Zhou X, Wang L, Feng H, Guo Q, Dai H. Acute phase response in Chinese softshelled turtle (Trionyx sinensis) with Aeromonas hydrophila infection. Dev Comp Immunol 2011;35:441e51. [24] Takeda K, Akira S. TLR signaling pathways. Semin Immunol 2004;16:3e9. [25] Cheng N, He R, Tian J, Patrick PY, Richard DY. Cutting edge: TLR2 is a functional receptor for acute-phase serum amyloid A. J Immunol 2008;181:22e6. [26] Sandri S, Rodriguez D, Gomes E, Monteiro HP, Russo M, Campa A. Is serum amyloid A an endogenous TLR4 agonist? J Leukoc Biol 2008;83:1174e80. [27] He RL, Zhou J, Hanson CZ, Chen J, Cheng N, Ye RD. Serum amyloid A induces GCSF expression and neutrophilia via Toll-like receptor 2. Blood 2009;113: 429e37.
151
[28] Liang Y, Zhou Y, Shen P. NF-kappaB and its regulation on the immune system. Cell Mol Immunol 2004;1:343e50. [29] Montagnani C, Kappler C, Reichhart J, Escoubas J. Cg-Rel, the first Rel/NF-kB homolog characterized in a mollusk, the Pacific oyster Crassostrea gigas. FEBS Lett 2004;561:75e82. [30] Zhang L, Li L, Zhang G. A Crassostrea gigas Toll-like receptor and comparative analysis of TLR pathway in invertebrates. Fish Shellfish Immunol 2011;30: 653e60. [31] Zhang Y, He X, Yu Z. Two homologues of inhibitor of NF-kappa B (IkappaB) are involved in the immune defense of the Pacific oyster, Crassostrea gigas. Fish Shellfish Immunol 2011;30:1354e61. [32] Lemaitre B, Hoffmann J. The host defense of Drosophila melanogaster. Annu Rev Immunol 2007;25:697e743. [33] Skjæveland I, Iliev DB, Strandskog G, Jørgensen JB. Identification and characterization of TLR8 and MyD88 homologs in Atlantic salmon (Salmo salar). Dev Comp Immunol 2009;33:1011e7.
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
The first molluscan acute phase serum amyloid A (A-SAA) identified from oyster Crassostrea hongkongensis: Molecular cloning and functional characterization Fufa Qu a, b, 1, Zhiming Xiang a, 1, Ziniu Yu a, * a b
Key Laboratory of Tropical Marine Bio-resources and Ecology, Chinese Academy of Sciences, 164 West Xingang Road, Guangzhou 510301, China Graduate School of the Chinese Academy of Sciences, 19A Yuquan Road, Beijing 100049, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 20 February 2014 Received in revised form 4 May 2014 Accepted 13 May 2014 Available online 22 May 2014
Serum amyloid A (SAA), a major evolutionarily conserved acute-phase protein, participates in many biological processes in eukaryotic cells, including innate immunity. However, little information regarding the relationship between SAA and innate immunity in mollusks is currently available. In this report, the first bivalve SAA (referred to as ChSAA) gene was identified and characterized from the Hong Kong oyster Crassostrea hongkongensis. Its full-length cDNA is 623 bp, including a 50 -UTR of 147 bp, a 30 -UTR of 56 bp containing a poly(A) tail and an open reading frame (ORF) of 420 bp that encodes a polypeptide of 139 amino acids. The predicted amino acid sequence of ChSAA comprises characteristic motifs of the SAA family, including a typical signal peptide and a conserved SAA domain. Comparison and phylogenetic analyses suggested that ChSAA shares a high identity to known acute-phase SAA proteins (A-SAAs). In addition, quantitative real-time PCR analysis revealed that ChSAA is constitutively expressed in all tissues examined, with the highest expression level in the mantle, and that its expression was acutely and significantly up-regulated in hemocytes following challenge by Vibrio alginolyticus (G), Staphylococcus haemolyticus (Gþ) or Saccharomyces cerevisiae (fungus). Furthermore, over-expression of ChSAA via transfection with a ChSAA expression vector led to significantly increased NF-kB activity in HEK293T cells. These results suggest that ChSAA is likely to constitute a member of the A-SAA family involved in anti-pathogen responses in C. hongkongensis. © 2014 Elsevier Ltd. All rights reserved.
Keywords: Crassostrea hongkongensis Acute phase serum amyloid A (A-SAA) Innate immunity NF-kB
1. Introduction The innate immune system is a rapid and non-specific mechanism that fulfills an important role in the early defense of eukaryotic organisms against pathogens. The acute phase response (APR), a core component of the innate immune response found in many animal species [1], is the response of the organism to infection, tissue injury or immunological disorders [2,3]. The APR is responsible for minimizing tissue damage, destroying microbes and promoting repair processes, thereby permitting the homeostatic mechanisms of the host to rapidly restore a healthy state [2,4,5]. Acute phase proteins (APPs) are a group of plasma proteins that are produced and released predominantly by hepatocytes [6], and their
* Corresponding author. Tel./fax: þ86 20 8910 2507. E-mail address: [email protected] (Z. Yu). 1 These authors contributed equally to the work. http://dx.doi.org/10.1016/j.fsi.2014.05.013 1050-4648/© 2014 Elsevier Ltd. All rights reserved.
plasma concentrations can increase (positive APP) or decrease (negative APP) within hours or days during the APR [7,8]. Serum amyloid A (SAA) is a major positive acute-phase protein that is reported to be involved in the modulation of numerous immunological responses during the inflammatory response to infection, trauma or stress [5]. Several differentially expressed apolipoproteins constitute the SAA family, which can be categorized into two major classes based on their responsiveness to inflammatory stimuli: acute-phase serum amyloid A proteins (ASAAs) and constitutive serum amyloid A proteins (C-SAAs). The former have been identified as the major acute-phase response factors among all vertebrates [3], whose expression can be induced from resting plasma levels by more than1000-fold during inflammation, and the expression level of A-SAAs is often used as a potential biomarker to monitor the health status of animals exhibiting an acute or chronic immune response [3,5]; unlike A-SAAs, C-SAAs, whose expression is at most minimally induced during the APR, have only been found in humans and mice [9,10].
146
F. Qu et al. / Fish & Shellfish Immunology 39 (2014) 145e151
In recent years, SAA homologs have been identified and characterized from major vertebrates, such as Homo sapiens, Mus musculus, Danio rerio, Oncorhynchus mykiss and Epinephelus coioides [3,8,11e13]. Numerous previous studies have revealed that SAA, a key factor of vertebrate innate immunity, is involved in LPS- and pathogen-mediated APRs [3,13e16]. Up to now, SAA homologs only in a few invertebrates, including Amblyomma triste, Ornithodoros parkeri and Ixodes scapularis, have been reported in the NCBI database. However, these reports provide limited information of SAAs in invertebrates. To the best of our knowledge, SAA homolog in mollusk, a second most diverse group of animals, has not been reported yet. In the current study, we report the successful cloning and characterization of a full-length cDNA of the SAA gene (ChSAA) from Crassostrea hongkongensis, one of the most economically important and extensively cultured bivalve mollusks along the coastal waters of the South China Sea. The expression of the ChSAA gene in tissues and its expression profiles were investigated in hemocytes challenged by bacterial or fungal pathogens. Moreover, the functional role of ChSAA in the NF-kB signaling pathway was analyzed in HEK293T cells. These data may help improve our understanding of the evolution of SAAs and the possible role of ChSAA in the innate immune response of oysters. 2. Materials and methods 2.1. Cloning the full-length cDNA of ChSAA The homologs of ChSAA were obtained using the BLAST database (Error! Hyperlink reference not valid. www.ncbi.nlm.nih.gov/ blast) to screen the C. hongkongensis hemocyte EST library (unpublished). To prepare RNA for RACE reactions, total RNA samples were extracted from hemocytes of C. hongkongensis using TRIzol (Invitrogen, USA). Gene-specific primers for ChSAAF1, ChSAAF2, ChSAAR1 and ChSAAR2 were designed to amplify the full-length cDNA of ChSAA using the BD SMART RACE cDNA Amplification kit (Clontech, USA). For the 50 - and 30 -ends used for RACE-PCR, the primer pairs Takara5P/ChSAAR1 and Takara3P/ChSAAF1, respectively, were used in the first PCR reaction, and Takara5NP/ChSAAR2 and Takara3NP/ChSAAF2, respectively, were used for the nested PCR reaction (listed in Table 1). All of the specific PCR products were cloned into the pMD™ 18-T Vector (TaKaRa, Japan) for sequencing using an Applied Biosystems (ABI) 3730 DNA Sequencer. 2.2. Sequence analysis The deduced amino acid sequences of ChSAA were compared with previously published sequences of representative
Table 1 Sequences of designed primers used in this study. Primer
Sequence (50 to 30 )
Comment
Takara5P Takara5NP Takara3P Takara3NP ChSAAR1 ChSAAR2 ChSAAF1 ChSAAF2 ChSAAF3 ChSAAR3 GAPDH-F GAPDH-R ChSAAF4 ChSAAR4
CATGGCTACATGCTGACAGCCTA CGCGGATCCACAGCCTACTGATGATCAGTCGATG TACCGTCGTTCCACTAGTGATTT CGCGGATCCTCCACTAGTGATTTCACTATAGG GGTATCTATCTGGTAACCCGTC ATAACTTCCGCTGCCCAACG TATCAGAGCGGATTGAGTGGAC CCGACGGGTTACCAGATAGATA ATTCTCAGTATTGTCGGTGCTTT GTCTGGCGGCGTCATAGTTA GGATTGGCGTGGTGGTAGAG GTATGATGCCCCTTTGTTGAGTC AAAAAGCTTCCATGAGGGTATTCT TTTCTCGAGTCGGTATCTATCTGGT
50 Adaptor
“F” indicates forward primers and “R” indicates reverse primers.
30 Adaptor 50 RACE 30 RACE qPCR of SAA qPCR of GAPDH SAA-His
invertebrate and vertebrate SAAs, and the identity and similarity between these amino acid sequences was calculated using MatGAT2.02 software [17]. The sequences were analyzed based on nucleotide and protein databases using BLASTN and BLASTX, respectively (http://www.ncbi.nlm.nih.gov/BLAST/). The molecular weight and the theoretical isoelectric point were calculated using the compute Mw/pI tool (http://www.expasy.ch/tools/pi_tool. html). The protein secondary structure and domains were predicted using ExPASy (http://www.biogem.org/tool/chou-fasman/) and SMART (http://smart.embl-heidelberg.de/), respectively. The signal sequence was identified using SignalP (http://www.cbs.dtu. dk/services/SignalP/). Multiple sequence alignments and the phylogenetic tree were constructed using the Megalign program of DNAstar based on the alignment of the complete amino acid sequences. 2.3. Animals, tissue collection and pathogen challenge Individual samples of C. hongkongensis (two years of age, average shell height of 90 mm) were collected from Zhanjiang, Guangdong Province, China, and maintained at 25 C in tanks containing circulating seawater (20‰) for one week prior to the experiments. The oysters were fed twice daily with Tetraselmis chui. For the tissue distribution analysis, eight tissues (including hemocytes, heart, gill, labial palps, mantle, adductor muscle, digestive gland and gonads) were collected from five healthy Hong Kong oysters. In the pathogen challenge experiments, 200 oysters were randomly separated into pathogen-challenged and control groups. The individuals in the pathogen-challenged group were injected with 100 ml of Staphylococcus haemolyticus, Vibrio alginolyticus or Saccharomyces cerevisiae (suspended in 0.1 M phosphate buffered saline (PBS) at a concentration of 1.0 109 cells/ml) into the adductor muscle, and the individuals in the control group were injected with 100 ml of PBS. The hemolymph from five randomly sampled individuals in each group was collected at each of seven time points: 0, 3, 6, 12, 24, 48, and 72 h after the injection. 2.4. Isolation of total RNA and real-time quantitative RT-PCR analysis of ChSAA Total RNA from different tissues and hemocytes of C. hongkongensis was extracted using TRIzol reagent (Invitrogen, USA) according to the manufacturer's instructions. Genomic DNA was removed from the RNA samples via DNase I treatment (Promega, USA). The concentration and the purity of the RNA samples were examined at 260 nm and 280 nm using a Biophotometer, and its quality was assessed via electrophoresis using a 1.0% agarose gel. The first-strand cDNA synthesis was performed using 1 mg of total RNA template and an SYBR Premix Ex Taq™ kit (TOYOBO, Japan). The ChSAA mRNA expression levels in various tissues and during pathogen challenge were determined via quantitative realtime PCR using gene-specific ChSAAF3/ChSAAR3 primer pairs (Table 1). The GAPDH gene was used as a reference gene to normalize the initial quantity of RNA. Quantitative real-time PCR reactions were performed using the Light-Cycler 480 II System (Roche, USA) with a volume of 20 ml containing 10 ml of 2 SYBR Green PCR Master Mix (TOYOBO, Japan), 1 ml of 10 mM primers, 8 ml of nuclease-free water, and 1 ml of cDNA template. The PCR thermal cycle protocol was an initial denaturation cycle at 95 C for 5 min, followed by 40 cycles of 95 C for 15 s, 57 C for 15 s and 72 C for 15 s. Melting curve analysis was performed at the end of the reaction to assess the specificity of the PCR amplification.
F. Qu et al. / Fish & Shellfish Immunology 39 (2014) 145e151
147
The relative expression level of ChSAA was determined using 2DDCt method based on the Ct values of the target and reference genes to calculate the fold-change in expression [18]. The amplification efficiencies of the target and reference genes were verified and found to be approximately equal. All data obtained from RTPCR were analyzed using SPSS 13.0 for Windows software. 2.5. Construction of the eukaryotic expression plasmid, cell culture and the dual-luciferase reporter assay To examine the effect of ChSAA on NF-kB transcriptional activity, recombinant pcDNA3.1-ChSAA vectors were constructed. The entire ORF of ChSAA was inserted into the pcDNA3.1 vector (Invitrogen, USA) and amplified using the primers pair ChSAAF4/ChSAAR4 (Table 1). This primer pair contained the restriction sites HindIII at the 50 end and XhoI at the 30 end. The target PCR products were purified, digested, and then inserted into the pcDNA3.1 plasmid. The resulting colonies were verified via DNA sequencing, and the confirmed recombinant plasmids were transformed into HEK293T cells. The HEK293T cells were cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum (FBS, Gibco BRL) and antibiotics (100 mg/L streptomycin and 105 U/L penicillin, Gibco) in a humidified incubator containing 5% CO2 maintained at 37 C. Due to the lack of bivalve mollusk cell lines, the analysis of the influence of ChSAA on (human) NF-kB-mediated promoter activation was performed on HEK293T cells using a luciferase reporter gene. The cells were seeded on 48-well plates (105 cells/well) for 24 h and transiently co-transfected with the NF-kB reporter vector (Promega, USA), pRL-TK (Clontech, USA), pcDNA3.1 (Promega, USA) and pcDNA3.1-ChSAA in a serum-free culture medium using Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer's protocol. The luciferase activity of the total cell lysates was measured using a luciferase reporter assay system (Promega, USA) at 48 h post-transfection. Briefly, the HEK293T cells in 48-well plates were washed twice with 100 ml PBS, followed by treatment with 30 ml 1 passive lysis buffer at room temperature for 10 min. The cell lysates were transferred to a plate, and 50 ml of luciferase assay reagent II and 50 ml of 1 stop & glo reagent were added sequentially. Then, both the firefly and renilla luciferase activities were measured. The values were expressed as the means ± S.E. for three separate experiments, each performed in duplicate. 3. Results 3.1. cDNA cloning and sequence analysis of the ChSAA gene A 400 bp EST sharing high similarity with the SAA gene of M. musculus was identified in the hemocyte EST library of C. hongkongensis. Based on the sequence of the EST, two fragments of ChSAA measuring 204 bp and 84 bp were amplified via 50 - and 30 RACE, respectively. A 623 bp nucleotide sequence representing the full-length cDNA sequence of ChSAA was obtained by overlapping the EST sequences and the RACE fragments, as described above. The complete cDNA sequence of the ChSAA gene (GenBank accession no. KF156832) contains a 50 -UTR of 147 bp, a 30 -UTR of 56 bp containing a polyadenylation signal sequence (AATAAA) and a poly(A) tail, and an open reading frame (ORF) of 420 bp. The ORF is predicted to encode a polypeptide of 139 amino acids (Fig. 1A), with a calculated molecular mass of 15.86 kDa and a theoretical isoelectric point of 9.75. A signal peptide of 22 amino acids was predicted using the SignalP program (Fig. 1B). The conserved domains of ChSAA were revealed based on secondary structure predictions and analysis using the SMART program, including a signal
Fig. 1. The complete cDNA and deduced amino acid sequences of ChSAA. (A) The initiation and stop codons are in bold. The polyadenylation signal sequence (AATAAA) is in bold and underlined. The 22 amino acid signal peptide is indicated by the box, and the predicted SAA domain is shaded. (B) Domain organization of ChSAA.
peptide “MRVFSVLSVLLIGLVLTEQTLA” (positions 1e22 aa) and a conserved SAA domain (positions 36e138 aa), with the typical features of SAA family proteins (Fig. 2). The multiple sequence alignment revealed that the deduced amino acid sequence of ChSAA shares 51.1e59.6% identity to published A-SAAs from other species and 41.1e43.8% identity to CSAAs, including H. sapiens SAA4 and M. musculus SAA5 (Table 2). A phylogenetic tree constructed using the Megalign tool in DNAstar software using the amino acid sequences of the SAA from C. hongkongensis and other species indicates its clear evolutionary relationship. As shown in Fig. 3, the analysis classified the SAA sequences into two major clusters; the ChSAA sequences from C. hongkongensis were grouped into a single branch, while the SAAs from other spices formed a distinct branch. 3.2. Distribution patterns and time-dependent expression of ChSAA mRNA in response to pathogen challenge The mRNA expression of ChSAA was detected via quantitative RT-PCR for all examined tissues of C. hongkongensis, including the labial palps, the digestive gland, the gonad, the adductor muscle, the mantle, the gill, the heart, and hemocytes. The results revealed relatively high expression levels in the labial palps and the mantle and relatively low expression levels in hemocytes (Fig. 4). The expression levels of ChSAA in hemocytes were significantly increased in response to pathogen challenge based on quantitative
148
F. Qu et al. / Fish & Shellfish Immunology 39 (2014) 145e151
Fig. 2. Multiple alignment analysis of ChSAA amino acid sequences and other known SAA proteins. The GenBank accession numbers corresponding to the SAA protein sequences examined are listed in Table 2.
RT-PCR. When challenged by V. alginolyticus, the expression level initially significantly increased at 6 h post-challenge (24-fold), peaking (425-fold) at 72 h post-infection, compared to treatment with PBS (Fig. 5A). When challenged by S. haemolyticus, the level of ChSAA mRNA rose up to 14-fold at 6 h post-challenge, peaking at 493-fold at 48 h post-challenge, and then decreased to 116-fold at 72 h (Fig. 5B). Under challenge by S. cerevisiae, the expression initially rose at 3 h post-infection (91-fold), peaking at 222-fold at 48 h post-infection, and then declined to 46-fold at 72 h postchallenge (Fig. 5C). 3.3. The activating effect of ChSAA on the NF-kB signaling pathway Dual-luciferase reporter assays were performed to determine the immune signaling pathways that ChSAA activates. The results revealed that the NF-kB luciferase reporter was activated by ChSAA in a dose-dependent manner, with a maximum increase of 5-fold relative to transfection of HEK293T cells with pcDNA3.1 alone (P < 0.05) (Fig. 6). These results suggest that ChSAA could trigger the activation of the NF-kB signaling pathway in HEK293T cells. 4. Discussion As a major immune effector molecule during the acute phase, SAAs are functionally important for host defense and the immune
Table 2 Amino acid identity comparison of the ChSAA with other known SAA homologs. Species
GenBank accession no.
Amino acid identity (%)
Homo sapiens SAA1 Homo sapiens SAA2 Homo sapiens SAA4 Pongo abelii Gallus gallus Mus musculus SAA1 Mus musculus SAA2 Mus musculus SAA3 Mus musculus SAA5 Ornithorhynchus anatinus Danio rerio Tetraodon nigroviridis Apostichopus japonicus Crassostrea hongkongensis
AAA64799.1 NP_110381.2 NP_006503.2 NP_001127066 XP_003641381.1 NP_033143.1 NP_035444.1 NP_035445.1 AAB17555.1 XP_001513428.1 NP_001005599.1 CAF99678 ABX55830.2 KF156832
54.0 55.4 43.8 57.6 57.6 53.2 51.1 53.2 41.1 58.3 54.0 56.1 59.6 100.0
response in animals from teleosts to mammals [1,2]. However, information regarding SAA homologs in invertebrates remains limited. To the best of our knowledge, this new SAA-homologous gene cloned from C. hongkongensis (ChSAA) was the first SAA gene sequence identified in mollusks. The present ChSAA displays structural characteristics typical of SAA family proteins: A signal peptide and a conserved SAA domain. Sequence analysis reveals that the deduced amino acid sequence of ChSAA displays a higher degree of sequence identity and similarity to known A-SAAs than CSAAs. Similar to other known A-SAAs, the typical C-SAA sequence contains an octapeptide located in the middle region that does not exist in the ChSAA sequence. Phylogenetically, ChSAA is certainly considered to be an evolutionarily conserved protein from lower invertebrates to higher mammals. In recent reports, it has been demonstrated that the size of known SAA family genes ranges from one to five copies, with a single copy in teleosts and invertebrates, two in hamsters, three in horses, dogs and rabbits, four in humans and five in mice [3,8]. Our study reveals only one SAA-encoding gene, equivalent to that of teleosts and other non-mammalian organisms, present in C. hongkongensis, suggesting that the multigene SAA family may be specific to mammals. Moreover, the known non-mammalian SAA proteins, including ChSAA, are highly similar to those from humans, which are encoded by the inducible acute phase SAA (A-SAA) genes. These characteristics appear to indicate that the primordial SAA gene was an inducible and constitutively expressed SAAencoding gene (C-SAA) that recently differentiated exclusively within the mammalian lineage [12]. Furthermore, the known non-
Fig. 3. Phylogenetic analysis of SAA homologs from invertebrates to vertebrates using the Megalign program of DNAstar software based on the alignment of the complete amino acid sequences. The GenBank accession numbers included are listed in Table 2.
F. Qu et al. / Fish & Shellfish Immunology 39 (2014) 145e151
149
Fig. 4. Relative expression levels of ChSAA in different tissues: hemocytes, heart, gill, labial palps, mantle, adductor muscle, digestive gland and gonads. Each bar represents the mean of the normalized expression levels of replicates (N ¼ 3).
mammalian SAA proteins, including ChSAA, are highly similar to the human SAA proteins. Together, the significant homology between ChSAA and other known A-SAA sequences and the presence of characteristics important for SAA function suggests that ChSAA is a functionally conserved protein that may play important roles in the innate immune response in C. hongkongensis. In vertebrates, SAA was previously demonstrated to be ubiquitously expressed in many tissues, typically at the highest level in the liver, which is the primary organ that synthesizes SAA proteins [3,19]. In this study, mRNA transcripts corresponding to ChSAA were detected in all eight examined tissues, suggesting that ChSAA is ubiquitously and constitutive expressed. These results are agreement with that in other species. The highest expression level of ChSAA in the mantle may be somewhat different from that of vertebrate animals [13], implying that the mantle may play a role in some biological processes related to ChSAA. In mammals, SAA is detected at low plasma concentrations under non-immune challenged conditions. However, in the inflammatory state, the serum SAA concentration may increase up to 1000-fold due to the stimulation of inflammatory cytokines, including IL-1, IL-6, and TNF-a, compared to the non-inflammatory state [3,5,20]. The low expression level of ChSAA in hemocytes may indicate that the expression pattern of ChSAA in bivalve mollusks is similar to that of the vertebrates under normal conditions. It is generally believed that all organisms are exposed to challenging environments comprising various biotic and abiotic components and require a highly coordinated system for contending with immune challenges. The acute phase response (APR) is a complex systemic early defense system activated by tissue injury, infection and inflammation [1,3] that induces a remarkable alteration in the concentrations of many acute phase proteins (APPs) [7]. APPs, essential components of the innate immune system [2,21], play important roles in a variety of host defense-related activities, such as destroying infectious microbes, repairing damaged tissue and restoring the healthy state [22]. In vertebrates, APPs have been categorized based on the extent to which their plasma level changes (major, moderate, or minor) and the direction of this change (positive or negative) during the APR. The APP types include major APPs (concentrations increasing from 10- to 100-fold or up to 1000-fold), moderate APPs (concentrations increasing from 2- to 10-fold), minor APPs (concentrations increasing only slightly), positive APPs (concentrations increasing) and negative APPs (concentrations decreasing) [1,6,8,23]. As a major positive APP, SAA has been demonstrated to play important roles in the host defense against extracellular pathogens in vertebrates [3]. In the present study, the temporal expression of ChSAA in hemocytes under pathogen challenge indicates that ChSAA mRNA expression was
Fig. 5. The expression of ChSAA after pathogen challenge in hemocytes. (A) The expression patterns of ChSAA mRNA in C. hongkongensis after challenge by V. alginolyticus, (B) S. haemolyticus and (C) S. cerevisiae. Each bar represents the mean of the normalized expression levels of replicates (N ¼ 3); significant differences were indicated by an asterisk (* and ** represent p < 0.05 and p < 0.01, respectively).
quickly and drastically triggered by V. alginolyticus, S. haemolyticus and, to a lesser extent, S. cerevisiae (Fig. 5). This result is similar to the changes in SAA expression in E. coioides upon pathogen infection [13], which showed us that SAAs both in C. hongkongensis and E. coioides have a stronger and wider responsiveness to Gþ bacteria, G bacteria and fungus challenges, suggesting that ChSAA is involved in related pathways of innate immune defense against bacterial and fungal pathogens. The acute phase expression patterns of ChSAA, the expression levels in hemocytes increased up to hundreds of times compared to the control group in response to pathogen challenge, strongly indicate that ChSAA, similar to other SAA proteins of vertebrates, is a major positive APP in C. hongkongensis. Combined with the computerized analysis of the ChSAA sequence described above, this result may also suggest that
150
F. Qu et al. / Fish & Shellfish Immunology 39 (2014) 145e151
the NF-kB signaling pathway in HEK293T cells. These results strongly support that ChSAA is a major positive APP involved in the APR against bacterial and fungal pathogens in C. hongkongensis and provide new insights into the innate immune defense system of oysters against pathogens. However, further study is required to elucidate the specific functions of ChSAA and its involvement in the innate immune response pathways in mollusks. For example, RNAi approach could be used to knock down the ChSAA gene expression in C. hongkongensis to study the function of ChSAA in regulating TLR-mediated NF-kB signaling pathway post-bacteria challenge. In addition, microbial-binding assays could also be used to test binding of recombinant ChSAA fusion protein from prokaryotic expression system to pathogenic microorganisms. Fig. 6. Effects of ChSAA expression on the activity of the NF-kB reporter gene. The cells were transiently co-transfected with an NF-kB reporter vector, pRL-TK and the ChSAA expression vector. The pcDNA3.1 vector was used as a control in the HEK293T cells. Significant differences are indicated by different letters (p < 0.05).
ChSAA is a member of the A-SAA family rather than the C-SAA family. Furthermore, it may be concluded that the dramatic upregulation of A-SAAs in response to pathogenic stimuli is common and has a shared protective biological function among vertebrates and invertebrates. Toll-like receptors (TLRs) have been established to play an essential role in the activation of the innate immune response by acting as pattern recognition receptors that recognize specific patterns of microorganisms [24]. Except for microbial pathogens, there are several endogenous TLR ligands that have been identified; one of these ligands is the acute serum amyloid A protein (A-SAA) [25e27], which has been proposed to be an endogenous ligand for TLR2 [25] and an effector molecule for TLR4 [26]. Upon infection and inflammation, the expression of A-SAA is induced by proinflammatory cytokines, such as IL-1, IL-6 and TNF-a [3]. The secreted SAA could enhance the innate immune response to pathogens by acting as a potent endogenous ligand binding to TLRs, stimulating inflammatory cytokine expression via the TLRmediated NF-kB signaling pathway [25,27]. Previous studies revealed that TLR-induced NF-kB activation is important in the ancient innate host defense system, which is phylogenetically conserved and has been proven to exist in bivalve mollusks [28e32]. The activation of the NF-kB signaling pathway is essential for the induction of immune response-related genes and is typically measured to assess the extent of activation of immune responses [33]. The NF-kB reporter gene (human) assay performed using HEK293T cells indicated that the activation of NF-kB was clearly induced by ChSAA (Fig. 6), suggesting that ChSAA could activate the NF-kB reporter gene in mammalian cells. Combined with the results of the ChSAA mRNA expression level under pathogen challenge, we deduce that ChSAA may be involved in and activate the NF-kB signaling pathway against extracellular pathogens in C. hongkongensis. However, further study is required to confirm this hypothesis. Further results are expected to provide additional evidence for the involvement of ChSAA in the TLR-induced NF-kB cellular immune response pathway in mollusks. In conclusion, a molluscan functional SAA homolog (ChSAA), a major member of the APP family, was identified for the first time from C. hongkongensis. Sequence and phylogenetic analyses indicate that the ChSAA protein shares a high degree of sequence identity and similarity to known A-SAAs. Furthermore, the expression profiles of ChSAA were demonstrated to be constitutively expressed in the oyster. The acute response patterns in hemocytes under pathogen challenge suggest that ChSAA may perform a protective biological function in the host immune defense. Additional studies revealed that ChSAA acts as an inducer of
Acknowledgments This research was supported by the National Natural Science Foundation of China (No. 31202021), the National Science Foundation of China (41176150) and the National Basic Research Program of China (No. 2010CB126404). References [1] Cray C, Zaias J, Altman NH. Acute phase response in animals: a review. Comp Med 2009;59:517e26. [2] Baumann H, Gauldie J. The acute phase response. Immunol today 1994;15: 74e80. [3] Uhlar CM, Whitehead AS. Serum amyloid A, the major vertebrate acute-phase reactant. Eur J Biochem 1999;265:501e23. [4] Kushner I. The phenomenon of the acute phase response. Ann N Y Acad Sci 1982;389:39e48. [5] Jensen LE, Whitehead AS. Regulation of serum amyloid A protein expression during the acute-phase response. Biochem J 1998;334:489e503. [6] Bayne CJ, Gerwick L. The acute phase response and innate immunity of fish. Dev Comp Immunol 2001;25:725e43. [7] Epstein FH, Gabay C, Kushner I. Acute-phase proteins and other systemic responses to inflammation. N Engl J Med 1999;340:448e54. [8] Steel DM, Whitehead AS. The major acute phase reactants: C-reactive protein, serum amyloid P component and serum amyloid A protein. Immunol today 1994;15:81e8. [9] De Beer M, Kindy MS, Lane WS, De Beer F. Mouse serum amyloid A protein (SAA5) structure and expression. J Biol Chem 1994;269:4661e7. [10] Whitehead A, De Beer M, Steel D, Rits M, Lelias J, Lane W, et al. Identification of novel members of the serum amyloid A protein superfamily as constitutive apolipoproteins of high density lipoprotein. J Biol Chem 1992;267:3862e7. [11] Lin B, Chen S, Cao Z, Lin Y, Mo D, Zhang H, et al. Acute phase response in zebrafish upon Aeromonas salmonicida and Staphylococcus aureus infection: striking similarities and obvious differences with mammals. Mol Immunol 2007;44:295e301. €llner B, Seyfert H-M. Characterization of [12] Rebl A, Goldammer T, Fischer U, Ko two key molecules of teleost innate immunity from rainbow trout (Oncorhynchus mykiss): MyD88 and SAA. Vet Immunol Immunopathol 2009;131: 122e6. [13] Wei J, Guo M, Ji H, Qin Q. Molecular cloning, characterization of one key molecule of teleost innate immunity from orange-spotted grouper (Epinephelus coioides): serum amyloid A. Fish Shellfish Immunol 2012;34: 296e304. [14] Yiangou M, Papaconstantinou J. The differential induction of a-acid glycoprotein and serum amyloid A genes by heavy metals. Biochim Biophys Acta BBA e Gene Struct Expr 1993;1174:123e32. [15] Teles M, Mackenzie S, Boltana S, Callol A, Tort L. Gene expression and TNFalpha secretion profile in rainbow trout macrophages following exposures to copper and bacterial lipopolysaccharide. Fish Shellfish Immunol 2011;30: 340e6. [16] Shah C, Hari-Dass R, Raynes JG. Serum amyloid A is an innate immune opsonin for Gram-negative bacteria. Blood 2006;108:1751e7. [17] Campanella JJ, Bitincka L, Smalley J. MatGAT: an application that generates similarity/identity matrices using protein or DNA sequences. BMC Bioinformatics 2003;4:29. [18] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2DDCT method. Methods 2001;25:402e8. [19] Meek R, Urieli-Shoval S, Benditt E. Expression of apolipoprotein serum amyloid A mRNA in human atherosclerotic lesions and cultured vascular cells: implications for serum amyloid A function. Proc Natl Acad Sci 1994;91: 3186e90. [20] Kushner I. The acute phase response: an overview. Method Enzymol 1988;163:373e83.
F. Qu et al. / Fish & Shellfish Immunology 39 (2014) 145e151 [21] Revathy KS, Umasuthan N, Whang I, Lee Y, Lee S, Oh M-J, et al. A novel acute phase reactant, serum amyloid A-like 1, from Oplegnathus fasciatus: genomic and molecular characterization and transcriptional expression analysis. Dev Comp Immunol 2012;37:294e305. [22] Murata H, Shimada N, Yoshioka M. Current research on acute phase proteins in veterinary diagnosis: an overview. Veterinary J 2004;168:28e40. [23] Zhou X, Wang L, Feng H, Guo Q, Dai H. Acute phase response in Chinese softshelled turtle (Trionyx sinensis) with Aeromonas hydrophila infection. Dev Comp Immunol 2011;35:441e51. [24] Takeda K, Akira S. TLR signaling pathways. Semin Immunol 2004;16:3e9. [25] Cheng N, He R, Tian J, Patrick PY, Richard DY. Cutting edge: TLR2 is a functional receptor for acute-phase serum amyloid A. J Immunol 2008;181:22e6. [26] Sandri S, Rodriguez D, Gomes E, Monteiro HP, Russo M, Campa A. Is serum amyloid A an endogenous TLR4 agonist? J Leukoc Biol 2008;83:1174e80. [27] He RL, Zhou J, Hanson CZ, Chen J, Cheng N, Ye RD. Serum amyloid A induces GCSF expression and neutrophilia via Toll-like receptor 2. Blood 2009;113: 429e37.
151
[28] Liang Y, Zhou Y, Shen P. NF-kappaB and its regulation on the immune system. Cell Mol Immunol 2004;1:343e50. [29] Montagnani C, Kappler C, Reichhart J, Escoubas J. Cg-Rel, the first Rel/NF-kB homolog characterized in a mollusk, the Pacific oyster Crassostrea gigas. FEBS Lett 2004;561:75e82. [30] Zhang L, Li L, Zhang G. A Crassostrea gigas Toll-like receptor and comparative analysis of TLR pathway in invertebrates. Fish Shellfish Immunol 2011;30: 653e60. [31] Zhang Y, He X, Yu Z. Two homologues of inhibitor of NF-kappa B (IkappaB) are involved in the immune defense of the Pacific oyster, Crassostrea gigas. Fish Shellfish Immunol 2011;30:1354e61. [32] Lemaitre B, Hoffmann J. The host defense of Drosophila melanogaster. Annu Rev Immunol 2007;25:697e743. [33] Skjæveland I, Iliev DB, Strandskog G, Jørgensen JB. Identification and characterization of TLR8 and MyD88 homologs in Atlantic salmon (Salmo salar). Dev Comp Immunol 2009;33:1011e7.