The genome and the antigen gene repertoire of Trypanosoma brucei gambiense are smaller than those of T. b. brucei

Molecular and Biochemical Parasitology, 26 (1987) 24%256 Elsevier

247

MBP 00886

The genome and the antigen gene repertoire of Trypanosoma brucei gambiense are smaller than those of T. b. brucei Brigitte Dero, Franqoise Zampetti-Bosseler,

Etienne Pays and Maurice Steinert

DOparternent de Biologie MolOculaire, UniversitO Libre de Bruxelles, Rhode Saint Gen~se, Belgium (Received 9 April 1987: accepted 13 July 1987)

The amount of nuclear DNA of Trypanosoma brucei gambiense is only 70% of that of T. b. brucei. The difference is partially due to depletion of 50-150 kb mini-chromosomes in T. b. gambiense, as well as a reduction in the content of some repetitive DNA families. Quantitation of 'barren" DNA regions characteristic of the 5' environment of telomeric antigen genes confirms that the T. b. gambiense genome contains fewer chromosome ends, and thus most probably fewer telomeric antigen genes, than T. b. brucei. The extent of the antigen gene repertoire of the two subspecies has been estimated by hybridization with probes specific for the conserved 3' region of antigen genes. It appears that the repertoire of the gambiense subspecies is only about 50% of that of T. b. brucei. These observations are discussed with regard to the stability of the T. b. gambiense repertoire. Key words: Trypanosomes; DNA; Antigen gene repertoire: Genome organisation; Sleeping sickness

Introduction

African trypanosomes evade the immune response of their mammalian host by changing repeatedly their antigenic surface coat (for a review, see ref. 1). The latter is made of a single glycoprotein species, the variant surface glycoprotein or VSG. Antigenic variation is achieved by the sequential activation of different VSG genes, only one being expressed at a time from a large collection of antigen-specific sequences (for reviews, see refs. 2-6). In Trypanosoma brucei brucei, the repertoire contains up to 1000 different sequences, although probably only a fraction encode complete functional antigens [17,8]. This repertoire is highly variable between T. b. brucei stocks, reflecting a high evolution rate of antigen-specific sequences [6]. At least three peculiarities of antigen genes may Correspondence address: M. Steinert, D6partement de Biologie Mol6culaire, Universit6 Libre de Bruxelles, 67, rue des Chevaux, B-1640 Rhode Saint Gen6se, Belgium. Abbreviations: VSG, variant specific surface glycoprotein; kb, kilobase pairs; bp, base pairs; PFG, pulse-field gradient: ESAG, antigen expression site-associated gene.

account for this variability. First, many antigen genes reside at telomeres, which appear particularly prone to different D N A recombinational mechanisms. Alternation between these mechanisms has been shown to modify the antigen repertoire by expanding some gene families at the expense of others [9,10]. Secondly, telomeric genes seem particularly prone to variation [11]. Thirdly, reassortments between antigen gene families can be achieved by asymmetrical genetic exchange taking place between trypanosomes in the vector, the tsetse fly [12]. T. b. gambiense is the subspecies responsible for human sleeping sickness in West Africa. In contrast with T. b. brucei, different garnbiense stocks exhibit very similar antigen repertoires [131 (E.A. BaNker, Ph. D. Thesis, 1981). Analysis of restriction fragment length polymorphism in VSG gene families has revealed a striking conservation between stocks, even from distant geographic areas [14]. This remarkable homogeneity of T. b. garnbiense has led to its identification as a distinct, sibling species of T. brucei [15]. In an attempt to explain the relatively low variability of antigen genes in the gambiense subspecies, the contribution of telomeric genes to the repertoire

0166-6851/87/$03.50 © 1987 Elsevier Science Publishers B.V. (Biomedical Division)

248 in both subspecies has b e e n c o m p a r e d . We report here that T. b. gambiense is strongly depleted in V S G genes, particularly telomeric ones, as c o m p a r e d to 7". b. brucei. Materials and Methods

Trypanosornes. T h e t r y p a n o s o m e stocks analysed in this w o r k are listed in Table I. All the T. b. gambiense stocks analysed herein, identified as noted in Table I b e l o n g to G i b s o n ' s g r o u p 1 [16]. T h e t r y p a n o s o m e s were grown in rats, mice or Mastomys natalensis, d e p e n d i n g on the particular a d a p t a t i o n of each stock to these hosts. T h e n u m b e r of passages n e e d e d for adaptation of the stocks in l a b o r a t o r y rodents is indicated in Table I. T h e last 1-3 passages were always p e r f o r m e d by intravenous inoculation in the tail of 6 weekold mice, c y c l o p h o s p h a m i d e treated to ensure better yields [17]. A f t e r cultivation, the t r y p a n o somes were lysed in 1% sodium dodecyl sulfate (SDS), 0.1 M E D T A and 10 m M Tris-HCl ( p H

8). Microfluorometry.

D N A determinations were carried out by m e a s u r i n g the fluorescence emission of Feulgen-stained nuclei in t r y p a n o s o m e preparations, as described previously [18].

Pulsed field gradient (PFG) gel electrophoresis. P F G gel electrophoresis of intact c h r o m o s o m e s was carried out as described by Van der Ploeg et al. [19]: the c h r o m o s o m e - s i z e d D N A molecules from 10 s lysed T r y p a n o s o m e s in agarose blocks were pulsed in a 1% agarose gel run at 5°C, alternating the electrical fields (350 V: N/S; 160 V: W/E) every 10 s for 22 h.

Dot blot and genornic hybridisation. L o a d i n g of D N A samples to nitrocellulose filters (dots) was done as follows: the D N A (2, 1.5 or 1 ~tg) in 50 ill of 0.1 m M E D T A , 10 m M Tris-HCl (pH 8), was d e n a t u r e d for 10 min in a boiling waterbath, followed by rapid cooling in an ice bath. The D N A samples were spotted onto nitrocellulose filters after addition of an equal volume of 20 x SSC (1 x SSC is 0.15 M NaC1, 0.015 M Na citrate). After washing with 6 x SSC, the filters were dried at 80°C for 2 h under v a c u u m , then hybridized with the different probes. Hybridization was in 6 x SSC at 65°C and washings in 0.1 x SSC at the same t e m p e r a t u r e . Estimation of the hybridization level was p e r f o r m e d by scintillation counting of the relevant nitrocellulose area. Transfer of the D N A from agarose gels to nitrocellulose filters was carried out as described by Southern [20]. P F G gels were preincubated with

TABLE I Listing of the stocks analysed in this work Stock

Host

Subspecies"

Country

Passagesb

gambiense Zaire 92 MBA (AnTAR 11): K1NKOLEE/74/ITMAP/1811 Man gambiense Ivory Coast ELIANE: PARIS/52/-/- (ELIANE) Man gambiense Congo 37 OK: MAKOUA/74/ITMAP/1800 Man garnbiense Zaire 55 BOSENDJA: KINSHASA/72/KIN/001 Man garnbiense Togo 5 FEO/R (Centre Murat) ITMAP/1893 Man gambiense Cameroun 35 JUA: FONTEM/-/ITMAP/1790 Man gambiense Congo 67 MA: MOSSAKA/74/-/Man gambiense Congo 33 D12K: NGABE/-/-/D12K Sheep Uganda 42 AnTAR 1: MAVUBWE/66/EATRO 1 1 2 5 Tragelaphusscriptus non-gambiense non-gambiense Ivory Coast 8 TSW (125/82 EKPI) Pig non-gambiense Nigeria 27 NITR 40.12 YANKARI/70/NITR/40.12 Glossina morsitans non-gambiense Zaire 30 KIM l: KIMALAYA/78/IMTK/18067 Sheep non-gambiense Ivory Coast 3 STIB 386 AA Man All the stocks were obtained from the Institute for Tropical Medicine, Antwerp (D. Le Ray and N. Van Meirvenne), except STIB 386 AA, received from the Swiss Tropical Institute, Basel (L. Jenni) [12], and TSW (125/82 EKPI) which was obtained as a cell lysate from the Bernhard Nocht Institut fur Schiffs und Tropenkrankheiten, Hamburg (D. Mehlitz) [14]. ~'As identified by human serum sensitivity tests, isoenzyme patterns and DNA hybridization [14]. t~Number of passages, generally 3-6 days, in mice or mastomys. Undefined, old laboratory strain.

249 40

of the 3' part of the LiTat 1.6 c D N A were isolated on 2% preparative agarose gel and cloned in the Pstl site of M13mp8 for sequencing [22].

20

Isolation of probes. The 3' LiTat 1.6 and AnTat 1.10A probes were obtained by HinfI and DdeI digestion of the corresponding 3' PstI fragment of the respective cDNAs. Both fragments were isolated on 2% preparative low melting point agarose gels (BRL) and cloned in the SmaI-PstI site of M13mpl0 after Klenow treatment. Probes have been generated from these recombinant clones by D N A synthesis in the presence of [c~32p]dCTP (3000 Ci m m o l - l ) , as described for D N A sequencing [22]. The probes were prepared by nick-translation of specific fragments isolated by preparative electrophoresis on low melting point agarose. Probe A is a 4.2 kb E c o R I - S p h I fragment from a sequence of unknown function, cloned from the large chromosome fraction of T. brucei, clone AnTat 1.3A. This probe usually hybridizes to a single D N A band in genomic D N A digests [23]. The actin probe is a 1.85 kb SalI-BglIl fragment which contains the actin gene from the 7". b. garnbiense LiTat 1.6 clone (M. Ben Amar and E. Pays, unpublished). The probe for the 5' barren region is a 5 kb H i n d l I - H i n d I I I fragment from the 5' environment of the AnTat 1.3A basic copy gene [241. The TRS-1 probe is the central 1.6 kb BamHI fragment containing the reverse transcriptase sequence of TRS-1 retroposon [25]. This part of TRS-1 appears well conserved both in T. b. brucei and in T. b. garnbiense, as judged from restriction mapping.

A

0 .....

12

15

18

DNA (F.U.) 40

"0

O3 @

"•

2O

E

o

0

-

B

C

-

6

12

12

40

20

D

_V~ _ rl 0

.

.

.

.

12

E

......

1i

Fig. l. Microfluorometric estimation, following Feulgen staining, of the nuclear D N A content in different T. b. gambiense stocks (FEO/R, E L I A N E , B O S E N D J A and MBA, in panels B - E respectively) and in a 7". b. brucei reference clone ( E A T R O 1125, in panel A). Fluorescence intensity is expressed in arbitrary units (F.U.) and the background fluorescence for each individual reading was subtracted. At least 20(1 nuclei have been analysed from each trypanosome clone.

0.25 N HC1 for 45 min prior to denaturation to facilitate the transfer of large D N A fragments. Hybridization of dots and blots with the labelled D N A probes was performed as reported by Pays et al, [21].

Cloning LiTat 1.6 cDNA and sequencing. The LiTat 1.6 c D N A was cloned into the PstI site of pBR322 by GC-tailing and double-screening selection, using LiTat 1.6 and LiTat 1.3 single stranded cDNAs as probes [21]. PstI fragments

Results

Cytofluorornetric estimation of nuclear DNA content in T. b. gambiense. The D N A content of T. b. garnbiense has been compared to that of T. b. brucei or T. b. rhodesiense using microfluorometric measurements [18,23]. Fig. 1 shows an example of the distribution of Feulgen-reaction fluorescence intensity of individual nuclei in four different stocks of T. b. garnbiense (panels B - E ) and in one clone of T. b. brucei (A) used as reference in this experiment. In the four garnbiense populations, the peak of cells in G1 has a fluorescence emission value close to 6 arbitrary units,

250 T A B L E II Summary of the titration experiments Probe

brucei (B)

garnbiense (G)

(B)/(G)

A

actin

TRS-1

5' barren

3' 10A

3' Li.6

dots blots

411 -+ 90 -

425 + 106 3285

77 480

6400 -+ 510 34 599

3120 -+ 880 7392

4200 ± 1790 19 483

dots blots

534 -+ 135 -

580 + 163 4540

45 400

3650 -+ 360 20 200

1930 ± 490 4770

2640 ± 380 13 700

dots blots

0.77 ± 0.05 -

0.73 ± 0.05 0.72

1.7

1.75 -+ 0.07 1.71

1.6 -+ 0.1 1.55

1.6 + 0.9 1.42

The level of radioactivity following dot and blot hybridization with various probes (indicated at the top), has been measured by liquid scintillation counting of the relevant nitrocellulose area. Where standard deviations are given, the mean values have been calculated from three independent experiments. (B)/(G) are the ratios between the values obtained for the two subspecies.

in sharp contrast to the T. b. brucei population which shows a G1 p e a k at about 9 arbitrary units. In four separate experiments, p e r f o r m e d on 5 different stocks of T. b. brucei or T. b. rhodesiense and 6 different stocks of T. b. gambiense (data not shown), the m e a n brucei/gambiense fluorescence emission ratio was 1.39, with a standard deviation of 0.10, strongly suggesting that the

A 1 2345678

genome of T. b. gambiense contains about 30% less D N A than T. b. brucei.

Estimation of the genome size by hybridization with probes for single copy genes. Two probes were used. The first one, called ' A ' , was derived from a sequence of unknown function, cloned from the large c h r o m o s o m e fraction of T. b. bru-

B 1 2 34

56

78

50-150kb

)t/

/

Fig. 2. (A) Distribution of chromosome-sized D N A molecules in the genome of different T. b. gambiense stocks. Lysates from T. b. gambiense stocks MBA, E L I A N E , B O S E N D J A , OK, F E O / R and J U A (lanes 1-6, respectively), as well as from one T. b. rhodesiense stock, STIB 386AA (lane 7) and one T. b. brucei stock, E A T R O 1125 (lane 8) have been subjected to pulse PFG gel electrophoresis. The negative photograph of the ethidium bromide-stained gel is shown. (B) Chromosomal distribution of VSGspecific sequences in T. b. gambiense and in T. b. brucei. A Southern blot of the PFG gel shown in panel A has been hybridized with the 3' AnTat 1.10A c D N A probe (see Fig. 4). Size calibration is as described by Guyaux et al. [34]. The arrowed chromosomes are about 40 kb long.

251

cei ( E A T R O 1125) [24]. It generally hybridizes to an identical single D N A fragment in all T. b. brucei and T. b. garnbiense stocks. This fragment can however be found in two probably allelic versions, the simultaneous presence of both versions in some stocks having been tentatively interpreted as evidence for heterozygosity [24]. The second probe was made from a recently cloned T. b. garnbiense actin gene (M. Ben A m a r and E. Pays, unpublished). This probe generally recognizes a single D N A fragment in all stocks, although here again there is preliminary evidence for heterozygosity in some of these stocks (E. Pays, unpublished). Dot blots and genomic blots were hybridized to the two probes, using calibrated amounts of D N A from four representative stocks of brucei and gambiense. The results, from scintillation countings of filter cut outs, are summarized in the first two columns of Table II. A ratio of about 0.74 _+ 0.03 is found between readings obtained for equal amounts of brucei and garnbiense DNAs, indicating a total nuclear D N A content about 1.35 +_ 0.05 times higher in T. b.

brucei. The gambiense genorne is depleted in rninichromosornes. Fig. 2A shows the distribution of chromosome-sized D N A molecules in six cloned stocks of T. b. gambiense, from different geographical origins. All six D N A s are remarkably depleted in the 50-150 kb minichromosomes fraction as compared to the karyotype of T. b. brucei, which has been estimated to contain more than 100 of these small chromosomes [19]. It implies that the garnbiense genome also contains considerably fewer telomeres than its brucei counterpart.

T. b. garnbiense genomic D N A is depleted in TRS1 repetitive sequences. TRS-1 is a family of highly repeated elements, resembling retrotransposons, that has been discovered in the genome of T. b. brucei [25,26]. We have titrated the amount of TRS-1 elements by hybridization to dot blots and genomic blots of D N A s from four representative brucei and gambiense stocks (Fig. 3 and Table II, column 3). The hybridization on Southern blots indicated a higher overall amount of TRS-1 in T. b. brucei as compared to T. b. garnbiense. In addition, variations in the banding pattern between

kb

1 2 345678

1" m

4_ 3_ 2_ _

Fig. 3. Hybridizationpattern of TRS-1 in different garnbiense and brucei stocks. Southern blots of PstI digests of genomic DNA from the gambiense stocks MBA, ELIANE, MA and D12K (lanes 1-4, respectively) and from the brucei stocks EATRO 1125, TSW(125/82 EKPI), NITR 40.12 and KIMALAYA (lanes 5-8, respectively) have been hybridized with a 32P-labelled 1.6 kb BamHI fragment from a TRS-1 element of T. b. brucei [25]. A calibration of the amount of DNA loaded on each lane has been performed by rehybridization of the filter with the actin probe (see text). The quantitative estimations shown in Table 2 are from duplicate gels run under the same conditions.

stocks are much more pronounced in T. b. brucei (Fig. 3). Quantitation by counting following hybridization to dot blots of calibrated amounts of D N A shows that TRS-1 elements are about 1.7 times more abundant in T. b. brucei than in T. b. gambiense D N A (Table II).

T. b. gambiense genornic D N A seems to be depleted in 76 bp repeats. In T. brucei, telomeric antigen genes are flanked by a 5' 'barren' region, made up of 76 bp repeated motifs [4]. The full 5' barren region of the AnTat 1.3A basic copy gene has been cloned [24]. It was used here as a probe in dot and blot hybridizations to calibrated amounts of D N A from the same eight stocks, representative of brucei and garnbiense subspe-

252 HinfI

DdeI

A I0:

GATTCCTCTATTCTAGTAACCAAGAAATTCGCCCTCAGTCTGGTTTCTGCTGCATTTGCGTCCTTGCTTTT~

Li6:

***********************************************************************~**,

AS:

*********************

AI0:

...... TTTTGG---CCCTTAAATTCCCC

.........

Li6:

AAGAAA--**

..........

A8:

........

***C*************CG*

..... ****C---**TT*T

**A*CCC****C

*******************G**********T**

-CCCCTTTTAAAATTTTCCTTGCTACTTGAAAA

I

....

***********************--**********

.... *TT*TAAAAATTTTC*****GC********-TGC*A*

..............

16-mer AI0:

-ACTTTCTGATATATTTTAACACC

Li6:

*************************

A8:

..... ********************--********

Fig. 4. Comparison of the conserved 3' region of brucei and gambiense VSG genes. The last 150 bp of the T. b. brucei A~Tat 1.10A (A10) and 1.8A (A8) cDNAs [9,28] have been aligned with the corresponding sequence of the T. b. gambiense Li Fat 1.6 (Li6) cDNA. The stop codon of the antigen coding sequence is boxed. The 3' LiTat 1.6 and the 3' AnTat 1.10A probes, uscd in the experiment of Fig. 5, were from the HinfI or the DdeI site respectively, to the PstI site generated by the cloning procedure at the 3' end of the sequences shown here. The asterisks indicate homology with the AnTat h 10A sequence. Dashes are introduced to align the three sequences for maximum homology. The underlined region ('16-mer') is conserved in all VSG sequences determined so far [4]~ cies, e x a m i n e d in the experiments described. Assuming that there is no significant sequence divergence b e t w e e n the 76 bp repeats of the two subspecies, the results (Table II, c o l u m n 4) indicate these repeats might be about 1.73 times more a b u n d a n t in the g e n o m i c D N A of T. b. brucei. This is in k e e p i n g with the data presented in Fig. 2, showing a depletion in small size class chrom o s o m e s in T. b. gambiense, since long stretches of 76 bp repeats are characteristic of telomeric sequences, a l t h o u g h a few such repeats are also f o u n d u p s t r e a m c h r o m o s o m e - i n t e r n a l V S G genes [27].

Comparative sizes o f brucei and gambiense antigen gene repertoires. In T. b. brucei, the last 150 bp of V S G genes are conserved [28], p r o b a b l y helping the r e c o m b i n a t i o n processes involved in antigen gene switching [4]. P r o b e s f r o m this region have b e e n used previously to determine the n u m b e r of V S G genes in T. b. brucei [7]. T h e 3' end of a T. b. gambiense V S G gene (LiTat 1.6)

was sequenced and f o u n d to share the 3' block of homology present in T. b. brucei V S G genes (Fig. 4). Probes specific for that conserved region have b e e n p r e p a r e d from the brucei A n T a t 1.10A and the gambiense LiTat 1.6 genes, and used in quantitative dot and blot hybridization to D N A s of different stocks from both subspecies (Fig. 5 and Table II, columns 5 and 6). Striking differences were found between brucei and gambiense stocks, regarding the level of hybridization as well as the conservation of the banding pattern. With both brucei and gambiense probes, the hybridization level is consistently about 1.5 times higher in T. b. brucei (Table II), strongly suggesting that the size of the V S G gene repertoire in T. b. gambiense is smaller than in T. b. brucei. As discussed below, the difference appears to be even higher if a correction for g e n o m e size is applied. T. b. brucei also exhibits a higher variability in band patterns, as shown in Fig. 5. T h e distribution of V S G genes in different c h r o m o s o m e size classes of both subspecies has

253

kb

is smaller than that of brucei and that it is depleted in minichromosomes. Our results are also indicative of a depletion of gambiense D N A in the interspersed repeated element TRS-1 and in the 76 bp repeats. The size of the gambiense antigen gene repertoire is also much smaller than that of

1 2345678

brucei.

6~ 4_ 3_ 2_

W

Fig. 5. Comparison of the size of antigen gene repertoires between 72 b. gambiense and T. b. brucei. Southern blots of PstI digests of genomic DNA from the gambiense stocks MBA, ELIANE, MA and D12K (lanes 1-4, respectively) and from the brucei stocks EATRO 1125, TSW(125/82 EKPI), NITR 40.12 and KIMALAYA (lanes 5-8, respectively) have been hybridized with a probe from the 3' part of the AnTat 1.10A cDNA (see Fig. 4). The amount of DNA per lane has been checked by rehybridization with the actin probe, as for Fig. 3.

been analysed with the same probes after PFG gel electrophoresis. Fig. 2B shows, as expected, that the strong hybridization to the minichromosomes in T. b. brucei is not observed in the case of T. b. garnbiense. H o w e v e r , some hybridization reaction can be observed in garnbiense c h r o m o s o m e s of the intermediate size class, and also in a few very small c h r o m o s o m e s , as for instance the arrowed 40 kb one which harbours a telomeric copy of the LiTat 1.3 V S G gene (B. D e r o , unpublished). Discussion

The g e n o m e of T. b. gambiense has been compared with that of brucei for total D N A content, for the occurrence of small size class chromosomes and for hybridization to a few specific sequences. It was found that the gambiense genome

DNA content of the two subspecies. Fluorometric estimation of the D N A content gave a brucei/gambiense D N A ratio of about 1.39. This value is close to the ratio of 1.35 calculated from the data obtained following hybridization with the single copy sequences. The g e n o m e of T. b. gambiense thus appears to contain about 30% less D N A than T. b. brucei. This is in accordance with the scattered data that have been compiled by Borst et al. [29]. Since the D N A content of brucei has been evaluated to be 0.1 pg per nucleus, or 74000 kb [29], the deficit of D N A in gambiense must be around 20000 kb. It should be stressed here that the same D N A value was found in four independent gambiense stocks, one of which ( E L I A N E ) has been passaged on rodents for a much longer period than the others. Previous analyses have already indicated that extended propagation periods in rodents were without effect on the hybridization pattern of genomic D N A blots [30]. Since the deficit in nuclear D N A content of T. b. gambiense has been reproducibly observed in several stocks (F. Zampetti-Bosseler, unpublished), it may provide an additional and simple criterion to define the gambiense subspecies. The n u m b e r of minichromosomes in T. b. brucei has been estimated to be about one hundred, with a mean size of approximately 100 kb [19]. This n u m b e r is much reduced in T. b. gambiense, as shown in this work (6 stocks examined) and in a previous publication (2 stocks examined) [31]. One may very crudely estimate that a complete loss of minichromosomes in T. b. brucei would reduce its D N A content by about 10000 kb, a value that corresponds to a significant fraction of the D N A deficit observed in T. b. gambiense. These minichromosomes constitute a reservoir of telomeric antigen genes [19]. Their absence in T. b. gambiense thus implies a depletion of telomeric VSG genes, in accordance with our data on

254 the reduction in the amount of 76 bp repeats, which are characteristic of the so called 5' 'barren' regions in trypanosome telomeres. We found that a conserved VSG specifc sequence is 1.5 times more abundant in T. b. brucei than in T. b. gambiense DNA. Considering a 30% difference in total nuclear D N A content between the two subspecies, we estimate that the number of VSG genes in T. b. garnbiense might be only 48% that of T. b. brucei. Since the number of VSG specific sequences in T. b. brucei has been estimated at about 1000 copies [7], we may tentatively conclude that the gambiense repertoire amounts to about 500 VSG sequences. The mean size of the D N A 'domain' occupied by individual VSG genes can be estimated by two different approaches: (i) from the extent of the transposed sequence when antigen switching is operated by the duplicative mechanism. The transposed sequence is generally 3.5 - 4 kb long, including the coding sequence and a 5' 'cotransposed' D N A stretch [32]; (ii) from the distance, about 6 kb, that has been found in cosmid clones between clustered, chromosome-internal VSG genes [7]. It seems therefore reasonable to assume a mean length of about 5 kb for VSG-specific domains. The deficit of 520 VSG-specific sequences in T. b. garnbiense could thus represent 2600 kb. The lack of minichromosomes in T. b. garnbiense would only account for part of this deficit. Indeed, it seems fair to assume that a total of only about 200 VSG genes is located in minichromosomes. These genes are probably all telomeric, since so far no chromosome-internal VSG genes have been located in minichromosomes and the restriction maps of the few minichromosomes described to date [33] (E. Pays and M. Guyaux, unpublished) show no place for such genes. These considerations suggest that the T. b. garnbiense genome lacks sequences, in particular VSG genes, from larger chromosomes as well. Since this subspecies does not appear to contain substantially less chromosomes of the intermediate size-class than T. b. brucei, it follows that it must lack DNA from the large chromosomes which do not enter PFG gels. This conclusion is further backed by the observation that T. b. garnbiense is totally devoid of A n T a t 1.1-specific sequences [30], an antigen

gene family that has been found exclusively in the large chromosomes of different brucei stocks [34] (M. Guyaux, unpublished).

Stability of antigen repertoires in T. b. garnbiense. The high evolution rate of VSG gene families and of antigen repertoires of T. b. brucei contrasts with the striking stability and conservation of VSG-specific sequences in T. b. gambiense [14]. This variability may be due to several causes, amongst which the telomeric location of antigen genes seems to be crucial. In particular, only telomeric VSG genes seem to be activated in situ [4]. Such 'telomere activation', in combination with the duplication mechanism for VSG gene activation, may lead to both gain and loss of VSG sequences during chronic infection [6,9,10]. The sequences gained in this process can be rearranged by partial gene conversion [36] and, as telomeric genes, appear particularly prone to mutations [11]. Therefore, telomere activation may be an important factor for the evolution of antigen gene repertoires. It is known that, as in T. b. brucei, the expression site for T. b. garnbiense VSG genes is telomeric [37]. Since T. b. garnbiense is depleted in telomeric VSG genes, it is probable that the major route for antigen gene activation is by duplication-transposition, which only leads to replacements of VSG gene copies in the expression site, and therefore does not alter the antigen gene repertoire. It is thus probable that the stability of the T. b. garnbiense repertoire is at least partially due to the fact that it is essentially defined by chromosome-internal VSG genes.

Acknowledgements We are indebted to Drs. D. Le Ray, N. Van Meirvenne (Antwerp), D. Mehlitz (Hamburg) and L. Jenni (Basel) for help in obtaining rat adapted T. b. gambiense stocks and trypanosome lysates. This work was supported by a Research Contract (TSD-M-023-B) between the Commission of the European Communities and the Free University of Brussels, by the African Trypanosomiasis Component of the U N D P / W O R L D B A N K / W H O Special Programme for Research and Training in Tropical Diseases, by the Agree-

255

ment for Collaborative Research on African Trypanosomiasis between the International Laboratory for Animal Diseases (ILRAD) and Belgian Research Centres, and by the Fonds de la Recherche Scientifique et M6dicale (Brussels). References 1 Cross, G. (1978) Antigenic variation in trypanosomes. Proc. R. Soc. Lond. B. 202, 55-72. 2 Donelson, J.E. and Rice Ficht, A.C. (1985) Molecular biology of Trypanosorna antigenic variation. Microbiol. Rev. 49, 107-125. 3 Steinert, M. and Pays, E. (1986) Selective expression of surface antigen genes in african trypanosomes. Parasitol. Today 2, 15-19. 4 Borst, P. (1986) Discontinuous transcription and antigenic variation in trypanosomes. Annu. Rev. Biochem. 55, 701-732. 5 Boothroyd, J.C. (19851 Antigenic variation in african trypanosomes. Annu. Rcv. Microbiol. 33. 475-507. 6 Pays, E. (1986) Variability of antigen genes in african trypanosomes. TIG 2, 21-26. 7 Van der Ploeg, L.H.T., Valerio, D., De Lange, T.. Bernards, A., Borst, P. and Grosveld, F.G. (1982) An analysis of cosmid clones of nuclear DNA from 72 brucei shows that the genes for variant surface glycoproteins are clustered in the genome. Nucleic Acids Res. 10, 5905-5923. 8 Roth, C.W., Longacre, S., Raibaud, A., Baltz, T. and Eisen, H. (1986) 'The use of incomplete genes for the construction of a Trvpanosorna equiperdum variant surface glycoprotein gene. EMBO J. 5, 1065-1070. 9 Pays, E., Delauw, M.F., Van Assel, S., Laurent, M., Vervoort, T., Van Meirvenne, N. and Steinert, M. (1983) Modifications of a Trypanosoma b. brucei antigen gene repertoire by different DNA recombinational mechanisms. Cell 35, 721-731. 10 Laurent, M., Pays, E., Delinte, K., Magnus, E., Van Meirvenne, N. and Steinert, M. (1984) Evolution of a trypanosome surface antigen gene repertoire linked to nonduplicative gene activation. Nature 308, 370-373. 11 Bernards, A., Van der Ploeg, L.H.T., Gibson, W.C., Leegwater, P., Eijgenraam, F., de Lange, T., Weijers, P., Calafat, J. and Borst, P. (1986) Rapid changes in the repertoire of variant surface glycoprotein genes in Trypanosomes by gene duplication and deletion. J. Mol. Biol. 190, l-lt). 12 Jenni, L., Marti, S., Schweizer, J., Betschart, B., Le Page, R.W.F., Wells, J.M., Tait, A., Paindavoine, P., Pays, E. and Steinert, M. (19861 Hybrid formation between african trypanosomes during cyclical transmission. Nature 322, 173-175. 13 Gray, A.R. (19721 Variable agglutinogenic antigens of Trypanosorna gambiense and their distribution among isolates of the trypanosome collected in different places in Nigeria. Trans. R. Soc. Trop. Med. Hyg. 66, 263-284. 14 Paindavoine, P., Pays, E,, Laurent, M., Geltmeyer, Y.,

Le Ray, D., Mehlitz, D. and Steinert, M. (1986) The use of DNA hybridization and numerical taxonomy in determining relationships between Trypanosoma brucei stocks and subspecies. Parasitology 92, 31-5(/. 15 Tait, A., Babiker, E.A. and Le Ray, D. (1984) Enzyme variation in T. brucei spp. I. Evidence for the subspeciation of Trypanosoma brucei gambiense. Parasitology 89, 311-326. 16 Gibson, W.C. (1986) Will the real Trypanosoma b. gambiense please stand up. Parasitol. Today 2, 255-257. 17 Babiker. E.A. and Le Ray, D. (1981) Adaptation low virulence stocks of Trypanosoma brucei garnbiense to rat and mouse. Ann. Soc. Beige Med. Trop. 61, 15-29. 18 Zampetti-Bosseler, F., Schweizer, J., Pays, E., Jenni. L. and Steinert, M. (1986) Evidence for haploidy in metacyclic forms of Trvpanosoma brucei. Proc. Natl. Acad. Sci. USA 83, 6063-6064. 19 Van der Ploeg, k.H.T., Schwartz, D.C., Cantor, C.R. and Borst, P. (1984) Antigenic variation in Trvpanosoma brucei analysed by clectrophoretic separation of chromosome-sized DNA molecules. Cell 37, 77-84. 20 Southern, E. (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98,503-517. 21 Pays, E., Delronche, M., Lheureux, M., Vervoort, T., Bloch, J., Gannon, F. and Steinert, M. (1980) Cloning and characterization of DNA sequences complementary to messenger ribonucleic acids coding for the synthesis of two surface antigens of Trypanosorna brucei. Nucleic Acids Res. 8, 5965-5981. 22 Sanger, F., Nicklen, S. and Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463-5467. 23 Paindavoine, P., Zampetti-Bosseler, F., Pays, E., Schweizer, J., Guyaux, M., Jenni, L. and Steinert, M. (1986) Trypanosome hybrids generated in tsetse flies by nuclear fusion. EMBO J. 5, 3631-3636. 24 Murphy, N.B.. Guyaux, M., Pays, E. and Steinert, M. (1987) Analysis of VSG expression site sequences in T. brucei. In: Proceedings UCLA Symposium on Molecular Strategies of Parasitic Invasion (Agabian, N., Goodman, H. and Nogueira, N., eds.), pp. 449-469, A.R. Liss Inc., New York. 25 Murphy, N.B., Pays, A., Tebabi, P., Coquelet, H., Guyaux, M., Steinert, M. and Pays, E. (19871 A Trypanosoma brucei repeated element with unusual structural and transcriptional properties. J. Mol. Biol. 195, 855-871. 26 Kimmel, B.E., Ole-Moiyoi, O.K. and Young, J.R. (1987) Ingi, a 5.2-kb dispersed sequence element from Trypano.soma brucei that carries half of a smaller mobile element at either end and has homology with mammalian LINES. Mol. Cell. Biol. 7, 1465-1475. 27 Aline Jr., R., MacDonald, G., Brown, E., Allison, J., Myler, P., Rothwell, V. and Stuart, K. (1985) (TAA)n within sequences flanking several intrachromosomal variant surface glycoprotein genes in Tr~,panosorna brucei. Nucleic Acids Res. 13, 3161-3177. 28 Matthyssens, G., Michiels, F., Hamers, R., Pays, E, and Steinert. M. (1981) Two variant surface glycoproteins of

256

29

30

31

32 33

Trypanosoma brucei have a conserved C-terminus. Nature 293,230-233. Borst, P., Van der Ploeg, L.H.T., Van Hoek, J.F.M., Tas, J. and James, J. (1982) On the DNA content and ploidy of trypanosomes. Mol. Biochem. Parasitol. 6, 13-23. Pays, E., Dekerck, P., Van Assel, S., Eldirdiri, A.B., Le Ray, D., Van Meirvenne. N. and Steinert, M. (1983) Comparative analysis of a Trypanosoma brucei gambiense antigen gene family and its potential use in epidemiology of sleeping sickness. Mol. Biochcm. Parasitol. 7.63-74. Gibson, W.C. and Borst, P. (1986) Size-fractionation of the small chromosome of Trypanozoon and Nannomonas trypanosomes by pulsed field gradient gel electrophoresis. Mol. Biochem. Parasitol. 18, 127-140. Pays, E. (1985) Gene Conversion in trypanosome antigenic variation. Progr. NARMB 32, 1 26. Williams, R.O., Young, J.R. and Majiwa. P.A.O. (1982) Genomic environment of T. brucei VSG genes: presence of a minichromosome. Nature 299,417-421.

34 Guyaux, M., Cornelissen, A.W.C.A., Pays, E., Steinert, M. and Borst, P. (1985) Trypanosoma brucei: a surface antigen mRNA is discontinuously transcribed from two distinct chromosomes. EMBO J. 4,995-998. 35 Cully, D.F., Ip, H.S. and Cross, G.A.M. (1985) Coordinate lranscription of variant surface glycoprotein genes and an expression site associated gene family in Trypanosorna brucei. Cell 42, ,173-182. 36 Pays, E., Houard, S., Pays, A., Van Assel, S., Dupont, F., Aerts, D., Huet-Duvillier, G., Gomes, V., Richet, C., Degand, P., Van Meirvenn¢. N. and Steinert, M. (1985) Trypanosoma brucei: the extent ,of conversion in antigen genes may be related to the DNA coding specificity. Cell 42, 821-829. 37 Pays, E., Lheureux, M. and Steinert, M. (1952) Structure and expression of a Trypanosoma brucei gamb,;ense variant specific antigen gene. Nucleic Acids Reds. 10, 3149-3163.