The homeodomain of Tinman mediates homo- and heterodimerization of NK proteins

BBRC Biochemical and Biophysical Research Communications 334 (2005) 361–369 www.elsevier.com/locate/ybbrc

The homeodomain of Tinman mediates homo- and heterodimerization of NK proteins Ste´phane Zaffran *, Manfred Frasch Brookdale Department of Molecular, Cell and Developmental Biology, Box 1020, Mount Sinai School of Medicine, New York, NY 10029, USA Received 16 June 2005 Available online 28 June 2005

Abstract Cardiac development requires the action of transcription factors, which control the specification and differentiation of cardiac cell types. One of these factors, encoded by the homeobox gene tinman (tin), is essential for the specification of all cardiac cells in Drosophila. An increasing number of examples show that protein–protein interactions can be important for determining the specific transcriptional activities of homeodomain proteins, in addition to their binding to specific DNA target sites. Here, we show that Tin and Bagpipe (Bap), another homeodomain protein, form homo- and heterodimeric complexes. We demonstrate that homo- and heterodimerization of Tin is mediated through its homeodomain and that the region required for this interaction corresponds to the first two helices that are also necessary for DNA binding. We further show that, in the yeast system, the homeodomain can function as a transcriptional repressor domain. These findings suggest that protein–protein interactions of Tin play a role in its transcriptional and developmental functions.
2005 Elsevier Inc. All rights reserved. Keywords: NK-2; Dimerization; Cardiac; Drosophila; Homeodomain; Tinman

Tinman (Tin) is an NK-2 class (NK-homeodomain containing) protein from Drosophila, which is required for the differentiation of visceral and cardiac mesoderm and the formation of the dorsal vessel [1,2]. The NK-homeodomain family of transcription factors has been conserved from nematode to human and is characterized by a unique Tyr-residue at position 54 in the third helix of the homeodomain (HD) and by the presence of a short domain in their N-terminus, the TN domain, which consists of a conserved decapeptide [3]. Various family members have been shown to control the transcription of target genes via binding to a consensus sequence through their homeodomain [4]. This DNAbinding domain is the most highly conserved region among the various NK-homeodomain proteins. The cri* Corresponding author. Present address: Department of Developmental Biology, CNRS URA 2578, PASTEUR INSTITUTE, 75015 Paris, France. Fax: +33 1 4061 3452. E-mail address: zaff[email protected] (S. Zaffran).

0006-291X/$ - see front matter
2005 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2005.06.090

teria for defining tin homologues are based not only on the presence of a high degree of sequence similarity but also on their expression in patterns analogous to those of tin, such as in the developing heart, pharynx, and/ or visceral mesoderm. Vertebrate homologues have two additional conserved domains not found within Tin itself, the NK-2-specific domain carboxy-terminal to the homeodomain and a five amino acid sequence, GIRAW, at the C-terminus [3,5,6]. The finding that NK-2 homeobox genes are expressed in the developing hearts of both Drosophila and vertebrates has prompted broader research into the mechanisms of heart evolution and genetic pathways that underlie heart specification in embryos (for reviews see [7–9]). For example, in Xenopus, three tin homologues have been described, XNkx2.3, XNkx2.5, and XNkx2.9 [6,10,11]. XNkx2.3 and XNkx2.5 are co-expressed in the cardiogenic mesoderm and pharyngeal endoderm in an overlapping manner, whereas XNkx2.9 is first detected in presumptive cardiogenic and endodermal tissues,

362

S. Zaffran, M. Frasch / Biochemical and Biophysical Research Communications 334 (2005) 361–369

and unlike the other two homologues, disappears from the differentiating heart [6]. In the chick heart, cNkx2.3, cNkx2.5, and cNkx2.8 are co-expressed [12,13], and zebrafish homologues nkx2.3, nkx2.5, and nkx2.7 are co-expressed in the heart with distinct but overlapping patterns [14]. In contrast, Nkx2.5 is the principal NKhomeobox gene expressed in mouse cardiomyocytes from E7.5 to adulthood [5,15,16], and the expression of another NK-homeobox gene, Nkx2.6, is restricted to the sinus venosus and outflow tract region [17,18]. Tin as a NK-homeodomain protein binds to DNA sequences with the consensus T(T/C)AAGTG via interactions between the homeodomain and the major groove of DNA [19]. This type of binding site is found in the control region of numerous cardiac and visceral muscle-specific genes [20–27]. Activation of these targets by Tin in cardiac or visceral muscle precursors is frequently mediated by two or more high-affinity Tin binding sites in enhancers flanking the genes, suggesting the possibility of protein dimerization of Tin [20–24]. Homo- or heterodimerization of transcription factors has been proposed to regulate transcriptional activity of many transcription factors [28]. Recent studies on mouse Nkx2.5 have indicated that the homeodomain of Nkx2.5 binds as a monomer as well as a dimer to its DNA binding sites in the promoter of the atrial natriuretic factor (ANF) gene [51]. In an effort to understand the biochemical basis for dorsal mesodermal tissue specification, we sought to determine whether Tin proteins are capable of mediating interactions between themselves and homologous NK-homeodomain transcription factors. We demonstrate homodimerization of Tin in solution and on NK-consensus binding sites, and determine the critical amino acid residues for homodimerization as well as heterodimerization with a closely related NK-homeodomain protein, Bagpipe (Bap). Thus, our results reveal that the homeodomain of Tin is involved not only in DNA binding but also in mediating NK-homeodomain interactions. Homodimerization may be important for increasing target specificity in vivo. In addition, heterodimerization between Tin and Bap provides for the interesting possibility that both factors collaborate through complex formation during the early events of visceral musculature formation.

Materials and methods Yeast two-hybrid screening. Full-length tinman and bagpipe cDNAs were cloned in-frame into the GAL4 DNA-binding domain coding sequence of the pGBT9 vector (Stratagene). We screened a Drosophila cDNA library fused to the GAL4 activating domain in the pGADNOT vector (a gift from R. Mann) with pGTB9-tin or bag as the ‘‘bait’’ using the MATCHMAKER two-hybrid system, according to the manufacturerÕs protocol (Clontech). Approximately 750,000 colonies were screened as described by Bartel et al. [29]. Deletion of the homeobox (deletion of aa 301–364) was made by inverse PCR with

primers HD-S GCTGGATCCGGGGCTTGGTGGA and HD-E GGGGATCCCCCAAGCATCTGAA using the Pfu Taq-polymerase (Stratagene). Tin1–321 and Tin301–416 were generated by PCR using the oligonucleotides TIN-I ATCGAAGTGCTTCTCAAGTGGCC and TIN-II GAGTCGAAAGCGACACTCCAG and HD-1 CCCCG GATGAAGCGAAAGCCT and HD-2 GGTCTTAAGCTTTATTT ATT, respectively. Clones with correct sequences were selected and cloned into the pGAD424 vector (Clontech). The yeast strains used for these screenings were the HF7c and SFY526 lines provided by the MATCHMAKER two-hybrid system (Clontech). The upstream activating sequence (UAS) and TATA region of the GAL1 promoter are fused to lacZ in SFY526 and to HIS3 in HF7c. The lacZ activities of tin clones were measured as described by Xu et al. [24]. The nucleotide sequences of positive clones were determined by double-strand sequencing as described by Sambrook et al. [30]. In vitro binding assays. In vitro binding assays were performed essentially as described previously [31]. The different forms of tin and bag were cloned into the pGEX vectors (Pharmacia). pKS-tin was digested with EcoRV–BstEII and Klenow treated, then religated to produce pKS-tin-CT (deletion of aa 42–301) which was introduced into the pGEX-3 vector. Cultured Escherichia coli BL21 (DE3) (Stratagene) induced with 0.5 mM of IPTG were lysed by sonication in lysis buffer (25 mM Hepes pH7.5, 20 mM KCl, 2.5 mM EDTA, 0.5 mM PMSF, 1 mM DTT, 1% Triton X-100, and 1 lg/ml pepstatin) and lysates were incubated with glutathatione–agarose beads (Sigma) in PBS and then washed five times in 0.1% Tween 20/PBS. The beads were stored at 4 C and used as a 50% suspension. Both 35S-labeled Tin and luciferase proteins were expressed using the TNT coupled lysate system (Promega). pSK-tin301–416 and pKStinD301–364 were obtained as detailed above. tin1–124 was generated from pNB40-tin by digesting the cDNA with XmnI–PvuII and cloning into pKS. For the in vitro binding assays, 30 ll of the 50% suspension of beads containing ca. 3 lg of GST-fusion proteins was incubated at 4 C for 30 min with 15 ll lysate containing 35S-labeled proteins. One hundred and fifty microliters of 0.5% NP-40/PBS was added to the protein-bead mixtures and, following an incubation at 4 C for 30 min, the mixtures were washed five times for 30 min in 0.5% Tween 20/PBS. We separated the protein complexes by 10% SDS–PAGE gel and visualized them by autoradiography. DNA-binding assay. For electrophoretic mobility shift assays (EMSAs), the GST-fusion proteins were prepared as described above and dialyzed against binding buffer. EMSAs were performed in a 10 ll volume on ice with 104 cpm (0.5 ng) of either oligonucleotides M1 (CCGGGACTCAAGTGCCCGGGCTACGATAATGCTT), M2 (T AATGACAGTCAAGTGCAGCACTTGATCCGCATA), M3 (AAG CATTTCAAGTGCCCGGGCACTTGAGTCCC-GG) or M4 (TAA TTTCAAGTGCAAACTTTGACACTTGAATTGT), end-labeled DNA probe fragment, and 0.5 lg non-specific competitor poly[(dI– dC)] in a binding buffer composition of 4% Ficoll, 20 mM Hepes, pH 7.6, 50 mM KCl, 1 mM EDTA, 1 mM DTT, and 0.25 mg BSA. 0.09– 1 lg of both proteins was gently added and incubated for 30 min, then loaded on a 4% polyacrylamide gel in 0.25· TBE buffer. The gel was dried and analyzed with a PhosphoImager. Protein–DNA binding affinity (i.e., the Kd) was estimated by the protein concentration at which 50% of the DNA probe has become bound. The molecular weights of GST protein fusions were estimated by adding GST protein (MW = 26 kDa) to Tin-CT (aa D42–301, MW = 18 kDa).

Results The homeodomain of Tin interacts with itself The cardiac NK-homeodomain protein Tin is required for the development of dorsal mesoderm deriva-

S. Zaffran, M. Frasch / Biochemical and Biophysical Research Communications 334 (2005) 361–369

tives, including heart, visceral, and dorsal somatic muscles [1,2]. Ectopic ventral expression of Decapentaplegic (Dpp), a TGFb-related factor involved in specifying dorsal embryonic domains, induces ectopic ventral expression of tin and bap, as well as markers of the early visceral mesodermal lineage such as Fasciclin-III [32]. However, under this condition no cardiac marker genes are detected in the ventral mesoderm. Furthermore, ectopic expression of tin itself in the entire mesoderm using UAS-tin has only very mild and transient effects on mesodermal tissue specification. One possible explanation for the lack of effects with ectopic Tin could be that the cardiac function of tin requires additional Tin binding partners that are not present in the ventral mesoderm under these conditions. To elucidate the

363

molecular mechanisms by which Tin regulates cardiac and visceral development and identify potential co-factors, we isolated proteins that associate with Tin using the yeast two-hybrid system with full-length Tin as the bait. Sequence analysis showed that three cDNAs out of a total of 42 positives encoded a portion of Tin, which lacked N-terminal portions of the protein. Two clones were identical, with the Tin moiety of the fusion protein beginning with amino acid 124 of Tin, while the third started with amino acid 110. To determine the specific Tin domain involved in this interaction, we generated different forms of the protein and measured their ability to bind to the C-terminal portion of Tin (aa 301–416) that includes its homeodomain (Fig. 1A). These results indicated that the homeodomain

Fig. 1. The homeodomain of Tin is necessary and sufficient for homotypic protein–protein interactions. (A) Mapping of the dimerization domain identified by yeast two-hybrid screening. Deletion constructs of Tin in the yeast assay showing that the HD is necessary for this interaction. Interactions between Tin-derivatives (fused with the GAL4 DNA-binding domain) and its C-terminus, which contains the homeodomain (fused with the GAL4 activation domain), were tested by assaying for colony growth (‘‘-His selection’’) and activation of a lacZ reporter (‘‘b-gal Units’’). (B) In vitro-translated, 35S-labeled Tin (wild type and deletion mutations) was incubated with GST-Tin fusion protein immobilized on glutathione–agarose beads, and bound proteins were resolved on SDS–PAGE followed by autoradiography. GST alone was used as control. The results show that the HD (aa 301–364) is necessary for the dimerization. (C) The results with GST-Tin301–416 and labeled-Tin proteins show that the C-terminal domain of Tin (aa 301–416) is sufficient and necessary for the protein–protein interaction. (D) The results with GST-Tin and the labeled-Tin C-terminal domain show that the first two helices of the HD are sufficient for the interaction (HD, homeodomain; TN, Tin-homology domain). Molecular weights are indicated by vertical bars (left, panel C), from top to bottom: 180, 116, 84, 57, 48, 37 and 27 kDa.

364

S. Zaffran, M. Frasch / Biochemical and Biophysical Research Communications 334 (2005) 361–369

of Tin itself is necessary and sufficient for the homophilic interaction. The major contribution to this interaction appears to reside in the N-terminal 1/3 of the homeodomain (helix 1; Fig. 1A, see Tin1–321). This interaction was confirmed by using GST ‘‘pull-down’’ assays with

GST-Tin proteins (Fig. 1B). The result obtained in yeast showing that the homeodomain of the Tin protein is necessary for this homophilic interaction was also reproduced in vitro using the deleted form of Tin, TinD301–364 (Fig. 1B). We showed that the interaction is restricted to the HD itself since the N-terminal portion of the Tin protein (aa 1–124) is not able to mediate this interaction while the C-terminal portion with the homeodomain (aa 301–416) is sufficient for it (Fig. 1C). To localize the in vitro interaction domain within the homeodomain of Tin more precisely, we further truncated the domain and tested for interaction via GST ‘‘pull-down’’ assays. We find that the first two helices of the homeodomain are sufficient for this interaction (Fig. 1D). These results, together with similar data recently obtained for the vertebrate Nkx2.5 [51], reveal a dual role of the homeodomain, which also binds specific DNA recognition sequences through its second and third helices [33]. Tin forms a homodimer on a palindromic DNA sequence

Fig. 2. The Tin protein homodimerizes on palindrominc DNA sequences containing two Tin-binding sites. A 34-mer DNA segment with a monomeric (oligonucleotide M1) or palindromic (oligonucleotide M3) Tin-binding site was used for gel shift analysis. The first lane shows free probe without protein, followed by two fold serial increases in Tin protein concentration shown in lanes 1–4 on monomeric, and lanes 5–8 on palindromic sites. The homeodomain forms monomers as well as dimers with different binding affinity (see Table 1) on the palindromic oligonucleotide M3 (lanes 5–8) while only monomers are detected on monomeric oligonucleotide M1 (lanes 1–4). When the palindromic oligonucleotide M3 is used in the EMSA with Tin-CT (TinD42–301), a trimeric complex is observed.

To begin to elucidate the functional significance of the observed dimerization of Tin, we used electromobility shift assay (EMSA) with a DNA segment matching the consensus DNA sequence recognized by Tin-related NK-homeodomains, T(T/C)AAGT(A/G) [34–36]. In this assay, we used the C-terminal region of Tin (aa 301–416) that includes the HD and was shown to be sufficient for dimerization (Fig. 1C). Tin-CT bound to a 34mer DNA segment (M1) that contains one Tin-binding site, since a single shifted band is detected (Fig. 2). However, when the EMSA is performed with a 34-mer DNA segment containing two palindromic Tin-binding sites separated by six nucleotide pairs (oligonucleotide M3: AAGCATTTCAAGTGCCCGGGCACTTGAGTCCC GG), an additional and larger shifted band appears with increased protein concentrations (Fig. 2). In addition to the binding of Tin-CT to both DNA binding sites, these trimeric complexes could additionally involve protein– protein interactions, as indicated from our data in yeast two-hybrid and GST ‘‘pull-down’’ assays. Moreover, protein–protein interactions could potentially stabilize DNA binding. To address this possibility, we compared the relative binding affinity (Kd) of Tin-CT with different

Table 1 Apparent dissociation constants for binding to Tinman Oligonucleotidea

Sequenceb

Relative binding affinity (Kd)c (M)

Tin consensus M1 M2 M3 M4

T(T/C)AAGT(A/G) CCGGGACTCAAGTGCCCGGGCTACGATAATGCTT TAATGACAGTCAAGTGCAGCACTTGATCCGCATA AAGCATTTCAAGTGCCCGGGCACTTGAGTCCCGG TAATTTCAAGTGCAAACTTTGACACTTGAATTGT

43 · 10 11 · 10 5.2 · 10 10.6 · 10

a b c

8 8 8 8

Designation for the individual oligonucleotide is the same as those in figures. Oligonucleotides correspond to a 34-mer DNA segment. The Tin-binding sites are underlined. Affinities of the individual oligonucleotide were determined by EMSA, following with a Phosphoimager analysis (see Materials and methods).

S. Zaffran, M. Frasch / Biochemical and Biophysical Research Communications 334 (2005) 361–369

DNA fragments that contained either one binding site (oligonucleotide M1) or two sites with a six nucleotide-pair spacer (oligonucleotide M3). By applying EMSA we determined that the homeodomain of Tin protein binds to the monomeric binding site (oligonucleotide M1) with a Kd = 43 · 10 8 M (Table 1). Hence, the relative affinity of Tin binding is in the same range as that of related homeodomain proteins from vertebrates [51,35,36]. For a palindromic Tin-binding site (oligonucleotide M3), the Kd was determined to be 5.2 · 10 8 M, suggesting that the binding affinity is increased by cooperativity as compared to a monomeric binding site (Table 1). To determine the optimal situation for cooperative binding, we measured the relative binding affinities for palindromic sites with spacers of different lengths between the two binding sites. In EMSAs with a 34-mer DNA fragment containing a palindromic binding site separated by a three nucleotide-pair spacer (oligonucleotide M2), the Kd is 11 · 10 8 M and with a 10 nucleotide-pair spacer (oligonucleotide M4) the Kd is 10.6 · 10 8 M (Table 1). Although these results indicate that the Tin protein may bind with a highest affinity to the oligonucleotide M3, the small difference between the Kds with these different oligonucleotides suggests that, at least under our experimental conditions, cooperative binding is not very sensitive to the exact distance between the two binding sites.

365

Fig. 3. Heterodimerization of Tin and Bap through their homeodomain. GST ‘‘pull-down’’ assays with a GST fusion protein of Bap and different deletions of 35S-labeled Tin. GST alone and 35S-luciferase protein were used as controls. The data with the C-terminal domain of Tin (aa 301–416) and the deletion of the homeodomain (aa 301–364) show that homeodomain is necessary and sufficient to the heterodimerization between these two NK-homeodomain proteins. Molecular weights are indicated by vertical bars, from top to bottom: 116, 84, 48, 37 and 27 kDa.

proteins could be involved in cooperative binding on DNA and synergistic activation of target genes, as has been suggested for other homeodomain proteins [39].

Heterodimerization of Tinman with Bagpipe, an NK-3homeodomain protein

Analysis of transactivating functions of Tin

The specification of Drosophila visceral mesoderm requires the tin-dependent activation of bagpipe (bap), an NK-3 homeobox gene, within a segmental subset of tin-expressing cells in the dorsal mesoderm [1]. Bap and Tin proteins are transiently co-expressed in these cells, which give rise to visceral muscle precursors [37,38]. To identify the potential partners of Bap, we performed a yeast two-hybrid screen with full-length Bap protein as the ‘‘bait.’’ From this screen, we isolated 59 independent clones and after sequencing we found that 10 of these clones encoded portions of the Tin protein. The shortest of these Tin-positive clones corresponded to amino acids 294–416 of Tin, which includes the homeodomain. To determine the domain of Tin involved in this protein–protein interaction with Bap, we used different forms of the protein in a GST ‘‘pull-down’’ assay (Fig. 3). Analogous to the homodimerization of Tin, we found that the homeodomain is involved in the protein–protein interaction between Tin and Bap proteins (Fig. 3A). GST ‘‘pull-down’’ assays show that the C-terminal portion of Tin protein (aa 301–416) is sufficient for the binding to Bap, while no interaction is observed when the homeodomain is deleted (aa deleted 301–364) (Fig. 3). These data suggest that heterodimerization of Tin with NK-homeodomain

Previous studies have delimited the transactivation domain of the NK-homeodomain protein Nkx2.5 to its N-terminal region (aa 42–121) [40], but a more recent study found two domains capable of transactivation located at or near its N and C termini [41]. To investigate how Tin regulates transcription, we constructed several expression plasmids with portions of Tin fused to the GAL4 DNA-binding domain (DBD) and tested these constructs in yeast reporter cells. These cells have an integrated reporter sequence containing multiple copies of the GAL4 upstream activating sequence (UAS) of the GAL1 promoter driving a lacZ reporter gene. Fig. 4 shows the results of yeast GAL4-DBD experiments with a lacZ reporter vector that is suitable for observing transcriptional activation because of its low basal lacZ activity, using a series of deletion and truncation constructs. In these experiments, the higher transactivation of the lacZ reporter with the Tin constructs deleted for the C-terminal domain (Tin1–270) and specifically for the homeodomain (TinD301–364) suggests that the homeodomain reduces the transcriptional activity of the Tin protein (Fig. 4). This result is reminiscent of previous reports that the repressing activities of HoxA7 and Msx-1 are mediated by their homeodomains [42,43]. Our results make it conceivable that the Tin homeodo-

366

S. Zaffran, M. Frasch / Biochemical and Biophysical Research Communications 334 (2005) 361–369

Fig. 4. Transcriptional activity of Tin. Mapping of the transcriptional activation domain of Tin using a deletion series of proteins fused to the GAL4 DNA-binding domain (Gal4-DBD). Transcriptional activities are expressed relative to the level of reporter gene expression in the presence of GAL1 promoter fused to lacZ. Data are presented as fold activation above the activity seen with the Gal4-DBD alone with the lacZ reporter, and values shown are means and standard deviation of two times two independent experiments. The sizes of constructs are indicated with amino acids numbers. The homeodomain within the C-terminus of Tin (aa 301–364) represses the transcriptional activity of the protein (HD, homeodomain; TN, Tinhomology domain).

main modulates the transactivating function of Tin in an analogous fashion. Moreover, they raise the possibility that homo- or heterodimerization via the homeodomain can influence this repressing activity.

Discussion The NK-2 class (or NK-homeodomain) containing transcription factors are highly conserved from insect to vertebrates [3]. Tinman (Tin) and Nkx2.5 are good examples of such conservation, since 68% of identity is found in their homeodomain and both factors play an important role during heart formation in Drosophila and vertebrates, respectively [1,2,44,45]. Several studies on human NKX2.5 reported the identification of missense mutations in the homeodomain, which is the cause of cardiac defects [4,46–48]. In this study, we present new findings of protein dimerization of Tin, which involves its homeodomain. We also show that Tin forms heterodimers with another NK-homeodomain class protein, Bagpipe (Bap). Biologically, these interactions may affect Tin function at two different levels. First, because a transcriptional activator domain was mapped to the N-terminal region of the protein and the homeodomain represses this transcriptional activity, the identified protein–protein interactions may modulate transcriptional activity. Second, formation of homodimers of Tin and heterodimers with Bap increases protein–DNA binding affinity to adjacent binding sites, suggesting that dimerization plays also a role in increasing target specificity. Protein dimerization of Tin through the homeodomain By using a two-hybrid system and GST pull-down assays, we found that the homeodomain of Tin is critical for protein–protein interactions. Furthermore, deletion

of the homeodomain in Tin protein abolishes homodimerization. Our data show that dimer formed through the homeodomain increases the DNA binding affinity of the Tin protein. Palindromic Tin-specific binding sites have been identified in the enhancer of the Drosophila mef2, ind, pannier, tin, and b3-tubulin genes [21–24,49]. Tin binds the sequences of the cardiac enhancer of the mef2 gene, which has two NK-homeodomain binding sites [20,21]. Mutations that abolish one of these two sites cause loss of activation of the mef2 gene [21]. Strikingly, this and several other examples in which two different Tin binding sites are separated by about 200 bp [21,23,24] suggest that the Tin proteins could interact over a long distance while the DNA bends. Our data indicate that there is a slightly increased binding affinity of Tin when the palindromic sites are separated by at least 10 nucleotide pairs. Ten nucleotide pairs is the size corresponding to a complete helical turn of the double helix allowing the two Tin proteins to face each other on the same side of the helix. We have previously shown that HMG-D interacts with the homeodomain of Tin, as well as with DNA sequences within a Tin-responsive enhancer, tinD, and speculated that HMG-D-induced DNA bending may generate a proper tertiary structure that facilitates protein–protein interaction [50]. Taken together, these observations suggest that DNA bending facilitates homo- or heterodimerization of Tin proteins when the binding sites are not directly adjacent. ind which was initially identified in a screen for genes regulated by Tin is now known as a target of another NK-2 homeobox gene, vnd, and the identified enhancer has two palindromic NK-homeodomain binding sites with a 11 nucleotide spacer, plus a third following a 26 bp space. It is also noteworthy that one recent study on Nkx2.5 has demonstrated that the activation of the mouse cardiac enhancer ANF requires a palindromic

S. Zaffran, M. Frasch / Biochemical and Biophysical Research Communications 334 (2005) 361–369

NK-homeodomain binding site [51]. Most notably in this context, another study reported that Nkx2.5 can form homodimers, and that the homeodomain is critical for this interaction [16]. Thus, dimerization of Tin via its homeodomain probably reflects a more common and evolutionarily conserved molecular feature among members of the NK-homeodomain family, which may contribute to increased target gene selectivity. In addition, cardiac defects as a result of missense mutations in the homeodomain of human NKX2.5 may in some cases be due to a perturbation of dimer binding [4,46,48]. Heterodimerization of Tin with another NK homeodomain protein, Bap From a two-hybrid screen using Bap as bait, we identified only one partner as a NK-homeodomain protein, which is Tin. Bap and Tin are co-expressed, both temporally and spatially, in the ‘‘P’’ compartment of the dorsal mesoderm (the future visceral mesoderm), which would allow the two proteins to heterodimerize [1,37]. Identification of such protein interactions suggests that both proteins could modulate their activity during the specification of the dorsal mesodermal derivatives [1]. In this context, it is noteworthy that a tin-dependent enhancer of bap includes one Bap-specific binding site and another site within 50 bp that can bind both Tin and Bap. Each of the two sites has a non-redundant function in activating the enhancer, which may partially be due to protein interactions between bound Tin and Bap [25]. However, at this short distance, active DNA-bending, for example by HMG-D, would be required to bring the two proteins into contact. Our finding of heterodimerization is the second example of interactions between two NK-homeodomain proteins. Indeed, another heterophilic NKhomeodomain protein interaction has been described in the mouse, namely between Nkx2.5 and Nkx2.6/Tix [51]. Like Tin and Bap, Nkx2.5 and Nkx2.6 share a domain of spatial and temporal co-expression, which is functionally significant since double mutant embryos have additional defects that might reflect their specific functions as heterodimer [1,51,52]. These observations suggest that heterodimerization between two NK-homeodomain proteins may be used to increase functional specificities in domains where their expression overlaps. The previous identification of examples of protein– protein complexes of Tin and other proteins has also suggested that such interactions enhance the target specificity of Tin on particular enhancers [22,24]. Notably, protein interactions of Tin with Smad proteins, Mad and Medea, in response to Dpp signals are likely to contribute to the synergistic activation of tin by tin and dpp in the dorsal ectoderm through the tinD enhancer [24,50]. Likewise, physical interactions between Tin and the zinc finger transcription factor Pannier are likely to be involved in their synergistic activation of the mef2

367

gene [22]. A similar synergism is found between Nkx2.5 and the T-box protein Tbx5, which promotes cardiomyocyte differentiation [53]. These findings suggest that activation of target genes by NK-homeodomain proteins is partially controlled through their association with different partners that modulate their function. The homeodomain of Tin represses the transcriptional activity of the protein Previous studies have mapped transcriptional activation domains of NK-2 proteins to different regions depending on the system used [35,41,54]. Several studies including ours showed that the homeodomain acts as an inhibitory domain of the transcriptional activity [42,43,54,55]. The mechanism by which the homeodomain of Tin blocks the Tin activation function is unknown. Although a direct association between the homeodomain and the activation domain might have provided a simple explanation, the two domains do not interact detectably with one another in vitro (Fig. 1C). Thus, we suppose that other factor(s) are involved in this process, which in the native Drosophila system likely include the Groucho co-repressor [54]. As Groucho does not exist in the yeast system, additional mechanisms are likely to contribute as well. Our results show that the homeodomain is implicated in the dimerization of Tin. Hence, one possible mechanism could be that in the monomeric protein, transactivation is repressed but once a dimer is formed this repression is released.

Acknowledgments We thank Dr. Richard Mann for the cDNA library used for the two-hybrid assay. This work was supported by grants from NIH (HD30832). S.Z. is a fellow researcher from the ‘‘Centre National de la Recherche Scientifique’’ in France.

References [1] N. Azpiazu, M. Frasch, tinman and bagpipe: two homeo box genes that determine cell fates in the dorsal mesoderm of Drosophila, Genes Dev. 7 (1993) 1325–1340. [2] R. Bodmer, The gene tinman is required for specification of the heart and visceral muscles in Drosophila, Development 118 (1993) 719–729. [3] R.P. Harvey, NK-2 homeobox genes and heart development, Dev. Biol. 178 (1996) 203–216. [4] J.J. Schott, D.W. Benson, C.T. Basson, W. Pease, G.M. Silberbach, J.P. Moak, B.J. Maron, C.E. Seidman, J.G. Seidman, Congenital heart disease caused by mutations in the transcription factor NKX2-5, Science 281 (1998) 108–111. [5] T.J. Lints, L.M. Parsons, L. Hartley, I. Lyons, R.P. Harvey, Nkx-2.5: a novel murine homeobox gene expressed in early heart

368

[6] [7] [8] [9] [10]

[11]

[12]

[13]

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25]

S. Zaffran, M. Frasch / Biochemical and Biophysical Research Communications 334 (2005) 361–369 progenitor cells and their myogenic descendants, Development 119 (1993) 969. C.S. Newman, P.A. Krieg, tinman-related genes expressed during heart development in Xenopus, Dev. Genet. 22 (1998) 230–238. E.N. Olson, D. Srivastava, Molecular pathways controlling heart development, Science 272 (1996) 671–676. S. Zaffran, M. Frasch, Early signals in cardiac development, Circ. Res. 91 (2002) 457–469. M.C. Fishman, E.N. Olson, Parsing the heart: genetic modules for organ assembly, Cell 91 (1997) 153–156. Y. Fu, W. Yan, T.J. Mohun, S.M. Evans, Vertebrate tinman homologues XNkx2-3 and XNkx2-5 are required for heart formation in a functionally redundant manner, Development 125 (1998) 4439–4449. K.F. Tonissen, T.A. Drysdale, T.J. Lints, R.P. Harvey, P.A. Krieg, XNkx-2.5, a Xenopus gene related to Nkx-2.5 and tinman: evidence for a conserved role in cardiac development, Dev. Biol. 162 (1994) 325–328. A. Buchberger, O. Pabst, T. Brand, K. Seidl, H.H. Arnold, Chick NKx-2.3 represents a novel family member of vertebrate homologues to the Drosophila homeobox gene tinman: differential expression of cNKx-2.3 and cNKx-2.5 during heart and gut development, Mech. Dev. 56 (1996) 151–163. T.M. Schultheiss, S. Xydas, A.B. Lassar, Induction of avian cardiac myogenesis by anterior endoderm, Development 121 (1995) 4203–4214. J.N. Chen, M.C. Fishman, Zebrafish tinman homolog demarcates the heart field and initiates myocardial differentiation, Development 122 (1996) 3809–3816. I. Komuro, S. Izumo, Csx: a murine homeobox-containing gene specifically expressed in the developing heart, Proc. Natl. Acad. Sci. USA 90 (1993) 8145–8149. H. Kasahara, B. Lee, J.J. Schott, D.W. Benson, J.G. Seidman, C.E. Seidman, S. Izumo, Loss of function and inhibitory effects of human CSX/NKX2.5 homeoprotein mutations associated with congenital heart disease, J. Clin. Invest. 106 (2000) 299–308. C. Biben, T. Hatzistavrou, R.P. Harvey, Expression of NK-2 class homeobox gene Nkx2-6 in foregut endoderm and heart, Mech. Dev. 73 (1998) 125–127. M. Nikolova, X. Chen, T. Lufkin, Nkx2.6 expression is transiently and specifically restricted to the branchial region of pharyngealstage mouse embryos, Mech. Dev. 69 (1997) 215–218. D.H. Tsao, J.M. Gruschus, L.H. Wang, M. Nirenberg, J.A. Ferretti, The three-dimensional solution structure of the NK-2 homeodomain from Drosophila, J. Mol. Biol. 251 (1995) 297– 307. R.M. Cripps, B. Zhao, E.N. Olson, Transcription of the myogenic regulatory gene Mef2 in cardiac, somatic, and visceral muscle cell lineages is regulated by a Tinman-dependent core enhancer, Dev. Biol. 215 (1999) 420–430. K. Gajewski, Y. Kim, Y.M. Lee, E.N. Olson, R.A. Schulz, Dmef2 is a target for Tinman activation during Drosophila heart development, EMBO J. 16 (1997) 515–522. K. Gajewski, Q. Zhang, C.Y. Choi, N. Fossett, A. Dang, Y.H. Kim, Y. Kim, R.A. Schulz, Pannier is a transcriptional target and partner of Tinman during Drosophila cardiogenesis, Dev. Biol. 233 (2001) 425–436. T. Kremser, K. Gajewski, R.A. Schulz, R. Renkawitz-Pohl, Tinman regulates the transcription of the beta3 tubulin gene (betaTub60D) in the dorsal vessel of Drosophila, Dev. Biol. 216 (1999) 327–339. X. Xu, Z. Yin, J.B. Hudson, E.L. Ferguson, M. Frasch, Smad proteins act in combination with synergistic and antagonistic regulators to target Dpp responses to the Drosophila mesoderm, Genes Dev. 12 (1998) 2354–2370. H.H. Lee, M. Frasch, Nuclear integration of positive Dpp signals, antagonistic Wg inputs and mesodermal competence factors

[26]

[27]

[28] [29]

[30] [31]

[32]

[33] [34] [35]

[36]

[37]

[38]

[39]

[40]

[41]

[42]

[43]

[44]

[45]

during Drosophila visceral mesoderm induction, Development 132 (2005) 1429–1442. S. Knirr, M. Frasch, Molecular integration of inductive and mesoderm-intrinsic inputs governs even-skipped enhancer activity in a subset of pericardial and dorsal muscle progenitors, Dev. Biol. 238 (2001) 13–26. M.S. Halfon, A. Carmena, S. Gisselbrecht, C.M. Sackerson, F. Jimenez, M.K. Baylies, A.M. Michelson, Ras pathway specificity is determined by the integration of multiple signal-activated and tissue-restricted transcription factors, Cell 103 (2000) 63–74. D.S. Wilson, C. Desplan, Homeodomain proteins. Cooperating to be different, Curr. Biol. 5 (1995) 32–34. P. Bartel, C.T. Chien, R. Sternglanz, S. Fields, Elimination of false positives that arise in using the two-hybrid system, Biotechniques 14 (1993) 920–924. J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1989. C.P. Shen, L.Y. Jan, Y.N. Jan, Miranda is required for the asymmetric localization of Prospero during mitosis in Drosophila, Cell 90 (1997) 449–458. M. Frasch, Induction of visceral and cardiac mesoderm by ectodermal Dpp in the early Drosophila embryo, Nature 374 (1995) 464–467. S. Hayashi, M.P. Scott, What determines the specificity of action of Drosophila homeodomain proteins? Cell 63 (1990) 883–894. T. Mohun, D. Sparrow, Early steps in vertebrate cardiogenesis, Curr. Opin. Genet. Dev. 7 (1997) 628–633. H. Watada, R.G. Mirmira, J. Kalamaras, M.S. German, Intramolecular control of transcriptional activity by the NK2-specific domain in NK-2 homeodomain proteins, Proc. Natl. Acad. Sci. USA 97 (2000) 9443–9448. D.H. Tsao, J.M. Gruschus, L.H. Wang, M. Nirenberg, J.A. Ferretti, Elongation of helix III of the NK-2 homeodomain upon binding to DNA: a secondary structure study by NMR, Biochemistry 33 (1994) 15053–15060. H.H. Lee, M. Frasch, Wingless effects mesoderm patterning and ectoderm segmentation events via induction of its downstream target sloppy paired, Development 127 (2000) 5497–5508. H. Lee, S. Zaffran, M. Frasch, The development of the larval musculature of Drosophila, in: H. Sink (Ed.), Muscle Development in Drosophila, Landes Bioscience Collections, Georgetown, TX, USA, 2005, pp. 1–17. D. Wilson, G. Sheng, T. Lecuit, N. Dostatni, C. Desplan, Cooperative dimerization of paired class homeo domains on DNA, Genes Dev. 7 (1993) 2120–2134. C.Y. Chen, R.J. Schwartz, Identification of novel DNA binding targets and regulatory domains of a murine tinman homeodomain factor, nkx-2.5, J. Biol. Chem. 270 (1995) 15628–15633. G. Ranganayakulu, D.A. Elliott, R.P. Harvey, E.N. Olson, Divergent roles for NK-2 class homeobox genes in cardiogenesis in flies and mice, Development 125 (1998) 3037–3048. H. Zhang, K.M. Catron, C. Abate-Shen, A role for the Msx-1 homeodomain in transcriptional regulation: residues in the Nterminal arm mediate TATA binding protein interaction and transcriptional repression, Proc. Natl. Acad. Sci. USA 93 (1996) 1764–1769. C.A. Schnabel, C. Abate-Shen, Repression by HoxA7 is mediated by the homeodomain and the modulatory action of its Nterminal-arm residues, Mol. Cell. Biol. 16 (1996) 2678–2688. M. Tanaka, Z. Chen, S. Bartunkova, N. Yamasaki, S. Izumo, The cardiac homeobox gene Csx/Nkx2.5 lies genetically upstream of multiple genes essential for heart development, Development 126 (1999) 1269–1280. I. Lyons, L.M. Parsons, L. Hartley, R. Li, J.E. Andrews, L. Robb, R.P. Harvey, Myogenic and morphogenetic defects in the heart tubes of murine embryos lacking the homeo box gene Nkx25, Genes Dev. 9 (1995) 1654–1666.

S. Zaffran, M. Frasch / Biochemical and Biophysical Research Communications 334 (2005) 361–369 [46] S.M. Reamon-Buettner, H. Hecker, K. Spanel-Borowski, S. Craatz, E. Kuenzel, J. Borlak, Novel NKX2-5 mutations in diseased heart tissues of patients with cardiac malformations, Am. J. Pathol. 164 (2004) 2117–2125. [47] Y. Ikeda, Y. Hiroi, T. Hosoda, T. Utsunomiya, S. Matsuo, T. Ito, J. Inoue, T. Sumiyoshi, H. Takano, R. Nagai, I. Komuro, Novel point mutation in the cardiac transcription factor CSX/ NKX2.5 associated with congenital heart disease, Circ. J. 66 (2002) 561–563. [48] D.W. Benson, G.M. Silberbach, A. Kavanaugh-McHugh, C. Cottrill, Y. Zhang, S. Riggs, O. Smalls, M.C. Johnson, M.S. Watson, J.G. Seidman, C.E. Seidman, J. Plowden, J.D. Kugler, Mutations in the cardiac transcription factor NKX2.5 affect diverse cardiac developmental pathways, J. Clin. Invest. 104 (1999) 1567–1573. [49] J.B. Weiss, T. Von Ohlen, D.M. Mellerick, G. Dressler, C.Q. Doe, M.P. Scott, Dorsoventral patterning in the Drosophila central nervous system: the intermediate neuroblasts defective homeobox gene specifies intermediate column identity, Genes Dev. 12 (1998) 3591–3602. [50] S. Zaffran, X. Xu, P.C. Lo, H.H. Lee, M. Frasch, Cardiogenesis in the Drosophila model: control mechanisms during early

[51]

[52]

[53]

[54]

[55]

369

induction and diversification of cardiac progenitors, Cold Spring Harb. Symp. Quant Biol. 67 (2002) 1–12. H. Kasahara, A. Usheva, T. Ueyama, H. Aoki, N. Horikoshi, S. Izumo, Characterization of homo- and heterodimerization of cardiac Csx/Nkx2.5 homeoprotein, J. Biol. Chem. 276 (2001) 4570–4580. M. Tanaka, M. Schinke, H.S. Liao, N. Yamasaki, S. Izumo, Nkx2.5 and Nkx2.6, homologs of Drosophila tinman, are required for development of the pharynx, Mol. Cell. Biol. 21 (2001) 4391– 4398. Y. Hiroi, S. Kudoh, K. Monzen, Y. Ikeda, Y. Yazaki, R. Nagai, I. Komuro, Tbx5 associates with Nkx2-5 and synergistically promotes cardiomyocyte differentiation, Nat. Genet. 28 (2001) 276–280. C.Y. Choi, Y.M. Lee, Y.H. Kim, T. Park, B.H. Jeon, R.A. Schulz, Y. Kim, The homeodomain transcription factor NK-4 acts as either a transcriptional activator or repressor and interacts with the p300 coactivator and the Groucho corepressor, J. Biol. Chem. 274 (1999) 31543–31552. X. Li, C. Murre, W. McGinnis, Activity regulation of a Hox protein and a role for the homeodomain in inhibiting transcriptional activation, EMBO J. 18 (1999) 198–211.