The high-fat high-fructose hamster as an animal model for niacin’s biological activities in humans

M ET AB O LI S M CL I NI CA L A N D EX PE R IM EN T AL 6 2 (2 0 1 3) 1 84 0–1 84 9

Available online at www.sciencedirect.com

Metabolism www.metabolismjournal.com

Methods

The high-fat high-fructose hamster as an animal model for niacin’s biological activities in humans Beth A. Connolly a, b, 1 , Daniel P. O’Connell a, b, 1 , Stefania Lamon-Fava c , Daniel F. LeBlanc a, b , Yu-Lin Kuang c , Ernst J. Schaefer c , Andrew L. Coppage a , Claude R. Benedict b , Christopher P. Kiritsy b , William W. Bachovchin a, b,⁎ a b c

Tufts University Sackler School of Graduate Biomedical Sciences, Department of Biochemistry, Boston, MA, USA Arisaph Pharmaceuticals, Boston, MA, USA Lipid Metabolism Laboratory, Jean Mayer USDA Human Nutrition Research Center on Aging at Tufts University, Boston, MA, USA

A R T I C LE I N FO Article history:

AB S T R A C T Objective. Niacin has been used for more than 50 years to treat dyslipidemia, yet the

Received 17 January 2013

mechanisms underlying its lipid-modifying effects remain unknown, a situation stemming

Accepted 3 August 2013

at least in part from a lack of validated animal models. The objective of this study was to determine if the dyslipidemic hamster could serve as such a model.

Keywords:

Materials/Methods. Dyslipidemia was induced in Golden Syrian hamsters by feeding them a

Lipid metabolism

high-fat, high-cholesterol, and high-fructose (HF/HF) diet. The effect of high-dose niacin

HDL-C

treatment for 18 days and 28 days on plasma lipid levels and gene expression was measured.

LDL-C TG

Results. Niacin treatment produced significant decreases in plasma total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), triglycerides (TG), and free fatty acids (FFA), but had no measureable effect on high-density lipoprotein cholesterol (HDL-C) in the dyslipidemic hamster. Niacin treatment also produced significant increases in hepatic adenosine ATP-Binding Cassette A1 (ABCA1) mRNA, ABCA1 protein, apolipoprotein A-I (Apo A-I) mRNA, and adipose adiponectin mRNA in these animals. Conclusions. With the exception of HDL-C, the lipid effects of niacin treatment in the dyslipidemic hamster closely parallel those observed in humans. Moreover, the effects of niacin treatment on gene expression of hepatic proteins related to HDL metabolism are similar to those observed in human cells in culture. The HF/HF-fed hamster could therefore

Abbreviations: TC, total cholesterol; HDL, high-density lipoprotein; LDL, low-density lipoprotein; VLDL, very low-density lipoprotein; TG, triglycerides; FFA, free fatty acids; ABCA1, adenosine ATP-Binding Cassette A1; Apo A-I, apolipoprotein A-I; HATS, HDLAtherosclerosis Treatment Study; FATS, Familial Atherosclerosis Treatment Study; CLAS, The Cholesterol-Lowering Atherosclerosis Study; ARBITER, Arterial Biology for the Investigation of Treatment Effects of Reducing Cholesterol; HPS2-THRIVE, Heart Protection Study 2-Treatment of HDL to Reduce the Incidence of Vascular Events; AIM-HIGH, Atherothrombosis Intervention in Metabolic Syndrome with Low HDL/High Triglycerides: Impact on Global Health Outcomes; HF/HF, high-fat, high-cholesterol, and high-fructose; NC, normal chow; GS, Golden Syrian; DGAT2, diacylglycerol acyltransferase 2; CETP, cholesteryl ester transfer protein; apoE, apolipoprotein E; LDLr, lowdensity lipoprotein receptor; ApoB48, apolipoprotein B48; LXRα, liver x receptor-alpha; SR-B1, scavenger receptor class B member 1. ⁎ Corresponding author. Tufts University Sackler School of Graduate Biomedical Sciences, Department of Biochemistry, 136 Harrison Avenue, Boston, MA 02111. Tel.: +1 617 636 6881; fax: 617 636 2409. E-mail address: [email protected] (W.W. Bachovchin). 1 These authors equally contributed to this work.

0026-0495/$ – see front matter © 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.metabol.2013.08.001

M E TAB O LI S M CL I NI CA L A N D EX P ER IM EN T AL 6 2 (2 0 1 3) 1 84 0 –1 8 49

1841

serve as an animal model for niacin’s lowering of proatherogenic lipids and mechanisms of action relative to lipid metabolism. © 2013 Elsevier Inc. All rights reserved.

1.

Introduction

Niacin (nicotinic acid) is a broad-spectrum drug that has been used for decades to significantly lower proatherogenic triglycerides (TGs) and low-density lipoprotein cholesterol (LDLC) [1] and to raise levels of the cardioprotective high-density lipoprotein cholesterol (HDL-C) [2]. Several outcome trials have demonstrated that niacin treatment, either alone or in combination with other lipid-lowering drugs, reduces cardiovascular endpoints and improves total mortality [3–9]. However, two recent trials studying the use of niacin in patients with well-controlled LDL-C, AIM-HIGH and HPS2-THRIVE, failed to show any clinical benefit of niacin over background statin therapy [10,11]. Both studies have been criticized as being flawed, and therefore do not necessarily overturn conventional dogma and 50 years of niacin outcome trials [11,12]. Due to the discrepancies and questions around niacin’s clinical efficacy, it is becoming increasingly important to understand the mechanisms of niacin’s lipid-lowering and anti-atherogenic properties. Notwithstanding niacin’s long history of clinical use and well-established effects on lipids, its mechanism of action to improve the lipid profile is not well understood. GPR109a, a G-protein coupled receptor expressed in several cell types, including adipocytes and macrophages, was initially identified as the receptor for niacin [13–15]. Niacin’s agonism of this receptor in adipose tissue results in inhibition of lipolysis and a reduction in plasma free fatty acid (FFA) levels and it is suggested that this antilipolytic activity mediates the lipid-lowering effects of niacin [14]. However, the inability of GPR109a partial and full agonists to lower TG and LDL-C and to raise HDL-C in both preclinical models and Phase II clinical trials, despite profound lowering of FFAs, strongly suggests that niacin’s beneficial effects on plasma lipids are not through its agonism of GPR109a [16–18]. Because niacin has a relatively modest effect on LDL-C lowering (7%–20%) [19,20], it has been widely assumed that much of its clinical benefit comes from its ability to raise HDL-C. How niacin raises HDL-C and improves HDL particle functionality also remains largely unknown. Possible mechanisms include increasing hepatic secretion of apolipoprotein A-I (Apo A-I), the major protein of HDL, inhibition of Apo A-I uptake by the liver, and upregulation of hepatic and macrophage ATPBinding Cassette (ABC) A1 [21–24]. Niacin also has anti-inflammatory effects independent of its lipid-modifying abilities [25,26]. Indeed, niacin has been shown to dose-dependently increase gene expression of the anti-inflammatory adiponectin in 3T3-L1 adipocytes [27] and serum levels of adiponectin in patients with cardiovascular disease [28–30]. Much of the reason niacin’s mechanisms of action remain inscrutable is the lack of validated animal models in which its effects can be systemically studied. Preclinical rodent models of dyslipidemia have their limitations and often drugs that display

hypolipidemic properties in the clinic do not show similar efficacy in these animal models [31]. Indeed, niacin treatment failed to display significant changes in the lipid profiles of classical rodent models of hyperlipidemia, such as the apolipoprotein E (ApoE)-deficient mouse and the cholesterol-fed rat [31,32]. The disadvantage of several of these rodent models stems from the absence of proteins critical to human lipoprotein metabolism such as cholesteryl ester transfer protein (CETP), ApoE, and the LDL receptor (LDLr). Niacin treatment did improve the lipid profile in transgenic mouse models [18,33]; however, it may be more feasible to test niacin efficacy and mechanisms in an animal model that is more human-like relative to lipid metabolism without genetic manipulation. Due to the presence of plasma CETP and lack of ApoB48 expression and secretion by the liver, the lipoprotein metabolism of the Golden Syrian (GS) hamster more closely resembles that of humans than other rodents [34]. When the GS hamster is fed a Western-type diet, an increase in total plasma cholesterol, TGs, and FFA is observed, similar to the dyslipidemia observed in humans [35,36]. The objective of the present study was to determine if niacin treatment in the high-fat, high-cholesterol, high-fructose fed hamster parallels the lipid-lowering effects seen in humans and if it can serve as a validated model for studying niacin’s mechanisms with respect to lipoprotein metabolism and inflammation.

2.

Methods

2.1.

Diet induction study

All animal procedures were performed in conformity with the Public Health Service Policy on Humane Care and Use of Laboratory Animals and approved by the Institutional Animal Care and Use Committee of Tufts University. Male Golden Syrian (GS) hamsters (111–120 g) were purchased from Charles River Laboratories (Wilmington, MA). Upon arrival, they were housed in solid-bottom cages with contact bedding of 4 animals each and allowed to acclimate to environment for 4 days. Hamsters were then fed a combination of either normal chow with water (NC), high-fat chow with water (HF), or high-fat chow with high-fructose water (HF/HF). Normal chow was PMI Rodent 5001 from Harlan (Madison, WI). Highfat chow was normal chow supplemented with 11.5% corn oil, 11.5% coconut oil, 0.5% cholesterol, and 0.25% deoxycholate (Dyets, #611288). Fructose water was a 10% fructose solution and was replaced weekly or earlier if needed. All animals were fed their respective diets and water sources ad libitum. Three animals from each cohort were sacrificed after 0, 7, 14, or 21 days of diet feeding by carbon dioxide asphyxiation followed by cardiac puncture. Blood was collected into K3EDTA tubes, centrifuged (10,000 rpm for 15 min), and the resulting plasma was collected and stored at − 80 °C until use.

1842 2.2.

M ET AB O LI S M CL I NI CA L A N D EX PE R IM EN T AL 6 2 (2 0 1 3) 1 84 0–1 84 9

Niacin treatment studies

Male GS hamsters were housed either individually (experiment 1) or in groups of five (experiment 2) in solid-bottom cages with contact bedding. Upon arrival, all animals were fed the HF/HF diet for 19 days (experiment 1) or 14 days (experiment 2) before niacin dosing, and remained on the diet throughout the duration of each study. Before treatment with niacin was started, the animals were matched by weight (n = 9–10 per group). Hamsters were treated orally either with niacin (900 mg/kg/bid) or with vehicle (H2O). On the last day of niacin treatment (18 days for experiment 1 and 28 days for experiment 2), the niacin-treated animals (n = 9 for experiment 1, n = 10 for experiment 2) were dosed once with 900 mg/kg of niacin. All animals were fasted for 4 h, then euthanized under CO2 and bled via cardiac puncture to withdraw blood in Vacutainer® tubes containing K3EDTA. Blood samples were centrifuged (10,000 rpm, 15 min) and plasma was collected and stored at − 80 °C until further analysis. Liver tissues were collected, immediately frozen in liquid nitrogen, and stored at − 80 °C until further analysis. Adipose tissue for the adiponectin mRNA measurements was collected and stored in the same manner from a separate dosing experiment in which hamsters were fed the HF/HF diet for 14 days before dosing with either vehicle (H2O, n = 11) or niacin (1200 mg/kg/qd, n = 9) for 18 days.

2.3.

Table 1 – Gene name, sequence, and amplicon length of primers used in real time RT-PCR. Gene

Sequence

Amplicon

ABCA1 Forward Reverse

TTGGATGGATTATATTGGACTGC TGGTCTCATTGAAAGCTTCTCTC

118

Adiponectin Forward Reverse

AGAAGTCGTGATCCCTCCACC GGGACCAAGAAGACCTGCATC

154

Apo A-I Forward Reverse

CTGTGCTCTTCCTGACCGGA GTGGCGAAATCCTTCACTCTG

91

SR-B1 Forward Reverse

AGGAGCATTCCTTGTTCCTAGAC CAGGACTACTGGCTCGATCTTC

137

LXRα Forward Reverse

GTCCACAAAAGCGGAAAAAG CTCGCAGCTCAGAACAATGTA

110

β-Actin Forward Reverse

GTCATCACCATTGGCAACGA GCCACAGGATTCCATACCCA

81

master mix on RT PCR 7300 (Applied Biosystems, Foster City, CA). β-Actin was used as the housekeeping gene. mRNA-fold change was calculated using the ΔΔCT method.

Lipid and lipoprotein analysis 2.5.

Western blot analysis

Plasma total cholesterol (TC), LDL-C, TG, FFA, and HDL-C levels were measured using kits from Wako USA (Richmond, VA). Plasma from hamsters fed normal chow was used undiluted, while plasma from HF and HF/HF hamsters was diluted with normal saline to fit values within standard curves. Absorbance was read on a spectrophotometric plate reader and compared to standards supplied from Wako USA. Fast performance liquid chromatography (FPLC) data were generated according to standard techniques [37]. Briefly, 250 μL diluted plasma pooled from each group of animals was loaded onto a Superose 6 10/ 300GL column (GE Life Sciences, Uppsala, Sweden) on an ÄKTA System (Amersham Pharmacia Biotech, Piscataway, NJ), and eluted with buffer (50 mmol/L phosphate buffered saline, containing 0.1 mol/L NaCl, 0.02% NaN3, and 0.001 mol/L EDTA, pH 7.4) at a flow rate of 0.5 mL/min. The aliquots were collected onto a 96-well plate at a size of 240 μL per well. Cholesterol was then measured using the Wako USA Cholesterol-E kit with the following modifications: 60 μL of kit buffer was added to wells containing 30 μL of sample.

Liver tissues (~300 mg) from HF/HF-fed hamsters treated with either vehicle or niacin for 18 days (experiment 1) were homogenized in 1.5 mL HEPES buffer (25 mmol/L HEPES, 300 mmol/L NaCl, 1.5 mmol/L MgCl2, 1 mmol/L EDTA, 0.5% Triton X-100, and 10% glycerol) containing phosphatase and protease inhibitors. Protein was extracted by vigorous shaking of homogenates at 4 °C for 30 min. Samples were centrifuged for 15 min at 4 °C at 10,000 rpm and supernatant was collected for use for western blotting. Protein concentrations were determined by Pierce BCA Protein Assay Kit (Thermo Scientific). Liver lysates (50 μg) were separated on a 7.5% polyacrylamide gel containing SDS and transferred to a nitrocellulose membrane. Standard western blot analysis was performed using the primary antibodies rabbit polyclonal anti-ABCA1 (Thermo Scientific) and mouse monoclonal anti-β-actin (Abcam). Signals were quantitated by scanning with the BioRad GS-710 Imaging Densitometer and analyzing with Quantity One Software.

2.4.

2.6.

Gene expression studies

Hepatic RNA was extracted using the RNeasy Mini Kit and adipose RNA was extracted using the RNeasy Lipid Tissue Mini Kit and Qiazol® lysis reagent (Qiagen, Valencia, CA). cDNA was synthesized from RNA using SuperScript™III RT according to the manufacturer’s protocol (Invitrogen, Carlsbad, CA). Primers were designed using Primer Express version 2.0 (Applied Biosystems, Foster City, CA) and are listed in Table 1. cDNA levels for the genes of interest were measured by real-time polymerase chain reaction (PCR) using power SYBR green

Statistical analysis

All data were analyzed using GraphPad Prism® software and are presented as mean ± SD. Results from the diet induction study were assessed using a one-way ANOVA, followed by Dunnett’s multiple comparison test, using day 0 as the control group. Statistical differences between vehicleand niacin-treated hamster lipids, mRNA levels, and protein levels (experiments 1 and 2) were assessed using the Mann–Whitney U test. A P value of < 0.05 was considered statistically significant.

M E TAB O LI S M CL I NI CA L A N D EX P ER IM EN T AL 6 2 (2 0 1 3) 1 84 0 –1 8 49

3.

Results

3.1. HF/HF Diet induces hyperlipidemia in Golden Syrian hamsters Hamsters were fed either a normal chow diet with water (NC), or a high fat diet with either water (HF) or water supplemented with 10% fructose (HF/HF) and were sacrificed on days 0, 7, 14, or 21 for lipid analysis. As shown in Fig. 1A–D, TC, LDL-C, TG, and FFA levels were increased by both the HF and the HF/HF diets in a time-dependent manner and steady state levels were achieved by day 14 for all parameters. After 14 days on the HF diet, relative to day 0, TC increased by 412% (623± 197 mg/dL versus 122 ± 17 mg/dL; P < 0.01), LDL-C by 602% (322 ± 131 mg/dL versus 46 ± 6 mg/dL; P < 0.01), TG by 382% (1066 ± 320 mg/dL versus 221 ± 61 mg/dL; P < 0.01), and FFA by 230% (2.40 ± 0.21 mEq/L versus 0.72 ± 0.06 mEq/L; P < 0.001). In a similar manner, on the HF/HF diet (Fig. 1A–D), TC increased by 369% (738 ± 121 mg/dL versus 157 ± 46 mg/ dL; P < 0.001), LDL-C by 664% (372 ± 147 mg/dL versus 49± 6.7 mg/dL; P < 0.01), TG by 636% (1453 ± 1032 mg/dL versus 197 ± 54 mg/dL; NS), and FFA by 591% (2.61 ± 1.39 mEq/L versus 0.38 ± 0.04 mEq/L; P < 0.01). After 14 days, HDL-C did not change significantly in response to HF or HF/HF feedings (HF, 110 ± 29 mg/dL versus 64 ± 12 mg/dL; HF/HF, 103±16 mg/dL versus 81 ± 13 mg/dL, Fig. 1E). However, after 21 days on the HF

1843

diet, HDL-C was significantly increased relative to day 0 (129± 16 mg/dL versus 64 ± 12 mg/dL, P < 0.05). FPLC tracings of plasma collected after 14 days on the diets showed a marked difference in non-HDL populations in response to HF or HF/ HF feedings, relative to the NC group (Fig. 1F). While the VLDL and LDL populations were slightly increased in the HF/HF group compared to the HF cohort, the difference between these groups was marginal and dwarfed by the differences when compared to NC-fed animals. The HDL populations of all three diet cohorts overlapped, consistent with the lack of significant differences in HDL-C levels between these groups. Because steady state was reached after two weeks on the HF/HF diet, subsequent experiments utilized animals that were first fed HF/HF for at least 14 days before any intervention.

3.2. Niacin reduces proatherogenic plasma lipids in HF/ HF-fed Golden Syrian hamsters In experiment 1, treatment of HF/HF-fed GS hamsters with niacin (900 mg/kg/bid) for 18 days significantly reduced plasma levels of TC, LDL-C, TG, and FFA when compared to vehicle-treated animals (Fig. 2A–D). TC was reduced by 42% (420 ± 53 mg/dL versus 727 ± 205 mg/dL; P < 0.001), LDL-C by 30% (244 ± 64 mg/dL versus 457 ± 120 mg/dL; P < 0.001), TG by 55% (297 ± 112 mg/dL versus 656 ± 336 mg/dL; P < 0.001), and FFA levels were reduced by 43% (0.66 ± 0.06 mEq/L versus

Fig. 1 – Lipid profiles in response to diet over time (A–E). Hamsters were sacrificed after the indicated number of days on the indicated diet. Data are compared to day 0 data within the same treatment arm. FPLC plasma is pooled from animals in the treatment group (F). Values are mean ± SD. (n = 3 per group). *P < 0.05, **P < 0.01, ***P < 0.001.

1844

M ET AB O LI S M CL I NI CA L A N D EX PE R IM EN T AL 6 2 (2 0 1 3) 1 84 0–1 84 9

Fig. 2 – Effect of 18-day niacin treatment (experiment 1) on plasma lipid levels. HF/HF-fed GS hamsters were treated with 900 mg/kg/b.i.d. niacin (n = 9) P.O. for 18 days. Plasma TC (A), LDL-C (B), TG (C), FFA (D), and HDL-C (E) levels were measured. Data are compared to vehicle-treated hamsters (n = 10). FPLC plasma is pooled from animals in each of the treatment groups (F). Values are mean ± SD. *P < 0.05, **P < 0.01, ***P < 0.001.

1.16 ± 0.34 /L; P < 0.001). HDL-C levels were not significantly different between the two groups (Fig. 2E). FPLC analysis demonstrated that the 42% reduction in TC was limited to the proatherogenic lipoproteins VLDL-C and LDL-C, whereas HDLC levels were unchanged (Figs. 2F). In experiment 2 (Fig. 3), dosing with niacin (900 mg/kg/bid) for 28 days showed similar efficacy as the 18-day dosing experiment relative to TC (− 42%, 364 ± 95 mg/dL versus 624 ± 150 mg/dL; P < 0.01), LDL-C (− 44%, 203 ± 66 mg/dL versus 360 ± 92 mg/dL; P < 0.001), TG (− 47%, 482 ± 195 mg/dL versus 910 ± 326 mg/ dL; P < 0.01), and FFA (− 34%, 0.55 ± 0.17 mEq/L versus 0.83 ± 0.29 mEq/L; P < 0.05), when compared to vehicletreated hamsters. Similar to experiment 1, FPLC fractionation demonstrated that the reduction in TC levels in experiment 2 resulted from the lowering of plasma VLDL-C and LDL-C concentrations (Fig. 3F).

3.3. Niacin treatment increases hepatic ABCA1 mRNA and protein expression and adipose adiponectin mRNA One objective of this work was to determine if the HF/HF fed GS hamster would serve as a valid model for determining the mechanisms of niacin’s action relative to lipoprotein metabolism. We therefore evaluated the effect of niacin treatment on expression of genes related to HDL metabolism and adipocyte function (Fig. 4). Despite the absence of an absolute increase in plasma HDL-C levels, hepatic ABCA1 mRNA and protein levels were significantly increased in the niacin-treated hamsters, when compared to vehicle-treated (Fig. 4A, + 73%, P < 0.001 and Fig. 4C, 42%, P < 0.01, respectively), in the 18-day dosing experiment. The significant increase in ABCA1 mRNA

was also observed when the dosing was extended to 28 days (Fig. 4B, + 58%, P < 0.001). A smaller, but statistically significant, increase in Apo A-I mRNA (+27%, P < 0.01) was observed in the niacin-treated hamsters compared to vehicle-treated in the 18 day dosing study (Fig. 4A), but this effect was not observed when the dosing was extended to 28 days (Fig. 4B). No effect on the hepatic expression of LXRα, a transcription factor regulating the expression of ABCA1, was observed with niacin treatment (Fig. 4A and B). Similarly, niacin did not change the expression of SR-B1, a receptor involved in the selective uptake of cholesterol from HDL (Fig. 4A and B). To determine if niacin exerts the same increase on adiponectin mRNA in our hamster model, we measured adiponectin mRNA levels in adipose tissue collected from a separate dosing experiment, in which the hamsters were administered 1200 mg/kg niacin for 18 days. Indeed, adipose adiponectin mRNA levels were significantly increased in the niacin-treated hamsters when compared to vehicle-treated hamsters (Fig. 5, +67%, P < 0.01). Adipose adiponectin mRNA levels were not measured in the experiments in which the hamsters were dosed 900 mg/kg b.i.d and therefore were not reported.

4.

Discussion

The objective of this study was to determine if the HF/HF-fed Golden Syrian hamster would serve as a valid model to study the effects of niacin on lipid metabolism. Our data indicate that an HF/HF diet induces a dyslipidemic profile in the Golden Syrian hamster. These rodents respond to two weeks on the HF/HF diet with significant elevations in plasma TC,

M E TAB O LI S M CL I NI CA L A N D EX P ER IM EN T AL 6 2 (2 0 1 3) 1 84 0 –1 8 49

1845

Fig. 3 – Effect of 28-day niacin treatment (experiment 2) on plasma lipid levels. HF/HF-fed GS hamsters were treated with 900 mg/kg/b.i.d. niacin (n = 10) P.O. for 28 days. Plasma TC (A), LDL-C (B), TG (C), FFA (D), and HDL-C (E) levels were measured. Data are compared to vehicle-treated hamsters (n = 10). FPLC plasma is pooled from animals in each of the treatment groups (F). Values are mean ± SD. *P < 0.05, **P < 0.01, ***P < 0.001.

LDL-C, TG, and FFA levels. In humans, a diet high in saturated fat and sugar also causes elevation in these plasma lipids [38,39]. While other high-fat diets have been shown to raise total cholesterol and, in particular, the LDL-C population [40], the high-fructose component of this diet was a useful means by which to model the high-sugar intake of what is now deemed the “Western diet.” Triglycerides were elevated by both the HF and HF/HF diets, but were 50% greater in HF/HF-fed hamsters than HF-fed hamsters. Although humans distribute their cholesterol populations predominantly in LDL, elevated triglycerides are also an independent risk factor for heart disease [41], making this rodent model an enticing means to study the effects of niacin. We observed marked reductions in TC, as well as LDL-C, in our hamster model in response to niacin treatment. Additionally, the greatest reductions were observed in FFA and TG levels. The directional changes are consistent with those observed for various lipid parameters in humans as measured in several different trials: TC (CDP, ARBITER-6, ADMIT); LDL (HATS, ARBITER-6, FATS); and TG (CDP, HATS, ARBITER-2, ARBITER-6, ADMIT) [3,4,6,8,9]. Moreover, with the exception of the HATS trial which included simvastatin, all of the other trials have demonstrated that the largest magnitude of the effect of niacin is in reduction of the TG population. This closely parallels the results in our hamster model, giving further strength to its validity as a model of human response to niacin. Niacin therapy in humans dose-dependently raises HDL-C levels by 15%–40% [42] however, HDL-C levels did not change significantly in our hamster model. While this result was

surprising, it should be noted that in general, rodents are predominantly HDL animals, suggesting that it may be difficult to push relatively high concentrations of HDL-C even higher with pharmacological therapy. Indeed, a study of fenofibrate administration to hamsters has demonstrated a paradoxical 41% decrease in HDL-C [43], whereas humans benefit from a 10% increase [44]. Moreover, our results do not preclude the idea that these hamsters continued to receive cardioprotective benefit from HDL. We examined the effects of niacin treatment on hepatic genes related to HDL metabolism and demonstrated that both hepatic Apo A-I and ABCA1 transcripts were increased by treatment with niacin. These two genes are key players in the formation of HDL, and their upregulation is associated with increases in HDL-C and HDL particle functionality [45,46]. The increase in ABCA1 mRNA was associated with an increase in ABCA1 protein concentration in liver homogenates in response to niacin treatment. A significant increase in ABCA1 expression has been reported in both macrophages and HepG2 cells treated with niacin in vitro [22,47]. In addition, recent work in cultured HepG2 cells suggests that niacin exposure increases Apo A-I secretion and lipidation via the LXRα-ABCA1 pathway [47]. In the ApoE*3Leiden.CETP mouse model, niacin treatment increased HDL–Apo A-I by decreasing the clearance of Apo A-I from plasma [33]. Consistent with this, one study in humans has indicated that niacin treatment increases HDL particle number with a proportional increase in cholesterol efflux [48], while a second study has suggested that niacin raises HDL-C by increasing the production of Apo A-I [23].

1846

M ET AB O LI S M CL I NI CA L A N D EX PE R IM EN T AL 6 2 (2 0 1 3) 1 84 0–1 84 9

Fig. 4 – Effect of niacin treatment on hepatic ABCA, Apo A-I, LXRα, and SR-B1 mRNA expression and hepatic ABCA1 protein expression. Hamsters on a HF/HF diet were treated with 900 mg/kg/bid for 18 (A) or 28 (B) days. Representative immunoblot analysis of liver lysates (n = 3/group) from HF/HF-fed hamsters dosed with 900 mg/kg/bid for 18 days (C). Right panel is densitometric quantitation of all vehicle-treated (n = 10) and niacin-treated (n = 9) hamsters from experiment 1. All data are compared to vehicle-treated hamsters for each experiment. Values are mean ± SD. *P < 0.05, **P < 0.01, ***P < 0.001.

The observations of regulation of hepatic Apo A-I and ABCA1 by niacin in our hamster model fit nicely with these previous studies, despite no absolute increases in HDL-C. Finally, adiponectin was increased in hamsters dosed with niacin compared to placebo. This corroborates nicely with data in man suggesting that niacin treatment in metabolic syndrome raises this anti-inflammatory adipokine [49]. Since adiponectin levels are associated with inflammatory diseases such as metabolic syndrome [50], this demonstration in HF/HF hamsters suggests a valid animal model by which to study another cardioprotective component of niacin. The history of niacin is long, yet its mechanism of action remains unclear. Activation of the niacin receptor, GPR109a, was initially thought to be responsible for niacin’s effects on lipids. In the adipose tissue, GPR109a agonism by niacin causes a signaling cascade which reduces intracellular cAMP levels and inhibits lipolysis, resulting in a decreased release of FFA into the circulation [14]. It has been hypothesized that this dramatic reduction in plasma FFA results in decreased secretion of VLDL, as the liver has less available substrate for triglyceride

synthesis [51]. However, the mechanism behind the effects of niacin on lipids may not be entirely mediated by GPR109a [18]. Experiments conducted in vitro have suggested that niacin inhibits the activity of DGAT2, the enzyme involved in TG synthesis in liver cells [52]. Kinetic studies conducted in dyslipidemic subjects have demonstrated that increased clearance of VLDL and chylomicrons may also play a role in the niacin-related reduction in TG levels [23]. As further evidence against GPR109a agonism as the mechanism of niacin’s lipidmodifying effects, clinical studies have shown that the therapeutic dose of niacin is at least 2 g per day [53], while the ED50 for niacin at GPR109a is approximately 80–250 nmol/L [54]. This disparity, in addition to the failure of two GPR109a agonists to elicit lipid changes in Phase II clinical studies, despite significant reductions in FFA [16–18], indicates niacin mediates its lipid effects through mechanisms independent of GPR109a agonism, although this mechanism remains unknown. Recently, AIM-HIGH failed to demonstrate niacin’s ability to reduce adverse cardiac events, despite raising HDL [10]. Importantly, with respect to the borderline significant increase

M E TAB O LI S M CL I NI CA L A N D EX P ER IM EN T AL 6 2 (2 0 1 3) 1 84 0 –1 8 49

1847

Yu-Lin Kuang: Study design, data collection and analysis, data interpretation. Ernst Schaefer: Study design, data interpretation. Andrew Coppage: Data collection and analysis. Claude Benedict: Study design, data interpretation. Chris Kiritsy: Study design, data interpretation. William Bachovchin: Study design, data interpretation, manuscript writing.

Funding Fig. 5 – Effect of niacin treatment on adipose adiponectin mRNA expression. Hamsters on a HF/HF diet were treated with 1200 mg/kg/qd for 18 days and adipose adiponectin mRNA levels were measured. Data are compared to vehicletreated hamsters. Values are mean ± SD. **P < 0.01.

in ischemic stroke, Giugliano has noted that no prior study or meta-analysis has observed similar results in over 50 years of niacin use [55]. Considerable criticism has been lobbied at the study since its results were announced in late 2011, and many in the field had turned their attention to HPS2-THRIVE [12]. However, Merck recently announced that HPS2-THRIVE did not meet its primary endpoint, in that the combination of niacin and its anti-flushing molecule, laropiprant, did not reduce cardiovascular events over statin therapy alone [11]. Although the detailed results have not yet been revealed, the design is already being questioned in that patients with low HDL-C (<40 mg/dL), who would most likely confer the most benefit from niacin treatment, were not preselected for the study [11]. Despite the recent controversy, niacin therapy has repeatedly shown to increase HDL-C while simultaneously lowering effectively all the other cholesterol populations, driving the entire lipid profile toward lowered risk. Weaknesses in this present study include the inability of niacin treatment to raise HDL-C levels in the HF/HF-fed GS hamster model similar to what is observed in the clinic. However, niacin’s ability to lower plasma levels of proatherogenic LDL-C and TG and increase hepatic ABCA1 gene expression and protein levels and adipose adiponectin levels in this model corroborates well with clinical and in vitro data and strongly suggests it can serve as a validated model for studying the mechanism of niacin’s effects relative to lipid metabolism. Mechanisms of niacin action will continue to invite investigation, and if transcript upregulation in humans correlates with that in hamsters, this rodent model may prove to be the most accurate mechanistic model in which to study niacin.

Author Contributions Beth Connolly: Study design, data collection and analysis, data interpretation, manuscript writing. Daniel O’Connell: Study design, data collection and analysis, data interpretation, manuscript writing. Stefania Lamon-Fava: Study design, data collection and analysis, data interpretation, manuscript writing. Daniel LeBlanc: Data collection and analysis.

This work was supported by Arisaph Pharmaceuticals. Additional support was provided by the USDA Department of Agriculture Research Service Contract 53-3K-06 (EJS and SL-F).

Conflict of interest Dr. Beth Connolly, Dr. Daniel O’Connell, Daniel LeBlanc, Dr. Claude Benedict, Christopher Kiritsy, and Dr. William Bachovchin have significant financial interest in Arisaph Pharmaceuticals. Dr. Ernst Schaefer and Dr. Stefania Lamon-Fava serve as consultants for Arisaph Pharmaceuticals.

REFERENCES

[1] Kamanna VS, Kashyap ML. Mechanism of action of niacin on lipoprotein metabolism. Curr Atheroscler Rep 2000;2(1): 36–46. [2] Nicholls SJ, Rye KA, Barter PJ. High-density lipoproteins as therapeutic targets. Curr Opin Lipidol 2005;16(3):345–9. [3] Berge KG, Canner PL. Coronary drug project: experience with niacin. Coronary Drug Project Research Group. Eur J Clin Pharmacol 1991;40(Suppl. 1):S49–51. [4] Brown BG, Zhao XQ, Chait A, et al. Simvastatin and niacin, antioxidant vitamins, or the combination for the prevention of coronary disease. N Engl J Med 2001;345(22):1583–92. [5] Brown BG, Hillger L, Zhao XQ, et al. Types of change in coronary stenosis severity and their relative importance in overall progression and regression of coronary disease. Observations from the FATS Trial. Familial Atherosclerosis Treatment Study. Ann N Y Acad Sci 1995;748:407–17. discussion 417–408. [6] Elam MB, Hunninghake DB, Davis KB, et al. Effect of niacin on lipid and lipoprotein levels and glycemic control in patients with diabetes and peripheral arterial disease: the ADMIT study: a randomized trial. Arterial Disease Multiple Intervention Trial. JAMA 2000;284(10):1263–70. [7] Blankenhorn DH, Nessim SA, Johnson RL, et al. Beneficial effects of combined colestipol–niacin therapy on coronary atherosclerosis and coronary venous bypass grafts. JAMA 1987;257(23):3233–40. [8] Taylor AJ, Sullenberger LE, Lee HJ, et al. Arterial Biology for the Investigation of the Treatment Effects of Reducing Cholesterol (ARBITER) 2: a double-blind, placebo-controlled study of extended-release niacin on atherosclerosis progression in secondary prevention patients treated with statins. Circulation 2004;110(23):3512–7. [9] Villines TC, Stanek EJ, Devine PJ, et al. The ARBITER 6-HALTS Trial (Arterial Biology for the Investigation of the Treatment Effects of Reducing Cholesterol 6-HDL and LDL Treatment

1848

[10]

[11]

[12] [13]

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

M ET AB O LI S M CL I NI CA L A N D EX PE R IM EN T AL 6 2 (2 0 1 3) 1 84 0–1 84 9

Strategies in Atherosclerosis): final results and the impact of medication adherence, dose, and treatment duration. J Am Coll Cardiol 2010;55(24):2721–6. Boden WE, Probstfield JL, Anderson T, et al. Niacin in patients with low HDL cholesterol levels receiving intensive statin therapy. N Engl J Med 2011;365(24):2255–67. O'Riordan M. HPS-2 THRIVE misses primary end point: no benefit of niacin/laropiprant. Assessed at http://www. theheart.org/article/1490635.do on 20 December 2012. Nicholls SJ. Is niacin ineffective? Or did AIM-HIGH miss its target? Cleve Clin J Med 2012;79(1):38–43. Wise A, Foord SM, Fraser NJ, et al. Molecular identification of high and low affinity receptors for nicotinic acid. J Biol Chem 2003;278(11):9869–74. Tunaru S, Kero J, Schaub A, et al. PUMA-G and HM74 are receptors for nicotinic acid and mediate its anti-lipolytic effect. Nat Med 2003;9(3):352–5. Soga T, Kamohara M, Takasaki J, et al. Molecular identification of nicotinic acid receptor. Biochem Biophys Res Commun 2003;303(1):364–9. Lai E, Waters MG, Tata JR, et al. Effects of a niacin receptor partial agonist, MK-0354, on plasma free fatty acids, lipids, and cutaneous flushing in humans. J Clin Lipidol 2008;2(5): 375–83. Boatman PD, Lauring B, Schrader TO, et al. (1aR,5aR)1a,3,5,5aTetrahydro-1H-2,3-diaza-cyclopropa[a]pentalene-4-carboxylic acid (MK-1903): a potent GPR109a agonist that lowers free fatty acids in humans. J Med Chem 2012;55(8):3644–66. Lauring B, Taggart AK, Tata JR, et al. Niacin lipid efficacy is independent of both the niacin receptor GPR109A and free fatty acid suppression. Sci Transl Med 4(148):148ra115. Capuzzi DM, Guyton JR, Morgan JM, et al. Efficacy and safety of an extended-release niacin (Niaspan): a long-term study. Am J Cardiol 1998;82(12A):74U–81U. discussion 85U-86U. Grundy SM, Vega GL, McGovern ME, et al. Efficacy, safety, and tolerability of once-daily niacin for the treatment of dyslipidemia associated with type 2 diabetes: results of the assessment of diabetes control and evaluation of the efficacy of niaspan trial. Arch Intern Med 2002;162(14): 1568–76. Siripurkpong P, Na-Bangchang K. Effects of niacin and chromium on the expression of ATP-binding cassette transporter A1 and apolipoprotein A-1 genes in HepG2 cells. J Nutr Biochem 2009;20(4):261–8. Rubic T, Trottmann M, Lorenz RL. Stimulation of CD36 and the key effector of reverse cholesterol transport ATP-binding cassette A1 in monocytoid cells by niacin. Biochem Pharmacol 2004;67(3):411–9. Lamon-Fava S, Diffenderfer MR, Barrett PH, et al. Extendedrelease niacin alters the metabolism of plasma apolipoprotein (Apo) A-I and ApoB-containing lipoproteins. Arterioscler Thromb Vasc Biol 2008;28(9):1672–8. Jin FY, Kamanna VS, Kashyap ML. Niacin decreases removal of high-density lipoprotein apolipoprotein A-I but not cholesterol ester by Hep G2 cells. Implication for reverse cholesterol transport. Arterioscler Thromb Vasc Biol 1997;17(10):2020–8. Wu BJ, Yan L, Charlton F, et al. Evidence that niacin inhibits acute vascular inflammation and improves endothelial dysfunction independent of changes in plasma lipids. Arterioscler Thromb Vasc Biol 2010;30(5):968–75. Lukasova M, Malaval C, Gille A, et al. Nicotinic acid inhibits progression of atherosclerosis in mice through its receptor GPR109A expressed by immune cells. J Clin Invest 2011;121(3): 1163–73. Digby JE, McNeill E, Dyar OJ, et al. Anti-inflammatory effects of nicotinic acid in adipocytes demonstrated by suppression of fractalkine, RANTES, and MCP-1 and upregulation of adiponectin. Atherosclerosis 2009;209(1):89–95.

[28] Westphal S, Borucki K, Taneva E, et al. Adipokines and treatment with niacin. Metabolism 2006;55(10):1283–5. [29] Westphal S, Borucki K, Taneva E, et al. Extended-release niacin raises adiponectin and leptin. Atherosclerosis 2007;193(2):361–5. [30] Westphal S, Luley C. Preferential increase in high-molecular weight adiponectin after niacin. Atherosclerosis 2008;198(1): 179–83. [31] Krause BR, Princen HM. Lack of predictability of classical animal models for hypolipidemic activity: a good time for mice? Atherosclerosis 1998;140(1):15–24. [32] Holzhauser E, Albrecht C, Zhou Q, et al. Nicotinic acid has anti-atherogenic and anti-inflammatory properties on advanced atherosclerotic lesions independent of its lipidmodifying capabilities. J Cardiovasc Pharmacol 2011;57(4): 447–54. [33] van der Hoorn JW, de Haan W, Berbee JF, et al. Niacin increases HDL by reducing hepatic expression and plasma levels of cholesteryl ester transfer protein in APOE*3Leiden.CETP mice. Arterioscler Thromb Vasc Biol 2008;28(11):2016–22. [34] Otto J, Ordovas JM, Smith D, et al. Lovastatin inhibits diet induced atherosclerosis in F1B Golden Syrian hamsters. Atherosclerosis 1995;114(1):19–28. [35] Wang PR, Guo Q, Ippolito M, et al. High fat fed hamster, a unique animal model for treatment of diabetic dyslipidemia with peroxisome proliferator activated receptor alpha selective agonists. Eur J Pharmacol 2001;427(3):285–93. [36] Srivastava RA, He S. Anti-hyperlipidemic and insulin sensitizing activities of fenofibrate reduces aortic lipid deposition in hyperlipidemic Golden Syrian hamster. Mol Cell Biochem 2010;345(1–2):197–206. [37] Innis-Whitehouse W, Li X, Brown WV, et al. An efficient chromatographic system for lipoprotein fractionation using whole plasma. J Lipid Res 1998;39(3):679–90. [38] Basciano H, Federico L, Adeli K. Fructose, insulin resistance, and metabolic dyslipidemia. Nutr Metab (Lond) 2005;2(1):5. [39] Stanhope KL, Schwarz JM, Keim NL, et al. Consuming fructose-sweetened, not glucose-sweetened, beverages increases visceral adiposity and lipids and decreases insulin sensitivity in overweight/obese humans. J Clin Invest 2009;119(5):1322–34. [40] Nakashima Y, Plump AS, Raines EW, et al. ApoE-deficient mice develop lesions of all phases of atherosclerosis throughout the arterial tree. Arterioscler Thromb 1994;14(1): 133–40. [41] Hokanson JE, Austin MA. Plasma triglyceride level is a risk factor for cardiovascular disease independent of high-density lipoprotein cholesterol level: a meta-analysis of populationbased prospective studies. J Cardiovasc Risk 1996;3(2):213–9. [42] Hochholzer W, Berg DD, Giugliano RP. The facts behind niacin. Ther Adv Cardiovasc Dis 2011;5(5):227–40. [43] Guo Q, Wang PR, Milot DP, et al. Regulation of lipid metabolism and gene expression by fenofibrate in hamsters. Biochim Biophys Acta 2001;1533(3):220–32. [44] Birjmohun RS, Hutten BA, Kastelein JJ, et al. Efficacy and safety of high-density lipoprotein cholesterol-increasing compounds: a meta-analysis of randomized controlled trials. J Am Coll Cardiol 2005;45(2):185–97. [45] Singaraja RR, Bocher V, James ER, et al. Human ABCA1 BAC transgenic mice show increased high density lipoprotein cholesterol and ApoAI-dependent efflux stimulated by an internal promoter containing liver X receptor response elements in intron 1. J Biol Chem 2001;276(36):33969–79. [46] Rader DJ. Molecular regulation of HDL metabolism and function: implications for novel therapies. J Clin Invest 2006;116(12):3090–100. [47] Zhang LH, Kamanna VS, Ganji SH, et al. Niacin increases HDL biogenesis by enhancing DR4-dependent transcription of

M E TAB O LI S M CL I NI CA L A N D EX P ER IM EN T AL 6 2 (2 0 1 3) 1 84 0 –1 8 49

[48]

[49]

[50]

[51]

ABCA1 and lipidation of apolipoprotein A-I in HepG2 cells. J Lipid Res 2012;53(5):941–50. Yvan-Charvet L, Kling J, Pagler T, et al. Cholesterol efflux potential and antiinflammatory properties of high-density lipoprotein after treatment with niacin or anacetrapib. Arterioscler Thromb Vasc Biol 2010;30(7):1430–8. Plaisance EP, Grandjean PW, Brunson BL, et al. Increased total and high-molecular weight adiponectin after extendedrelease niacin. Metabolism 2008;57(3):404–9. Renaldi O, Pramono B, Sinorita H, et al. Hypoadiponectinemia: a risk factor for metabolic syndrome. Acta Med Indones 2009;41(1):20–4. Zhang Y, Schmidt RJ, Foxworthy P, et al. Niacin mediates lipolysis in adipose tissue through its G-protein coupled

[52]

[53]

[54]

[55]

1849

receptor HM74A. Biochem Biophys Res Commun 2005;334(2): 729–32. Ganji SH, Tavintharan S, Zhu D, et al. Niacin noncompetitively inhibits DGAT2 but not DGAT1 activity in HepG2 cells. J Lipid Res 2004;45(10):1835–45. Montecucco F, Quercioli A, Dallegri F, et al. New evidence for nicotinic acid treatment to reduce atherosclerosis. Expert Rev Cardiovasc Ther 2010;8(10):1457–67. Offermanns S, Colletti SL, Lovenberg TW, et al. International Union of Basic and Clinical Pharmacology. LXXXII: nomenclature and classification of hydroxy-carboxylic acid receptors (GPR81, GPR109A, and GPR109B). Pharmacol Rev 2011;63(2):269–90. Giugliano RP. Niacin at 56 years of age—time for an early retirement? N Engl J Med 2011;365(24):2318–20.