- Email: [email protected]
The functional variant rs1048990 in PSMA6 is associated with susceptibility to myocardial infarction in a Chinese population
Atherosclerosis 206 (2009) 199–203
Contents lists available at ScienceDirect
Atherosclerosis journal homepage: www.elsevier.com/locate/atherosclerosis
The functional variant rs1048990 in PSMA6 is associated with susceptibility to myocardial infarction in a Chinese population Xin Liu a , Xingyu Wang b , Yue Shen b , Lijun Wu a,b , Xiaoyang Ruan b , Klaus Lindpaintner c , Salim Yusuf d , James C. Engert e , Sonia Anand d , Xuerui Tan a,∗ , Lisheng Liu b,∗ a
The First Affiliated Hospital, Medical College of Shantou University, Shantou, China Laboratory of Human Genetics, Beijing Hypertension League Institute, Beijing, China Roche Center for Medical Genomics, F. Hoffmann-La Roche, Ltd., Basel, Switzerland d Population Health Research Institute, Department of Medicine, McMaster University, Canada e Departments of Medicine and Human Genetics, McGill University, Canada b c
a r t i c l e
i n f o
Article history: Received 1 October 2008 Received in revised form 22 January 2009 Accepted 2 February 2009 Available online 12 February 2009 Keywords: PSMA6 Genetics Myocardial infarction Single nucleotide polymorphism Chinese population
a b s t r a c t A recent case–control study reported that a functional single nucleotide polymorphism (SNP) in the proteasome subunit ␣ type 6 gene (PSMA6) (rs1048990, C/G) was associated with susceptibility to myocardial infarction (MI) in the Japanese population. Replication studies have been performed in European and other Japanese study samples, but the results were not conclusive. The purpose of the present study was to determine whether this locus confers significant susceptibility to MI in a Chinese population. We conducted a case–control association study on a cohort of 1884 MI patients and 2643 unrelated controls from the Chinese population. Genotyping of the rs1048990 SNP was performed by the Allele-specific Real Time PCR method. We found that rs1048990 was significantly associated with MI (adjusted for age and sex, odds ratio 1.22, p = 0.000005, allele frequency model; odds ratio 1.44, p = 0.0000025; recessive model; odds ratio 1.56, p = 0.00000048, additive model). A meta-analysis yielded a combined OR for MI of 1.15 (95% CI: 1.11–1.21) with an allele frequency model, 1.37 (95% CI: 1.23–1.51) with a recessive model and 1.44 (95% CI: 1.29–1.60) with an additive model. There was no relationship between rs1048990 and age, sex or other conventional cardiovascular risk factors. Our results indicate that the PSMA6 variant rs1048990 is a risk factor of myocardial infarction in the Chinese population. © 2009 Elsevier Ireland Ltd. All rights reserved.
1. Introduction Coronary artery disease (CAD) is one of the leading causes of death and loss of disability-adjusted life years in both developed and developing countries [1]. Myocardial infarction (MI), the most serious clinical manifestation of CAD, is the condition of irreversible necrosis of the heart muscle that results from prolonged ischemia. Approximately 90% of MI results from formation of an acute thrombus that obstructs an atherosclerotic coronary artery. MI is a complex disease caused by both environmental and genetic factors. The INTERHEART study, a global case–control study of first acute MI carried out in 52 countries, has reported that nine potentially modifiable risk factors (smoking, diabetes, abdominal obesity, etc) contribute to MI in both sexes and in all regions of the world [2]. A large number of association studies have been carried out
∗ Corresponding authors. Tel.: +86 754 88611690; fax: +86 754 88259850. E-mail addresses: [email protected] (X. Tan), [email protected] (L. Liu). 0021-9150/$ – see front matter © 2009 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.atherosclerosis.2009.02.004
and variants in many genes have been implicated in modifying susceptibility to MI [3,4]. Inflammation is thought to play a key role in the development of coronary atherosclerosis and increases the risk of MI [5,6]. It is a consequence of complex interactions among modified lipoproteins, monocyte-derived macrophages, T lymphocytes, and vascular smooth muscle cells from the vessel wall. Recent studies indicated that genetic variations of inflammatory genes, such as inter-alpha (globulin) inhibitor 3 (ITIH3) genes [7] and the galectin-2 (LGALS2) gene [8], are significantly associated with susceptibility to MI. Recently, a large case–control study (2592 cases and 2851 controls) showed that a functional single nucleotide polymorphism (SNP) in the proteasome subunit ␣ type 6 gene (PSMA6) confers a risk of MI in a Japanese population [9]. The rs1048990 SNP is located in the 5 untranslated region of exon 1, and the risk-conferring G allele appears to enhance the transcription of PSMA6. The altered expression of PSMA6 could impair ubiquitin-proteasome functions and increase inflammation through activation of nuclear factor (NF-B) protein [10]. Replication studies have been performed in another Japanese population [11] and in European populations
200
X. Liu et al. / Atherosclerosis 206 (2009) 199–203
[12,13], but the results were not conclusive. Additional studies in different populations, especially in other ethnic groups, are necessary and important. Therefore, we examined the association of the PSMA6 rs1048990 SNP with risk of MI in the INTERHEART China study cohort (1884 MI cases and 2643 controls). 2. Methods 2.1. Subjects To assess the importance of risk factors of first acute MI and to clarify whether the effects of risk factors vary in different countries or ethnic groups, a large scale case–control study, the INTERHEART study, was carried out in China and 51 other countries. The present cohort is part of the global INTERHEART study. The criteria for recruitment of MI cases and controls have been previously described in detail [2]. Briefly, cases for this study were screened to identify first incident MI, recruited from 24 participating hospitals in 15 cities of China. We included cases without cardiogenic shock or history of major chronic diseases. Acute MI was defined as follows: clinical symptoms and electrocardiogram showing substantial changes such as new pathological Q waves or 1 mm ST elevation in any two or more contiguous limb leads, or a new left bundle branch block or new persistent ST-T wave changes diagnostic of a non-Q wave MI, or raised concentration of troponin. Control subjects were recruited from healthy adult visitors to the hospitals without a history of cardiovascular disease, matched for age (up to 5 years older or younger) and sex with the cases. The Ethics Committee of Beijing Hypertension League Institute approved the study and all participants provided informed consent before taking part in the study. The investigation conforms with the principles outlined in the Declaration of Helsinki. Participants who consented to the study completed a structured questionnaire, attended a health examination, and had a venous blood sample taken. Information about demographic factors, socioeconomic status, lifestyle (smoking, leisure time, physical activity, and dietary patterns), personal and family history of cardiovascular disease, hypertension, diabetes mellitus was obtained. Hypertension and diabetes were defined by self-report of being previously diagnosed or treated with medication for these diseases. Height, weight, waist and hip circumferences, and heart rate were determined by a standard protocol. Body mass index (BMI) was calculated as [weight (kg)/height2 (m)2 ]. Blood samples were drawn Table 1 Characteristics of the study cohorts. Characteristic *
Age , years Male (%) BMI* Waist circumference* , cm W/H* Current smoking (%) Alcohol intake (%) History of HT (%) History of T2D (%) HDL-C* , mmol/L TC* , mmol/L TG* mmol/L LDL-C* , mmol/L ApoA1* , g/L ApoB* , g/L ApoB/A1*
MI case (n = 1884)
Control (n = 2643)
p value
60.7 (11.7) 70.2 24.8 (3.1) 86.8 (9.6) 0.9 (0.1) 44.0 40.5 42.9 13.3 1.0 (0.3) 4.7 (1.2) 1.6 (1.1) 2.9 (1.0) 1.3 (0.3) 0.9 (0.3) 0.7 (0.2)
59.4 (11.4) 69.3 24.4 (2.9) 84.4 (9.0) 0.9 (0.1) 28.7 36.5 22.8 3.2 1.1 (0.4) 4.6 (1.1) 1.7 (1.1) 2.7 (1.0) 1.4 (0.3) 0.8 (0.2) 0.6 (0.2)
0.026 0.094 <0.0001 0.007 0.007 <0.0001 0.007 <0.0001 <0.0001 <0.0001 0.010 0.059 <0.0001 <0.0001 <0.0001 0.023
MI, myocardial infarction; BMI, body mass index (kg/m2 ); cm, centimeters; W/H, waist/hip ratio; HT, hypertension; T2D, type 2 diabetes; HDL-C, high-density lipoprotein cholesterol; TC, total cholesterol; TG, triglycerides; LDL-C, low-density lipoprotein cholesterol; Apo, apolipoprotein. * Data are means (SD).
from every individual, and shipped to a central blood storage site at the Beijing Hypertension League Institute where samples were stored at −160 ◦ C in liquid nitrogen. Plasma concentrations of triglyceride, total cholesterol, highdensity lipoprotein cholesterol (HDL-C), apolipoproteins B (ApoB) and A1 (ApoA1) were analyzed by Roche/Hitachi 911 analyser (Roche Diagnostics, Mannheim, Germany). Analytic techniques have been described in detail previously [2]. Total cholesterol, HDL-C and triglycerides were quantified by standard enzymatic procedure (Roche Diagnostics, Mannheim, Germany), and the Assayed Human multi-sera (Randox Laboratories Ltd., UK) was used as quantity control. Immunoturbidimetric assays were used to measure apolipoprotein concentrations (Tina-quant ApoB version 2 and ApoA1 version 2 kits; Roche Diagnostics, Mannheim, Germany). Precinorm and Precipath controls (Roche Diagnostics, Mannheim, Germany) were used in ApoA1 and ApoB analysis in every run. Interassay coefficient variation was less than 5% for all laboratory tests. Low-density lipoprotein cholesterol (LDL-C) concentrations were calculated according to Friedewald’s formula [14]. 2.2. Genotyping A total of 5850 participants (2932 MI cases and 2918 controls) were recruited for the INTERHEART study in China, and of these, 4598 participants (1901 MI cases and 2697 controls) had DNA samples available. Genomic DNAs were extracted from leukocytes using QIAamp® DNA Blood Midi Kit (QIAGEN, Germany) according to the manufacture’s protocol. Genotyping for rs1048990 in PSMA6 was carried out by Allele-specific Real Time PCR assay [15]. Primers were designed using Oligo Version 6.54 and are as follows: common primer: 5 aacttccgggaggtgcttgtg3 ; allele-specific primer 1: 5 aaccacgggacatgttggtag3 ; allele-specific primer 2: 5 aaccacgggacatgttggtac3 . The Real Time PCR amplifications were performed in a 25 L mixture consisting of 4 L DNA template (2.5 ng/L), 1× PCR buffer, 50 M dNTP, 0.2 × SYBR Green I (Invitrogen, USA) and 2.4 U of DeltaZ05 DNA polymerase (Roche), 0.2 M of common primer and 0.2 M of an allele-specific primer (the amplifications of the same DNA sample with different allelespecific primers were performed in different wells but on the same plate). The PCR was performed by GeneAmp® 5700 Real Time PCR System (Applied Biosystems, USA) under the following conditions: denaturation at 95 ◦ C for 12 min, followed by 45 cycles of 95 ◦ C for 30 s and 60 ◦ C for 30 s, and finished by a 20 min dissociation step at 60 ◦ C. Fluorescence data files from each plate were analyzed by GeneAmp® 5700 software Version 1.3 and reviewed by an operator. The genotype was assigned by Ct, the difference in Ct’s between the two reactions on the same sample with different allele-specific primers. As a quality control measure, direct sequencing of 94 randomly selected genotyped samples was conducted to assess the accuracy of genotyping. 2.3. Statistical analysis Univariate associations were explored with frequency tables and Pearson’s 2 tests for independent proportions. Continuous variables were compared with t tests or appropriate non-parametric tests, depending on their distribution. Fisher’s exact test was used to assess differences in allele or genotype distribution between cases and controls. A weighted kappa statistic was computed to assess reproducibility of genotyping. Logistic regression was used to estimate odds ratio (OR) and OR adjusted for age and sex of allele frequency and genotype for MI. Standard one-way ANOVA were used to assess the associations of SNP with biochemical markers in the control group. Analyses were performed using SAS Version 9.1 software. The genotype distribution for the SNP was assessed for departure from Hardy–Weinberg equilibrium in
X. Liu et al. / Atherosclerosis 206 (2009) 199–203
201
Table 2 Association between MI and rs1048990 SNP. Genotype (%) CC MI case Control Model
CG
753(40.0) 1203(45.5)
GG 888 (47.1) 1190 (45.0)
Total 243 (12.9) 250 (9.5)
1884 (100) 2643 (100)
0.37 0.32
Adjusted*
Unadjusted
OR (95% CI)
p
2
OR (95% CI)
p
19.8 20.3 23.9
1.22 (1.12–1.33) 1.42 (1.18–1.71) 1.55 (1.27–1.89)
0.0000084 0.00025 0.000013
20.8 22.1 25.3
1.22 (1.13–1.35) 1.44 (1.19–1.80) 1.56 (1.24–1.90)
0.000005 0.0000025 0.00000048
2
Allele frequency Recessive Additive
MAF (G allele)
MI, myocardial infarction; MAF, minor allele frequency; OR, odds ratio. * Odds ratio adjusted for age and sex.
cases, controls and total samples, using an exact 2 goodness-offit test [16]. Linkage disequilibrium (LD) analysis was conducted using genotypes of the HCB population from the HapMap Project (www.hapmap.org) (Rel#21a/PhaseII, Jan07) and Haploview Version 4.0 software [17,18]. Meta-analysis statistics were performed using Review Manager Version 4.2 software. The OR and 95% confidence interval (CI) were calculated for each study, and the results were compared through the use of a fixed effects model. Statistical heterogeneity was evaluated with the 2 and the I2 statistics, which assess the appropriateness of pooling the individual study results [19]. 3. Results We successfully obtained the genotype information from 4527 samples (1884 cases and 2643 controls) with a call rate of 98.5%. The characteristics of the participants genotyped in the study are shown in Table 1. The reproducibility of the genotyping was high, with a weighted kappa score of 1.00. The minor allele frequency (MAF) and genotype distribution in MI cases and controls for the PSMA6 rs1048990 polymorphism is shown in Table 2. The G allele was a risk allele for MI (adjusted for age and sex, OR 1.22, 95% CI: 1.13–1.35,
p = 0.000005). Significant association was also observed between the genotype and susceptibility to MI under both a recessive model (GG to CG + CC, adjusted for age and sex, OR 1.44, 95% CI: 1.19–1.80, p = 0.0000025) and an additive model (GG to CC, adjusted for age and sex, OR 1.56, 95% CI: 1.24–1.90, p = 0.00000048). The polymorphism was in Hardy–Weinberg equilibrium in cases, controls and the combined sample (p > 0.05). We carried out LD analysis using the data from the HapMap Project (www.hapmap.org) (Rel#21a/PhaseII, Jan07). A map of SNPs in a 25 kb region of the PSMA6 gene in the HapMap HCB population is shown (Fig. 1). Four SNPs with MAF ≥ 5% were in low pair-wise LD measured by r2 values (rs1048990 and rs12878391 had the highest r2 = 0.162), although most had D values. The results of a meta-analysis of our study and five other studies are displayed in Table 3. The combined OR for MI was 1.15 (95% CI: 1.11–1.21, Z = 6.48, p < 0.00001) with the allele frequency model, 1.37 (95% CI: 1.23–1.51, Z = 6.01, p < 0.00001) with a recessive model and 1.44 (95% CI: 1.29–1.60, Z = 6.67, p < 0.00001) with an additive model. There was no evidence of statistical heterogeneity between the results of different studies (p = 0.20, p = 0.48 and p = 0.37, for allele frequency, recessive and additive models respectively). We found no relationship between rs1048990 genotypes and age, sex and other conventional phenotypic risk factors. Table 4 shows the age, sex, and other risk factors for the genotypes in the controls. 4. Discussion
Fig. 1. LD map of the human PSMA6 gene. Physical organization of the 14q13 locus containing PSMA6 and LD analysis based on the HapMap database (Rel#21a/PhaseII, Jan07) in the HCB population, SNPs with an MAF ≥ 5%. Values represent D .
The present study involving 1884 MI cases and 2643 unrelated controls is the first genetic association study in a Chinese population to investigate MI risk in relation to the functional variant rs1048990 in the PSMA6 gene. The results indicated that the rs1048990 SNP is a risk factor for MI susceptibility in the Chinese population which is consistent with the finding reported by Ozaki et al. in the Japanese population [9], but somewhat different from the results of studies in another Japanese population [11] and two European populations [12,13]. To provide an estimate of the pooled OR, a meta-analysis of the results for the rs1048990 SNP in the Chinese population and the five other populations were performed. The result shows that the polymorphism is associated with the risk of MI in the allele frequency, recessive and additive models (Table 3). There is no evidence of statistical heterogeneity between the results of these studies. The MAF (G allele frequency) of rs1048990 in the Chinese is similar to that in the Japanese population, but differs sharply from the European populations, and this finding is in concordance with the HapMap data (www.hapmap.org; 0.38, 0.41 and 0.12, for HCB, JPT, and CEU MAFs respectively). There is also a substantial difference in the frequency of the GG genotype of rs1048990 in different populations (Table 3). Despite having similar MAF and GG frequency for the rs1048990 SNP, in contrast to Ozaki’s and the present study,
1.44 (1.29–1.60) Z = 6.67, p < 0.00001 2 = 5.43 (df = 5), p = 0.37, I2 = 7.9% 1.37 (1.23–1.51) Z = 6.01, p < 0.00001 2 = 4.51 (df = 5), p = 0.48, I2 = 0%
Age* , years Male (%) BMI* Waist circumference* , cm W/H* Current smoker (%) Alcohol intake (%) History of HT (%) History of T2D (%) HDL-C* , mmol/L TC* , mmol/L Triglycerides* , mmol/L LDL-C* , mmol/L ApoA1* ApoB* Apo B/A1*
Heterogeneity between studies:
MI, myocardial infarction; MAF, minor allele frequency; OR, odds ratio.
11745 12983 Overall
p
CC
CG
GG
59.7 (0.33) 67.8 24.3 (0.09) 84.3 (0.26) 0.9 (0.002) 26.5 34.5 22.1 2.9 1.1 (0.01) 4.5 (0.04) 1.7 (0.03) 2.7 (0.03) 1.4 (0.01) 0.8 (0.07) 0.6 (0.01)
59.2 (0.33) 71.3 24.6 (0.08) 84.7 (0.26) 0.9 (0.003) 30.1 39.1 22.6 3.8 1.1 (0.01) 4.6 (0.04) 1.7 (0.03) 2.7 (0.03) 1.4 (0.01) 0.9 (0.07) 0.6 (0.01)
58.8 (0.75) 66.8 24.2 (0.19) 83.7 (0.63) 0.9 (0.006) 32.3 32.3 27.0 1.3 1.1 (0.02) 4.7 (0.08) 1.6 (0.07) 2.8 (0.07) 1.4 (0.02) 0.8 (0.16) 0.6 (0.02)
0.410 0.114 0.573 0.266 0.162 0.065 0.052 0.272 0.119 0.239 0.093 0.393 0.088 0.787 0.063 0.082
MI, myocardial infarction; BMI, body mass index (kg/m2 ); cm, centimeters; W/H, waist/hip ratio; HT, hypertension; T2D, type 2 diabetes; HDL-C, high-density lipoprotein cholesterol; TC, total cholesterol; TG, triglycerides; LDL-C, low-density lipoprotein cholesterol; Apo, apolipoprotein. * Data are means (SE).
1.15 (1.11–1.21) Z = 6.48, p < 0.00001 2 = 7.27 (df = 5), p = 0.20, I2 = 31.3%
1.55 (1.29–1.86) 1.51 (1.14–2.00) 1.13 (0.79–1.61) 1.09 (0.41–2.89) 1.15 (0.84–1.56) 1.55 (1.27–1.89) 1.45 (1.22–1.73) 1.50 (1.15–1.96) 1.09 (0.78–1.53) 1.10 (0.42–2.89) 1.12 (0.83–1.53) 1.42 (1.18–1.71)
Genotype
8.9 10.7 9.8 3.0 2.1 10.9
1.21 (1.11–1.31) 1.16 (1.02–1.33) 1.06 (0.91–1.24) 1.00 (0.73–1.36) 1.08 (0.99–1.17) 1.22 (1.12–1.33)
Table 4 Association between rs1048990 and biochemical markers in controls.
0.30 0.34 0.32 0.17 0.16 0.34 2851 1104 2186 282 2760 2643 Japanese Japanese Japanese Caucasian UK Chinese Ozaki [9] Ozaki-rep [9] Takashima [11] Sjakste [13] Bennett [12] This study
Allele frequency
Additive model
2592 867 433 289 6946 1884
GG (%) MAF Control MI Case Population Study
Table 3 Meta-analysis of odds ratio for MI associated with the rs1048990 polymorphism.
Recessive model
X. Liu et al. / Atherosclerosis 206 (2009) 199–203
OR (95% CI)
202
Takashima et al. reported an absence of association in a Japanese population, perhaps due to a smaller sample size. In a British study, the association of rs1048990 with MI did not reach statistical significance, even though the G allele conferred moderate risk which was consistent with the first Japanese study and our present work. We cannot exclude the possibility that other PSMA6 variants may account for the increased risk of MI that we observed. However, the data generated by the HapMap Project for the Chinese population suggests that this is unlikely. There are four SNPs with MAF > 5% in the PSMA6 gene region, including rs1048990, all in low pair-wise LD based on r2 values. Both rs2277459 and rs17103181 have a MAF of 5.6%, which is too low to determine the association with MI in the present study. SNP rs12878391 has a higher MAF (21%) in the HCB population, which is similar to the frequency in the JPT population. The study conducted by Ozaki et al. did not find an association between rs12878391 and MI in the Japanese population. Because the frequency of PSMA6 gene SNPs between the Chinese and Japanese populations are very similar, we believe that rs12878391 SNP would have not be a suitable candidate for MI in Chinese population. In the present study, the rs1048990 SNP showed no association with hypertension, type 2 diabetes, smoking and alcohol intake, as well as other known risk factors for MI pathogenesis (Table 4). This is in agreement with the results of previous studies [9,11]. Moreover there was also no relationship between this SNP and plasma lipids levels (triglycerides, total cholesterol, HDL-C, LDL-C, ApoA1 and ApoB) (Table 4). Although plasma concentrations of markers of inflammation, such as C-reaction protein (CRP) and fibrinogen, have not been measured in this study, it has been reported that rs1048990 had no association with these inflammation markers. In the study of Bennett et al. [12], CRP level was not associated with G allele frequency or the GG genotype in recessive model. Fibrinogen level also had no relation with G allele frequency. But in a recessive model, carriers of the GG genotype had a slightly higher level of fibrinogen with a p value of 0.03. Considering the low frequency of GG in the European population (2.1%), this association appeared inconclusive. In the Japanese population, Takashima reported that rs1048990 was not associated with CPR concentration [11]. Although Ozaki et al. concluded that rs1048990 was an independent risk factor of MI in the Japanese population, more experiments are required to investigate the association between the SNP and biomarkers of MI, especially inflammatory markers in different populations.
X. Liu et al. / Atherosclerosis 206 (2009) 199–203
The study conducted by Ozaki reported that the G allele of rs1048990 affected PSMA6 gene transcription in vitro and in vivo. The altered expression of PSMA6 impairs physiological ubiquitin-proteasome functions and regulates the expression of genes involved in the NF-B-dependent inflammatory pathway, and thereby influences the initiation and progression of atherosclerosis, the underlying pathogenesis of MI. In the study of Takashima et al. [11], it was shown that the rs1048990 SNP was significantly associated with intima-media thickness of the carotid artery suggesting that it may play a role in the pathogenesis of atherosclerosis. PSMA6 encodes the proteasome subunit ␣ type 6, a component of the 20S proteasome [20]. Proteasomes are the main non-lysosomal multicatalytic protease complexes involving in the degradation of most intracellular proteins [21]. Several findings support the ubiquitin-proteasome system’s involvement in heart disease by regulating expression of many signaling molecules and transcription factors such as atrogin-1 [22] and ␣B-crystallin [23,24]. It can be hypothesized that the ubiquitin-proteasome system may play a role in MI through multi-pathways. But more functional research is needed to investigate the specific pathogenesis of MI influenced by PSMA6. In conclusion, our results indicate that the PSMA6 variant rs1048990 is a risk factor associated with MI in the Chinese population. The precise mechanism of how the variant may accelerate atherosclerosis or MI awaits further investigation. Competing interests statement The authors declare that they have no competing financial interests. Acknowledgements We thank Bo Xi (Department of Epidemiology, Capital Institute of Pediatrics, Beijing) for his help on meta-analysis statistics. This study was supported by the Beijing Hypertension League Institute, in part through China’s Post-doctoral Science Fund (No. 20070410244), an unrestricted educational grant from F. Hoffmann-La Roche, the National Infrastructure Program of Chinese Genetic Resources (2005DKA21300), INTERHEART Funding sources, and the Population Health Research Institute. References [1] Yusuf S, Reddy S, Ôunpuu S, Anand S. Global burden of cardiovascular diseases, part I: general considerations, the epidemiologic transition, risk factors, and impact of urbanization. Circulation 2001;104:2746–53.
203
[2] Yusuf S, Hawken S, Ounpuu S, et al. Effects of potentially modifiable risk factors associated with myocardial infarction in 52 countries (the INTERHEART study): case–control study. Lancet 2004;364:937–52. [3] Helgadottir A, Thorleifsson G, Manolescu A, et al. A common variant on chromosome 9p21 affects the risk of myocardial infarction. Science 2007;316: 1491–3. [4] Kooperberg C, Bis JC, Marciante KD, et al. Logic regression for analysis of the association between genetic variation in the renin-angiotensin system and myocardial infarction or stroke. Am J Epidemiol 2007;165:334–43. [5] Libby P. Atherosclerosis in inflammation. Nature 2002;420:868–74. [6] Ross R. Atherosclerosis—an inflammatory disease. N Engl J Med 1999;340:115–26. [7] Ebana Y, Ozaki K, Inoue K, et al. A functional SNP in ITIH3 is associated with susceptibility to myocardial infarction. J Hum Genet 2007;52(3):220–9. [8] Ozaki K, Inoue K, Sato H, et al. Functional variation in LGALS2 confers risk of myocardial infarction and regulates lymphotoxin-alpha secretion in vitro. Nature 2004;429:72–5. [9] Ozaki K, Sato H, Iida A, et al. A functional SNP in PSMA6 confers risk of myocardial infarction in the Japanese population. Nat Genet 2006;38:921–5. [10] Beinke S, Ley SC. Functions of NF-kappaB1 and NF-kappaB2 in immune cell biology. Biochem J 2004;382:393–409. [11] Takashima N, Shioji K, Kokubo Y, et al. Validation of the association between the gene encoding proteasome subunit alpha type 6 and myocardial infarction in a Japanese population. Circ J 2007;71:495–8. [12] Bennett DA, Xu P, Clarke R, et al. The exon 1-8C/G SNP in the PSMA6 gene contributes only a small amount to the burden of myocardial infarction in 6946 cases and 2720 controls from a United Kingdom population. Eur J Hum Genet 2008;16:480–6. [13] Sjakste T, Poudziunas I, Ninio E, et al. SNPs of PSMA6 gene-investigation of possible association with myocardial infarction and type 2 diabetes mellitus. Genetika 2007;43:553–9. [14] Friedewald WT, Levy RI, Fredrickson DS. Estimation of the concentration of low-density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge. Clin Chem 1972;18:499–502. [15] Germer S, Holland MJ, Higuchi R. High-throughput SNP allele-frequency determination in pooled DNA samples by kinetic PCR. Genome Res 2000;10:258–66. [16] Guo SW, Thompson EA. Performing the exact test of Hardy–Weinberg proportion for multiple alleles. Biometrics 1992;48:361–72. [17] The International HapMap Consortium. The International HapMap Project. Nature 2003;426:789–96. [18] Barrett JC, Fry B, Maller J, Daly MJ. Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics 2005;21:263–5. [19] Higgins JP, Thompson SG, Deeks JJ, Altman DG. Measuring inconsistency in meta-analyses. BMJ 2003;327:557–60. [20] Elenich LA, Nandi D, Kent AE, et al. The complete primary structure of mouse 20S proteasomes. Immunogenetics 1999;49:835–42. [21] Zolk O, Schenke C, Sarikas A. The ubiquitin–proteasome system: focus on the heart. Cardiovasc Res 2006;70:410–21. [22] Li HH, Kedar V, Zhang C, et al. Atrogin-1/muscle atrophy F-box inhibits calcineurin-dependent cardiac hypertrophy by participating in an SCF ubiquitin ligase complex. J Clin Invest 2004;114:1058–71. [23] den Engelsman J, Keijsers V, de Jong WW, Boelens WC. The small heat-shock protein alpha B-crystallin promotes FBX4-dependent ubiquitination. J Biol Chem 2003;278:4699–704. [24] Ray PS, Martin JL, Swanson EA, et al. Transgene overexpression of alphaB crystallin confers simultaneous protection against cardiomyocyte apoptosis and necrosis during myocardial ischemia and reperfusion. FASEB J 2001;15:393–402.
Contents lists available at ScienceDirect
Atherosclerosis journal homepage: www.elsevier.com/locate/atherosclerosis
The functional variant rs1048990 in PSMA6 is associated with susceptibility to myocardial infarction in a Chinese population Xin Liu a , Xingyu Wang b , Yue Shen b , Lijun Wu a,b , Xiaoyang Ruan b , Klaus Lindpaintner c , Salim Yusuf d , James C. Engert e , Sonia Anand d , Xuerui Tan a,∗ , Lisheng Liu b,∗ a
The First Affiliated Hospital, Medical College of Shantou University, Shantou, China Laboratory of Human Genetics, Beijing Hypertension League Institute, Beijing, China Roche Center for Medical Genomics, F. Hoffmann-La Roche, Ltd., Basel, Switzerland d Population Health Research Institute, Department of Medicine, McMaster University, Canada e Departments of Medicine and Human Genetics, McGill University, Canada b c
a r t i c l e
i n f o
Article history: Received 1 October 2008 Received in revised form 22 January 2009 Accepted 2 February 2009 Available online 12 February 2009 Keywords: PSMA6 Genetics Myocardial infarction Single nucleotide polymorphism Chinese population
a b s t r a c t A recent case–control study reported that a functional single nucleotide polymorphism (SNP) in the proteasome subunit ␣ type 6 gene (PSMA6) (rs1048990, C/G) was associated with susceptibility to myocardial infarction (MI) in the Japanese population. Replication studies have been performed in European and other Japanese study samples, but the results were not conclusive. The purpose of the present study was to determine whether this locus confers significant susceptibility to MI in a Chinese population. We conducted a case–control association study on a cohort of 1884 MI patients and 2643 unrelated controls from the Chinese population. Genotyping of the rs1048990 SNP was performed by the Allele-specific Real Time PCR method. We found that rs1048990 was significantly associated with MI (adjusted for age and sex, odds ratio 1.22, p = 0.000005, allele frequency model; odds ratio 1.44, p = 0.0000025; recessive model; odds ratio 1.56, p = 0.00000048, additive model). A meta-analysis yielded a combined OR for MI of 1.15 (95% CI: 1.11–1.21) with an allele frequency model, 1.37 (95% CI: 1.23–1.51) with a recessive model and 1.44 (95% CI: 1.29–1.60) with an additive model. There was no relationship between rs1048990 and age, sex or other conventional cardiovascular risk factors. Our results indicate that the PSMA6 variant rs1048990 is a risk factor of myocardial infarction in the Chinese population. © 2009 Elsevier Ireland Ltd. All rights reserved.
1. Introduction Coronary artery disease (CAD) is one of the leading causes of death and loss of disability-adjusted life years in both developed and developing countries [1]. Myocardial infarction (MI), the most serious clinical manifestation of CAD, is the condition of irreversible necrosis of the heart muscle that results from prolonged ischemia. Approximately 90% of MI results from formation of an acute thrombus that obstructs an atherosclerotic coronary artery. MI is a complex disease caused by both environmental and genetic factors. The INTERHEART study, a global case–control study of first acute MI carried out in 52 countries, has reported that nine potentially modifiable risk factors (smoking, diabetes, abdominal obesity, etc) contribute to MI in both sexes and in all regions of the world [2]. A large number of association studies have been carried out
∗ Corresponding authors. Tel.: +86 754 88611690; fax: +86 754 88259850. E-mail addresses: [email protected] (X. Tan), [email protected] (L. Liu). 0021-9150/$ – see front matter © 2009 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.atherosclerosis.2009.02.004
and variants in many genes have been implicated in modifying susceptibility to MI [3,4]. Inflammation is thought to play a key role in the development of coronary atherosclerosis and increases the risk of MI [5,6]. It is a consequence of complex interactions among modified lipoproteins, monocyte-derived macrophages, T lymphocytes, and vascular smooth muscle cells from the vessel wall. Recent studies indicated that genetic variations of inflammatory genes, such as inter-alpha (globulin) inhibitor 3 (ITIH3) genes [7] and the galectin-2 (LGALS2) gene [8], are significantly associated with susceptibility to MI. Recently, a large case–control study (2592 cases and 2851 controls) showed that a functional single nucleotide polymorphism (SNP) in the proteasome subunit ␣ type 6 gene (PSMA6) confers a risk of MI in a Japanese population [9]. The rs1048990 SNP is located in the 5 untranslated region of exon 1, and the risk-conferring G allele appears to enhance the transcription of PSMA6. The altered expression of PSMA6 could impair ubiquitin-proteasome functions and increase inflammation through activation of nuclear factor (NF-B) protein [10]. Replication studies have been performed in another Japanese population [11] and in European populations
200
X. Liu et al. / Atherosclerosis 206 (2009) 199–203
[12,13], but the results were not conclusive. Additional studies in different populations, especially in other ethnic groups, are necessary and important. Therefore, we examined the association of the PSMA6 rs1048990 SNP with risk of MI in the INTERHEART China study cohort (1884 MI cases and 2643 controls). 2. Methods 2.1. Subjects To assess the importance of risk factors of first acute MI and to clarify whether the effects of risk factors vary in different countries or ethnic groups, a large scale case–control study, the INTERHEART study, was carried out in China and 51 other countries. The present cohort is part of the global INTERHEART study. The criteria for recruitment of MI cases and controls have been previously described in detail [2]. Briefly, cases for this study were screened to identify first incident MI, recruited from 24 participating hospitals in 15 cities of China. We included cases without cardiogenic shock or history of major chronic diseases. Acute MI was defined as follows: clinical symptoms and electrocardiogram showing substantial changes such as new pathological Q waves or 1 mm ST elevation in any two or more contiguous limb leads, or a new left bundle branch block or new persistent ST-T wave changes diagnostic of a non-Q wave MI, or raised concentration of troponin. Control subjects were recruited from healthy adult visitors to the hospitals without a history of cardiovascular disease, matched for age (up to 5 years older or younger) and sex with the cases. The Ethics Committee of Beijing Hypertension League Institute approved the study and all participants provided informed consent before taking part in the study. The investigation conforms with the principles outlined in the Declaration of Helsinki. Participants who consented to the study completed a structured questionnaire, attended a health examination, and had a venous blood sample taken. Information about demographic factors, socioeconomic status, lifestyle (smoking, leisure time, physical activity, and dietary patterns), personal and family history of cardiovascular disease, hypertension, diabetes mellitus was obtained. Hypertension and diabetes were defined by self-report of being previously diagnosed or treated with medication for these diseases. Height, weight, waist and hip circumferences, and heart rate were determined by a standard protocol. Body mass index (BMI) was calculated as [weight (kg)/height2 (m)2 ]. Blood samples were drawn Table 1 Characteristics of the study cohorts. Characteristic *
Age , years Male (%) BMI* Waist circumference* , cm W/H* Current smoking (%) Alcohol intake (%) History of HT (%) History of T2D (%) HDL-C* , mmol/L TC* , mmol/L TG* mmol/L LDL-C* , mmol/L ApoA1* , g/L ApoB* , g/L ApoB/A1*
MI case (n = 1884)
Control (n = 2643)
p value
60.7 (11.7) 70.2 24.8 (3.1) 86.8 (9.6) 0.9 (0.1) 44.0 40.5 42.9 13.3 1.0 (0.3) 4.7 (1.2) 1.6 (1.1) 2.9 (1.0) 1.3 (0.3) 0.9 (0.3) 0.7 (0.2)
59.4 (11.4) 69.3 24.4 (2.9) 84.4 (9.0) 0.9 (0.1) 28.7 36.5 22.8 3.2 1.1 (0.4) 4.6 (1.1) 1.7 (1.1) 2.7 (1.0) 1.4 (0.3) 0.8 (0.2) 0.6 (0.2)
0.026 0.094 <0.0001 0.007 0.007 <0.0001 0.007 <0.0001 <0.0001 <0.0001 0.010 0.059 <0.0001 <0.0001 <0.0001 0.023
MI, myocardial infarction; BMI, body mass index (kg/m2 ); cm, centimeters; W/H, waist/hip ratio; HT, hypertension; T2D, type 2 diabetes; HDL-C, high-density lipoprotein cholesterol; TC, total cholesterol; TG, triglycerides; LDL-C, low-density lipoprotein cholesterol; Apo, apolipoprotein. * Data are means (SD).
from every individual, and shipped to a central blood storage site at the Beijing Hypertension League Institute where samples were stored at −160 ◦ C in liquid nitrogen. Plasma concentrations of triglyceride, total cholesterol, highdensity lipoprotein cholesterol (HDL-C), apolipoproteins B (ApoB) and A1 (ApoA1) were analyzed by Roche/Hitachi 911 analyser (Roche Diagnostics, Mannheim, Germany). Analytic techniques have been described in detail previously [2]. Total cholesterol, HDL-C and triglycerides were quantified by standard enzymatic procedure (Roche Diagnostics, Mannheim, Germany), and the Assayed Human multi-sera (Randox Laboratories Ltd., UK) was used as quantity control. Immunoturbidimetric assays were used to measure apolipoprotein concentrations (Tina-quant ApoB version 2 and ApoA1 version 2 kits; Roche Diagnostics, Mannheim, Germany). Precinorm and Precipath controls (Roche Diagnostics, Mannheim, Germany) were used in ApoA1 and ApoB analysis in every run. Interassay coefficient variation was less than 5% for all laboratory tests. Low-density lipoprotein cholesterol (LDL-C) concentrations were calculated according to Friedewald’s formula [14]. 2.2. Genotyping A total of 5850 participants (2932 MI cases and 2918 controls) were recruited for the INTERHEART study in China, and of these, 4598 participants (1901 MI cases and 2697 controls) had DNA samples available. Genomic DNAs were extracted from leukocytes using QIAamp® DNA Blood Midi Kit (QIAGEN, Germany) according to the manufacture’s protocol. Genotyping for rs1048990 in PSMA6 was carried out by Allele-specific Real Time PCR assay [15]. Primers were designed using Oligo Version 6.54 and are as follows: common primer: 5 aacttccgggaggtgcttgtg3 ; allele-specific primer 1: 5 aaccacgggacatgttggtag3 ; allele-specific primer 2: 5 aaccacgggacatgttggtac3 . The Real Time PCR amplifications were performed in a 25 L mixture consisting of 4 L DNA template (2.5 ng/L), 1× PCR buffer, 50 M dNTP, 0.2 × SYBR Green I (Invitrogen, USA) and 2.4 U of DeltaZ05 DNA polymerase (Roche), 0.2 M of common primer and 0.2 M of an allele-specific primer (the amplifications of the same DNA sample with different allelespecific primers were performed in different wells but on the same plate). The PCR was performed by GeneAmp® 5700 Real Time PCR System (Applied Biosystems, USA) under the following conditions: denaturation at 95 ◦ C for 12 min, followed by 45 cycles of 95 ◦ C for 30 s and 60 ◦ C for 30 s, and finished by a 20 min dissociation step at 60 ◦ C. Fluorescence data files from each plate were analyzed by GeneAmp® 5700 software Version 1.3 and reviewed by an operator. The genotype was assigned by Ct, the difference in Ct’s between the two reactions on the same sample with different allele-specific primers. As a quality control measure, direct sequencing of 94 randomly selected genotyped samples was conducted to assess the accuracy of genotyping. 2.3. Statistical analysis Univariate associations were explored with frequency tables and Pearson’s 2 tests for independent proportions. Continuous variables were compared with t tests or appropriate non-parametric tests, depending on their distribution. Fisher’s exact test was used to assess differences in allele or genotype distribution between cases and controls. A weighted kappa statistic was computed to assess reproducibility of genotyping. Logistic regression was used to estimate odds ratio (OR) and OR adjusted for age and sex of allele frequency and genotype for MI. Standard one-way ANOVA were used to assess the associations of SNP with biochemical markers in the control group. Analyses were performed using SAS Version 9.1 software. The genotype distribution for the SNP was assessed for departure from Hardy–Weinberg equilibrium in
X. Liu et al. / Atherosclerosis 206 (2009) 199–203
201
Table 2 Association between MI and rs1048990 SNP. Genotype (%) CC MI case Control Model
CG
753(40.0) 1203(45.5)
GG 888 (47.1) 1190 (45.0)
Total 243 (12.9) 250 (9.5)
1884 (100) 2643 (100)
0.37 0.32
Adjusted*
Unadjusted
OR (95% CI)
p
2
OR (95% CI)
p
19.8 20.3 23.9
1.22 (1.12–1.33) 1.42 (1.18–1.71) 1.55 (1.27–1.89)
0.0000084 0.00025 0.000013
20.8 22.1 25.3
1.22 (1.13–1.35) 1.44 (1.19–1.80) 1.56 (1.24–1.90)
0.000005 0.0000025 0.00000048
2
Allele frequency Recessive Additive
MAF (G allele)
MI, myocardial infarction; MAF, minor allele frequency; OR, odds ratio. * Odds ratio adjusted for age and sex.
cases, controls and total samples, using an exact 2 goodness-offit test [16]. Linkage disequilibrium (LD) analysis was conducted using genotypes of the HCB population from the HapMap Project (www.hapmap.org) (Rel#21a/PhaseII, Jan07) and Haploview Version 4.0 software [17,18]. Meta-analysis statistics were performed using Review Manager Version 4.2 software. The OR and 95% confidence interval (CI) were calculated for each study, and the results were compared through the use of a fixed effects model. Statistical heterogeneity was evaluated with the 2 and the I2 statistics, which assess the appropriateness of pooling the individual study results [19]. 3. Results We successfully obtained the genotype information from 4527 samples (1884 cases and 2643 controls) with a call rate of 98.5%. The characteristics of the participants genotyped in the study are shown in Table 1. The reproducibility of the genotyping was high, with a weighted kappa score of 1.00. The minor allele frequency (MAF) and genotype distribution in MI cases and controls for the PSMA6 rs1048990 polymorphism is shown in Table 2. The G allele was a risk allele for MI (adjusted for age and sex, OR 1.22, 95% CI: 1.13–1.35,
p = 0.000005). Significant association was also observed between the genotype and susceptibility to MI under both a recessive model (GG to CG + CC, adjusted for age and sex, OR 1.44, 95% CI: 1.19–1.80, p = 0.0000025) and an additive model (GG to CC, adjusted for age and sex, OR 1.56, 95% CI: 1.24–1.90, p = 0.00000048). The polymorphism was in Hardy–Weinberg equilibrium in cases, controls and the combined sample (p > 0.05). We carried out LD analysis using the data from the HapMap Project (www.hapmap.org) (Rel#21a/PhaseII, Jan07). A map of SNPs in a 25 kb region of the PSMA6 gene in the HapMap HCB population is shown (Fig. 1). Four SNPs with MAF ≥ 5% were in low pair-wise LD measured by r2 values (rs1048990 and rs12878391 had the highest r2 = 0.162), although most had D values. The results of a meta-analysis of our study and five other studies are displayed in Table 3. The combined OR for MI was 1.15 (95% CI: 1.11–1.21, Z = 6.48, p < 0.00001) with the allele frequency model, 1.37 (95% CI: 1.23–1.51, Z = 6.01, p < 0.00001) with a recessive model and 1.44 (95% CI: 1.29–1.60, Z = 6.67, p < 0.00001) with an additive model. There was no evidence of statistical heterogeneity between the results of different studies (p = 0.20, p = 0.48 and p = 0.37, for allele frequency, recessive and additive models respectively). We found no relationship between rs1048990 genotypes and age, sex and other conventional phenotypic risk factors. Table 4 shows the age, sex, and other risk factors for the genotypes in the controls. 4. Discussion
Fig. 1. LD map of the human PSMA6 gene. Physical organization of the 14q13 locus containing PSMA6 and LD analysis based on the HapMap database (Rel#21a/PhaseII, Jan07) in the HCB population, SNPs with an MAF ≥ 5%. Values represent D .
The present study involving 1884 MI cases and 2643 unrelated controls is the first genetic association study in a Chinese population to investigate MI risk in relation to the functional variant rs1048990 in the PSMA6 gene. The results indicated that the rs1048990 SNP is a risk factor for MI susceptibility in the Chinese population which is consistent with the finding reported by Ozaki et al. in the Japanese population [9], but somewhat different from the results of studies in another Japanese population [11] and two European populations [12,13]. To provide an estimate of the pooled OR, a meta-analysis of the results for the rs1048990 SNP in the Chinese population and the five other populations were performed. The result shows that the polymorphism is associated with the risk of MI in the allele frequency, recessive and additive models (Table 3). There is no evidence of statistical heterogeneity between the results of these studies. The MAF (G allele frequency) of rs1048990 in the Chinese is similar to that in the Japanese population, but differs sharply from the European populations, and this finding is in concordance with the HapMap data (www.hapmap.org; 0.38, 0.41 and 0.12, for HCB, JPT, and CEU MAFs respectively). There is also a substantial difference in the frequency of the GG genotype of rs1048990 in different populations (Table 3). Despite having similar MAF and GG frequency for the rs1048990 SNP, in contrast to Ozaki’s and the present study,
1.44 (1.29–1.60) Z = 6.67, p < 0.00001 2 = 5.43 (df = 5), p = 0.37, I2 = 7.9% 1.37 (1.23–1.51) Z = 6.01, p < 0.00001 2 = 4.51 (df = 5), p = 0.48, I2 = 0%
Age* , years Male (%) BMI* Waist circumference* , cm W/H* Current smoker (%) Alcohol intake (%) History of HT (%) History of T2D (%) HDL-C* , mmol/L TC* , mmol/L Triglycerides* , mmol/L LDL-C* , mmol/L ApoA1* ApoB* Apo B/A1*
Heterogeneity between studies:
MI, myocardial infarction; MAF, minor allele frequency; OR, odds ratio.
11745 12983 Overall
p
CC
CG
GG
59.7 (0.33) 67.8 24.3 (0.09) 84.3 (0.26) 0.9 (0.002) 26.5 34.5 22.1 2.9 1.1 (0.01) 4.5 (0.04) 1.7 (0.03) 2.7 (0.03) 1.4 (0.01) 0.8 (0.07) 0.6 (0.01)
59.2 (0.33) 71.3 24.6 (0.08) 84.7 (0.26) 0.9 (0.003) 30.1 39.1 22.6 3.8 1.1 (0.01) 4.6 (0.04) 1.7 (0.03) 2.7 (0.03) 1.4 (0.01) 0.9 (0.07) 0.6 (0.01)
58.8 (0.75) 66.8 24.2 (0.19) 83.7 (0.63) 0.9 (0.006) 32.3 32.3 27.0 1.3 1.1 (0.02) 4.7 (0.08) 1.6 (0.07) 2.8 (0.07) 1.4 (0.02) 0.8 (0.16) 0.6 (0.02)
0.410 0.114 0.573 0.266 0.162 0.065 0.052 0.272 0.119 0.239 0.093 0.393 0.088 0.787 0.063 0.082
MI, myocardial infarction; BMI, body mass index (kg/m2 ); cm, centimeters; W/H, waist/hip ratio; HT, hypertension; T2D, type 2 diabetes; HDL-C, high-density lipoprotein cholesterol; TC, total cholesterol; TG, triglycerides; LDL-C, low-density lipoprotein cholesterol; Apo, apolipoprotein. * Data are means (SE).
1.15 (1.11–1.21) Z = 6.48, p < 0.00001 2 = 7.27 (df = 5), p = 0.20, I2 = 31.3%
1.55 (1.29–1.86) 1.51 (1.14–2.00) 1.13 (0.79–1.61) 1.09 (0.41–2.89) 1.15 (0.84–1.56) 1.55 (1.27–1.89) 1.45 (1.22–1.73) 1.50 (1.15–1.96) 1.09 (0.78–1.53) 1.10 (0.42–2.89) 1.12 (0.83–1.53) 1.42 (1.18–1.71)
Genotype
8.9 10.7 9.8 3.0 2.1 10.9
1.21 (1.11–1.31) 1.16 (1.02–1.33) 1.06 (0.91–1.24) 1.00 (0.73–1.36) 1.08 (0.99–1.17) 1.22 (1.12–1.33)
Table 4 Association between rs1048990 and biochemical markers in controls.
0.30 0.34 0.32 0.17 0.16 0.34 2851 1104 2186 282 2760 2643 Japanese Japanese Japanese Caucasian UK Chinese Ozaki [9] Ozaki-rep [9] Takashima [11] Sjakste [13] Bennett [12] This study
Allele frequency
Additive model
2592 867 433 289 6946 1884
GG (%) MAF Control MI Case Population Study
Table 3 Meta-analysis of odds ratio for MI associated with the rs1048990 polymorphism.
Recessive model
X. Liu et al. / Atherosclerosis 206 (2009) 199–203
OR (95% CI)
202
Takashima et al. reported an absence of association in a Japanese population, perhaps due to a smaller sample size. In a British study, the association of rs1048990 with MI did not reach statistical significance, even though the G allele conferred moderate risk which was consistent with the first Japanese study and our present work. We cannot exclude the possibility that other PSMA6 variants may account for the increased risk of MI that we observed. However, the data generated by the HapMap Project for the Chinese population suggests that this is unlikely. There are four SNPs with MAF > 5% in the PSMA6 gene region, including rs1048990, all in low pair-wise LD based on r2 values. Both rs2277459 and rs17103181 have a MAF of 5.6%, which is too low to determine the association with MI in the present study. SNP rs12878391 has a higher MAF (21%) in the HCB population, which is similar to the frequency in the JPT population. The study conducted by Ozaki et al. did not find an association between rs12878391 and MI in the Japanese population. Because the frequency of PSMA6 gene SNPs between the Chinese and Japanese populations are very similar, we believe that rs12878391 SNP would have not be a suitable candidate for MI in Chinese population. In the present study, the rs1048990 SNP showed no association with hypertension, type 2 diabetes, smoking and alcohol intake, as well as other known risk factors for MI pathogenesis (Table 4). This is in agreement with the results of previous studies [9,11]. Moreover there was also no relationship between this SNP and plasma lipids levels (triglycerides, total cholesterol, HDL-C, LDL-C, ApoA1 and ApoB) (Table 4). Although plasma concentrations of markers of inflammation, such as C-reaction protein (CRP) and fibrinogen, have not been measured in this study, it has been reported that rs1048990 had no association with these inflammation markers. In the study of Bennett et al. [12], CRP level was not associated with G allele frequency or the GG genotype in recessive model. Fibrinogen level also had no relation with G allele frequency. But in a recessive model, carriers of the GG genotype had a slightly higher level of fibrinogen with a p value of 0.03. Considering the low frequency of GG in the European population (2.1%), this association appeared inconclusive. In the Japanese population, Takashima reported that rs1048990 was not associated with CPR concentration [11]. Although Ozaki et al. concluded that rs1048990 was an independent risk factor of MI in the Japanese population, more experiments are required to investigate the association between the SNP and biomarkers of MI, especially inflammatory markers in different populations.
X. Liu et al. / Atherosclerosis 206 (2009) 199–203
The study conducted by Ozaki reported that the G allele of rs1048990 affected PSMA6 gene transcription in vitro and in vivo. The altered expression of PSMA6 impairs physiological ubiquitin-proteasome functions and regulates the expression of genes involved in the NF-B-dependent inflammatory pathway, and thereby influences the initiation and progression of atherosclerosis, the underlying pathogenesis of MI. In the study of Takashima et al. [11], it was shown that the rs1048990 SNP was significantly associated with intima-media thickness of the carotid artery suggesting that it may play a role in the pathogenesis of atherosclerosis. PSMA6 encodes the proteasome subunit ␣ type 6, a component of the 20S proteasome [20]. Proteasomes are the main non-lysosomal multicatalytic protease complexes involving in the degradation of most intracellular proteins [21]. Several findings support the ubiquitin-proteasome system’s involvement in heart disease by regulating expression of many signaling molecules and transcription factors such as atrogin-1 [22] and ␣B-crystallin [23,24]. It can be hypothesized that the ubiquitin-proteasome system may play a role in MI through multi-pathways. But more functional research is needed to investigate the specific pathogenesis of MI influenced by PSMA6. In conclusion, our results indicate that the PSMA6 variant rs1048990 is a risk factor associated with MI in the Chinese population. The precise mechanism of how the variant may accelerate atherosclerosis or MI awaits further investigation. Competing interests statement The authors declare that they have no competing financial interests. Acknowledgements We thank Bo Xi (Department of Epidemiology, Capital Institute of Pediatrics, Beijing) for his help on meta-analysis statistics. This study was supported by the Beijing Hypertension League Institute, in part through China’s Post-doctoral Science Fund (No. 20070410244), an unrestricted educational grant from F. Hoffmann-La Roche, the National Infrastructure Program of Chinese Genetic Resources (2005DKA21300), INTERHEART Funding sources, and the Population Health Research Institute. References [1] Yusuf S, Reddy S, Ôunpuu S, Anand S. Global burden of cardiovascular diseases, part I: general considerations, the epidemiologic transition, risk factors, and impact of urbanization. Circulation 2001;104:2746–53.
203
[2] Yusuf S, Hawken S, Ounpuu S, et al. Effects of potentially modifiable risk factors associated with myocardial infarction in 52 countries (the INTERHEART study): case–control study. Lancet 2004;364:937–52. [3] Helgadottir A, Thorleifsson G, Manolescu A, et al. A common variant on chromosome 9p21 affects the risk of myocardial infarction. Science 2007;316: 1491–3. [4] Kooperberg C, Bis JC, Marciante KD, et al. Logic regression for analysis of the association between genetic variation in the renin-angiotensin system and myocardial infarction or stroke. Am J Epidemiol 2007;165:334–43. [5] Libby P. Atherosclerosis in inflammation. Nature 2002;420:868–74. [6] Ross R. Atherosclerosis—an inflammatory disease. N Engl J Med 1999;340:115–26. [7] Ebana Y, Ozaki K, Inoue K, et al. A functional SNP in ITIH3 is associated with susceptibility to myocardial infarction. J Hum Genet 2007;52(3):220–9. [8] Ozaki K, Inoue K, Sato H, et al. Functional variation in LGALS2 confers risk of myocardial infarction and regulates lymphotoxin-alpha secretion in vitro. Nature 2004;429:72–5. [9] Ozaki K, Sato H, Iida A, et al. A functional SNP in PSMA6 confers risk of myocardial infarction in the Japanese population. Nat Genet 2006;38:921–5. [10] Beinke S, Ley SC. Functions of NF-kappaB1 and NF-kappaB2 in immune cell biology. Biochem J 2004;382:393–409. [11] Takashima N, Shioji K, Kokubo Y, et al. Validation of the association between the gene encoding proteasome subunit alpha type 6 and myocardial infarction in a Japanese population. Circ J 2007;71:495–8. [12] Bennett DA, Xu P, Clarke R, et al. The exon 1-8C/G SNP in the PSMA6 gene contributes only a small amount to the burden of myocardial infarction in 6946 cases and 2720 controls from a United Kingdom population. Eur J Hum Genet 2008;16:480–6. [13] Sjakste T, Poudziunas I, Ninio E, et al. SNPs of PSMA6 gene-investigation of possible association with myocardial infarction and type 2 diabetes mellitus. Genetika 2007;43:553–9. [14] Friedewald WT, Levy RI, Fredrickson DS. Estimation of the concentration of low-density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge. Clin Chem 1972;18:499–502. [15] Germer S, Holland MJ, Higuchi R. High-throughput SNP allele-frequency determination in pooled DNA samples by kinetic PCR. Genome Res 2000;10:258–66. [16] Guo SW, Thompson EA. Performing the exact test of Hardy–Weinberg proportion for multiple alleles. Biometrics 1992;48:361–72. [17] The International HapMap Consortium. The International HapMap Project. Nature 2003;426:789–96. [18] Barrett JC, Fry B, Maller J, Daly MJ. Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics 2005;21:263–5. [19] Higgins JP, Thompson SG, Deeks JJ, Altman DG. Measuring inconsistency in meta-analyses. BMJ 2003;327:557–60. [20] Elenich LA, Nandi D, Kent AE, et al. The complete primary structure of mouse 20S proteasomes. Immunogenetics 1999;49:835–42. [21] Zolk O, Schenke C, Sarikas A. The ubiquitin–proteasome system: focus on the heart. Cardiovasc Res 2006;70:410–21. [22] Li HH, Kedar V, Zhang C, et al. Atrogin-1/muscle atrophy F-box inhibits calcineurin-dependent cardiac hypertrophy by participating in an SCF ubiquitin ligase complex. J Clin Invest 2004;114:1058–71. [23] den Engelsman J, Keijsers V, de Jong WW, Boelens WC. The small heat-shock protein alpha B-crystallin promotes FBX4-dependent ubiquitination. J Biol Chem 2003;278:4699–704. [24] Ray PS, Martin JL, Swanson EA, et al. Transgene overexpression of alphaB crystallin confers simultaneous protection against cardiomyocyte apoptosis and necrosis during myocardial ischemia and reperfusion. FASEB J 2001;15:393–402.