- Email: [email protected]
The Human Glycine Receptor β Subunit Gene (GLRB): Structure, Refined Chromosomal Localization, and Population Polymorphism
GENOMICS
50, 341–345 (1998) GE985324
ARTICLE NO.
The Human Glycine Receptor b Subunit Gene (GLRB): Structure, Refined Chromosomal Localization, and Population Polymorphism Nicoletta Milani,* Cornel Mu¨lhardt,* Ruthild G. Weber,† Peter Lichter,† Petra Kioschis,‡ Annemarie Poustka,‡ and Cord-Michael Becker*,1 *Institut fu¨r Biochemie, Universita¨t Erlangen-Nu¨rnberg, Fahrstrasse 17, D-91054 Erlangen, Germany; and †Abteilung Organisation Komplexer Genome and ‡Abteilung Molekulare Genomanalyse, Deutsches Krebsforschungszentrum, Im Neuenheimer Feld 280, D-69120 Heidelberg, Germany Received January 13, 1998; accepted March 24, 1998
The glycine receptor of the human CNS comprises ligand-binding a1 and structural b subunits encoded by the GLRA1 and GLRB genes, respectively. Screening of a human hippocampal cDNA library resulted in the identification of the novel subunit transcript bB, differing in the 5*-UTR. Analysis of the genomic organization of GLRB showed that the coding region is distributed over nine exons, highly homologous to the GLRA1 gene. By in situ hybridization, the chromosomal localization of GLRB was refined to band 4q31.3. Based on the identical phenotypes of mouse lines carrying mutant alleles of the a1 and b subunit genes, GLRB was assumed to be a candidate gene for those cases of hyperekplexia that cannot be associated with mutations of GLRA1. Therefore, flanking intronic sequences were determined, and DNA samples from more than 30 index patients were subjected to SSCP screening of the entire GLRB coding region. A polymorphism in exon 8 was found both in the normal population and in families affected by hyperekplexia, although no coding mutation was detectable. © 1998 Academic Press
INTRODUCTION
The strychnine-sensitive glycine receptor (GlyR) is a ligand-gated chloride channel mediating synaptic inhibition in spinal cord, brain stem, and other CNS regions. It exists in developmentally regulated, heteromeric isoforms composed of variants of the ligand-binding polypeptide (a1–a4) and structural (b) subunits (Becker et al., 1988; Betz, 1992; Becker, 1995). These subunits share a similar membrane topology in which a large extracellular N-terminal domain is followed by four membrane-spanning segments, TM1–TM4. Structural determinants of ligand binding have been identified within the N-terminal domain of the a polypeptides, while TM2 is thought to line the anion pore of the recep1 To whom correspondence should be addressed. Telephone: (49-9131) 85-4190. Fax: (49-9131) 85-2485. E-mail: C.-M.Becker@biochem. uni-erlangen.de.
tor channel (Betz, 1992; Becker, 1995). While the a subunit variants possess highly homologous primary structures displaying 80–90% amino acid identities, the b subunit exhibits a diverging amino acid sequence accounting for approximately 47% identity compared to the a1 subunit (Grenningloh et al., 1990; Kingsmore et al., 1994; Matzenbach et al., 1994; Mu¨lhardt et al., 1994; Handford et al., 1996). Human and murine glycine receptor genes represent a family of genes that share a similar exon–intron organization, suggesting a phylogenetic gene duplication (Shiang et al., 1995). The coding regions of the human GLRA1 gene and the murine Glra1, Glra2, and Glrb genes are spread over nine exons (Matzenbach et al., 1994; Mu¨lhardt et al., 1994). The GLRA1 and GLRB genes have been localized to human chromosomal regions 5q32 and 4q32, respectively (Baker et al., 1994; Handford et al., 1996). By synteny homology, these locations are linked to the murine loci on chromosome 11 (29 cM) and chromosome 3 (36 cM) of the Glra1 and Glrb genes, respectively. Interestingly, each of these loci is part of a cluster of amino acid receptor subunit genes also comprising glutamate and GABAA receptor subunits. In contrast, human and murine a2 genes as well as the Glra4 gene are located on the X chromosome (Grenningloh et al., 1990; Derry and Barnard, 1991). Hereditary hyperekplexia or startle disease (STHE; MIM 149400) is a rare neurological disorder characterized by infantile generalized muscular stiffness and excessive startle responses (Andermann et al., 1980). Mutations in the human gene encoding the a1 subunit (GLRA1) are causal to both dominant (Shiang et al., 1993; Shiang et al., 1995; Elmslie et al., 1996; Milani et al., 1996) and recessive (Rees et al., 1994; Brune et al., 1996) forms of hyperekplexia. The missense mutations found give rise to substitutions of amino acid residues located from the TM1 segment to the extracellular loop following segment TM2. Neurological phenotypes reminiscent of human hyperekplexia are encountered in three strains of mutant recessive mice. Spasmodic and oscillator mice carry mutant alleles of Glra1 (Ryan et al., 1994; Saul et al., 1994; Kling et al., 1997). In the
341
0888-7543/98 $25.00 Copyright © 1998 by Academic Press All rights of reproduction in any form reserved.
342
MILANI ET AL.
TABLE 1 PCR Primer Pairs for Amplification and SSCP Analysis of the GLRB Gene Exon 1 2 3 4 5 6 7 8-I 8-II 9-I 9-II
Primer set
Product size
Primer sequence
hsb-S1-(-19) hsb-A1-106 hsb-S2-145 hsb-A2-208 hsb-Sin2-(-42) hsb-Ain3-(46) hsb-S4-319 hsb-A4-508 hsb-Sin4-(-37) hsb-Ain5-(40) hsb-Sin5-(-81) hsb-Ain6-(23) hsb-Sin6-(-54) hsb-Ain7-(23) hsb-Sin7-(-34) hsb-A8-982 hsb-S8-1035 hsb-Ain8-(44) hsb-Sin8-(-51) hsb-A9-1340 hsb-S9-1320 hsb-A9-1548
162
59GCCTCCGGATCGATCTTCT39 59CTGAGATGGGCATAGATACTG39 59CAGTCAGCAGAGGACCTTG39 59TTTGAAGTTTGGTCTTATCCT39 59AACTATGATGATTCTGACCAAG39 59AATGTTACTTTCACTATCTC39 59GGACTATAGAGTTAACATCTTCC39 59CTCATGCTGACAAGGACATC39 59ATCAGATGGATGACAGAGAAGT39 59GTATTACCCAGACATTTTAAA39 59TTTCTTTCCTTGTGCTATG39 59TCTTTGAAATAGAACTTCGT39 59CAGGTCTGTCATTGATGTTT39 59TATAATCTGTTCCTGATGTGA39 59CAGAACATCTCATAGGGATAA39 59ATAAGCCAAACATCAAGAG39 59GGCTAAAAAGAATACTGTGA39 59CTCTCTCTTGACACGATG39 59AATATCGTTTGAAGAGATGTG39 59TTAGCCTGAGATTTCCCAAGT39 59TATGACTGCTATGGAAAAC39 59CACAGATTGGCATTTATGAAA39
101 195 230 203 284 269 151 119 235 266
spastic mouse, the intronic insertion of a LINE-1 element into the Glrb gene interferes with pre-mRNA splicing (Kingsmore et al., 1994; Mu¨lhardt et al., 1994). These mouse lines illustrate that mutations of glycine receptor a1 and b subunit genes may result in similar neurological disorders. In addition to GLRA1, this finding suggests GLRB to be a candidate gene for human hypertonic motor disorders resembling hyperekplexia. Here we describe the cloning, refined chromosomal localization, and analysis of the exon–intron structure of the human gene encoding the GlyR b subunit. We also report a frequent silent mutation of GLRB present both in the normal population and in families affected by hypertonic disorders. MATERIALS AND METHODS PCR conditions, SSCP, and DNA sequencing. PCR amplifications of genomic DNA were carried out as described (Mu¨lhardt et al., 1994), except that the annealing temperature was 55°C for 30 cycles. For SSCP, amplimers were separated on a 12% polyacrylamide gel at 10, 15, 20, and 25°C, and silver stained (Pharmacia Biotech). PCR products showing a band shift were subcloned in the pZEr0-2 vector (Invitrogen) and sequenced with an ABI 377 automated sequencing apparatus. Libraries, screening, and genomic structure. Two cDNA fragments, P1 and P2, were amplified from a human hippocampal library (Clontech). The primers employed for the amplification of fragment P1 (646 bp), covering nt -37/609 of the glycine receptor b subunit cDNA (Handford et al., 1996; GenBank Accession No. U33267), were hsb-S1-(-19) (Table 1) and hsb-A5-591 (59 AGCTCTCCAGTTGCATCTTG 39). The primers used for the amplification of fragment P2 (955 bp), covering nt 612/1567 of the b subunit cDNA, were hsb-S6635 (59 GGTTACACAACTGATGATTTACG 39) and hsb-A9-1548 (Table 1). The hippocampal library was screened with a-32P-labeled P1 and P2 probes as described (Sambrook et al., 1989). A human PAC library (Reference Library, RZPD, Berlin, Germany; Ioannou et al., 1994) was screened using the bB cDNA clone labeled by
random hexamer priming according to standard procedures (Sambrook et al., 1989). This approach led to the isolation of one positive clone, ICRFc100D11145, abbreviated in the following text as KN1. PCR amplification employing specific primers for each of the nine GLRB exons showed that clone KN1 comprised the entire coding region of GLRB. Primer pairs were hsb-S1-34 59 GACAACTGCCTTTTTAATTTT 39 and hsb-A1-106 59 CTGAGATGGGCATAGATACTG 39 for exon 1, hsb-S2145 59 CAGTCAGCAGAGGACCTTG 39 and hsb-A2-208 59 TTTGAAGTTTGGTCTTATCCT 39 for exon 2, hsb-S3-249 59 GGCATTCCTGTTGATGTAGTA 39 and hsb-A3-247 59 TGTTGTTTCTTGAATGGATCC 39 for exon 3, hsb-S4-319 59 GGACTATAGAGTTAACATCTTCC 39 and hsb-A4-508 59 CTCATGCTGACAAGGACATC 39 for exon 4, hsb-S5-550 59GTTATCTATTACTCTTTCATGCC 39 and hsb-A5-591 59 AGCTCTCCAGTTGCATCTTG 39 for exon 5, hsb-S6-635 59 GGTTACACAACTGATGATTTACG 39 and hsb-A6-733 59 GCCCGT GCCTTTATAGTATTT 39 for exon 6, hsb-S7-772 59 CTACTACACATGCGTGGAAG 39 and hsb-A7-888 59 CCAGGGGCACTCTGGCA 39 for exon 7, hsb-S81035 59 GGCTAAAAAGAATACTGTGA 39 and hsb-A8-982 59 ATAAGCCAAACATCAAGAG 39 for exon 8, and hsb-S9-1217 59 GTTGGTGAGACCAGATGCAA 39 and hsb-A9-1548 59 CACAGATTGGCATTTATGAAA 39 for exon 9. FISH. PAC clone KN1 was labeled with digoxigenin-11– dUTP (Boehringer Mannheim, Mannheim, Germany) using standard nick translation protocols, and FISH was performed to normal human metaphase chromosomes as described (Lichter et al., 1990). Experiments were analyzed by epifluorescence microscopy. Digitized images were obtained with a CCD camera (Photometrics, Tucson, AZ), electronically overlaid and aligned.
RESULTS AND DISCUSSION
Transcript Variants of GLRB Based on published sequences of the human glycine receptor b subunit (Handford et al., 1996), cDNA fragments P1 (nt -37 to 609 of the cDNA, 646 bp) and P2 (nt 612 to 1567, 955 bp) were amplified by PCR from a human hippocampal cDNA library. Using a mixture of both amplimers as a probe, 16 independent clones were
GLRB STRUCTURE AND POLYMORPHISM
343
1.6-kb DNA fragment, while the 59-UTR sequence of clone bA failed to produce corresponding amplimers (not shown). This suggests that the 59-UTR of transcript variant bA, which was derived from independent cDNA clones (Handford et al., 1996; these data), may reside upstream of the 59-UTR of bB and, in any case, is not contained in the genomic clone KN1. It remains to be shown whether these transcript variants result from alternative splicing of the 59-UTR or usage of alternative promoters. The sequence of the human b polypeptide diverged from that of the human a1 subunit, displaying an amino acid identity of 48% (Handford et al., 1996). Significant differences exist in the cytoplasmic loop linking TM3 and TM4. In the b subunit, this loop comprises the binding motif for the intracellular anchoring protein gephyrin. This motif has been implicated in the molecular interaction of GlyR channels with gephyrin, resulting in postsynaptic clustering of receptors (Meyer et al., 1995). Genomic Structure and Refinement of the Chromosomal Localization of GLRB
FIG. 1. Nucleotide and deduced amino acid sequences of the human GlyR b subunit cDNA. The 59-UTR nucleotide sequences of the bA and bB cDNA clones diverge beyond nt position -31. The sequence is given for the bA transcript, where different from bB. The four putative transmembrane domains are underlined. Exon borders are indicated by arrows.
isolated. To confirm their identity, clones were first subjected to PCR amplification using two primer pairs specific for the b subunit cDNA sequence, encompassing nt 126 to 228 and nt 1197 to 1567, and then completely sequenced. The sequence of clone l081-11, termed bA (Fig. 1), contained the complete open reading frame, covering 497 amino acids and, thus, was identical to the human b subunit sequence published previously (Handford et al., 1996). In contrast, clone A531, named bB, also contained the complete open reading frame, but diverged from bA in the 59-UTR beyond nt position -31 (Fig. 1). Analysis of further clones showed that the independent clone l61-11 also contained the novel 59-UTR of bB. PCR amplification from genomic clone KN1 (see below) using a primer pair specific for the 59-UTR of clone bB resulted in a
To isolate the GLRB gene, a human PAC library was screened employing the radiolabeled bB cDNA clone as a probe. A unique clone (KN1) that proved to comprise the complete coding regions of GLRB as shown by PCR amplification was identified. Given the homology of human and murine sequences, primer pairs were positioned to putative exon borders as predicted from the murine gene structure (Mu¨lhardt et al., 1994), and used for sequencing the genomic clone KN1. Analysis of exon–intron boundaries showed that GLRB contained nine exons (Figs. 1 and 2), indeed resembling the situation in the murine Glrb gene (Kingsmore et al., 1994; Mu¨lhardt et al., 1994). All of the human exon–intron splice signals were consistent with the AG/CT rule (Shapiro and Senepathy, 1987). A comparison of the genomic organization of GLRA1 and GLRB showed that the position of most of the introns was conserved between both human subunit genes. This observation emphasizes the need to apply a unifying numbering for both murine and human glycine receptor subunit genes. For an analysis of the highly homologous human and murine glycine receptor a1 subunit
FIG. 2. Exon–intron organization of the human genes encoding the b (GLRB) and the a1 (GLRA1) subunits of the glycine receptor. Exons are given in arabic numbers, and introns are given in roman numerals. Some conserved structural features of the deduced proteins are indicated: hatched boxes indicate signal peptides; black boxes indicate transmembrane segments TM1–TM4. The shadowed areas denote the different positions of introns I and VII in both genes.
344
MILANI ET AL.
FIG. 3. Chromosomal mapping of the GLRB gene to normal human metaphase cells by FISH. The hybridized probe PAC KN1 was detected via FITC, and chromosomes were counterstained with DAPI. A spread metaphase cell is shown on the left, illustrating the specificity of the hybridization experiment. On the right, individual chromosome 4 homologues with probe hybridization signals are shown to demonstrate the position of the signal on the chromosome. Careful comparison of DAPI and FITC images revealed that PAC KN1 is localized on chromosomal band 4q31.3.
genes, we therefore refer to the numbering scheme derived from the murine gene (Matzenbach et al., 1994), as an earlier scheme for GLRA1 lacked the designation of one exon (Shiang et al., 1993, 1995). In both species, the positions of introns I and VII differed between the a1 and the b subunit genes: In GLRB and Glrb, intron VII disrupts the exonic sequences encoding TM2 into two portions. In GLRA1 and Glra1, the corresponding intron separates the region encoding TM2 from those sequences predicting the extracellular loop linking TM2 to TM3 (Fig. 2). This is consistent with an early phylogenetic duplication. When amplification of intronic sequences was attempted from genomic DNA, introns II, IV, and V yielded PCRamplimers ranging in size from 106 bp to 1.8 kb. The size of human intron IV was found to match precisely that of the corresponding murine Glrb intron IV (106 bp). Other primer pairs failed to give consistent PCR results, suggesting that the corresponding introns were too large to be efficiently amplified (not shown). For the assessment of the chromosomal localization of GLRB, FISH was performed to normal human metaphase chromosomes using labeled PAC KN1. After probe detection with FITC and counterstaining of the chromosomes with DAPI (Lichter et al., 1990) of 40 metaphase cells, 15 with particularly extended chromosomes were selected for digital image analysis. The FITC images, revealing the probe signals, were overlaid with the images of DAPI-banded chromosomes. This allowed an assignment of GLRB to chromosomal band 4q31.3 (Fig. 3). No additional signals were found in other regions of the human genome.
SSCP Screening for GLRB Allelic Variants Glycine receptor mutant mice carrying pathological alleles of Glra1 and Glrb display similar phenotypes (Becker, 1995). By analogy, this has led to the proposal that GLRB represents a candidate for those motor disorders that resemble hyperekplexia but are not associated with a GLRA1 mutant allele. Therefore, genomic DNA samples from more than 30 index patients affected with hyperekplexia, as well as samples from 55 normal individuals, were screened for GLRB polymorphisms using SSCP analysis. To this end, we designed PCR primers covering exons 1 through 9 of GLRB positioned within flanking intronic sequences to ensure an amplification of the corresponding splice signals. Given the sizes of exons 8 and 9, two overlapping primer pairs were used (Table 1). Some of the primers employed had previously been used for the amplification of genomic clone KN1 (see Materials and Methods). Samples from families 16 and 21 exhibited a polymorphic banding for the 59 part of exon 8 (primer pair for exon 8-I). In particular, a band shift was observed for an affected boy and for his unaffected mother in family 16, as well as for the affected boy and his unaffected father in family 21 (not shown). The amplification products were subcloned, and sequence analysis of at least 10 recombinants per individual revealed a T3 C transition at nt 1024 of the cDNA sequence (Handford et al., 1996; these data) in about 50% of the clones. Within the leucine codon CTT in position 316, the polymorphic nucleotide exchange to CTC did not predict any amino acid substitution. When SSCP analysis of exon 8 was extended to normal individuals, the same nucleotide alteration was present in
GLRB STRUCTURE AND POLYMORPHISM
8 of the controls tested. This led to the conclusion that the GLRB allele T1024C may represent a frequent polymorphism (heterozygosity index: H 5 0.13) that does not correlate with hyperekplexia or any neurological phenotype. At present, it is not clear whether the underlying assumption that GLRB mutant alleles induce phenotypes resembling hyperekplexia will eventually hold true. In contrast to the mouse, human glycine receptor b subunit disorders might result in broader neurological symptoms, in particular as b subunit expression in the human CNS remains to be characterized. The refined localization of GLRB to the human chromosomal band 4q31.3 does not yet resolve this puzzle, as distinct neurological phenotypes have not been assigned to this region. Given the contribution of glycinergic inhibition to the regulation of human motor coordination (Becker, 1995), however, mutations in GLRB are highly likely to induce hereditary motor disorders. This would be consistent with the original hypothesis, placing GLRB as a candidate gene for hypertonic motor disorders. ACKNOWLEDGMENTS We thank Gullan Hebel-Klebsch and Renate Fa¨cke-Ku¨hnhauser for technical assistance. This work was supported by the Bundesministerium fu¨r Bildung und Forschung, the Deutsche Krebshilfe, the Commission of the European Union, and the Fonds der Chemischen Industrie.
REFERENCES Andermann, F., Keen, D. L., Andermann, E., and Quesney, L. F. (1980). Startle disease of hyperekplexia. Further delineation of the syndrome. Brain 103, 985–997. Baker, E., Sutherland, G. R., and Schofield, P. R. (1994). Localization of the glycine receptor a1 subunit gene (GLRA1) to chromosome 5q32 by FISH. Genomics 22, 491– 493. Becker, C.-M. (1995). Glycine receptors: Molecular heterogeneity and implications for disease. The Neuroscientist 1, 130 –141. Becker, C.-M., Hoch, W., and Betz, H. (1988). Glycine receptor heterogeneity in rat spinal cord during postnatal development. EMBO J. 7, 3717–3726. Betz, H. (1992). Structure and function of inhibitory glycine receptor. Quart. Rev. Biophys. 25: 381–394. Brune, W., Weber, R., Saul, B., von Knebel Doeberitz, M., GrondGinsbach, C., Kellermann, K., Meinck, H.-M., and Becker, C.-M. (1996). A GLRA1 Null mutation in recessive hyperekplexia challenges the functional role of glycine receptors. Am. J. Hum. Genet. 58, 989 –997. Derry, J. M., and Barnard, P. J. (1991). Mapping of the glycine receptor a2-subunit gene and of the GABAA a3-subunit gene on the mouse X chromosome. Genomics 10, 593–597. Elmslie, F. V., Hutchings, S. M., Spencer, V., Curtis, A., Covanis, T., Gardiner, R. M., and Rees, M. (1996). Analysis of GLRA1 in hereditary and sporadic hyperekplexia: A novel mutation in a familiy cosegregating for hyperekplexia and spastic paraparesis. J. Med. Gen. 33, 435– 436. Grenningloh, G., Pribilla, I., Prior, P., Multhaup, G., Beyreuther, K., Taleb, O., and Betz, H. (1990). Cloning and expression of the 58 kd b subunit of the inhibitory glycine receptor. Neuron 4, 963–970.
345
Handford, C. A., Lynch, J. W., Baker, E., Webb, G. C., Ford, J. H., Sutherland, G. R., and Schofield, P. R. (1996). The human glycine receptor ß subunit: Primary structure, functional characterisation and chromosomal localisation of the human and murine genes. Mol. Brain Res. 35, 211–219. Ioannou, P. A., Amamiya, C. T., Garnes, J., Kroisel, P. M., Shizuya, H., Chen, C., Batzer, M. A., and de Jong, P. J. (1994). A new bacteriophage P1-derived vector for the propagation of large human DNA fragments. Nat. Genet. 6, 84 – 89. Kingsmore, S. F., Giros, B., Suh, D., Bieniarz, M., Caron, M. G., and Seldin, M. F. (1994). Glycine receptor b-subunit gene mutation in spastic mouse associated with LINE-1 element insertion. Nat. Genet. 7, 136 –142. Kling, C., Koch, M., Saul, B., and Becker, C.-M. (1997). The frameshift mutation oscillator (Glra1spd-ot) produces a complete loss of glycine receptor a1-polypeptide in mouse central nervous system. Neuroscience 78, 441– 417. Lichter, P., Chang Tang, C. J., Call, K., Hermanson, G., Evans, G. A., Housman, D., and Ward, D. C. (1990). High-resolution mapping of human chromosome 11 by in situ hybridization with cosmid clones. Science 247, 64 – 69. Matzenbach, B., Maulet, Y., Sefton, L., Courtier, B., Avner, P., Guenet, J.-L., and Betz, H. (1994). Structural analysis of mouse glycine receptor a subunit genes: Identification and chromosomal localization of a novel variant, a4. J. Biol. Chem. 269, 2607–2612. Meyer, G., Kirsch, J., Betz, H., and Langosch, D. (1995). Identification of a gephyrin binding motif on the glycine receptor beta subunit. Neuron 15, 563–572. Milani, N., Dalpra’, L., Del Prete, A., Zanini, R., and Larizza, L. (1996). A novel mutation (Gln2663 His) in hereditary hyperekplexia. Am. J. Hum. Genet. 58, 420 – 422. Mu¨lhardt, C., Fischer, M., Gass, P., Simon-Chazottes, D., Gue´net, J.-L., Kuhse, J., Betz, H., and Becker, C.-M. (1994). The spastic mouse: Aberrant splicing of glycine receptor b subunit mRNA caused by intronic insertion of L1 element. Neuron 13, 1003–1015. Rees, M. I., Andrew, M., Jawad, S., and Owen, M. J. (1994). Evidence for recessive as well as dominant forms of startle disease (hyperekplexia) caused by mutations in the a1 subunit of the inhibitory glycine receptor. Hum. Mol. Genet. 3, 2175–2179. Ryan, S. G., Buckwalter, M. S., Lynch, J. W., Handford, C. A., Segura, L., Shiang, R., Wasmuth, J. J., Camper, S. A., Schofield, P., and O’Connell, P. (1994). A missense mutation in the gene encoding the a1 subunit of the inhibitory glycine receptor in the spasmodic mouse. Nat. Genet. 7, 131–135. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). ‘‘Molecular Cloning: A Laboratory Manual,’’ 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Saul, B., Schmieden, V., Kling, C., Mu¨lhardt, C., Gass, P., Kuhse, J., and Becker, C.-M. (1994). Point mutation of glycine receptor a1 subunit in the spasmodic mouse affects agonist responses. FEBS Lett. 350, 71–76. Shapiro, M. B., and Senapathy, P. (1987). RNA splice junctions of different classes of eukaryotes: Sequence statistics and functional implications in gene expression. Nucleic Acids Res. 15, 7155–7174. Shiang, R., Ryan, S. G., Zhu, Y. Z., Fielder, T. J., Allen, R. J., Fryer, A., Yamashita, S., O’Connell, P., and Wasmuth, J. J. (1995). Mutational analysis of familial and sporadic hyperekplexia. Ann. Neurol. 38, 85–91. Shiang, R., Ryan, S. G., Zhu, Y. Z., Hahn, A. F., O’Connell, P., and Wasmuth, J. J. (1993). Mutations in the a1 subunit of the inhibitory glycine receptor cause the dominant neurologic disorder, hyperekplexia. Nat. Genet. 5, 351–358.
50, 341–345 (1998) GE985324
ARTICLE NO.
The Human Glycine Receptor b Subunit Gene (GLRB): Structure, Refined Chromosomal Localization, and Population Polymorphism Nicoletta Milani,* Cornel Mu¨lhardt,* Ruthild G. Weber,† Peter Lichter,† Petra Kioschis,‡ Annemarie Poustka,‡ and Cord-Michael Becker*,1 *Institut fu¨r Biochemie, Universita¨t Erlangen-Nu¨rnberg, Fahrstrasse 17, D-91054 Erlangen, Germany; and †Abteilung Organisation Komplexer Genome and ‡Abteilung Molekulare Genomanalyse, Deutsches Krebsforschungszentrum, Im Neuenheimer Feld 280, D-69120 Heidelberg, Germany Received January 13, 1998; accepted March 24, 1998
The glycine receptor of the human CNS comprises ligand-binding a1 and structural b subunits encoded by the GLRA1 and GLRB genes, respectively. Screening of a human hippocampal cDNA library resulted in the identification of the novel subunit transcript bB, differing in the 5*-UTR. Analysis of the genomic organization of GLRB showed that the coding region is distributed over nine exons, highly homologous to the GLRA1 gene. By in situ hybridization, the chromosomal localization of GLRB was refined to band 4q31.3. Based on the identical phenotypes of mouse lines carrying mutant alleles of the a1 and b subunit genes, GLRB was assumed to be a candidate gene for those cases of hyperekplexia that cannot be associated with mutations of GLRA1. Therefore, flanking intronic sequences were determined, and DNA samples from more than 30 index patients were subjected to SSCP screening of the entire GLRB coding region. A polymorphism in exon 8 was found both in the normal population and in families affected by hyperekplexia, although no coding mutation was detectable. © 1998 Academic Press
INTRODUCTION
The strychnine-sensitive glycine receptor (GlyR) is a ligand-gated chloride channel mediating synaptic inhibition in spinal cord, brain stem, and other CNS regions. It exists in developmentally regulated, heteromeric isoforms composed of variants of the ligand-binding polypeptide (a1–a4) and structural (b) subunits (Becker et al., 1988; Betz, 1992; Becker, 1995). These subunits share a similar membrane topology in which a large extracellular N-terminal domain is followed by four membrane-spanning segments, TM1–TM4. Structural determinants of ligand binding have been identified within the N-terminal domain of the a polypeptides, while TM2 is thought to line the anion pore of the recep1 To whom correspondence should be addressed. Telephone: (49-9131) 85-4190. Fax: (49-9131) 85-2485. E-mail: C.-M.Becker@biochem. uni-erlangen.de.
tor channel (Betz, 1992; Becker, 1995). While the a subunit variants possess highly homologous primary structures displaying 80–90% amino acid identities, the b subunit exhibits a diverging amino acid sequence accounting for approximately 47% identity compared to the a1 subunit (Grenningloh et al., 1990; Kingsmore et al., 1994; Matzenbach et al., 1994; Mu¨lhardt et al., 1994; Handford et al., 1996). Human and murine glycine receptor genes represent a family of genes that share a similar exon–intron organization, suggesting a phylogenetic gene duplication (Shiang et al., 1995). The coding regions of the human GLRA1 gene and the murine Glra1, Glra2, and Glrb genes are spread over nine exons (Matzenbach et al., 1994; Mu¨lhardt et al., 1994). The GLRA1 and GLRB genes have been localized to human chromosomal regions 5q32 and 4q32, respectively (Baker et al., 1994; Handford et al., 1996). By synteny homology, these locations are linked to the murine loci on chromosome 11 (29 cM) and chromosome 3 (36 cM) of the Glra1 and Glrb genes, respectively. Interestingly, each of these loci is part of a cluster of amino acid receptor subunit genes also comprising glutamate and GABAA receptor subunits. In contrast, human and murine a2 genes as well as the Glra4 gene are located on the X chromosome (Grenningloh et al., 1990; Derry and Barnard, 1991). Hereditary hyperekplexia or startle disease (STHE; MIM 149400) is a rare neurological disorder characterized by infantile generalized muscular stiffness and excessive startle responses (Andermann et al., 1980). Mutations in the human gene encoding the a1 subunit (GLRA1) are causal to both dominant (Shiang et al., 1993; Shiang et al., 1995; Elmslie et al., 1996; Milani et al., 1996) and recessive (Rees et al., 1994; Brune et al., 1996) forms of hyperekplexia. The missense mutations found give rise to substitutions of amino acid residues located from the TM1 segment to the extracellular loop following segment TM2. Neurological phenotypes reminiscent of human hyperekplexia are encountered in three strains of mutant recessive mice. Spasmodic and oscillator mice carry mutant alleles of Glra1 (Ryan et al., 1994; Saul et al., 1994; Kling et al., 1997). In the
341
0888-7543/98 $25.00 Copyright © 1998 by Academic Press All rights of reproduction in any form reserved.
342
MILANI ET AL.
TABLE 1 PCR Primer Pairs for Amplification and SSCP Analysis of the GLRB Gene Exon 1 2 3 4 5 6 7 8-I 8-II 9-I 9-II
Primer set
Product size
Primer sequence
hsb-S1-(-19) hsb-A1-106 hsb-S2-145 hsb-A2-208 hsb-Sin2-(-42) hsb-Ain3-(46) hsb-S4-319 hsb-A4-508 hsb-Sin4-(-37) hsb-Ain5-(40) hsb-Sin5-(-81) hsb-Ain6-(23) hsb-Sin6-(-54) hsb-Ain7-(23) hsb-Sin7-(-34) hsb-A8-982 hsb-S8-1035 hsb-Ain8-(44) hsb-Sin8-(-51) hsb-A9-1340 hsb-S9-1320 hsb-A9-1548
162
59GCCTCCGGATCGATCTTCT39 59CTGAGATGGGCATAGATACTG39 59CAGTCAGCAGAGGACCTTG39 59TTTGAAGTTTGGTCTTATCCT39 59AACTATGATGATTCTGACCAAG39 59AATGTTACTTTCACTATCTC39 59GGACTATAGAGTTAACATCTTCC39 59CTCATGCTGACAAGGACATC39 59ATCAGATGGATGACAGAGAAGT39 59GTATTACCCAGACATTTTAAA39 59TTTCTTTCCTTGTGCTATG39 59TCTTTGAAATAGAACTTCGT39 59CAGGTCTGTCATTGATGTTT39 59TATAATCTGTTCCTGATGTGA39 59CAGAACATCTCATAGGGATAA39 59ATAAGCCAAACATCAAGAG39 59GGCTAAAAAGAATACTGTGA39 59CTCTCTCTTGACACGATG39 59AATATCGTTTGAAGAGATGTG39 59TTAGCCTGAGATTTCCCAAGT39 59TATGACTGCTATGGAAAAC39 59CACAGATTGGCATTTATGAAA39
101 195 230 203 284 269 151 119 235 266
spastic mouse, the intronic insertion of a LINE-1 element into the Glrb gene interferes with pre-mRNA splicing (Kingsmore et al., 1994; Mu¨lhardt et al., 1994). These mouse lines illustrate that mutations of glycine receptor a1 and b subunit genes may result in similar neurological disorders. In addition to GLRA1, this finding suggests GLRB to be a candidate gene for human hypertonic motor disorders resembling hyperekplexia. Here we describe the cloning, refined chromosomal localization, and analysis of the exon–intron structure of the human gene encoding the GlyR b subunit. We also report a frequent silent mutation of GLRB present both in the normal population and in families affected by hypertonic disorders. MATERIALS AND METHODS PCR conditions, SSCP, and DNA sequencing. PCR amplifications of genomic DNA were carried out as described (Mu¨lhardt et al., 1994), except that the annealing temperature was 55°C for 30 cycles. For SSCP, amplimers were separated on a 12% polyacrylamide gel at 10, 15, 20, and 25°C, and silver stained (Pharmacia Biotech). PCR products showing a band shift were subcloned in the pZEr0-2 vector (Invitrogen) and sequenced with an ABI 377 automated sequencing apparatus. Libraries, screening, and genomic structure. Two cDNA fragments, P1 and P2, were amplified from a human hippocampal library (Clontech). The primers employed for the amplification of fragment P1 (646 bp), covering nt -37/609 of the glycine receptor b subunit cDNA (Handford et al., 1996; GenBank Accession No. U33267), were hsb-S1-(-19) (Table 1) and hsb-A5-591 (59 AGCTCTCCAGTTGCATCTTG 39). The primers used for the amplification of fragment P2 (955 bp), covering nt 612/1567 of the b subunit cDNA, were hsb-S6635 (59 GGTTACACAACTGATGATTTACG 39) and hsb-A9-1548 (Table 1). The hippocampal library was screened with a-32P-labeled P1 and P2 probes as described (Sambrook et al., 1989). A human PAC library (Reference Library, RZPD, Berlin, Germany; Ioannou et al., 1994) was screened using the bB cDNA clone labeled by
random hexamer priming according to standard procedures (Sambrook et al., 1989). This approach led to the isolation of one positive clone, ICRFc100D11145, abbreviated in the following text as KN1. PCR amplification employing specific primers for each of the nine GLRB exons showed that clone KN1 comprised the entire coding region of GLRB. Primer pairs were hsb-S1-34 59 GACAACTGCCTTTTTAATTTT 39 and hsb-A1-106 59 CTGAGATGGGCATAGATACTG 39 for exon 1, hsb-S2145 59 CAGTCAGCAGAGGACCTTG 39 and hsb-A2-208 59 TTTGAAGTTTGGTCTTATCCT 39 for exon 2, hsb-S3-249 59 GGCATTCCTGTTGATGTAGTA 39 and hsb-A3-247 59 TGTTGTTTCTTGAATGGATCC 39 for exon 3, hsb-S4-319 59 GGACTATAGAGTTAACATCTTCC 39 and hsb-A4-508 59 CTCATGCTGACAAGGACATC 39 for exon 4, hsb-S5-550 59GTTATCTATTACTCTTTCATGCC 39 and hsb-A5-591 59 AGCTCTCCAGTTGCATCTTG 39 for exon 5, hsb-S6-635 59 GGTTACACAACTGATGATTTACG 39 and hsb-A6-733 59 GCCCGT GCCTTTATAGTATTT 39 for exon 6, hsb-S7-772 59 CTACTACACATGCGTGGAAG 39 and hsb-A7-888 59 CCAGGGGCACTCTGGCA 39 for exon 7, hsb-S81035 59 GGCTAAAAAGAATACTGTGA 39 and hsb-A8-982 59 ATAAGCCAAACATCAAGAG 39 for exon 8, and hsb-S9-1217 59 GTTGGTGAGACCAGATGCAA 39 and hsb-A9-1548 59 CACAGATTGGCATTTATGAAA 39 for exon 9. FISH. PAC clone KN1 was labeled with digoxigenin-11– dUTP (Boehringer Mannheim, Mannheim, Germany) using standard nick translation protocols, and FISH was performed to normal human metaphase chromosomes as described (Lichter et al., 1990). Experiments were analyzed by epifluorescence microscopy. Digitized images were obtained with a CCD camera (Photometrics, Tucson, AZ), electronically overlaid and aligned.
RESULTS AND DISCUSSION
Transcript Variants of GLRB Based on published sequences of the human glycine receptor b subunit (Handford et al., 1996), cDNA fragments P1 (nt -37 to 609 of the cDNA, 646 bp) and P2 (nt 612 to 1567, 955 bp) were amplified by PCR from a human hippocampal cDNA library. Using a mixture of both amplimers as a probe, 16 independent clones were
GLRB STRUCTURE AND POLYMORPHISM
343
1.6-kb DNA fragment, while the 59-UTR sequence of clone bA failed to produce corresponding amplimers (not shown). This suggests that the 59-UTR of transcript variant bA, which was derived from independent cDNA clones (Handford et al., 1996; these data), may reside upstream of the 59-UTR of bB and, in any case, is not contained in the genomic clone KN1. It remains to be shown whether these transcript variants result from alternative splicing of the 59-UTR or usage of alternative promoters. The sequence of the human b polypeptide diverged from that of the human a1 subunit, displaying an amino acid identity of 48% (Handford et al., 1996). Significant differences exist in the cytoplasmic loop linking TM3 and TM4. In the b subunit, this loop comprises the binding motif for the intracellular anchoring protein gephyrin. This motif has been implicated in the molecular interaction of GlyR channels with gephyrin, resulting in postsynaptic clustering of receptors (Meyer et al., 1995). Genomic Structure and Refinement of the Chromosomal Localization of GLRB
FIG. 1. Nucleotide and deduced amino acid sequences of the human GlyR b subunit cDNA. The 59-UTR nucleotide sequences of the bA and bB cDNA clones diverge beyond nt position -31. The sequence is given for the bA transcript, where different from bB. The four putative transmembrane domains are underlined. Exon borders are indicated by arrows.
isolated. To confirm their identity, clones were first subjected to PCR amplification using two primer pairs specific for the b subunit cDNA sequence, encompassing nt 126 to 228 and nt 1197 to 1567, and then completely sequenced. The sequence of clone l081-11, termed bA (Fig. 1), contained the complete open reading frame, covering 497 amino acids and, thus, was identical to the human b subunit sequence published previously (Handford et al., 1996). In contrast, clone A531, named bB, also contained the complete open reading frame, but diverged from bA in the 59-UTR beyond nt position -31 (Fig. 1). Analysis of further clones showed that the independent clone l61-11 also contained the novel 59-UTR of bB. PCR amplification from genomic clone KN1 (see below) using a primer pair specific for the 59-UTR of clone bB resulted in a
To isolate the GLRB gene, a human PAC library was screened employing the radiolabeled bB cDNA clone as a probe. A unique clone (KN1) that proved to comprise the complete coding regions of GLRB as shown by PCR amplification was identified. Given the homology of human and murine sequences, primer pairs were positioned to putative exon borders as predicted from the murine gene structure (Mu¨lhardt et al., 1994), and used for sequencing the genomic clone KN1. Analysis of exon–intron boundaries showed that GLRB contained nine exons (Figs. 1 and 2), indeed resembling the situation in the murine Glrb gene (Kingsmore et al., 1994; Mu¨lhardt et al., 1994). All of the human exon–intron splice signals were consistent with the AG/CT rule (Shapiro and Senepathy, 1987). A comparison of the genomic organization of GLRA1 and GLRB showed that the position of most of the introns was conserved between both human subunit genes. This observation emphasizes the need to apply a unifying numbering for both murine and human glycine receptor subunit genes. For an analysis of the highly homologous human and murine glycine receptor a1 subunit
FIG. 2. Exon–intron organization of the human genes encoding the b (GLRB) and the a1 (GLRA1) subunits of the glycine receptor. Exons are given in arabic numbers, and introns are given in roman numerals. Some conserved structural features of the deduced proteins are indicated: hatched boxes indicate signal peptides; black boxes indicate transmembrane segments TM1–TM4. The shadowed areas denote the different positions of introns I and VII in both genes.
344
MILANI ET AL.
FIG. 3. Chromosomal mapping of the GLRB gene to normal human metaphase cells by FISH. The hybridized probe PAC KN1 was detected via FITC, and chromosomes were counterstained with DAPI. A spread metaphase cell is shown on the left, illustrating the specificity of the hybridization experiment. On the right, individual chromosome 4 homologues with probe hybridization signals are shown to demonstrate the position of the signal on the chromosome. Careful comparison of DAPI and FITC images revealed that PAC KN1 is localized on chromosomal band 4q31.3.
genes, we therefore refer to the numbering scheme derived from the murine gene (Matzenbach et al., 1994), as an earlier scheme for GLRA1 lacked the designation of one exon (Shiang et al., 1993, 1995). In both species, the positions of introns I and VII differed between the a1 and the b subunit genes: In GLRB and Glrb, intron VII disrupts the exonic sequences encoding TM2 into two portions. In GLRA1 and Glra1, the corresponding intron separates the region encoding TM2 from those sequences predicting the extracellular loop linking TM2 to TM3 (Fig. 2). This is consistent with an early phylogenetic duplication. When amplification of intronic sequences was attempted from genomic DNA, introns II, IV, and V yielded PCRamplimers ranging in size from 106 bp to 1.8 kb. The size of human intron IV was found to match precisely that of the corresponding murine Glrb intron IV (106 bp). Other primer pairs failed to give consistent PCR results, suggesting that the corresponding introns were too large to be efficiently amplified (not shown). For the assessment of the chromosomal localization of GLRB, FISH was performed to normal human metaphase chromosomes using labeled PAC KN1. After probe detection with FITC and counterstaining of the chromosomes with DAPI (Lichter et al., 1990) of 40 metaphase cells, 15 with particularly extended chromosomes were selected for digital image analysis. The FITC images, revealing the probe signals, were overlaid with the images of DAPI-banded chromosomes. This allowed an assignment of GLRB to chromosomal band 4q31.3 (Fig. 3). No additional signals were found in other regions of the human genome.
SSCP Screening for GLRB Allelic Variants Glycine receptor mutant mice carrying pathological alleles of Glra1 and Glrb display similar phenotypes (Becker, 1995). By analogy, this has led to the proposal that GLRB represents a candidate for those motor disorders that resemble hyperekplexia but are not associated with a GLRA1 mutant allele. Therefore, genomic DNA samples from more than 30 index patients affected with hyperekplexia, as well as samples from 55 normal individuals, were screened for GLRB polymorphisms using SSCP analysis. To this end, we designed PCR primers covering exons 1 through 9 of GLRB positioned within flanking intronic sequences to ensure an amplification of the corresponding splice signals. Given the sizes of exons 8 and 9, two overlapping primer pairs were used (Table 1). Some of the primers employed had previously been used for the amplification of genomic clone KN1 (see Materials and Methods). Samples from families 16 and 21 exhibited a polymorphic banding for the 59 part of exon 8 (primer pair for exon 8-I). In particular, a band shift was observed for an affected boy and for his unaffected mother in family 16, as well as for the affected boy and his unaffected father in family 21 (not shown). The amplification products were subcloned, and sequence analysis of at least 10 recombinants per individual revealed a T3 C transition at nt 1024 of the cDNA sequence (Handford et al., 1996; these data) in about 50% of the clones. Within the leucine codon CTT in position 316, the polymorphic nucleotide exchange to CTC did not predict any amino acid substitution. When SSCP analysis of exon 8 was extended to normal individuals, the same nucleotide alteration was present in
GLRB STRUCTURE AND POLYMORPHISM
8 of the controls tested. This led to the conclusion that the GLRB allele T1024C may represent a frequent polymorphism (heterozygosity index: H 5 0.13) that does not correlate with hyperekplexia or any neurological phenotype. At present, it is not clear whether the underlying assumption that GLRB mutant alleles induce phenotypes resembling hyperekplexia will eventually hold true. In contrast to the mouse, human glycine receptor b subunit disorders might result in broader neurological symptoms, in particular as b subunit expression in the human CNS remains to be characterized. The refined localization of GLRB to the human chromosomal band 4q31.3 does not yet resolve this puzzle, as distinct neurological phenotypes have not been assigned to this region. Given the contribution of glycinergic inhibition to the regulation of human motor coordination (Becker, 1995), however, mutations in GLRB are highly likely to induce hereditary motor disorders. This would be consistent with the original hypothesis, placing GLRB as a candidate gene for hypertonic motor disorders. ACKNOWLEDGMENTS We thank Gullan Hebel-Klebsch and Renate Fa¨cke-Ku¨hnhauser for technical assistance. This work was supported by the Bundesministerium fu¨r Bildung und Forschung, the Deutsche Krebshilfe, the Commission of the European Union, and the Fonds der Chemischen Industrie.
REFERENCES Andermann, F., Keen, D. L., Andermann, E., and Quesney, L. F. (1980). Startle disease of hyperekplexia. Further delineation of the syndrome. Brain 103, 985–997. Baker, E., Sutherland, G. R., and Schofield, P. R. (1994). Localization of the glycine receptor a1 subunit gene (GLRA1) to chromosome 5q32 by FISH. Genomics 22, 491– 493. Becker, C.-M. (1995). Glycine receptors: Molecular heterogeneity and implications for disease. The Neuroscientist 1, 130 –141. Becker, C.-M., Hoch, W., and Betz, H. (1988). Glycine receptor heterogeneity in rat spinal cord during postnatal development. EMBO J. 7, 3717–3726. Betz, H. (1992). Structure and function of inhibitory glycine receptor. Quart. Rev. Biophys. 25: 381–394. Brune, W., Weber, R., Saul, B., von Knebel Doeberitz, M., GrondGinsbach, C., Kellermann, K., Meinck, H.-M., and Becker, C.-M. (1996). A GLRA1 Null mutation in recessive hyperekplexia challenges the functional role of glycine receptors. Am. J. Hum. Genet. 58, 989 –997. Derry, J. M., and Barnard, P. J. (1991). Mapping of the glycine receptor a2-subunit gene and of the GABAA a3-subunit gene on the mouse X chromosome. Genomics 10, 593–597. Elmslie, F. V., Hutchings, S. M., Spencer, V., Curtis, A., Covanis, T., Gardiner, R. M., and Rees, M. (1996). Analysis of GLRA1 in hereditary and sporadic hyperekplexia: A novel mutation in a familiy cosegregating for hyperekplexia and spastic paraparesis. J. Med. Gen. 33, 435– 436. Grenningloh, G., Pribilla, I., Prior, P., Multhaup, G., Beyreuther, K., Taleb, O., and Betz, H. (1990). Cloning and expression of the 58 kd b subunit of the inhibitory glycine receptor. Neuron 4, 963–970.
345
Handford, C. A., Lynch, J. W., Baker, E., Webb, G. C., Ford, J. H., Sutherland, G. R., and Schofield, P. R. (1996). The human glycine receptor ß subunit: Primary structure, functional characterisation and chromosomal localisation of the human and murine genes. Mol. Brain Res. 35, 211–219. Ioannou, P. A., Amamiya, C. T., Garnes, J., Kroisel, P. M., Shizuya, H., Chen, C., Batzer, M. A., and de Jong, P. J. (1994). A new bacteriophage P1-derived vector for the propagation of large human DNA fragments. Nat. Genet. 6, 84 – 89. Kingsmore, S. F., Giros, B., Suh, D., Bieniarz, M., Caron, M. G., and Seldin, M. F. (1994). Glycine receptor b-subunit gene mutation in spastic mouse associated with LINE-1 element insertion. Nat. Genet. 7, 136 –142. Kling, C., Koch, M., Saul, B., and Becker, C.-M. (1997). The frameshift mutation oscillator (Glra1spd-ot) produces a complete loss of glycine receptor a1-polypeptide in mouse central nervous system. Neuroscience 78, 441– 417. Lichter, P., Chang Tang, C. J., Call, K., Hermanson, G., Evans, G. A., Housman, D., and Ward, D. C. (1990). High-resolution mapping of human chromosome 11 by in situ hybridization with cosmid clones. Science 247, 64 – 69. Matzenbach, B., Maulet, Y., Sefton, L., Courtier, B., Avner, P., Guenet, J.-L., and Betz, H. (1994). Structural analysis of mouse glycine receptor a subunit genes: Identification and chromosomal localization of a novel variant, a4. J. Biol. Chem. 269, 2607–2612. Meyer, G., Kirsch, J., Betz, H., and Langosch, D. (1995). Identification of a gephyrin binding motif on the glycine receptor beta subunit. Neuron 15, 563–572. Milani, N., Dalpra’, L., Del Prete, A., Zanini, R., and Larizza, L. (1996). A novel mutation (Gln2663 His) in hereditary hyperekplexia. Am. J. Hum. Genet. 58, 420 – 422. Mu¨lhardt, C., Fischer, M., Gass, P., Simon-Chazottes, D., Gue´net, J.-L., Kuhse, J., Betz, H., and Becker, C.-M. (1994). The spastic mouse: Aberrant splicing of glycine receptor b subunit mRNA caused by intronic insertion of L1 element. Neuron 13, 1003–1015. Rees, M. I., Andrew, M., Jawad, S., and Owen, M. J. (1994). Evidence for recessive as well as dominant forms of startle disease (hyperekplexia) caused by mutations in the a1 subunit of the inhibitory glycine receptor. Hum. Mol. Genet. 3, 2175–2179. Ryan, S. G., Buckwalter, M. S., Lynch, J. W., Handford, C. A., Segura, L., Shiang, R., Wasmuth, J. J., Camper, S. A., Schofield, P., and O’Connell, P. (1994). A missense mutation in the gene encoding the a1 subunit of the inhibitory glycine receptor in the spasmodic mouse. Nat. Genet. 7, 131–135. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). ‘‘Molecular Cloning: A Laboratory Manual,’’ 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Saul, B., Schmieden, V., Kling, C., Mu¨lhardt, C., Gass, P., Kuhse, J., and Becker, C.-M. (1994). Point mutation of glycine receptor a1 subunit in the spasmodic mouse affects agonist responses. FEBS Lett. 350, 71–76. Shapiro, M. B., and Senapathy, P. (1987). RNA splice junctions of different classes of eukaryotes: Sequence statistics and functional implications in gene expression. Nucleic Acids Res. 15, 7155–7174. Shiang, R., Ryan, S. G., Zhu, Y. Z., Fielder, T. J., Allen, R. J., Fryer, A., Yamashita, S., O’Connell, P., and Wasmuth, J. J. (1995). Mutational analysis of familial and sporadic hyperekplexia. Ann. Neurol. 38, 85–91. Shiang, R., Ryan, S. G., Zhu, Y. Z., Hahn, A. F., O’Connell, P., and Wasmuth, J. J. (1993). Mutations in the a1 subunit of the inhibitory glycine receptor cause the dominant neurologic disorder, hyperekplexia. Nat. Genet. 5, 351–358.