- Email: [email protected]
The fusions of elastin-like polypeptides and xylanase self-assembled into insoluble active xylanase particles
Journal of Biotechnology 177 (2014) 60–66
Contents lists available at ScienceDirect
Journal of Biotechnology journal homepage: www.elsevier.com/locate/jbiotec
The fusions of elastin-like polypeptides and xylanase self-assembled into insoluble active xylanase particles Cuncun Li, Guangya Zhang ∗ Department of Biotechnology and Bioengineering, Huaqiao University, Xiamen 361021, Fujian, PR China
a r t i c l e
i n f o
Article history: Received 10 December 2013 Received in revised form 21 February 2014 Accepted 22 February 2014 Available online 5 March 2014 Keywords: Elastin-like polypeptide Xylanase Active protein aggregates Stability Immobilization
a b s t r a c t We fused the genes of elastin-like polypeptides (ELPs) and xylanase and then expressed them in Escherichia coli. Unexpectedly, the fusion proteins self-assembled into insoluble active particles as the ELPs underwent a hardly reversible phase transition. The specific activity of the particles was 92% of the native counterparts, which means it can act as a pull-down handler for converting soluble proteins into active aggregates. We evaluated the characterizations of the insoluble active xylanase particles in detail and the results were encouraging. The pH optimum (6.0) of the particles was the same as the free one, but the optimum pH range was 5–7, while the free xylanase was 6–7. The free xylanase had an optimum temperature of 50 ◦ C, whereas the insoluble active xylanase particles shifted to 70 ◦ C. The pH stability, thermostability and storage stability of the xylanase particles increased significantly when compared with the free xylanase. We also observed an increase of the Km values of the free xylanase from 0.374 g L−1 to 0.980 g L−1 at the insoluble state. The considerable higher activity and stability of the xylanase particles were much like immobilized xylanases and could be valuable for its industrial application. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Elastin-like polypeptides (ELPs) are polymers composed of repeats of the pentapeptide (Val-Pro-Gly-Xaa-Gly)n, where Xaa is the amino acid except Pro; n describes the number of repeats (Meyer and Chilkoti, 2004). ELPs have been synthesized and used for applications such as protein purification, tissue engineering and drug delivery (Meyer and Chilkoti, 1999). To be purification tag is one of the most important uses of ELPs. Till now, the green fluorescence protein, blue fluorescence protein, thioredoxin, chloramphenicol acetyl transferase, and calmodulin have been purified successfully (Trabbic-Carlson et al., 2004; Chow et al., 2006; Lim et al., 2007). Similar to other affinity tags, a ELPs tag can be genetically engineered into recombinant proteins. The proteins or peptides fused to ELPs show similar stimulus responsive behavior. The ELPs fusion proteins are soluble at temperatures lower than their transition temperature (Tt ) and become insoluble aggregates above the Tt . Thus, the ELPs fusion proteins can be purified without chromatography using a technique termed inverse thermal cycling (ITC) (Luan et al., 1990; Meyer and Chilkoti, 2002). Usually, the transition is reversible and the aggregates dissolve when the temperature is below Tt . However, in our case, we
∗ Corresponding author. E-mail address: [email protected] (G. Zhang). http://dx.doi.org/10.1016/j.jbiotec.2014.02.020 0168-1656/© 2014 Elsevier B.V. All rights reserved.
found most of the fusions of ELPs and xylanase became insoluble particles at the temperatures below Tt when they experienced an ITC. At the same time, the insoluble particles showed high xylanase activity and stability. They would be potentially useful biocatalysts. In recent years, there was an increasing trend towards using enzymes for biocatalysis (Faber and Kroutil, 2005; Kaur and Sharma, 2006). More and more researchers paid attention to the active insoluble protein aggregates, which is commonly known as active inclusion bodies (IBs). (García-Fruitós et al., 2005; Arié et al., 2006). For example, an ionic self-assembling peptide ELK16 attached to the carboxyl termini of four model proteins could effectively induce to form active IBs in E. coli. The proteins included lipase A, amadoriase II (AMA), -xylosidase (Xyn B), and green fluorescent protein (GFP), and three of the aggregates retained comparable specific activities with the native counterparts (Wu et al., 2011). Other tags could also induce the formation of active IBs under conditions of heterologous expression in E. coli. These tags included the cellulose binding domain from Clostridiu mcellulovorans (Shoseyov and DoI, 1990; Goldstein et al., 1993; Nahalka and Nidetzky, 2007), the human -amyloid peptide Ab42 (F19D) (García-Fruitós et al., 2005) and a modified apolipoprotein A-I mimetic amphipathic peptide 18A (Wu et al., 2011). The peptide-mediated protein aggregations have potential applications in immobilized biocatalysis (Roessl et al., 2010), bioassays (Nahálka et al., 2009), and biomaterials (García-Fruitós et al., 2009).
C. Li, G. Zhang / Journal of Biotechnology 177 (2014) 60–66
In this paper, we will report the stable aggregates of the fused xylanase with ELPs as the tag. To purify the xylanase by the ITC, the fusions self-assembled into aggregates and became insoluble when the temperature was lower than Tt . What’s more, the aggregates retained comparable specific xylanase activities and higher stability. We regarded the insoluble active particles as immobilized xylanase, and compared its catalytic properties with the free one. This is the first report of active xylanase particles on ELPs. 2. Materials and methods 2.1. Materials E. coli strains BL21 (DE3), BLR (DE3), plasmid pUC-19-ELPs, and ELPs [KV8F-20] were preserved in our lab. Restriction endonucleases including PflM I, Bgl I, Nde I, EcoR I, Sfi I, were purchased from Shanghai Generay. The protein and DNA Marker were obtained from Takara, and the birchwood xylan was from Sigma. The xylanase, namely the Sox-M2, was from Streptomyces, with five mutations N12H, N13D, F15Y, 16 F in the N-terminal sequence (Zhang et al., 2010). The amino acid sequence of the coil S was (AGAGAGPEG)10. The coil S between ELPs and xylanase was designed to decrease the mutual interference of ELPs and xylanase (Wheeldon et al., 2009). For facilitating the subsequent non-chromatographic purification, we modified the PET-22b with the sequence of CATATGAGCAAAGGGCCGGGCTGGCCGTGATAAGAATTC to replace the histidine tag. The gene of Sox-M2 and S were synthesized and sequenced by Shanghai Biological Technology Co. 2.2. Construction and expression of the SoxB-M2-S-ELPs fusion gene The molecular biology techniques, such as preparation, transformation of cells, plasmid extraction and enzyme digestion, are from reference (Sambrook et al., 1989). SoxB-M2-S-ELPs gene was synthesized, prepared by Nde, and HindIII digestion and then connected to pUC19 and got the cloning vector pUC19-SoxB-M2-S-ELPs. Then the cloning vector was digested by Nde I, and HindIII and the obtained SoxB-M2-S-ELPs gene was inserted into the modified pET22b to yield the expressing vector pET-22b-SoxB-M2-S-ELPs. After confirming the sequence, the expression plasmids were introduced into E. coli BL21 and E. coli BLR (DE3). The condition of the strain incubation and recombinant gene inducing were described in detail in an earlier paper (Fu et al., 2012). 2.3. Preparation and quantification of the insoluble active xylanases The fusions were aggregated by increasing the temperature of the cell lysate to 40 ◦ C with 0.8 mol L−1 Na2 CO3 . The aggregates were separated from solution by centrifugation at 35–45 ◦ C at 10,000–15,000 × g for 15 min. The supernatant was decanted and discarded, and the pellet containing the fusion protein was resolubilized in PBS by agitation in cold. The insoluble protein aggregates were separated from the clarified soluble fractions at 4 ◦ C by centrifugation (15,000 × g for 15 min), then the soluble protein was decanted and retained. The insoluble fractions were the active xylanase aggregates, we washed the aggregates once with PBS and resuspended in the same volume of PBS. The amounts of xylanase in both fractions were determined densitometrically by denaturing polyacrylamide gel electrophoresis (SDS-PAGE) using bovine serum albumin (BSA) as standard (Peternel et al., 2008). Protein concentration was determined using BSA as the protein standard.
61
2.4. Dynamic Light Scattering (DLS) measurements The average size and size distribution of the insoluble active xylanase particles was determined by DLS using Zetasizer Nano (Malvern Instruments, Worcestershire, UK), configured with a 173◦ scattering angle and equipped with a HeNe laser (633 nm) with an output power of 10 mW. Solutions were vigorously stirred before analysis and each sample measured in triplicate.
2.5. Xylanase activity assays The activities of the xylanase in both purification and immobilization were measured by the dinitrosalicylic acid (DNS) method (Bailey et al., 1992). Briefly, 200 L of diluted xylanase were mixed with 200 L of a 10 mg/mL suspension of birchwood xylan (Sigma–Aldrich) and incubated for 30 min at the optimum temperature. Then 400 L of DNS reagent were mixed and incubated for 5 min at 100 ◦ C. One international unit (IU) is defined as the amount of xylanase that releases 1 mol of reducing sugar per minute.
2.6. pH and temperature properties of the free and insoluble active xylanases The effects of pH on the free and insoluble active xylanases were studied by assaying both preparations at different pH. The pH values range from 5 to 10 (100 mmol L−1 Na2 HPO4 citric acid buffer for pH 4.0–5.0; 100 mmol L−1 phosphate buffer for pH 6.0–8; 100 mmol L−1 Na2 CO3 –NaHCO3 buffer for pH 9.0–10.0.). To determine the pH stability of them, xylanases were incubated 1 h in buffers of various pHs (as mentioned above) and the residual activity was measured by the standard assay procedure. The optimum temperature for the free and insoluble xylanases was determined by incubating them with substrates at temperature ranging from 40 to 80 ◦ C. To determine the thermal stability of xylanase, the free and insoluble xylanases were incubated at 40, 50, 60 and 70, 80 ◦ C for 60 min (pH 6.0). Aliquots of the free and insoluble xylanase were withdrawn at different time intervals, and the remaining activities were measured under the standard conditions.
2.7. Kinetic parameters of the free and insoluble active xylanase Kinetic parameters for both free and insoluble active xylanase were determined by using a HP8453 UV–vis spectrometer. In brief, Birchwood xylan solutions were prepared at different concentrations (0, 1.1, 1.25, 1.43, 1.67, 2, 2.5, 3.33, 5, 10 g L−1 ) in PBS buffer (0.05 mol L−1 , pH7.0). A fixed volume of the free and insoluble active xylanase was added to each birchwood xylan solution and incubated for 10 min separately. Then each reaction mixture was centrifuged immediately, and the absorbance of the supernatant was monitored at 540 nm. The substrate saturation curves of various xylanase samples with birchwood xylan were fitted into Michaelis–Menten kinetics and the corresponding Km and Vmax were obtained from Lineweaver–Burk plot.
2.8. Storage stability of the free and insoluble active xylanase Storage stability of the free and insoluble active xylanase was investigated by calculating the remaining activity periodically during 44 days of incubation at 4 ◦ C and 30 ◦ C, respectively. The residual activities were calculated as percentage of the initial activity.
62
C. Li, G. Zhang / Journal of Biotechnology 177 (2014) 60–66
Fig. 1. SDS-PAGE of each stage of purificication for the xylanase-ELP20 fusion (45 kDa). The total extracellular proteins fraction (lanes 1 and 2); supernatant containin E. coli protein (lane 3); M (molecular mass markers); resolubilized pellet cotaining purified fusion protein (lane 5); first-round pellet (lane 6); second-round supernatant (lane 7); second-round pellet (lane 8);BSA (lane 9).
3. Results 3.1. Preparation of the insoluble active xylanase and DLS study The ELPs (KV8F-20) was terminally fused to xylanase and overexpressed inducing by isopropyl b-d-1-thiogalactopyranoside (IPTG) as judged from SDS-PAGE (Fig. 1). From it, one can see the soluble fusions was much less than the insoluble ones by the first cycle of ITC (Fig. 1), indicating the xylanase were predominantly accumulated in the insoluble fractions when the phase transition was triggered by 0.8 mol L−1 K2 CO3 . At the same time, most of them could not dissolve when resuspend the pellet in cold PBS. Judging from the xylanase activities in the soluble and insoluble fractions (Table 1), the aggregated insoluble xylanase accounted for 92% of the total xylanase activity. Using the total activities of the native xylanase (without ELPs as the tag) as the respective benchmark, about 81% of the native xylanase activity could be obtained in the form of active insoluble particles. It was similar to a previous study done by Wu et al. (2011) and Zhou et al. (2012). In their study, the aggregated fusion proteins accounted for 87.5% of the total activity for AMA-ELK16 and 94.4% for XynB-ELK16. Besides, the specific activities of the aggregated fusions were closed to the native xylanase, which indicated the addition of ELPs did not influence the folding or catalytic site of the xylanase significantly. Furthermore, we chose three other salts to trigger the phase transition and then resuspend the pellet in PBS. The three salts include 3 mol L−1 NaCl, 0.8 mol L−1 K2 CO3 and Na2 SO4 , respectively. For the K2 CO3 , the percent of activity in insoluble fraction is the lowest, which is about 78.01%, and for Na2 SO4 and NaCl, it was about 91.2% and 94.4%, respectively (Table 2). This means most of the activities of the fusion proteins are also in the insoluble fractions. Then, we chose three other buffers to resuspend the pellet triggered by 0.8 mol L−1 Na2 CO3 . The three buffers include citrate-phosphate, citric acid-sodium citrate and sodium acetate. The concentrations and pHs of the buffers are the same as PBS. The activities of the fusion proteins in the insoluble fractions are in the range of 83–97% (Table 2), which means the activities of the fusion xylanases are predominantly distributed in the insoluble fractions. These results indicate the aggregates are relative stable in different salt and buffer conditions. We also explore the size distribution of the particles after the phase transition and the centrifugation. The average size of the
insoluble active xylanase particles measured by DLS was 174.2 nm after the phase transition (Fig. 2a), and increased to 4206 nm after centrifugation (Fig. 2b). This means these small particles aggregated and formed a 20-fold larger one during the process of centrifugation. Moreover, the peak width value of the bigger ones increased, which means their size distributions are wider and might be polydispersity. It is not uncommon to find active protein aggregates, widely known as inclusion bodies, obtained from over expression in E. coli (Worrall and Goss, 1989; García-Fruitós et al., 2005; Arié et al., 2006). The target protein was fused to various tags, such as the MalE31 (Arié et al., 2006), the cellulose-binding domain (CBD) (Nahalka and Nidetzky, 2007), the ELK16 peptide (Wu et al., 2011) and so on. These active protein aggregations induced by the peptides have great potential in biotechnological applications. However, these aggregations were formed spontaneously when the fusion gene expressed in vivo. Here, we introduce a novel concept of controlled active enzyme particles in vitro. The formation of the micron-sized particles was largely irreversible when the temperature is above the Tt . This is achieved under the conditions that induced selective pull down of the folded chimeric protein via intermolecular self-aggregation of the ELPs. As mentioned in the introduction part, ELPs are attractive for purification tags, as proteins that are fused to an ELPs show similar stimulus responsive behavior like free ELPs (Meyer and Chilkoti, 1999). However, for the first time, we found the fusions undergone a nearly irreversible phase transition below Tt and most of them become insoluble active xylanase particles. These particles exhibited a single peak with a narrow distribution. After purification, they exhibited a single peak and polydispersity which were micron-sized and visible to the naked eye. It is much like immobilized xylanase on the microcarriers, which is formed by the self-assemble of the ELPs. 3.2. Kinetic parameters of the free and insoluble active xylanases To evaluate the change in kinetic parameters upon immobilization, we calculated the Km and Vmax from Linweaver–Burk plot and showed the results in Fig. 3. The Km and Vmax values of the free and insoluble active xylanase are 0.374 mg mL−1 , 0.980 mg mL−1 and 0.84 × 10−4 mol L−1 min−1 , 2.95 × 10−4 mol L−1 min−1 , respectively. As mentioned above, the average xylanase particles size was about 4.6 m, it hinders the diffusion of enzyme and substrate to a
Table 1 Comparison of purification by ITC. ITC Purification
Protein concentration (mg/mL)
Percent of activity found in insoluble fraction
Enzyme activity (U/mL)
Specific activity (U/mL)
Purification fold
Crude xylanase Soluble xylanase Non-soluble xylanase
80.81 ± 0.37 13.75 ± 0.52 20.35 ± 0.68
– 8.0% 92.0%
177.68 ± 3.98 10.22 ± 0.64 117.83 ± 2.55
2.20 0.74 5.79
100 5.75 66.31
C. Li, G. Zhang / Journal of Biotechnology 177 (2014) 60–66
63
Table 2 The activity distribution with different salt and buffer. Buffer (0.1 mol L−1 , pH 6.0)
Salt
0.8 mol L−1 K2 CO3 0.8 mol L−1 Na2 SO4 3 mol L−1 NaCl 0.8 mol L−1 Na2 CO3
PBS PBS PBS PBS Citrate-phosphate Citric acid-sodium citrate Sodium acetate
Activity (U/mL)
Percent of activity in insoluble fraction (%)
Soluble fractions
Insoluble fractions
36.48 ± 3.21 14.70 ± 1.16 9.83 ± 0.59 10.22 ± 1.41 20.63 ± 1.21 10.20 ± 0.43
129.42 ± 2.37 152.28 ± 4.44 183.27 ± 3.15 117.83 ± 1.56 103.98 ± 2.64 119.15 ± 2.11
78.01 91.20 94.91 92.01 83.44 92.11
4.96 ± 0.07
180.31 ± 2.89
97.32
Fig. 2. Size distribution of purified insoluble xylanase-ELP20 in the first round by ITC (a) and insoluble xylanase-ELP20 (b) by DLS.
certain degree. Therefore, the Km value of the immobilized xylanase on ELPs is higher than that free one. Moderate increases in Km value of xylanase after being immobilized is similarly reported (Kapoor and Kuhad, 2007; Yan et al., 2012). The large particle size (4.6 m) will lead to the mass transfer resistance of the substrate, this mass transfer resistance drastically appears with macromolecule substrate like xylan (Allenza et al., 1986; Gouda and Abdel-Naby, 2002). As the DLS measurement showed the particles size was only 174.2 nm before centrifugation. This indicated the particle should be much smaller and might be
Fig. 3. Comparison of kinetic parameters of free () and insoluble xylanase ().
a nanomaterial for xylanase immobilization after centrifugation if proper treatment was applied. As we know, the mass transfer resistance of enzymes with nanoscale supporting materials was much lower, while the enzyme loadings with nanomaterial was much higher than that of macroscale one (Liu et al., 2012). Thus, how to prepare the nano-sized insoluble active xylanase particles is one of the important directions in our future research. 3.3. pH and temperature properties of the free and insoluble active xylanase Fig. 4 shows the activity of the free and insoluble active xylanase at different pH ranging from 5 to 10. They hold similar pH-activity trends and the maximum activity were observed at pH 6.0 for both of them. This indicates the self-assemble of ELPs with xylanase into insoluble particle did not significantly alter the pH nature of the xylanase. The pH stabilities of the free and insoluble xylanase were also compared at the pH ranging from 5 to 9 at 40 ◦ C for 60 min. As shown in Fig. 5, the insoluble active particle exhibits more acidic optimum pH range (pH 4–8) than that of the free one (pH 5.5–6.5). It can retain about 91.8% of the maximum activity at the pH value is 8, while the free one only 45.6%. The increased pH stability would favor the application of the insoluble active xylanase in pulp and paper industry (Subramaniyan and Prema, 2002). To study the temperature dependence activities of the free and insoluble active xylanases, the pHs of assay mixtures were maintained at their optimum level (6.0 for both of them). The free xylanase had an optimum temperature of 50 ◦ C, whereas that of the
64
C. Li, G. Zhang / Journal of Biotechnology 177 (2014) 60–66
Fig. 7. The thermal stability of free () and insoluble xylanase (). Fig. 4. Effect of pH on the activities of free () and insoluble xylanase ().
3.4. Storage stability of the free and insoluble active xylanase
Fig. 5. The pH stability of free () and insoluble xylanase ().
insoluble active xylanase shifted to 70 ◦ C (Fig. 6). The half time and stabilizing factor values of the insoluble active xylanase prolonged remarkably at all temperatures, indicating better thermostability of the “immobilized” xylanase (Fig. 7). This might be due to the fact that the insoluble particle provides extra rigidity to the xylanase support matrix and protects it substantially against the heat inactivation (Sardar et al., 2000; Gouda and Abdel-Naby, 2002).
Fig. 6. Effect of temperature on the activities of free () and insoluble xylanase().
Long-term stability of immobilized enzymes is one of the key factors that determine their practical applications. In this regard, we detected the storage stability of the free and the insoluble active xylanase at the temperatures of 4 ◦ C and 30 ◦ C, respectively. Fig. 8 shows the storage stability at the temperature of 4 ◦ C. From it, one can see that the insoluble active xylanase retained almost 100% of its initial activity after 40-day storage, while the free one only retained less than 20% after 5 days. On the other hand, the insoluble active xylanase retained about 50% of its initial activity after 40-day storage at 30 ◦ C as shown in Fig. 9, while the free one lost all of its activity at the 5th day. These results indicate that the insoluble active xylanase had remarkable stabilizing effect toward storage than the free one at both 30 ◦ C and 4 ◦ C with their pH optima (pH 6.0). Moreover, the slight loss of xylanase activities caused by the immobilization was largely compensated by the higher stability. Besides, lowering the storage temperature to 4 ◦ C significantly improves the insoluble active xylanase stability, nearly no loss of activity was observed up to 40 days. This result was better than previous reports (Shah and Madamwar, 2005; Hasirci et al., 2006). According to their results, at the refrigeration temperature (about 4 ◦ C), no loss of activity was observed up to 2 weeks and after 4 weeks a marginal decrease (5–10%) was found. At room temperature 10% loss in enzyme activity was found at the end of a week.
Fig. 8. The storage stability of free () and insoluble xylanase () at 4 ◦ C.
C. Li, G. Zhang / Journal of Biotechnology 177 (2014) 60–66
65
many factors such as the salt kinds and concentration, the length of the ELPs, the pH of the buffer, can influence the size of the particles, thus, it relatively easy for us to control the size of the active particles. This is the potential advantage of ours compared with the previous in vivo methods (Worrall and Goss, 1989; García-Fruitós et al., 2005; Arié et al., 2006). It is very difficult to control the particle sizes in the host cell. Secondly, to seek the molecular mechanism of the irreversible self-assembling of ELPs, the molecular dynamic simulation should be performed. Some secondary bonds might dominate in the irreversible phase transition between the ELPs and the xylanase and need to be clarified. Besides, more target enzymes should be tested to see if they can also form the insoluble active particles. When we have more different active particles, some general rule might be obtained for the phenomenon we reported here.
Acknowledgements Fig. 9. The storage stability of free () and insoluble xylanase () at 30 ◦ C.
4. Discussion In view of their high costs (as compared to the chemical catalysts), reusable forms of enzymes, called immobilized enzymes, are often used (Saleemuddin, 1999). Conventional immobilization of enzymes is generally recognized as randomly immobilized on the supports though exposed residues such as lysine. Unfortunately, in the case of random immobilization, the possibility of multipoint attachments will result in loss of activity. This could eventually lead to the conformational changes or obstruction of the binding site of the immobilized protein (Butterfield et al., 2001; Wilchek and Miron, 2003; Lin et al., 2010). To circumvent this difficulty, site-specific immobilization of the enzymes with the active sitedirected away from the carrier is essential. This will obtain a higher efficiency and catalytic yield (Hernandez and Fernandez-Lafuente, 2011; Liu et al., 2012). Based on this view, the ELPs self-assembled into an insoluble particle, which can be regarded as the carrier for immobilization. It was covalently attached with the C-terminus residue of the xylanase via a random coil. At the same time, the active sites of the xylanase may direct away from the carrier as it has relative high activity. So, the xylanase “moieties” might be “site-specific immobilized” xylanase. However, there should be some secondary interactions between them, while the covalent attachment of xylanase to ELPs aggregates was beneficial to use in industrial application under some mild conditions. Xylanase has been immobilized on various carriers by different immobilization methods for the xylan hydrolysis. These methods include physical absorption (Sardar et al., 2000), covalent binding (Gouda and Abdel-Naby, 2002; Adriano et al., 2005), ionic binding (Dumitriu and Chornet, 1997), and entrapment (Kapoor et al., 2008). However, all of these immobilizations are random, and the linkage to the support may block the active site. Our study indicates ELPs has great potential to “site-specifically” immobilize the xylanase, as the xylanase particles had considerable higher activity and stability. Additionally, the purification and immobilization of the enzymes were performed separately in most cases. However, in our case, purifying and immobilizing of the xylanase was integrated in one-step with the self-assemble of the smart ELPs at a specific temperature. Obviously, our method is more cost- and time-efficient and easy to scale-up from an economic point of view. This simple method shows great promise for processing of other enzymes and would have a brilliant prospect for their applications in industrial biotechnology. Perhaps, in the future, we should pay more attention on the following points. Firstly, the particles could be uniform and nanosized by regulating the operating conditions to decrease the mass transfer resistance and increase the enzyme loading. As we know,
This work was supported by the National Natural Science Foundation of China (21376103) and the Natural Science Foundation of Fujian Province (2013J01048).
References Adriano, W.S., Edilson Filho, H., Silva, J.A., Gonc¸alves, L.R., 2005. Optimization of penicillin G acylase multipoint immobilization on to glutaraldehyde–chitosan beads. Biotechnol. Appl. Biochem. 41, 201–207. Allenza, P., Scherl, D.S., Detroy, R.W., Leathers, T.D., Scott, C., 1986. Hydrolysis of xylan by an immobilized xylanase from Aureobasidium pullanans. In: Biotechnol. Bioeng. Symp., United States. Allied-Signal Research Center/USDA, NRRL, Des Plaines, IL, USA/Peoria, IL, USA. Arié, J.P., Miot, M., Sassoon, N., Betton, J.M., 2006. Formation of active inclusion bodies in the periplasm of Escherichia coli. Mol. Microbiol. 62, 427–437. Bailey, M.J., Biely, P., Poutanen, K., 1992. Interlaboratory testing of methods for assay of xylanase activity. J. Biotechnol. 23, 257–270. Butterfield, D.A., Bhattacharyya, D., Daunert, S., Bachas, L., 2001. Catalytic biofunctional membranes containing site-specifically immobilized enzyme arrays: a review. J. Membr. Sci. 181, 29–37. Chow, D.C., Dreher, M.R., Trabbic-Carlson, K., Chilkoti, A., 2006. Ultra-high expression of a thermallyresponsive recombinant fusion protein in E coli. Biotechnol. Prog. 22, 638–646. Dumitriu, S., Chornet, E., 1997. Immobilization of xylanase in chitosan-xanthan hydrogels. Biotechnol. Prog. 13, 539–545. Faber, K., Kroutil, W., 2005. New enzymes for biotransformations. Curr. Opin. Chem. Biol. 9, 181–187. Fu, X., Wang, W., Zhang, G., 2012. Purification fusion xylanase with the shortest elastin-like polypeptide tag by non-chromatographic. Acta Microbiol. Sin. 52, 90–95 (in Chinese.). García-Fruitós, E., González-Montalbán, N., Morell, M., Vera, A., Ferraz, R.M., Arís, A., Ventura, S., Villaverde, A., 2005. Aggregation as bacterial inclusion bodies does not imply inactivation of enzymes and fluorescent proteins. Microb. Cell Fact. 4, 27. García-Fruitós, E., Rodríguez-Carmona, E., Díez-Gil, C., Ferraz, R.M., Vázquez, E., Corchero, J.L., Cano-Sarabia, M., Ratera, I., Ventosa, N., Veciana, J., 2009. Surface cell growth engineering assisted by a novel bacterial nanomaterial. Adv. Mater. 21, 4249–4253. Goldstein, M.A., Takagi, M., Hashida, S., Shoseyov, O., Segel, I., 1993. Characterization of the cellulose-binding domain of the Clostridium cellulovorans cellulosebinding protein A. J. Bacteriol. 175, 5762–5768. Gouda, M.K., Abdel-Naby, M.A., 2002. Catalytic properties of the immobilized Aspergillus tamarii xylanase. Microbiol. Res. 157, 275–281. Hasirci, N., Aksoy, S., Tumturk, H., 2006. Activation of poly(dimer acid-co-alkyl polyamine) particles for covalent immobilization of alpha-amylase. React. Funct. Polym. 66, 1546–1551. Hernandez, K., Fernandez-Lafuente, R., 2011. Control of protein immobilization: coupling immobilization and site-directed mutagenesis to improve biocatalyst or biosensor performance. Enzyme Microb. Technol. 48, 107–122. Kapoor, M., Kuhad, R.C., 2007. Immobilization of xylanase from Bacillus pumilus strain MK001 and its application in production of xylo-oligosaccharides. Appl. Biochem. Biotechnol. 142, 125–138. Kapoor, M., Nair, L.M., Kuhad, R.C., 2008. Cost-effective xylanase production from free and immobilized Bacillus pumilus strain MK001 and its application in saccharification of Prosopis juliflora. Biochem. Eng. J. 38, 88–97. Kaur, J., Sharma, R., 2006. Directed evolution: an approach to engineer enzymes. Crit. Rev. Biotechnol. 26, 165–199. Lim, D.W., Trabbic-Carlson, K., MacKay, J.A., Chilkoti, A., 2007. Improved nonchromatographic purification of a recombinant protein by cationic elastin-like polypeptides. Biomacromolecules 8, 1417–1424.
66
C. Li, G. Zhang / Journal of Biotechnology 177 (2014) 60–66
Lin, P.C., Weinrich, D., Waldmann, H., 2010. Protein biochips: oriented surface immobilization of proteins. Macromol. Chem. Phys. 211, 136–144. Liu, W., Wang, L., Jiang, R., 2012. Specific enzyme immobilization approaches and their application with nanomaterials. Top. Catal. 55, 1146–1156. Luan, C.H., Harris, R.D., Prasad, K.U., Urry, D.W., 1990. Differential scanning calorimetry studies of the inverse temperature transition of the polypentapeptide of elastin and its analogues. Biopolymers 29, 1699– 1706. Meyer, D.E., Chilkoti, A., 1999. Purification of recombinant proteins by fusion with thermally-responsive polypeptides. Nat. Biotechnol. 17, 1112–1115. Meyer, D.E., Chilkoti, A., 2002. Genetically encoded synthesis of protein-based polymers with precisely specified molecular weight and sequence by recursive directional ligation: examples from the elastin-like polypeptide system. Biomacromolecules 3, 357–367. Meyer, D.E., Chilkoti, A., 2004. Quantification of the effects of chain length and concentration on the thermal behavior of elastin-like polypeptides. Biomacromolecules 5, 846–851. Nahálka, J., Misloviˇcová, D., Kavcová, H., 2009. Targeting lectin activity into inclusion bodies for the characterisation of glycoproteins. Mol. BioSyst. 5, 819–821. Nahalka, J., Nidetzky, B., 2007. Fusion to a pull-down domain: a novel approach of producing trigonopsis variabilis d-amino acid oxidase as insoluble enzyme aggregates. Biotechnol. Bioeng. 97, 454–461. ˇ Grdadolnik, J., Gaberc-Porekar, V., Komel, R., 2008. Engineering inclusion Peternel, S., bodies for non-denaturing extraction of functional proteins. Microb. Cell Fact. 7, 34. Roessl, U., Nahálka, J., Nidetzky, B., 2010. Carrier-free immobilized enzymes for biocatalysis. Biotechnol. Lett. 32, 341–350. Saleemuddin, M., 1999. Bioaffinity based immobilization of enzymes. Thermal Biosensors, Bioactivity, Bioaffinitty. Springer, pp. 203–226. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning. Cold Spring Harbor Laboratory Press, New York.
Sardar, M., Roy, I., Gupta, M.N., 2000. Simultaneous purification and immobilization of Aspergillus niger xylanase on the reversibly soluble polymer EudragitTM L-100. Enzyme Microb. Technol. 27, 672–679. Shah, A.R., Madamwar, D., 2005. Xylanase production by a newly isolated Aspergillus foetidus strain and its characterization. Process Biochem. 40, 1763–1771. Shoseyov, O., DoI, R.H., 1990. Essential 170-kDa subunit for degradation of crystalline cellulose by Clostridium cellulovorans cellulase. Proc. Natl. Acad. Sci. U.S.A. 87, 2192–2195. Subramaniyan, S., Prema, P., 2002. Biotechnology of microbial xylanases: enzymology, molecular biology, and application. Crit. Rev. Biotechnol. 22, 33–64. Trabbic-Carlson, K., Meyer, D., Liu, L., Piervincenzi, R., Nath, N., LaBean, T., Chilkoti, A., 2004. Effect of protein fusion on the transition temperature of an environmentally responsive elastin-like polypeptide: a role for surface hydrophobicity? Protein Eng. Des. Sel. 17, 57–66. Wheeldon, I.R., Campbell, E., Banta, S., 2009. A chimeric fusion protein engineered with disparate functionalities-enzymatic activity and self-assembly. J. Mol. Biol. 392, 129–142. Wilchek, M., Miron, T., 2003. Oriented versus random protein immobilization. J. Biochem. Bioph. Meth. 55, 67–70. Worrall, D., Goss, N., 1989. The formation of biologically active beta-galactosidase inclusion bodies in Escherichia coli. Aust. J. Biotechnol. 3, 28–32. Wu, W., Xing, L., Zhou, B., Lin, Z., 2011. Active protein aggregates induced by terminally attached self-assembling peptide ELK16 in Escherichia coli. Microb. Cell Fact. 10, 9. Yan, X., Wang, X., Zhao, P., Xu, P., Ding, Y., 2012. Xylanase immobilized nanoporous gold as a highly active and stable biocatalyst. Micropor. Mesopor. Mater. 161, 1–6. Zhang, S., Zhang, K., Chen, X., Chu, X., Sun, F., Dong, Z., 2010. Five mutations in Nterminus confer thermostability on mesophilic xylanase. Biochem. Biophys. Res. Commun. 395, 200–206. Zhou, B., Xing, L., Wu, W., Zhang, X.-E., Lin, Z., 2012. Small surfactant-like peptides can drive soluble proteins into active aggregates. Microb. Cell Fact. 11, 10.
Contents lists available at ScienceDirect
Journal of Biotechnology journal homepage: www.elsevier.com/locate/jbiotec
The fusions of elastin-like polypeptides and xylanase self-assembled into insoluble active xylanase particles Cuncun Li, Guangya Zhang ∗ Department of Biotechnology and Bioengineering, Huaqiao University, Xiamen 361021, Fujian, PR China
a r t i c l e
i n f o
Article history: Received 10 December 2013 Received in revised form 21 February 2014 Accepted 22 February 2014 Available online 5 March 2014 Keywords: Elastin-like polypeptide Xylanase Active protein aggregates Stability Immobilization
a b s t r a c t We fused the genes of elastin-like polypeptides (ELPs) and xylanase and then expressed them in Escherichia coli. Unexpectedly, the fusion proteins self-assembled into insoluble active particles as the ELPs underwent a hardly reversible phase transition. The specific activity of the particles was 92% of the native counterparts, which means it can act as a pull-down handler for converting soluble proteins into active aggregates. We evaluated the characterizations of the insoluble active xylanase particles in detail and the results were encouraging. The pH optimum (6.0) of the particles was the same as the free one, but the optimum pH range was 5–7, while the free xylanase was 6–7. The free xylanase had an optimum temperature of 50 ◦ C, whereas the insoluble active xylanase particles shifted to 70 ◦ C. The pH stability, thermostability and storage stability of the xylanase particles increased significantly when compared with the free xylanase. We also observed an increase of the Km values of the free xylanase from 0.374 g L−1 to 0.980 g L−1 at the insoluble state. The considerable higher activity and stability of the xylanase particles were much like immobilized xylanases and could be valuable for its industrial application. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Elastin-like polypeptides (ELPs) are polymers composed of repeats of the pentapeptide (Val-Pro-Gly-Xaa-Gly)n, where Xaa is the amino acid except Pro; n describes the number of repeats (Meyer and Chilkoti, 2004). ELPs have been synthesized and used for applications such as protein purification, tissue engineering and drug delivery (Meyer and Chilkoti, 1999). To be purification tag is one of the most important uses of ELPs. Till now, the green fluorescence protein, blue fluorescence protein, thioredoxin, chloramphenicol acetyl transferase, and calmodulin have been purified successfully (Trabbic-Carlson et al., 2004; Chow et al., 2006; Lim et al., 2007). Similar to other affinity tags, a ELPs tag can be genetically engineered into recombinant proteins. The proteins or peptides fused to ELPs show similar stimulus responsive behavior. The ELPs fusion proteins are soluble at temperatures lower than their transition temperature (Tt ) and become insoluble aggregates above the Tt . Thus, the ELPs fusion proteins can be purified without chromatography using a technique termed inverse thermal cycling (ITC) (Luan et al., 1990; Meyer and Chilkoti, 2002). Usually, the transition is reversible and the aggregates dissolve when the temperature is below Tt . However, in our case, we
∗ Corresponding author. E-mail address: [email protected] (G. Zhang). http://dx.doi.org/10.1016/j.jbiotec.2014.02.020 0168-1656/© 2014 Elsevier B.V. All rights reserved.
found most of the fusions of ELPs and xylanase became insoluble particles at the temperatures below Tt when they experienced an ITC. At the same time, the insoluble particles showed high xylanase activity and stability. They would be potentially useful biocatalysts. In recent years, there was an increasing trend towards using enzymes for biocatalysis (Faber and Kroutil, 2005; Kaur and Sharma, 2006). More and more researchers paid attention to the active insoluble protein aggregates, which is commonly known as active inclusion bodies (IBs). (García-Fruitós et al., 2005; Arié et al., 2006). For example, an ionic self-assembling peptide ELK16 attached to the carboxyl termini of four model proteins could effectively induce to form active IBs in E. coli. The proteins included lipase A, amadoriase II (AMA), -xylosidase (Xyn B), and green fluorescent protein (GFP), and three of the aggregates retained comparable specific activities with the native counterparts (Wu et al., 2011). Other tags could also induce the formation of active IBs under conditions of heterologous expression in E. coli. These tags included the cellulose binding domain from Clostridiu mcellulovorans (Shoseyov and DoI, 1990; Goldstein et al., 1993; Nahalka and Nidetzky, 2007), the human -amyloid peptide Ab42 (F19D) (García-Fruitós et al., 2005) and a modified apolipoprotein A-I mimetic amphipathic peptide 18A (Wu et al., 2011). The peptide-mediated protein aggregations have potential applications in immobilized biocatalysis (Roessl et al., 2010), bioassays (Nahálka et al., 2009), and biomaterials (García-Fruitós et al., 2009).
C. Li, G. Zhang / Journal of Biotechnology 177 (2014) 60–66
In this paper, we will report the stable aggregates of the fused xylanase with ELPs as the tag. To purify the xylanase by the ITC, the fusions self-assembled into aggregates and became insoluble when the temperature was lower than Tt . What’s more, the aggregates retained comparable specific xylanase activities and higher stability. We regarded the insoluble active particles as immobilized xylanase, and compared its catalytic properties with the free one. This is the first report of active xylanase particles on ELPs. 2. Materials and methods 2.1. Materials E. coli strains BL21 (DE3), BLR (DE3), plasmid pUC-19-ELPs, and ELPs [KV8F-20] were preserved in our lab. Restriction endonucleases including PflM I, Bgl I, Nde I, EcoR I, Sfi I, were purchased from Shanghai Generay. The protein and DNA Marker were obtained from Takara, and the birchwood xylan was from Sigma. The xylanase, namely the Sox-M2, was from Streptomyces, with five mutations N12H, N13D, F15Y, 16 F in the N-terminal sequence (Zhang et al., 2010). The amino acid sequence of the coil S was (AGAGAGPEG)10. The coil S between ELPs and xylanase was designed to decrease the mutual interference of ELPs and xylanase (Wheeldon et al., 2009). For facilitating the subsequent non-chromatographic purification, we modified the PET-22b with the sequence of CATATGAGCAAAGGGCCGGGCTGGCCGTGATAAGAATTC to replace the histidine tag. The gene of Sox-M2 and S were synthesized and sequenced by Shanghai Biological Technology Co. 2.2. Construction and expression of the SoxB-M2-S-ELPs fusion gene The molecular biology techniques, such as preparation, transformation of cells, plasmid extraction and enzyme digestion, are from reference (Sambrook et al., 1989). SoxB-M2-S-ELPs gene was synthesized, prepared by Nde, and HindIII digestion and then connected to pUC19 and got the cloning vector pUC19-SoxB-M2-S-ELPs. Then the cloning vector was digested by Nde I, and HindIII and the obtained SoxB-M2-S-ELPs gene was inserted into the modified pET22b to yield the expressing vector pET-22b-SoxB-M2-S-ELPs. After confirming the sequence, the expression plasmids were introduced into E. coli BL21 and E. coli BLR (DE3). The condition of the strain incubation and recombinant gene inducing were described in detail in an earlier paper (Fu et al., 2012). 2.3. Preparation and quantification of the insoluble active xylanases The fusions were aggregated by increasing the temperature of the cell lysate to 40 ◦ C with 0.8 mol L−1 Na2 CO3 . The aggregates were separated from solution by centrifugation at 35–45 ◦ C at 10,000–15,000 × g for 15 min. The supernatant was decanted and discarded, and the pellet containing the fusion protein was resolubilized in PBS by agitation in cold. The insoluble protein aggregates were separated from the clarified soluble fractions at 4 ◦ C by centrifugation (15,000 × g for 15 min), then the soluble protein was decanted and retained. The insoluble fractions were the active xylanase aggregates, we washed the aggregates once with PBS and resuspended in the same volume of PBS. The amounts of xylanase in both fractions were determined densitometrically by denaturing polyacrylamide gel electrophoresis (SDS-PAGE) using bovine serum albumin (BSA) as standard (Peternel et al., 2008). Protein concentration was determined using BSA as the protein standard.
61
2.4. Dynamic Light Scattering (DLS) measurements The average size and size distribution of the insoluble active xylanase particles was determined by DLS using Zetasizer Nano (Malvern Instruments, Worcestershire, UK), configured with a 173◦ scattering angle and equipped with a HeNe laser (633 nm) with an output power of 10 mW. Solutions were vigorously stirred before analysis and each sample measured in triplicate.
2.5. Xylanase activity assays The activities of the xylanase in both purification and immobilization were measured by the dinitrosalicylic acid (DNS) method (Bailey et al., 1992). Briefly, 200 L of diluted xylanase were mixed with 200 L of a 10 mg/mL suspension of birchwood xylan (Sigma–Aldrich) and incubated for 30 min at the optimum temperature. Then 400 L of DNS reagent were mixed and incubated for 5 min at 100 ◦ C. One international unit (IU) is defined as the amount of xylanase that releases 1 mol of reducing sugar per minute.
2.6. pH and temperature properties of the free and insoluble active xylanases The effects of pH on the free and insoluble active xylanases were studied by assaying both preparations at different pH. The pH values range from 5 to 10 (100 mmol L−1 Na2 HPO4 citric acid buffer for pH 4.0–5.0; 100 mmol L−1 phosphate buffer for pH 6.0–8; 100 mmol L−1 Na2 CO3 –NaHCO3 buffer for pH 9.0–10.0.). To determine the pH stability of them, xylanases were incubated 1 h in buffers of various pHs (as mentioned above) and the residual activity was measured by the standard assay procedure. The optimum temperature for the free and insoluble xylanases was determined by incubating them with substrates at temperature ranging from 40 to 80 ◦ C. To determine the thermal stability of xylanase, the free and insoluble xylanases were incubated at 40, 50, 60 and 70, 80 ◦ C for 60 min (pH 6.0). Aliquots of the free and insoluble xylanase were withdrawn at different time intervals, and the remaining activities were measured under the standard conditions.
2.7. Kinetic parameters of the free and insoluble active xylanase Kinetic parameters for both free and insoluble active xylanase were determined by using a HP8453 UV–vis spectrometer. In brief, Birchwood xylan solutions were prepared at different concentrations (0, 1.1, 1.25, 1.43, 1.67, 2, 2.5, 3.33, 5, 10 g L−1 ) in PBS buffer (0.05 mol L−1 , pH7.0). A fixed volume of the free and insoluble active xylanase was added to each birchwood xylan solution and incubated for 10 min separately. Then each reaction mixture was centrifuged immediately, and the absorbance of the supernatant was monitored at 540 nm. The substrate saturation curves of various xylanase samples with birchwood xylan were fitted into Michaelis–Menten kinetics and the corresponding Km and Vmax were obtained from Lineweaver–Burk plot.
2.8. Storage stability of the free and insoluble active xylanase Storage stability of the free and insoluble active xylanase was investigated by calculating the remaining activity periodically during 44 days of incubation at 4 ◦ C and 30 ◦ C, respectively. The residual activities were calculated as percentage of the initial activity.
62
C. Li, G. Zhang / Journal of Biotechnology 177 (2014) 60–66
Fig. 1. SDS-PAGE of each stage of purificication for the xylanase-ELP20 fusion (45 kDa). The total extracellular proteins fraction (lanes 1 and 2); supernatant containin E. coli protein (lane 3); M (molecular mass markers); resolubilized pellet cotaining purified fusion protein (lane 5); first-round pellet (lane 6); second-round supernatant (lane 7); second-round pellet (lane 8);BSA (lane 9).
3. Results 3.1. Preparation of the insoluble active xylanase and DLS study The ELPs (KV8F-20) was terminally fused to xylanase and overexpressed inducing by isopropyl b-d-1-thiogalactopyranoside (IPTG) as judged from SDS-PAGE (Fig. 1). From it, one can see the soluble fusions was much less than the insoluble ones by the first cycle of ITC (Fig. 1), indicating the xylanase were predominantly accumulated in the insoluble fractions when the phase transition was triggered by 0.8 mol L−1 K2 CO3 . At the same time, most of them could not dissolve when resuspend the pellet in cold PBS. Judging from the xylanase activities in the soluble and insoluble fractions (Table 1), the aggregated insoluble xylanase accounted for 92% of the total xylanase activity. Using the total activities of the native xylanase (without ELPs as the tag) as the respective benchmark, about 81% of the native xylanase activity could be obtained in the form of active insoluble particles. It was similar to a previous study done by Wu et al. (2011) and Zhou et al. (2012). In their study, the aggregated fusion proteins accounted for 87.5% of the total activity for AMA-ELK16 and 94.4% for XynB-ELK16. Besides, the specific activities of the aggregated fusions were closed to the native xylanase, which indicated the addition of ELPs did not influence the folding or catalytic site of the xylanase significantly. Furthermore, we chose three other salts to trigger the phase transition and then resuspend the pellet in PBS. The three salts include 3 mol L−1 NaCl, 0.8 mol L−1 K2 CO3 and Na2 SO4 , respectively. For the K2 CO3 , the percent of activity in insoluble fraction is the lowest, which is about 78.01%, and for Na2 SO4 and NaCl, it was about 91.2% and 94.4%, respectively (Table 2). This means most of the activities of the fusion proteins are also in the insoluble fractions. Then, we chose three other buffers to resuspend the pellet triggered by 0.8 mol L−1 Na2 CO3 . The three buffers include citrate-phosphate, citric acid-sodium citrate and sodium acetate. The concentrations and pHs of the buffers are the same as PBS. The activities of the fusion proteins in the insoluble fractions are in the range of 83–97% (Table 2), which means the activities of the fusion xylanases are predominantly distributed in the insoluble fractions. These results indicate the aggregates are relative stable in different salt and buffer conditions. We also explore the size distribution of the particles after the phase transition and the centrifugation. The average size of the
insoluble active xylanase particles measured by DLS was 174.2 nm after the phase transition (Fig. 2a), and increased to 4206 nm after centrifugation (Fig. 2b). This means these small particles aggregated and formed a 20-fold larger one during the process of centrifugation. Moreover, the peak width value of the bigger ones increased, which means their size distributions are wider and might be polydispersity. It is not uncommon to find active protein aggregates, widely known as inclusion bodies, obtained from over expression in E. coli (Worrall and Goss, 1989; García-Fruitós et al., 2005; Arié et al., 2006). The target protein was fused to various tags, such as the MalE31 (Arié et al., 2006), the cellulose-binding domain (CBD) (Nahalka and Nidetzky, 2007), the ELK16 peptide (Wu et al., 2011) and so on. These active protein aggregations induced by the peptides have great potential in biotechnological applications. However, these aggregations were formed spontaneously when the fusion gene expressed in vivo. Here, we introduce a novel concept of controlled active enzyme particles in vitro. The formation of the micron-sized particles was largely irreversible when the temperature is above the Tt . This is achieved under the conditions that induced selective pull down of the folded chimeric protein via intermolecular self-aggregation of the ELPs. As mentioned in the introduction part, ELPs are attractive for purification tags, as proteins that are fused to an ELPs show similar stimulus responsive behavior like free ELPs (Meyer and Chilkoti, 1999). However, for the first time, we found the fusions undergone a nearly irreversible phase transition below Tt and most of them become insoluble active xylanase particles. These particles exhibited a single peak with a narrow distribution. After purification, they exhibited a single peak and polydispersity which were micron-sized and visible to the naked eye. It is much like immobilized xylanase on the microcarriers, which is formed by the self-assemble of the ELPs. 3.2. Kinetic parameters of the free and insoluble active xylanases To evaluate the change in kinetic parameters upon immobilization, we calculated the Km and Vmax from Linweaver–Burk plot and showed the results in Fig. 3. The Km and Vmax values of the free and insoluble active xylanase are 0.374 mg mL−1 , 0.980 mg mL−1 and 0.84 × 10−4 mol L−1 min−1 , 2.95 × 10−4 mol L−1 min−1 , respectively. As mentioned above, the average xylanase particles size was about 4.6 m, it hinders the diffusion of enzyme and substrate to a
Table 1 Comparison of purification by ITC. ITC Purification
Protein concentration (mg/mL)
Percent of activity found in insoluble fraction
Enzyme activity (U/mL)
Specific activity (U/mL)
Purification fold
Crude xylanase Soluble xylanase Non-soluble xylanase
80.81 ± 0.37 13.75 ± 0.52 20.35 ± 0.68
– 8.0% 92.0%
177.68 ± 3.98 10.22 ± 0.64 117.83 ± 2.55
2.20 0.74 5.79
100 5.75 66.31
C. Li, G. Zhang / Journal of Biotechnology 177 (2014) 60–66
63
Table 2 The activity distribution with different salt and buffer. Buffer (0.1 mol L−1 , pH 6.0)
Salt
0.8 mol L−1 K2 CO3 0.8 mol L−1 Na2 SO4 3 mol L−1 NaCl 0.8 mol L−1 Na2 CO3
PBS PBS PBS PBS Citrate-phosphate Citric acid-sodium citrate Sodium acetate
Activity (U/mL)
Percent of activity in insoluble fraction (%)
Soluble fractions
Insoluble fractions
36.48 ± 3.21 14.70 ± 1.16 9.83 ± 0.59 10.22 ± 1.41 20.63 ± 1.21 10.20 ± 0.43
129.42 ± 2.37 152.28 ± 4.44 183.27 ± 3.15 117.83 ± 1.56 103.98 ± 2.64 119.15 ± 2.11
78.01 91.20 94.91 92.01 83.44 92.11
4.96 ± 0.07
180.31 ± 2.89
97.32
Fig. 2. Size distribution of purified insoluble xylanase-ELP20 in the first round by ITC (a) and insoluble xylanase-ELP20 (b) by DLS.
certain degree. Therefore, the Km value of the immobilized xylanase on ELPs is higher than that free one. Moderate increases in Km value of xylanase after being immobilized is similarly reported (Kapoor and Kuhad, 2007; Yan et al., 2012). The large particle size (4.6 m) will lead to the mass transfer resistance of the substrate, this mass transfer resistance drastically appears with macromolecule substrate like xylan (Allenza et al., 1986; Gouda and Abdel-Naby, 2002). As the DLS measurement showed the particles size was only 174.2 nm before centrifugation. This indicated the particle should be much smaller and might be
Fig. 3. Comparison of kinetic parameters of free () and insoluble xylanase ().
a nanomaterial for xylanase immobilization after centrifugation if proper treatment was applied. As we know, the mass transfer resistance of enzymes with nanoscale supporting materials was much lower, while the enzyme loadings with nanomaterial was much higher than that of macroscale one (Liu et al., 2012). Thus, how to prepare the nano-sized insoluble active xylanase particles is one of the important directions in our future research. 3.3. pH and temperature properties of the free and insoluble active xylanase Fig. 4 shows the activity of the free and insoluble active xylanase at different pH ranging from 5 to 10. They hold similar pH-activity trends and the maximum activity were observed at pH 6.0 for both of them. This indicates the self-assemble of ELPs with xylanase into insoluble particle did not significantly alter the pH nature of the xylanase. The pH stabilities of the free and insoluble xylanase were also compared at the pH ranging from 5 to 9 at 40 ◦ C for 60 min. As shown in Fig. 5, the insoluble active particle exhibits more acidic optimum pH range (pH 4–8) than that of the free one (pH 5.5–6.5). It can retain about 91.8% of the maximum activity at the pH value is 8, while the free one only 45.6%. The increased pH stability would favor the application of the insoluble active xylanase in pulp and paper industry (Subramaniyan and Prema, 2002). To study the temperature dependence activities of the free and insoluble active xylanases, the pHs of assay mixtures were maintained at their optimum level (6.0 for both of them). The free xylanase had an optimum temperature of 50 ◦ C, whereas that of the
64
C. Li, G. Zhang / Journal of Biotechnology 177 (2014) 60–66
Fig. 7. The thermal stability of free () and insoluble xylanase (). Fig. 4. Effect of pH on the activities of free () and insoluble xylanase ().
3.4. Storage stability of the free and insoluble active xylanase
Fig. 5. The pH stability of free () and insoluble xylanase ().
insoluble active xylanase shifted to 70 ◦ C (Fig. 6). The half time and stabilizing factor values of the insoluble active xylanase prolonged remarkably at all temperatures, indicating better thermostability of the “immobilized” xylanase (Fig. 7). This might be due to the fact that the insoluble particle provides extra rigidity to the xylanase support matrix and protects it substantially against the heat inactivation (Sardar et al., 2000; Gouda and Abdel-Naby, 2002).
Fig. 6. Effect of temperature on the activities of free () and insoluble xylanase().
Long-term stability of immobilized enzymes is one of the key factors that determine their practical applications. In this regard, we detected the storage stability of the free and the insoluble active xylanase at the temperatures of 4 ◦ C and 30 ◦ C, respectively. Fig. 8 shows the storage stability at the temperature of 4 ◦ C. From it, one can see that the insoluble active xylanase retained almost 100% of its initial activity after 40-day storage, while the free one only retained less than 20% after 5 days. On the other hand, the insoluble active xylanase retained about 50% of its initial activity after 40-day storage at 30 ◦ C as shown in Fig. 9, while the free one lost all of its activity at the 5th day. These results indicate that the insoluble active xylanase had remarkable stabilizing effect toward storage than the free one at both 30 ◦ C and 4 ◦ C with their pH optima (pH 6.0). Moreover, the slight loss of xylanase activities caused by the immobilization was largely compensated by the higher stability. Besides, lowering the storage temperature to 4 ◦ C significantly improves the insoluble active xylanase stability, nearly no loss of activity was observed up to 40 days. This result was better than previous reports (Shah and Madamwar, 2005; Hasirci et al., 2006). According to their results, at the refrigeration temperature (about 4 ◦ C), no loss of activity was observed up to 2 weeks and after 4 weeks a marginal decrease (5–10%) was found. At room temperature 10% loss in enzyme activity was found at the end of a week.
Fig. 8. The storage stability of free () and insoluble xylanase () at 4 ◦ C.
C. Li, G. Zhang / Journal of Biotechnology 177 (2014) 60–66
65
many factors such as the salt kinds and concentration, the length of the ELPs, the pH of the buffer, can influence the size of the particles, thus, it relatively easy for us to control the size of the active particles. This is the potential advantage of ours compared with the previous in vivo methods (Worrall and Goss, 1989; García-Fruitós et al., 2005; Arié et al., 2006). It is very difficult to control the particle sizes in the host cell. Secondly, to seek the molecular mechanism of the irreversible self-assembling of ELPs, the molecular dynamic simulation should be performed. Some secondary bonds might dominate in the irreversible phase transition between the ELPs and the xylanase and need to be clarified. Besides, more target enzymes should be tested to see if they can also form the insoluble active particles. When we have more different active particles, some general rule might be obtained for the phenomenon we reported here.
Acknowledgements Fig. 9. The storage stability of free () and insoluble xylanase () at 30 ◦ C.
4. Discussion In view of their high costs (as compared to the chemical catalysts), reusable forms of enzymes, called immobilized enzymes, are often used (Saleemuddin, 1999). Conventional immobilization of enzymes is generally recognized as randomly immobilized on the supports though exposed residues such as lysine. Unfortunately, in the case of random immobilization, the possibility of multipoint attachments will result in loss of activity. This could eventually lead to the conformational changes or obstruction of the binding site of the immobilized protein (Butterfield et al., 2001; Wilchek and Miron, 2003; Lin et al., 2010). To circumvent this difficulty, site-specific immobilization of the enzymes with the active sitedirected away from the carrier is essential. This will obtain a higher efficiency and catalytic yield (Hernandez and Fernandez-Lafuente, 2011; Liu et al., 2012). Based on this view, the ELPs self-assembled into an insoluble particle, which can be regarded as the carrier for immobilization. It was covalently attached with the C-terminus residue of the xylanase via a random coil. At the same time, the active sites of the xylanase may direct away from the carrier as it has relative high activity. So, the xylanase “moieties” might be “site-specific immobilized” xylanase. However, there should be some secondary interactions between them, while the covalent attachment of xylanase to ELPs aggregates was beneficial to use in industrial application under some mild conditions. Xylanase has been immobilized on various carriers by different immobilization methods for the xylan hydrolysis. These methods include physical absorption (Sardar et al., 2000), covalent binding (Gouda and Abdel-Naby, 2002; Adriano et al., 2005), ionic binding (Dumitriu and Chornet, 1997), and entrapment (Kapoor et al., 2008). However, all of these immobilizations are random, and the linkage to the support may block the active site. Our study indicates ELPs has great potential to “site-specifically” immobilize the xylanase, as the xylanase particles had considerable higher activity and stability. Additionally, the purification and immobilization of the enzymes were performed separately in most cases. However, in our case, purifying and immobilizing of the xylanase was integrated in one-step with the self-assemble of the smart ELPs at a specific temperature. Obviously, our method is more cost- and time-efficient and easy to scale-up from an economic point of view. This simple method shows great promise for processing of other enzymes and would have a brilliant prospect for their applications in industrial biotechnology. Perhaps, in the future, we should pay more attention on the following points. Firstly, the particles could be uniform and nanosized by regulating the operating conditions to decrease the mass transfer resistance and increase the enzyme loading. As we know,
This work was supported by the National Natural Science Foundation of China (21376103) and the Natural Science Foundation of Fujian Province (2013J01048).
References Adriano, W.S., Edilson Filho, H., Silva, J.A., Gonc¸alves, L.R., 2005. Optimization of penicillin G acylase multipoint immobilization on to glutaraldehyde–chitosan beads. Biotechnol. Appl. Biochem. 41, 201–207. Allenza, P., Scherl, D.S., Detroy, R.W., Leathers, T.D., Scott, C., 1986. Hydrolysis of xylan by an immobilized xylanase from Aureobasidium pullanans. In: Biotechnol. Bioeng. Symp., United States. Allied-Signal Research Center/USDA, NRRL, Des Plaines, IL, USA/Peoria, IL, USA. Arié, J.P., Miot, M., Sassoon, N., Betton, J.M., 2006. Formation of active inclusion bodies in the periplasm of Escherichia coli. Mol. Microbiol. 62, 427–437. Bailey, M.J., Biely, P., Poutanen, K., 1992. Interlaboratory testing of methods for assay of xylanase activity. J. Biotechnol. 23, 257–270. Butterfield, D.A., Bhattacharyya, D., Daunert, S., Bachas, L., 2001. Catalytic biofunctional membranes containing site-specifically immobilized enzyme arrays: a review. J. Membr. Sci. 181, 29–37. Chow, D.C., Dreher, M.R., Trabbic-Carlson, K., Chilkoti, A., 2006. Ultra-high expression of a thermallyresponsive recombinant fusion protein in E coli. Biotechnol. Prog. 22, 638–646. Dumitriu, S., Chornet, E., 1997. Immobilization of xylanase in chitosan-xanthan hydrogels. Biotechnol. Prog. 13, 539–545. Faber, K., Kroutil, W., 2005. New enzymes for biotransformations. Curr. Opin. Chem. Biol. 9, 181–187. Fu, X., Wang, W., Zhang, G., 2012. Purification fusion xylanase with the shortest elastin-like polypeptide tag by non-chromatographic. Acta Microbiol. Sin. 52, 90–95 (in Chinese.). García-Fruitós, E., González-Montalbán, N., Morell, M., Vera, A., Ferraz, R.M., Arís, A., Ventura, S., Villaverde, A., 2005. Aggregation as bacterial inclusion bodies does not imply inactivation of enzymes and fluorescent proteins. Microb. Cell Fact. 4, 27. García-Fruitós, E., Rodríguez-Carmona, E., Díez-Gil, C., Ferraz, R.M., Vázquez, E., Corchero, J.L., Cano-Sarabia, M., Ratera, I., Ventosa, N., Veciana, J., 2009. Surface cell growth engineering assisted by a novel bacterial nanomaterial. Adv. Mater. 21, 4249–4253. Goldstein, M.A., Takagi, M., Hashida, S., Shoseyov, O., Segel, I., 1993. Characterization of the cellulose-binding domain of the Clostridium cellulovorans cellulosebinding protein A. J. Bacteriol. 175, 5762–5768. Gouda, M.K., Abdel-Naby, M.A., 2002. Catalytic properties of the immobilized Aspergillus tamarii xylanase. Microbiol. Res. 157, 275–281. Hasirci, N., Aksoy, S., Tumturk, H., 2006. Activation of poly(dimer acid-co-alkyl polyamine) particles for covalent immobilization of alpha-amylase. React. Funct. Polym. 66, 1546–1551. Hernandez, K., Fernandez-Lafuente, R., 2011. Control of protein immobilization: coupling immobilization and site-directed mutagenesis to improve biocatalyst or biosensor performance. Enzyme Microb. Technol. 48, 107–122. Kapoor, M., Kuhad, R.C., 2007. Immobilization of xylanase from Bacillus pumilus strain MK001 and its application in production of xylo-oligosaccharides. Appl. Biochem. Biotechnol. 142, 125–138. Kapoor, M., Nair, L.M., Kuhad, R.C., 2008. Cost-effective xylanase production from free and immobilized Bacillus pumilus strain MK001 and its application in saccharification of Prosopis juliflora. Biochem. Eng. J. 38, 88–97. Kaur, J., Sharma, R., 2006. Directed evolution: an approach to engineer enzymes. Crit. Rev. Biotechnol. 26, 165–199. Lim, D.W., Trabbic-Carlson, K., MacKay, J.A., Chilkoti, A., 2007. Improved nonchromatographic purification of a recombinant protein by cationic elastin-like polypeptides. Biomacromolecules 8, 1417–1424.
66
C. Li, G. Zhang / Journal of Biotechnology 177 (2014) 60–66
Lin, P.C., Weinrich, D., Waldmann, H., 2010. Protein biochips: oriented surface immobilization of proteins. Macromol. Chem. Phys. 211, 136–144. Liu, W., Wang, L., Jiang, R., 2012. Specific enzyme immobilization approaches and their application with nanomaterials. Top. Catal. 55, 1146–1156. Luan, C.H., Harris, R.D., Prasad, K.U., Urry, D.W., 1990. Differential scanning calorimetry studies of the inverse temperature transition of the polypentapeptide of elastin and its analogues. Biopolymers 29, 1699– 1706. Meyer, D.E., Chilkoti, A., 1999. Purification of recombinant proteins by fusion with thermally-responsive polypeptides. Nat. Biotechnol. 17, 1112–1115. Meyer, D.E., Chilkoti, A., 2002. Genetically encoded synthesis of protein-based polymers with precisely specified molecular weight and sequence by recursive directional ligation: examples from the elastin-like polypeptide system. Biomacromolecules 3, 357–367. Meyer, D.E., Chilkoti, A., 2004. Quantification of the effects of chain length and concentration on the thermal behavior of elastin-like polypeptides. Biomacromolecules 5, 846–851. Nahálka, J., Misloviˇcová, D., Kavcová, H., 2009. Targeting lectin activity into inclusion bodies for the characterisation of glycoproteins. Mol. BioSyst. 5, 819–821. Nahalka, J., Nidetzky, B., 2007. Fusion to a pull-down domain: a novel approach of producing trigonopsis variabilis d-amino acid oxidase as insoluble enzyme aggregates. Biotechnol. Bioeng. 97, 454–461. ˇ Grdadolnik, J., Gaberc-Porekar, V., Komel, R., 2008. Engineering inclusion Peternel, S., bodies for non-denaturing extraction of functional proteins. Microb. Cell Fact. 7, 34. Roessl, U., Nahálka, J., Nidetzky, B., 2010. Carrier-free immobilized enzymes for biocatalysis. Biotechnol. Lett. 32, 341–350. Saleemuddin, M., 1999. Bioaffinity based immobilization of enzymes. Thermal Biosensors, Bioactivity, Bioaffinitty. Springer, pp. 203–226. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning. Cold Spring Harbor Laboratory Press, New York.
Sardar, M., Roy, I., Gupta, M.N., 2000. Simultaneous purification and immobilization of Aspergillus niger xylanase on the reversibly soluble polymer EudragitTM L-100. Enzyme Microb. Technol. 27, 672–679. Shah, A.R., Madamwar, D., 2005. Xylanase production by a newly isolated Aspergillus foetidus strain and its characterization. Process Biochem. 40, 1763–1771. Shoseyov, O., DoI, R.H., 1990. Essential 170-kDa subunit for degradation of crystalline cellulose by Clostridium cellulovorans cellulase. Proc. Natl. Acad. Sci. U.S.A. 87, 2192–2195. Subramaniyan, S., Prema, P., 2002. Biotechnology of microbial xylanases: enzymology, molecular biology, and application. Crit. Rev. Biotechnol. 22, 33–64. Trabbic-Carlson, K., Meyer, D., Liu, L., Piervincenzi, R., Nath, N., LaBean, T., Chilkoti, A., 2004. Effect of protein fusion on the transition temperature of an environmentally responsive elastin-like polypeptide: a role for surface hydrophobicity? Protein Eng. Des. Sel. 17, 57–66. Wheeldon, I.R., Campbell, E., Banta, S., 2009. A chimeric fusion protein engineered with disparate functionalities-enzymatic activity and self-assembly. J. Mol. Biol. 392, 129–142. Wilchek, M., Miron, T., 2003. Oriented versus random protein immobilization. J. Biochem. Bioph. Meth. 55, 67–70. Worrall, D., Goss, N., 1989. The formation of biologically active beta-galactosidase inclusion bodies in Escherichia coli. Aust. J. Biotechnol. 3, 28–32. Wu, W., Xing, L., Zhou, B., Lin, Z., 2011. Active protein aggregates induced by terminally attached self-assembling peptide ELK16 in Escherichia coli. Microb. Cell Fact. 10, 9. Yan, X., Wang, X., Zhao, P., Xu, P., Ding, Y., 2012. Xylanase immobilized nanoporous gold as a highly active and stable biocatalyst. Micropor. Mesopor. Mater. 161, 1–6. Zhang, S., Zhang, K., Chen, X., Chu, X., Sun, F., Dong, Z., 2010. Five mutations in Nterminus confer thermostability on mesophilic xylanase. Biochem. Biophys. Res. Commun. 395, 200–206. Zhou, B., Xing, L., Wu, W., Zhang, X.-E., Lin, Z., 2012. Small surfactant-like peptides can drive soluble proteins into active aggregates. Microb. Cell Fact. 11, 10.