- Email: [email protected]
The human papillomavirus type 11 E1^E4 protein is not essential for viral genome amplification
Virology 351 (2006) 271 – 279 www.elsevier.com/locate/yviro
The human papillomavirus type 11 E1^E4 protein is not essential for viral genome amplification L. Fang a , L.R. Budgeon b , J. Doorbar c , E.R. Briggs a , M.K. Howett a,⁎ a
b
Department of Bioscience and Biotechnology, Drexel University, 3141 Chestnut Street, Stratton Hall, Rm 118, Philadelphia, PA 19104, USA Department of Pathology, The Jake Gittlen Cancer Research Institute, The Pennsylvania State University, College of Medicine, Hershey, PA 16802, USA c Division of Virology, The National Institute for Medical Research, The Ridgeway, Mill Hill, London NW71AA, United Kingdom Received 1 August 2005; returned to author for revision 19 September 2005; accepted 9 January 2006 Available online 9 May 2006
Abstract An abundant human papillomavirus (HPV) protein E1^E4 is expressed late in the virus life cycle in the terminally differentiated layers of epithelia. The expression of E1^E4 usually coincides with the onset of viral DNA amplification. However, the function of E1^E4 in viral life cycle is not completely understood. To examine the role of E1^E4 in the virus life cycle, we introduced a single nucleotide change in the HPV-11 genome to result in a truncation of E1^E4 protein without affecting the E2 amino acid sequence. This mutated HPV-11 genome was introduced into a human foreskin keratinocyte cell line immortalized by the catalytic subunit of human telomerase, deficient in p16INK4a expression, and previously shown to support the HPV-11 life cycle when grown in organotypic raft culture. We have demonstrated that E1^E4 is dispensable for HPV-11 viral DNA amplification in the late stages of the viral life cycle. © 2006 Elsevier Inc. All rights reserved. Keywords: Human papillomavirus type 11; Organotypic raft culture; E1^E4
Introduction Human papillomaviruses (HPV) are small DNA tumor viruses that are epitheliotropic and can cause benign or malignant epithelial lesions at various sites (Shah and Howley, 1996). More than 200 different HPVs have been identified, and they can also be classified into two groups according to the route of infection (de Villiers, 2001). Cutaneous HPV, such as HPV-1, infect cutaneous epithelia, and mucosal HPV, such as HPV-11 and HPV-16, infect mucosal epithelium, for these two types, mucosa of the anogenital tract. Anogenital-associated HPV are further classified into two groups based on their oncogenic potential as either low or high risk types (de Villiers, 2001). HPV-6 and HPV-11 are prototypes of the low risk group, which are found primarily in benign, low-grade genital lesions at mucosal sites, known as warts or condylomata, and in some cases at cutaneous sites (Ko and Chu, 2004). HPV-16 and HPV18 are prototypes of the high risk group, which are found ⁎ Corresponding author. Fax: +1 215 895 1273. E-mail address: [email protected] (M.K. Howett). 0042-6822/$ - see front matter © 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.virol.2006.01.051
predominantly in high-grade cervical dysplasias and cervical carcinomas (Shah and Howley, 1996). Despite the differences in tissue tropism and the severity of the epithelial lesions that various HPVs cause, many common characteristics and events in the viral life cycles are shared among various HPVs. The HPV viral life cycle is tightly linked to the differentiation program of keratinocytes, and productive infection is limited to the terminally differentiated keratinocytes (Howley, 1996). HPV is thought to initially infect stem cells or transit amplifying cells in the basal layer of the epithelium. Following virus entry into basal epithelial cells, HPV genomes are initially amplified as episomes to approximately 50–100 copies per cell with low levels of HPV early gene expression (Stubenrauch and Laimins, 1999). Productive replication of the viral genome then occurs, and viral DNA amplifies to a high level of approximately 1000 copies per cell with epithelial cell differentiation and migration towards epithelial cell surface (Stubenrauch and Laimins, 1999). Viral DNA amplification is usually followed by viral capsid antigen synthesis and assembly of the progeny virion in the terminally differentiated epithelial layers (Peh et al., 2002).
272
L. Fang et al. / Virology 351 (2006) 271–279
E1^E4 RNA is a spliced product transcribed from the E1 and the E4 open reading frames (ORFs). Codons for the first 5 amino acids are from the E1 ORF, and the remaining amino acids are from the E4 ORF. E1^E4 is the most abundant viral gene product constituting approximately 90% of viral transcripts in genital condylomata. In experimentally generated human papillomas arising from HPV-11-infected foreskin xenografts, over 80% of total viral transcripts represent the predominant E1^E4 transcripts (Fecile, 1995). However, the role of E1^E4 in the papillomavirus life cycle remains speculative. Although the E1^E4 protein shows little conservation among HPV types, E1^E4 expression occurs in the upper layers of differentiated epithelia and its expression coincides with the onset of viral DNA amplification and occurs before and with the expression of viral capsid proteins (Doorbar et al., 1997; Middleton et al., 2003; Peh et al., 2002). A role of E1^E4 in the productive stage of viral life cycle has been suggested. However, despite the correlation of E1^E4 expression and the onset of viral DNA amplification, which occurs in the nucleus, E1^E4 is mainly located in the cytoplasm (Doorbar et al., 1997). E1^E4 has also been shown to interact with cellular keratins when expressed in cultured epithelial cells and result in collapse of the epithelial cell intermediate filament network (Doorbar et al., 1991). The N-terminal leucine-rich motif is thought to be important for the mucosal types of HPV E1^E4 association with cellular keratin (Roberts et al., 1994; Wang et al., 2004), and the association suggested a role in inhibition of keratin dynamics and the sequestering of E1^E4's cellular targets in the cytoplasm (Wang et al., 2004). A physical interaction of HPV-16 E1^E4 through its C-terminus and a novel cellular protein, E4-DEAD box protein (E4-DBP), has also been demonstrated (Doorbar et al., 2000). Members of the DEAD box protein family, to which E4-DBP belongs, are typically involved in the regulation of mRNA stability, suggesting that HPV-16 E1^E4 may play a role in the post-transcriptional regulation of viral gene expression. HPV-11 E^E4 protein has also been shown to associate with the cornified cell envelope (Bryan and Brown, 2000), suggesting that E1^E4 may aid in the release and spread of infectious viruses. HPV-16, 18 and 11 E1^E4 can also mediate G2 cell cycle arrest in cervical cancer cells, and the proline-rich region of the protein is important for the arrest (Davy et al., 2002; Nakahara et al., 2002). HPV-16 E1^E4-induced G2 arrest is associated with cytoplasmic retention of active cdk1/cyclin B complex (Davy et al., 2005). Recently, HPV16 E1^E4 has been shown to associate with mitochondria and cause severely reduction of the mitochondrial membrane potential and an induction of apoptosis (Raj et al., 2004). However, the significance for the associations of E1^E4 with cellular keratin, E4-DBP and with mitochondria, as well as the E1^E4-induced cell cycle arrest with respect to the viral life cycle remains speculative. Functional analysis of E1^E4 in the context of viral life cycle has been hindered by the lack of in vitro system for productive viral infection and by the overlapping nature of the E4 and the E2 ORFs. Recent advances in the development of model systems for papillomavirus growth, such as organotypic raft cultures (Bedell et al., 1991; Meyers et al., 1992) and animal papillomavirus models, such as the
cottontail rabbit papillomavirus (CRPV) model (Brandsma and Xiao, 1993), allowed the study of individual viral proteins in the complete viral life cycle through mutagenesis (Brandsma et al., 1991; Flores et al., 2000; Peh et al., 2004). A recent study with CRPV showed that E1^E4 is not required for the formation of papillomas but is required for viral DNA amplification and capsid antigen synthesis (Peh et al., 2004). Mutational analysis of HPV-31 E1^E4 in normal human keratinocytes grown in semi-solid media showed reduction of viral DNA amplification and late viral transcript levels, suggesting that E1^E4 may play a role in viral DNA amplification and regulation of viral late gene expression (Wilson et al., 2005). Our previous studies demonstrate that human keratinocytes immortalized by the catalytic subunit of human telomerase (N-Tert) (Dickson et al., 2000), which retain normal growth and differentiation characteristics, can support the productive stage of the HPV-11 viral life cycle (Fang et al., 2006). In the study presented here, we examined the role of E1^E4 in the HPV-11 viral life cycle by comparing the severely truncated form and the wild type HPV-11 E1^E4 in the context of the whole viral genome in N-Tert cells grown in the organotypic raft cultures. We demonstrated that HPV-11 E1^E4 is not essential for viral DNA amplification in the late stages of the viral life cycle. Results and discussion HPV-11 E1^E4 is not required for episomal DNA maintenance in monolayer HPV-11 N-Tert cells To examine the role of HPV-11 E1^E4 in the viral life cycle, a single nucleotide change was introduced at position 3346, so that the first leucine of the leucine-rich motif was changed to a stop codon in the ORF of E4 while the overlapping E2 amino acid sequence was unaffected. The mutant was predicted to express a truncated E1^E4 protein consisting of the N-terminal 12 amino acids of the 90 amino acids full-length E1^E4. Two separately derived and sequence-confirmed E1^E4 mutant clones and the wild type plasmid (pBT-1) containing the whole HPV-11 genome were separated from the vector by BamHI digestion and electroporated separately into N-Tert cells along with a neomycin resistance marker. After selection, individual cell populations from each electroporation were analyzed for the presence of HPV-11 DNA by Southern blot analysis using full-length HPV-11 DNA as a probe. Results showed that both the wild type HPV-11 N-Tert cells (W-2 and W-6) and the HPV-11 E1^E4 mutant N-Tert cells (1-1, 1-3, 3-2 and 3-3) were able to maintain episomal copies of HPV-11 DNA (Fig. 1). Supercoiled and open circular forms of HPV-11 DNA were detected in DNA samples that were digested with a non-cutter of HPV-11 DNA (lanes X), and linear forms of HPV11 DNA were detected in DNA samples that were digested with a single cutter of HPV-11 DNA (lanes B) in both wild type and HPV-11 E1^E4 mutant-clone-derived cell populations. The copy number varies from clone to clone from approximately 300 copies to 1000 copies per cell (lanes B). The signal intensities of undigested DNA samples (lanes X) were consistently lower than that of their corresponding digested
L. Fang et al. / Virology 351 (2006) 271–279
273
Fig. 1. Detection of HPV-11 episomal DNA in HPV-11 DNA electroporated N-Tert human epithelial cells. Southern blot analysis using HPV-11 DNA as a probe for DNA from either wild type HPV-11 (W-2 and W-6) or mutant E1^E4 HPV-11 DNA (1-1, 1-3, 3-2, 3-3) showed that electroporated N-Tert cells were digested with either a single cutter of HPV-11, BamHI (B), or a non-cutter of HPV-11 genome, Xho (X). HPV-11 plasmid of 10 copies per cell and 100 copies per cell are shown as controls. Supercoiled (FI), linear (FIII) and open circular DNA (FII) are shown as indicated. The size of linear HPV-11 (8 kb) is also shown as indicated.
DNA samples (lanes B) for both wild type and mutant-clonederived cell populations. This is a normal phenomenon in these experiments. This may be due to the presence in the selected clones of large concatemers that were unable to enter the agarose gel for the samples digested with a non-cutter of HPV11 DNA and subsequently lost. Six out of six wild type and five out of five of each mutant E1^E4 HPV-11 electroporated N-Tert cells examined by Southern blot maintained episomal copies of HPV-11 genome. Results indicated that HPV-11 E1^E4 is not required for the episomal maintenance of HPV-11 DNA in undifferentiated monolayer N-Tert cells and the E4-mutant HPV-11 establishes itself at approximately the same frequency as the wild type HPV-11. This result is consistent with the very recent mutagenesis study of HPV-31 E1^E4 in transfected human keratinocytes (Wilson et al., 2005), where mutant HPV31 E1^E4 genomes and wild type HPV-31 E1^E4 genomes were maintained at copy numbers with no significant differences.
Tert rafts, Western blot analyses using antibody specific for HPV-11 E1^E4 protein were performed. The results indicated that HPV-11 E1^E4 protein was only detectable in the wild type HPV-11 N-Tert rafts at day 18 (Fig. 3B, lanes W-2 and W-6), but not detected in any of the HPV-11 E1^E4 mutant containing N-Tert rafts (Figs. 3A and B, lanes 1-1, 1-3, 3-2 and 3-3). This result was as expected because the single amino acid change at position 3346 should result in a stop codon in the E4 open reading frame, with the overlapping E2 ORF unaffected. The severely truncated E1^E4 protein is expected to be degraded rapidly and therefore not detected. Since HPV-11 E1^E4 is a differentiation-induced viral late protein, it is expected that the full-length functional E1^E4 should be present in wild type HPV-11 N-Tert rafts at day 18 when the epithelial cells are well differentiated and stratified but not at early days when epithelial cell differentiation is not completely achieved.
HPV-11 E1^E4 transcripts were unaffected by the mutation in the E4 gene In order to check whether there is any difference in the expression of HPV-11 E1^E4 at mRNA levels between wild type and E1^E4 HPV-11 mutant containing organotypic raft cultures, RNA samples isolated from both HPV-11 wild type and E1^E4 mutant organotypic raft cultures were subjected to RT-PCR analysis using nested primer pairs for spliced HPV-11 E1^E4 transcripts. Results showed that the same spliced E1^E4 transcripts were detected in both wild type HPV-11 and E1^E4 HPV-11 mutant raft cultures (Fig. 2). This demonstrated that the mutation did not affect the mRNA splicing or synthesis. This result was expected because the single nucleotide change is designed to affect only the translation of E1^E4 mRNA resulting in a severely truncated E1^E4 protein but not the splicing or synthesis of E1^E4 mRNA. Expression of HPV-11 E1^E4 protein is induced only in the wild type HPV-11 N-Tert cells grown in raft cultures In order to confirm the expression of HPV-11 E1^E4 protein in both wild type and the E1^E4 HPV-11 mutant N-
Fig. 2. Detection of HPV-11 E1^E4 transcripts by RT-PCR analysis. Total cellular RNA samples isolated from HPV-11 wild type (W-2 and W-6) or E1^E4 mutant (1-1, 1-3, 3-2, and 3-3) organotypic raft cultures harvested at day 10, 14 and 18 were subjected to RT-PCR analysis using nested primers for HPV-11 E1^E4. The amplification products, which are in the lower band of the two in each lane, are shown as indicated.
274
L. Fang et al. / Virology 351 (2006) 271–279
Fig. 3. Western blot analysis of protein extract isolated from HPV-11 N-Tert organotypic raft cultures. (A) One gel with protein samples from HPV-11 E1^E4 mutants N-Tert raft cultures (1-1, 1-3, and 3-2) harvested at days 10, 14 and 18 respectively as indicated. Protein extract from experimental papilloma cyst wall (cyst) was used as a positive control as indicated. The band (E1^E4) representing HPV-11 E1^E4 is shown as indicated. (B) Another gel with protein samples from HPV-11 E1^E4 mutant (3-3) and wild type (W-2 and W-6) N-Tert rafts harvested at days 10, 14 and 18 respectively as indicated. The positive control was the same as in panel A.
Papillomatous transformation and epithelial cell stratification were unaffected by HPV-11 E1^E4 truncation
HPV-11 E1^E4 is dispensable for HPV-11 viral DNA amplification
In order to examine the role of HPV-11 E1^E4 in the viral life cycle, both wild type HPV-11 and E1^E4 HPV-11 mutant episomal DNA containing N-Tert cells were allowed to differentiate and stratify using organotypic raft cultures. The morphological features of papillomatous transformation induced by both wild type HPV-11 and the E1^E4 HPV-11 mutant were examined in formalin-fixed, paraffin-embedded and hematoxylin and eosin-stained N-Tert raft tissue sections. Cross-section of rafts showed progressive stratification and differentiation of epithelial cells from day 10 to day 18 (Fig. 4). More specifically, the epithelium was 4–5 cell layers thick at day 10. The epithelium thickened significantly from day 10 to 14 with up to 20 cell layers. Some degree of epithelial differentiation also occurred. Occasional koilocytes in the upper layers and some degree of hyperplasia in parabasal layers characteristic of papillomatous transformation were observed (Figs. 4B, E and H). By day 18, further stratification and differentiation occurred with apparent cornification on the top of the epithelia. Koilocytosis and parakaratosis characteristic of papillomatous transformation were seen in both wild type and E1^E4 HPV-11 mutant N-Tert raft cultures (Figs. 4C, F and I). Although there were some variation in the thickness of the epithelia of the raft cultures, there was no apparent difference between the morphology of the HPV-11 wild type and the E1^E4 mutant cultures. Papillomatous transformation and morphology were unaffected by the truncation of HPV-11 E1^E4 protein.
To examine the role of HPV-11 E1^E4 in the viral life cycle, we further compared the productive functions of the HPV-11 viral life cycle in N-Tert organotypic raft cultures with or without full-length HPV-11 E1^E4. In order to make sure that any difference that we observed was not due to random nucleotide changes in regions other than the designed position in E4, we used two separately derived E1^E4 mutant clones and multiple HPV-11 episomal DNA containing cell populations for raft cultures. In situ hybridization using an HPV-11 DNA probe showed that viral DNA amplification was detected in both HPV-11 N-Tert rafts with or without full-length E1^E4 at days 14 and 18. The number and intensity of positive signals varies across each raft culture, which may be due to local variations in the stages of differentiation and in the state and copy numbers of the episomal HPV-11 genomes present in individual cells. Overall, however, there was no apparent difference for the viral DNA amplification in the presence or absence of the full-length E1^E4. The truncated E1^E4 is expected to be non-functional or non-expressing and acts as an E1^E4 null mutant since functional domains, including the arrest domain and cytokeratin association domain as well as dimmerization domain, were all eliminated or disrupted. These results indicate that E1^E4 protein is dispensable for HPV-11 DNA amplification in our system. Our findings differ from a recent study with cottontail rabbit papillomavirus (CRPV), which showed that E1^E4 is required for viral DNA amplification and capsid antigen synthesis (Peh et al., 2004). This difference may be due to the heterogeneity of the life cycles between CRPV and HPV. Rabbit
L. Fang et al. / Virology 351 (2006) 271–279
275
Fig. 4. Papillomatous transformation and stratification of HPV-11 N-Tert organotypic raft cultures. Hematoxylin and eosin staining of HPV-11 organotypic raft culture sections. (A, B and C) HPV-11 wild type (W-2) N-Tert organotypic raft culture tissue sections harvested at days 10, 14 and 18 respectively. (D, E and F) HPV-11 E1^E4 mutant (1-3) N-Tert organotypic raft culture tissue sections harvested at days 10, 14 and 18 respectively. (G, H and I) HPV-11 E1^E4 mutant (3-3) N-Tert organotypic raft culture tissue sections harvested at days 10, 14 and 18 respectively. Cells indicated by arrows are koilocytes.
oral papillomavirus (ROPV) is the animal model and animal viral type that mostly resembles the life cycle of the mucosal HPVs rather than CRPV (Christensen et al., 1996; Peh et al., 2002). In addition, viral DNA amplification was occasionally observed in the absence of E4 expression in lesions caused by CRPV (Peh et al., 2002), suggesting that E4 may not be absolutely required for viral DNA amplification. Southern blot analysis of HPV-31 E1^E4 mutant or wild type genome transfected human keratinocytes differentiated in semi-solid media showed reduction of viral DNA amplification but not complete abolishment of viral DNA amplification with an E1^E4 null mutant viral genome compared to the wild type genome (Wilson et al., 2005). However, our experiments indicate that mutant HPV-11 E1^E4 genome amplified to a comparable level as the wild type HPV-11 E1^E4 genome if not more (Fig. 5), suggesting that HPV-11 E1^E4 is not required for viral DNA amplification. The N-Tert cell line was immortalized by the catalytic subunit of human telomerase and was deficient in p16INK4a expression (Dickson et al., 2000). It seemed unlikely that telomerase activity and the lack of p16INK4a could have complemented E1^E4 function because E1^E4 has been shown to arrest cells in the G2/M phase of the cell cycle and the cell cycle arrest is associated with cytoplasmic retention of cyclin B1 and CDK1 complex (Davy et al., 2005), while p16INK4a is a CDK inhibitor of CDK4/6 and cyclin Ds that controls G1 progression in mammalian cells (Sherr and Roberts, 2004). Our results showed that HPV-11 E1^E4 is dispensable for the viral life cycle in N-Tert cells grown in raft culture. This suggests that, if E1^E4 plays a role in the HPV-11
viral life cycle, it must be in late stages after viral DNA amplification. Materials and methods Culture of N-Tert cell line N-Tert cells are human foreskin keratinocytes immortalized with the catalytic subunit of human telomerase (Dickson et al., 2000). The N-Tert cell line was cultured in E-media (Meyers, 1996) with 5 % fetal calf serum and 5 ng/ml of epidermal growth factor in the presence of mitomycin-C-treated J2 3T3 mouse fibroblasts feeder cells (Meyers et al., 1992). J2 3T3 mouse fibroblasts were kindly provided by Dr. Craig Meyers (Penn State University, College of Medicine, Hershey) and were treated with 8 μg/ml of mitomycin C (Roche Applied Science, Indianapolis, IN) for 2–4 h at 37 °C. Treated cells were then washed three times with PBS before trypsinization and added to plates containing epithelial cells. Mutagenesis of HPV-11 E1^E4 The C-terminal truncation of E1^E4 protein was constructed in the backbone of the HPV-11 genome (HPV-11-Hershey). A single nucleotide change (T→A) was introduced at position 3346 to generate a stop codon in the open reading frame of E4 while the overlapping E2 amino acid sequence was unaffected. The mutant was predicted to express a truncated E1^E4 protein of the N-terminal 12 amino acids of the 90 amino acid full-
276
L. Fang et al. / Virology 351 (2006) 271–279
Fig. 5. Detection of HPV-11 viral DNA amplification in HPV-11 N-Tert organotypic raft cultures. In situ hybridization of HPV-11 N-Tert organotypic raft culture tissue sections for HPV-11 DNA. (A and B) HPV-11 wild type (W-2) N-Tert organotypic raft culture tissue sections harvested at days 14 and 18 respectively. (C and D) HPV11 E1^E4 mutant (1-3) N-Tert organotypic raft culture tissue sections harvested at days 14 and 18 respectively. (E and F) HPV-11 E1^E4 mutant (3-3) N-Tert organotypic raft culture tissue sections harvested at days 14 and 18 respectively. Dark purple staining pointed by arrows are positive stained cells for HPV-11 DNA.
length E1^E4. The mutagenesis was performed using the QuickChange II XL site-directed mutagenesis kit (Stratagene, La Jolla, CA), according to the manufacturer's instructions. Primer pairs used to generate the mutant were as follows: 5′CGAGAAGT ATCCATAGCTGAACCTACTACATACACC-3′ and 5′-GGTGTATGTAGTAGGTTCAGCTATGGATACTTCTCG-3′. Mutation was confirmed by sequencing the entire region of E4 to make sure that no other nucleotide changes were present. Multiple mutants were used for generating HPV-11 episomal DNA containing cell lines and organotypic raft cultures to make sure that any changes observed were not due to random mutations in the rest of the HPV-11 genome. Establishment of HPV-11 episomal containing N-Tert cells As previously described (McLaughlin-Drubin et al., 2003; Meyers et al., 1992, 2002) with minor modifications, for each electroporation, HPV-11 DNA, the pBT-1 clone of HPV-11Hershey, was linearized and separated from the vector sequence by digestion with BamHI, which has a cutting site at nucleotide 7072 in the L1 region. Linearized HPV-11 DNA (7.5 μg), 1 μg pSV2-neo, which encodes the neomycin resistance gene, and 42.5 μg of salmon sperm DNA, in a total volume of 24.25 μl, were added to N-Tert cells (5 × 106) in a volume of 250 μl of E-media containing 10% fetal bovine
serum (FBS) and 5 mM N,N-bis (2-hydroxyethyl)-2aminoethanesulfonic acid and electroporated at 210 V and 960 μF by using the Gene Pulser Xcell (Bio-Rad Laboratories, Hercules, CA). The electroporated cell suspension was added to 10 ml E-media containing 10% FBS and centrifuged at 25 × g for 10 min. The resulting cell pellet was resuspended in E-media containing 10% FBS and added to a 100 mm tissue culture plate containing mitomycin-treated J2 3T3 feeder cells. Cells were then selected twice with 500 μg/ml of G418 for 24 h each time, beginning 72 h after electroporation. After the first selection, mitomycin-treated J2 3T3 feeder cells were added and culture was maintained for 24 h without G418 before a second round of G418 selection was carried out. G418-resistant cell populations grown out from a few colonies were maintained in culture for about 1 month without further selection until they were 70–80% confluent. The first week after electroporation, cells were cultured in E-media with 10% fetal calf serum and 5 ng/ml of epidermal growth factor. Cells were then cultured in E-media with 5% fetal calf serum and 5 ng/ml of epidermal growth factor until split (70–80% confluent). After splitting, cells were cultured in E-media with 5% fetal calf serum. Mitomycin-treated J2 3T3 feeder cells were added as needed to cover the plate. Cell populations containing HPV-11 DNA were identified by Southern blot analysis.
L. Fang et al. / Virology 351 (2006) 271–279
Organotypic raft culture Epithelial raft cultures were established and maintained as previously described (McCance et al., 1988; Meyers, 1996; Meyers et al., 1992). Briefly, mouse fibroblasts 3T3 J-2 were trypsinized and resuspended in 10% reconstitution buffer (Meyers, 1996), 10% 10× DMEM (Life Technologies, Gaithersburg, MD) (Meyers, 1996), 2.4 μl/ml 10 M NaOH and 80% collagen to 2.1 × 105 cells/ml on ice. The mixture was then aliquoted into 6-well plates at 3 ml per well and incubated at 37 °C for 2–4 h to allow solidification. E-media (2 ml) was then added to each well to allow the matrix to equilibrate. Human epithelial cells were trypsinized and resuspended at 1 × 106 cell/ml in E-media, and 1 ml of cell suspension was added to each well of the 6-well plate on top of the dermal equivalent from above. Epithelial cells were allowed to attach to the dermal equivalent for 2–4 h. After removal of E-media, collagen epithelia were transferred onto the grids in 100 mm tissue culture plates using a spatula. E-media was added to the culture plates until the media was just touching the under-side of the collagen. Epithelial tissues were allowed to stratify and differentiate at the air–liquid interface over 18 days. Rafts were harvested at various time points and fixed in 10% buffered formalin and embedded in paraffin for sectioning. Cellular and viral DNA extraction Cell pellets were resuspended in 3 ml of Hirt extraction buffer containing 400 mM NaCl, 10 mM Tris–Cl, pH 7.4, and 10 mM EDTA with a final concentration of 50 μg/ml RNase A and 0.2% SDS. The mixtures were then incubated at 37 °C overnight with rocking. Proteinase K was then added to a final concentration of 50 μg/ml, and the mixtures were rocked at 37 °C for an additional 3 h. DNA was sheared by passing through an 18-gauge needle 10 times. DNA was then extracted twice with an equal volume of phenol/chloroform/isoamyl alcohol (25:24:1) and extracted once with an equal volume of chloroform. DNA was precipitated overnight at 4 °C with 2 volumes of ethanol and 0.1 volume of 3 M NaOAc. Precipitated DNA was centrifuged at 12,000 × g for 30 min. Pellets were washed with 70% ethanol and dried. Pellets were then resuspended in 100 μl TE buffer. Southern blot analysis for HPV genome Total DNA (5 μg) was digested with BamHI to linearize the HPV-11 genome. XhoI, which does not cut the HPV-11 genomes, was used as a non-cut control. Enzyme digested DNA was separated on a 0.8% agarose gel and transferred to nitrocellulose membrane with a LKB2016-100 VacuGene vacuum blot (Amersham Pharmacia, Piscataway, NJ) as described by the manufacturer. The resulting membrane was pre-hybridized in 35.6% (v/v) deionized formamide, 1× Denhardt's solution, 0.02 M NaH2PO4, 5× SSC buffer (0.75 M NaCl and 75 mM sodium citrate, pH 7) and 0.1 mg/ml denatured and sheared salmon DNA. The HPV DNA probes were prepared by gel purification of the 8 kb HPV cloned insert
277
from recombinant vectors and labeled with the “Ready to Go” DNA labeling kit (Amersham Pharmacia, Piscataway, NJ). Labeled probe was purified with a ProbeQuant G50 microcolumn (Amersham Pharmacia, Piscataway, NJ). Purified probe was denatured and added to hybridization solution containing 10% (w/v) dextran sulfate, 35.6% (v/v) deionized formamide, 1× Denhardt's solution, 0.02 M NaH2PO4 and 5× SSC buffer (0.75 M NaCl and 75 mM sodium citrate, pH 7) and incubated with the membrane at 46 °C overnight. Membranes were washed 4 times with 2× SSC/0.1% SDS for 15 min each at room temperature. The membrane was then washed twice with 0.1× SSC/0.1% SDS for 30 min each at 50 °C and subjected to autoradiography to detect HPV DNA. RT-PCR analysis of HPV-11 E1^E4 transcripts RT-PCR analysis of HPV-11 E1^E4 transcripts was performed as described previously (Ludmerer et al., 2000; Smith et al., 1995). Briefly, total RNA (200 ng) extracted from infected A431 cells was reverse transcribed in the presence of RT buffer, 5 mM MgCl2, 1 mM of dNTPs, 5 μM 11-DO ( 3 6 8 4 GCCCAATGCCACGTTGAAGA 3 6 6 5 ) and A-DO (1036GGAGCAATGATCTTGA TCTTC1016 ) primers and 2.5 U of reverse transcriptase in a total volume of 20 μl and incubated at 42 °C for 1 h. The product was amplified using nested primer sets and two 30-cycle PCR rounds to detect the HPV-11 E1^E4 spliced transcript. Detection of the spliced transcript eliminated possible detection of a signal caused by DNA contamination. β-actin primer sets were included in PCR reactions to serve as an internal control for RNA integrity. Following cDNA synthesis, primers 11-UO (778GCTGGGCACACTAAA TATTGT798 ) and A-UO (395 GATGACCC AGATCATGTTTG414) were used for 30 cycles of PCR (temperature file: 94 °C/30 s, 60 °C/30 s, 72 °C/55 s with a final extension of 72 °C/10 min). A portion (5 μl of 100 μl) of the PCR reaction mixture was then utilized for a second 30 cycles of PCR primed with primers 11-UI (808CTGCGCACCAAAACCATAACA 828 ), 11-DI ( 3578 TAGGCGTAGCTGCACTGTGA 3 5 5 9 ), A-DI ( 8 5 2 ACTCCATGCCCAGG AAGGAAGG 831 ) and A-UI ( 423 AACACCCCAGCCAT GTACGTTG444) using the same temperature profile. PCRs were conducted according to the manufacturer's instruction (GeneAmp RNA PCR kit from Perkin-Elmer, Branchburg, NJ). The final concentration of deoxynucleotide triphosphates during PCR was 0.2 mM, and final concentrations of primers were 0.2 μM in all cases. The expected size of amplified product was 273 bp for the E1^E4 product and 429 bp for the β-actin product. Protein extraction and Western blot analysis Epithelial layers of organotypic raft cultures peeled from the collagen were washed with ice-cold PBS and homogenized on ice in 0.3 ml ice-cold Empigen BB extraction buffer containing 2% Empigen BB® (Calbiochem-Novabiochem Corporation, San Diego, CA), 5 mM EDTA, 0.1 mM PMSF, 10 μM pepstatin A, 10 μM leupeptin and 25 μg/ml aprotinin in PBS. Samples were then centrifuged at 15,000 × g for 15 min at 4 °C to pellet
278
L. Fang et al. / Virology 351 (2006) 271–279
insoluble debris. Supernatants containing solubilized cellular and viral proteins were collected and stored at −70 °C. The protein concentration of each sample was determined using the BioRad Protein Assay (Hercules, CA). Proteins were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulose membranes using a mini transblot apparatus (Bio-Rad, Richmond, CA). Proteincontaining membranes were blocked overnight at room temperature in 5% milk in Tris-buffered saline containing 0.1% Tween 20 (TBS-T). Primary (1473 anti-E4) and secondary antibodies (anti-rabbit) were diluted in 5% milk in TBS-T. Each antibody incubation time is usually 1 h to overnight. Following each antibody incubation, membranes were washed 3 × 15 min in TBS-T. Antibody binding was detected by enhanced chemiluminescence (Renaissance® Western Blot Chemiluminescence Reagent Plus, NEN™ Life Science Products, Inc., Boston, MA) with subsequent exposure to film. The anti-HPV11 E1^E4 (1473 anti-E4) and relevant preimmune sera were developed by John Doorbar and were used at 1:2500 dilution for detection of HPV-11 E1^E4 by Western blot analysis. In situ hybridization A biotin label was incorporated into DNA using the random priming method (Amersham, Cleveland, OH). Deparaffinized, rehydrated sections of formalin-fixed, paraffin-embedded tissues were digested with pepsin (4 mg/ml in 0.1 N HCl) and washed in Tris–HCl, pH 7.5, dehydrated and covered with a hybridization cocktail containing 0.6 M NaCl, 10 mM Tris pH 7.4, 0.5 mM EDTA, 1 mg/ml bovine serum albumin (BSA), 0.02% polyvinylpyrrolidone (PVP) (w/v), 0.02% Ficoll (w/v), 0.15 mg/ml yeast tRNA, 5 mM DTT, 10% dextran sulfate (w/v), 50% formamide (v/v) and 1 ng/μl labeled DNA. Probe and tissue were denatured together by heating the slides at 100 °C for 6 min. After heat denaturation, slides were incubated in a moist chamber at 37 °C for 2 h, washed 3 times for 10 min each in 2× SSC (0.3 M NaCl and 30 mM sodium citrate, pH 7.0) and incubated with avidin-conjugated alkaline phosphatase for 30 min. After washing in Tris–HCl buffer (pH 9.5) for 3 × 10 min, the McGady reagent was used to develop signal color and sections were counterstained with Nuclear Fast Red. Acknowledgments This work was supported by NIH grants P01 AI37829 and 5 PO1 HD41752. Funding was also from the PA Department of Health, Health Research Formula Funding Program as a part of the PA Tobacco Settlement Legislation, and a Penn State Cancer Research Institute Grant of the Penn State College of Medicine. We thank Dr. J. Rheinwald and Dr. M. Dickson at Department of Medicine and Harvard Skin Disease Research Center, Harvard University, for the permission of using their N-Tert cell line. References Bedell, M.A., Hudson, J.B., Golub, T.R., Turyk, M.E., Hosken, M., Wilbanks, G.D., Laimins, L.A., 1991. Amplification of human papillomavirus
genomes in vitro is dependent on epithelial differentiation. J. Virol. 65 (5), 2254–2260. Brandsma, J.L., Xiao, W., 1993. Infectious virus replication in papillomas induced by molecularly cloned cottontail rabbit papillomavirus DNA. J. Virol. 67 (1), 567–571. Brandsma, J.L., Yang, Z.H., Barthold, S.W., Johnson, E.A., 1991. Use of a rapid, efficient inoculation method to induce papillomas by cottontail rabbit papillomavirus DNA shows that the E7 gene is required. Proc. Natl. Acad. Sci. U. S. A. 88 (11), 4816–4820. Bryan, J.T., Brown, D.R., 2000. Association of the human papillomavirus type 11 E1()E4 protein with cornified cell envelopes derived from infected genital epithelium. Virology 277 (2), 262–269. Christensen, N.D., Cladel, N.M., Reed, C.A., Budgeon, L.R., Welsh, P.A., Patrick, S.D., Kreider, J.W., 1996. Laboratory production of infectious stocks of rabbit oral papillomavirus. J. Gen. Virol. 77 (Pt. 8), 1793–1798. Davy, C.E., Jackson, D.J., Wang, Q., Raj, K., Masterson, P.J., Fenner, N.F., Southern, S., Cuthill, S., Millar, J.B., Doorbar, J., 2002. Identification of a G(2) arrest domain in the E1 wedge E4 protein of human papillomavirus type 16. J. Virol. 76 (19), 9806–9818. Davy, C.E., Jackson, D.J., Raj, K., Peh, W.L., Southern, S.A., Das, P., Sorathia, R., Laskey, P., Middleton, K., Nakahara, T., Wang, Q., Masterson, P.J., Lambert, P.F., Cuthill, S., Millar, J.B., Doorbar, J., 2005. Human papillomavirus type 16 E1 E4-induced G2 arrest is associated with cytoplasmic retention of active Cdk1/cyclin B1 complexes. J. Virol. 79 (7), 3998–4011. de Villiers, E.M., 2001. Taxonomic classification of papillomaviruses. Papillomavirus Rep. 12 (3), 57–63. Dickson, M.A., Hahn, W.C., Ino, Y., Ronfard, V., Wu, J.Y., Weinberg, R.A., Louis, D.N., Li, F.P., Rheinwald, J.G., 2000. Human keratinocytes that express hTERT and also bypass a p16(INK4a)-enforced mechanism that limits life span become immortal yet retain normal growth and differentiation characteristics. Mol. Cell. Biol. 20 (4), 1436–1447. Doorbar, J., Ely, S., Sterling, J., McLean, C., Crawford, L., 1991. Specific interaction between HPV16 E1^E4 and cytokeratins results in collapse of the epithelial cell intermediate filament network. Nature 352 (6338), 824–827. Doorbar, J., Foo, C., Coleman, N., Medcalf, L., Hartley, O., Prospero, T., Napthine, S., Sterling, J., Winter, G., Griffin, H., 1997. Characterization of events during the late stages of HPV16 infection in vivo using high-affinity synthetic Fabs to E4. Virology 238 (1), 40–52. Doorbar, J., Elston, R.C., Napthine, S., Raj, K., Medcalf, E., Jackson, D., Coleman, N., Griffin, H.M., Masterson, P., Stacey, S., Mengistu, Y., Dunlop, J., 2000. The E1E4 protein of human papillomavirus type 16 associates with a putative RNA helicase through sequences in its C terminus. J Virol 74 (21), 10081–10095. Fang, L., Meyers, C., Budgeon, L.R., Howett, M.K., 2006. Induction of Productive Human Papillomavirus Type 11 Life Cycle in Epithelial Cells Grown in Organotypic Raft Cultures. Virology 347 (1), 28–35. Fecile, M.L., 1995. PhD Penn State University, Hershey. Flores, E.R., Allen-Hoffmann, B.L., Lee, D., Lambert, P.F., 2000. The human papillomavirus type 16 E7 oncogene is required for the productive stage of the viral life cycle. J. Virol. 74 (14), 6622–6631. Howley, P.M., 1996. Papillomavirinae: The viruses and their replication, In: Fields, B.N., Knipe, D.M., Howley, P.M. (Eds.), third ed. Fields Virology, vol. 2. Lippincott-Raven Publishers, Philadelphia, PA, pp. 2045–2076. 2 vols. Ko, M.J., Chu, C.Y., 2004. Disseminated human papillomavirus type 11 infection in a patient with pemphigus vulgaris: confirmed by DNA analysis. J. Am. Acad. Dermatol. 51 (5 Suppl.), S190–S193. Ludmerer, S.W., McClements, W.L., Wang, X.M., Ling, J.C., Jansen, K.U., Christensen, N.D., 2000. HPV11 mutant virus-like particles elicit immune responses that neutralize virus and delineate a novel neutralizing domain. Virology 266 (2), 237–245. McCance, D.J., Kopan, R., Fuchs, E., Laimins, L.A., 1988. Human papillomavirus type 16 alters human epithelial cell differentiation in vitro. Proc. Natl. Acad. Sci. U. S. A. 85 (19), 7169–7173. McLaughlin-Drubin, M.E., Wilson, S., Mullikin, B., Suzich, J., Meyers, C., 2003. Human papillomavirus type 45 propagation, infection, and neutralization. Virology 312 (1), 1–7.
L. Fang et al. / Virology 351 (2006) 271–279 Meyers, C., 1996. Organotypic (raft) epithelial tissue culture system for the differentiation-dependent replication of papillomavirus. Methods Cell Sci. 18, 201–210. Meyers, C., Frattini, M.G., Hudson, J.B., Laimins, L.A., 1992. Biosynthesis of human papillomavirus from a continuous cell line upon epithelial differentiation. Science 257 (5072), 971–973. Meyers, C., Bromberg-White, J.L., Zhang, J., Kaupas, M.E., Bryan, J.T., Lowe, R.S., Jansen, K.U., 2002. Infectious virions produced from a human papillomavirus type 18/16 genomic DNA chimera. J. Virol. 76 (10), 4723–4733. Middleton, K., Peh, W., Southern, S., Griffin, H., Sotlar, K., Nakahara, T., ElSherif, A., Morris, L., Seth, R., Hibma, M., Jenkins, D., Lambert, P., Coleman, N., Doorbar, J., 2003. Organization of human papillomavirus productive cycle during neoplastic progression provides a basis for selection of diagnostic markers. J. Virol. 77 (19), 10186–10201. Nakahara, T., Nishimura, A., Tanaka, M., Ueno, T., Ishimoto, A., Sakai, H., 2002. Modulation of the cell division cycle by human papillomavirus type 18 E4. J. Virol. 76 (21), 10914–10920. Peh, W.L., Middleton, K., Christensen, N., Nicholls, P., Egawa, K., Sotlar, K., Brandsma, J., Percival, A., Lewis, J., Liu, W.J., Doorbar, J., 2002. Life cycle heterogeneity in animal models of human papillomavirus-associated disease. J. Virol. 76 (20), 10401–10416. Peh, W.L., Brandsma, J.L., Christensen, N.D., Cladel, N.M., Wu, X., Doorbar, J., 2004. The viral E4 protein is required for the completion of the cottontail rabbit papillomavirus productive cycle in vivo. J. Virol. 78 (4), 2142–2151. Raj, K., Berguerand, S., Southern, S., Doorbar, J., Beard, P., 2004. E1^E4
279
protein of human papillomavirus type 16 associates with mitochondria. J. Virol. 78 (13), 7199–7207. Roberts, S., Ashmole, I., Gibson, L.J., Rookes, S.M., Barton, G.J., Gallimore, P.H., 1994. Mutational analysis of human papillomavirus E4 proteins: identification of structural features important in the formation of cytoplasmic E4/cytokeratin networks in epithelial cells. J. Virol. 68 (10), 6432–6445. Shah, K.V., Howley, P.M., 1996. Papillomaviruses, In: Fields, Bernard N., Knipe, David M., Howley, P.M. (Eds.), third ed. Fields Virology, vol. 2. Lippincott-Raven, Philadelphia, pp. 2077–2109. 2 vols. Sherr, C.J., Roberts, J.M., 2004. Living with or without cyclins and cyclindependent kinases. Genes Dev. 18 (22), 2699–2711. Smith, L.H., Foster, C., Hitchcock, M.E., Leiserowitz, G.S., Hall, K., Isseroff, R., Christensen, N.D., Kreider, J.W., 1995. Titration of HPV-11 infectivity and antibody neutralization can be measured in vitro. J. Invest. Dermatol. 105 (3), 438–444. Stubenrauch, F., Laimins, L.A., 1999. Human papillomavirus life cycle: active and latent phases. Semin. Cancer Biol. 9 (6), 379–386. Wang, Q., Griffin, H., Southern, S., Jackson, D., Martin, A., McIntosh, P., Davy, C., Masterson, P.J., Walker, P.A., Laskey, P., Omary, M.B., Doorbar, J., 2004. Functional analysis of the human papillomavirus type 16 E1 = E4 protein provides a mechanism for in vivo and in vitro keratin filament reorganization. J. Virol. 78 (2), 821–833. Wilson, R., Fehrmann, F., Laimins, L.A., 2005. Role of the E1–E4 protein in the differentiation-dependent life cycle of human papillomavirus type 31. J. Virol. 79 (11), 6732–6740.
The human papillomavirus type 11 E1^E4 protein is not essential for viral genome amplification L. Fang a , L.R. Budgeon b , J. Doorbar c , E.R. Briggs a , M.K. Howett a,⁎ a
b
Department of Bioscience and Biotechnology, Drexel University, 3141 Chestnut Street, Stratton Hall, Rm 118, Philadelphia, PA 19104, USA Department of Pathology, The Jake Gittlen Cancer Research Institute, The Pennsylvania State University, College of Medicine, Hershey, PA 16802, USA c Division of Virology, The National Institute for Medical Research, The Ridgeway, Mill Hill, London NW71AA, United Kingdom Received 1 August 2005; returned to author for revision 19 September 2005; accepted 9 January 2006 Available online 9 May 2006
Abstract An abundant human papillomavirus (HPV) protein E1^E4 is expressed late in the virus life cycle in the terminally differentiated layers of epithelia. The expression of E1^E4 usually coincides with the onset of viral DNA amplification. However, the function of E1^E4 in viral life cycle is not completely understood. To examine the role of E1^E4 in the virus life cycle, we introduced a single nucleotide change in the HPV-11 genome to result in a truncation of E1^E4 protein without affecting the E2 amino acid sequence. This mutated HPV-11 genome was introduced into a human foreskin keratinocyte cell line immortalized by the catalytic subunit of human telomerase, deficient in p16INK4a expression, and previously shown to support the HPV-11 life cycle when grown in organotypic raft culture. We have demonstrated that E1^E4 is dispensable for HPV-11 viral DNA amplification in the late stages of the viral life cycle. © 2006 Elsevier Inc. All rights reserved. Keywords: Human papillomavirus type 11; Organotypic raft culture; E1^E4
Introduction Human papillomaviruses (HPV) are small DNA tumor viruses that are epitheliotropic and can cause benign or malignant epithelial lesions at various sites (Shah and Howley, 1996). More than 200 different HPVs have been identified, and they can also be classified into two groups according to the route of infection (de Villiers, 2001). Cutaneous HPV, such as HPV-1, infect cutaneous epithelia, and mucosal HPV, such as HPV-11 and HPV-16, infect mucosal epithelium, for these two types, mucosa of the anogenital tract. Anogenital-associated HPV are further classified into two groups based on their oncogenic potential as either low or high risk types (de Villiers, 2001). HPV-6 and HPV-11 are prototypes of the low risk group, which are found primarily in benign, low-grade genital lesions at mucosal sites, known as warts or condylomata, and in some cases at cutaneous sites (Ko and Chu, 2004). HPV-16 and HPV18 are prototypes of the high risk group, which are found ⁎ Corresponding author. Fax: +1 215 895 1273. E-mail address: [email protected] (M.K. Howett). 0042-6822/$ - see front matter © 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.virol.2006.01.051
predominantly in high-grade cervical dysplasias and cervical carcinomas (Shah and Howley, 1996). Despite the differences in tissue tropism and the severity of the epithelial lesions that various HPVs cause, many common characteristics and events in the viral life cycles are shared among various HPVs. The HPV viral life cycle is tightly linked to the differentiation program of keratinocytes, and productive infection is limited to the terminally differentiated keratinocytes (Howley, 1996). HPV is thought to initially infect stem cells or transit amplifying cells in the basal layer of the epithelium. Following virus entry into basal epithelial cells, HPV genomes are initially amplified as episomes to approximately 50–100 copies per cell with low levels of HPV early gene expression (Stubenrauch and Laimins, 1999). Productive replication of the viral genome then occurs, and viral DNA amplifies to a high level of approximately 1000 copies per cell with epithelial cell differentiation and migration towards epithelial cell surface (Stubenrauch and Laimins, 1999). Viral DNA amplification is usually followed by viral capsid antigen synthesis and assembly of the progeny virion in the terminally differentiated epithelial layers (Peh et al., 2002).
272
L. Fang et al. / Virology 351 (2006) 271–279
E1^E4 RNA is a spliced product transcribed from the E1 and the E4 open reading frames (ORFs). Codons for the first 5 amino acids are from the E1 ORF, and the remaining amino acids are from the E4 ORF. E1^E4 is the most abundant viral gene product constituting approximately 90% of viral transcripts in genital condylomata. In experimentally generated human papillomas arising from HPV-11-infected foreskin xenografts, over 80% of total viral transcripts represent the predominant E1^E4 transcripts (Fecile, 1995). However, the role of E1^E4 in the papillomavirus life cycle remains speculative. Although the E1^E4 protein shows little conservation among HPV types, E1^E4 expression occurs in the upper layers of differentiated epithelia and its expression coincides with the onset of viral DNA amplification and occurs before and with the expression of viral capsid proteins (Doorbar et al., 1997; Middleton et al., 2003; Peh et al., 2002). A role of E1^E4 in the productive stage of viral life cycle has been suggested. However, despite the correlation of E1^E4 expression and the onset of viral DNA amplification, which occurs in the nucleus, E1^E4 is mainly located in the cytoplasm (Doorbar et al., 1997). E1^E4 has also been shown to interact with cellular keratins when expressed in cultured epithelial cells and result in collapse of the epithelial cell intermediate filament network (Doorbar et al., 1991). The N-terminal leucine-rich motif is thought to be important for the mucosal types of HPV E1^E4 association with cellular keratin (Roberts et al., 1994; Wang et al., 2004), and the association suggested a role in inhibition of keratin dynamics and the sequestering of E1^E4's cellular targets in the cytoplasm (Wang et al., 2004). A physical interaction of HPV-16 E1^E4 through its C-terminus and a novel cellular protein, E4-DEAD box protein (E4-DBP), has also been demonstrated (Doorbar et al., 2000). Members of the DEAD box protein family, to which E4-DBP belongs, are typically involved in the regulation of mRNA stability, suggesting that HPV-16 E1^E4 may play a role in the post-transcriptional regulation of viral gene expression. HPV-11 E^E4 protein has also been shown to associate with the cornified cell envelope (Bryan and Brown, 2000), suggesting that E1^E4 may aid in the release and spread of infectious viruses. HPV-16, 18 and 11 E1^E4 can also mediate G2 cell cycle arrest in cervical cancer cells, and the proline-rich region of the protein is important for the arrest (Davy et al., 2002; Nakahara et al., 2002). HPV-16 E1^E4-induced G2 arrest is associated with cytoplasmic retention of active cdk1/cyclin B complex (Davy et al., 2005). Recently, HPV16 E1^E4 has been shown to associate with mitochondria and cause severely reduction of the mitochondrial membrane potential and an induction of apoptosis (Raj et al., 2004). However, the significance for the associations of E1^E4 with cellular keratin, E4-DBP and with mitochondria, as well as the E1^E4-induced cell cycle arrest with respect to the viral life cycle remains speculative. Functional analysis of E1^E4 in the context of viral life cycle has been hindered by the lack of in vitro system for productive viral infection and by the overlapping nature of the E4 and the E2 ORFs. Recent advances in the development of model systems for papillomavirus growth, such as organotypic raft cultures (Bedell et al., 1991; Meyers et al., 1992) and animal papillomavirus models, such as the
cottontail rabbit papillomavirus (CRPV) model (Brandsma and Xiao, 1993), allowed the study of individual viral proteins in the complete viral life cycle through mutagenesis (Brandsma et al., 1991; Flores et al., 2000; Peh et al., 2004). A recent study with CRPV showed that E1^E4 is not required for the formation of papillomas but is required for viral DNA amplification and capsid antigen synthesis (Peh et al., 2004). Mutational analysis of HPV-31 E1^E4 in normal human keratinocytes grown in semi-solid media showed reduction of viral DNA amplification and late viral transcript levels, suggesting that E1^E4 may play a role in viral DNA amplification and regulation of viral late gene expression (Wilson et al., 2005). Our previous studies demonstrate that human keratinocytes immortalized by the catalytic subunit of human telomerase (N-Tert) (Dickson et al., 2000), which retain normal growth and differentiation characteristics, can support the productive stage of the HPV-11 viral life cycle (Fang et al., 2006). In the study presented here, we examined the role of E1^E4 in the HPV-11 viral life cycle by comparing the severely truncated form and the wild type HPV-11 E1^E4 in the context of the whole viral genome in N-Tert cells grown in the organotypic raft cultures. We demonstrated that HPV-11 E1^E4 is not essential for viral DNA amplification in the late stages of the viral life cycle. Results and discussion HPV-11 E1^E4 is not required for episomal DNA maintenance in monolayer HPV-11 N-Tert cells To examine the role of HPV-11 E1^E4 in the viral life cycle, a single nucleotide change was introduced at position 3346, so that the first leucine of the leucine-rich motif was changed to a stop codon in the ORF of E4 while the overlapping E2 amino acid sequence was unaffected. The mutant was predicted to express a truncated E1^E4 protein consisting of the N-terminal 12 amino acids of the 90 amino acids full-length E1^E4. Two separately derived and sequence-confirmed E1^E4 mutant clones and the wild type plasmid (pBT-1) containing the whole HPV-11 genome were separated from the vector by BamHI digestion and electroporated separately into N-Tert cells along with a neomycin resistance marker. After selection, individual cell populations from each electroporation were analyzed for the presence of HPV-11 DNA by Southern blot analysis using full-length HPV-11 DNA as a probe. Results showed that both the wild type HPV-11 N-Tert cells (W-2 and W-6) and the HPV-11 E1^E4 mutant N-Tert cells (1-1, 1-3, 3-2 and 3-3) were able to maintain episomal copies of HPV-11 DNA (Fig. 1). Supercoiled and open circular forms of HPV-11 DNA were detected in DNA samples that were digested with a non-cutter of HPV-11 DNA (lanes X), and linear forms of HPV11 DNA were detected in DNA samples that were digested with a single cutter of HPV-11 DNA (lanes B) in both wild type and HPV-11 E1^E4 mutant-clone-derived cell populations. The copy number varies from clone to clone from approximately 300 copies to 1000 copies per cell (lanes B). The signal intensities of undigested DNA samples (lanes X) were consistently lower than that of their corresponding digested
L. Fang et al. / Virology 351 (2006) 271–279
273
Fig. 1. Detection of HPV-11 episomal DNA in HPV-11 DNA electroporated N-Tert human epithelial cells. Southern blot analysis using HPV-11 DNA as a probe for DNA from either wild type HPV-11 (W-2 and W-6) or mutant E1^E4 HPV-11 DNA (1-1, 1-3, 3-2, 3-3) showed that electroporated N-Tert cells were digested with either a single cutter of HPV-11, BamHI (B), or a non-cutter of HPV-11 genome, Xho (X). HPV-11 plasmid of 10 copies per cell and 100 copies per cell are shown as controls. Supercoiled (FI), linear (FIII) and open circular DNA (FII) are shown as indicated. The size of linear HPV-11 (8 kb) is also shown as indicated.
DNA samples (lanes B) for both wild type and mutant-clonederived cell populations. This is a normal phenomenon in these experiments. This may be due to the presence in the selected clones of large concatemers that were unable to enter the agarose gel for the samples digested with a non-cutter of HPV11 DNA and subsequently lost. Six out of six wild type and five out of five of each mutant E1^E4 HPV-11 electroporated N-Tert cells examined by Southern blot maintained episomal copies of HPV-11 genome. Results indicated that HPV-11 E1^E4 is not required for the episomal maintenance of HPV-11 DNA in undifferentiated monolayer N-Tert cells and the E4-mutant HPV-11 establishes itself at approximately the same frequency as the wild type HPV-11. This result is consistent with the very recent mutagenesis study of HPV-31 E1^E4 in transfected human keratinocytes (Wilson et al., 2005), where mutant HPV31 E1^E4 genomes and wild type HPV-31 E1^E4 genomes were maintained at copy numbers with no significant differences.
Tert rafts, Western blot analyses using antibody specific for HPV-11 E1^E4 protein were performed. The results indicated that HPV-11 E1^E4 protein was only detectable in the wild type HPV-11 N-Tert rafts at day 18 (Fig. 3B, lanes W-2 and W-6), but not detected in any of the HPV-11 E1^E4 mutant containing N-Tert rafts (Figs. 3A and B, lanes 1-1, 1-3, 3-2 and 3-3). This result was as expected because the single amino acid change at position 3346 should result in a stop codon in the E4 open reading frame, with the overlapping E2 ORF unaffected. The severely truncated E1^E4 protein is expected to be degraded rapidly and therefore not detected. Since HPV-11 E1^E4 is a differentiation-induced viral late protein, it is expected that the full-length functional E1^E4 should be present in wild type HPV-11 N-Tert rafts at day 18 when the epithelial cells are well differentiated and stratified but not at early days when epithelial cell differentiation is not completely achieved.
HPV-11 E1^E4 transcripts were unaffected by the mutation in the E4 gene In order to check whether there is any difference in the expression of HPV-11 E1^E4 at mRNA levels between wild type and E1^E4 HPV-11 mutant containing organotypic raft cultures, RNA samples isolated from both HPV-11 wild type and E1^E4 mutant organotypic raft cultures were subjected to RT-PCR analysis using nested primer pairs for spliced HPV-11 E1^E4 transcripts. Results showed that the same spliced E1^E4 transcripts were detected in both wild type HPV-11 and E1^E4 HPV-11 mutant raft cultures (Fig. 2). This demonstrated that the mutation did not affect the mRNA splicing or synthesis. This result was expected because the single nucleotide change is designed to affect only the translation of E1^E4 mRNA resulting in a severely truncated E1^E4 protein but not the splicing or synthesis of E1^E4 mRNA. Expression of HPV-11 E1^E4 protein is induced only in the wild type HPV-11 N-Tert cells grown in raft cultures In order to confirm the expression of HPV-11 E1^E4 protein in both wild type and the E1^E4 HPV-11 mutant N-
Fig. 2. Detection of HPV-11 E1^E4 transcripts by RT-PCR analysis. Total cellular RNA samples isolated from HPV-11 wild type (W-2 and W-6) or E1^E4 mutant (1-1, 1-3, 3-2, and 3-3) organotypic raft cultures harvested at day 10, 14 and 18 were subjected to RT-PCR analysis using nested primers for HPV-11 E1^E4. The amplification products, which are in the lower band of the two in each lane, are shown as indicated.
274
L. Fang et al. / Virology 351 (2006) 271–279
Fig. 3. Western blot analysis of protein extract isolated from HPV-11 N-Tert organotypic raft cultures. (A) One gel with protein samples from HPV-11 E1^E4 mutants N-Tert raft cultures (1-1, 1-3, and 3-2) harvested at days 10, 14 and 18 respectively as indicated. Protein extract from experimental papilloma cyst wall (cyst) was used as a positive control as indicated. The band (E1^E4) representing HPV-11 E1^E4 is shown as indicated. (B) Another gel with protein samples from HPV-11 E1^E4 mutant (3-3) and wild type (W-2 and W-6) N-Tert rafts harvested at days 10, 14 and 18 respectively as indicated. The positive control was the same as in panel A.
Papillomatous transformation and epithelial cell stratification were unaffected by HPV-11 E1^E4 truncation
HPV-11 E1^E4 is dispensable for HPV-11 viral DNA amplification
In order to examine the role of HPV-11 E1^E4 in the viral life cycle, both wild type HPV-11 and E1^E4 HPV-11 mutant episomal DNA containing N-Tert cells were allowed to differentiate and stratify using organotypic raft cultures. The morphological features of papillomatous transformation induced by both wild type HPV-11 and the E1^E4 HPV-11 mutant were examined in formalin-fixed, paraffin-embedded and hematoxylin and eosin-stained N-Tert raft tissue sections. Cross-section of rafts showed progressive stratification and differentiation of epithelial cells from day 10 to day 18 (Fig. 4). More specifically, the epithelium was 4–5 cell layers thick at day 10. The epithelium thickened significantly from day 10 to 14 with up to 20 cell layers. Some degree of epithelial differentiation also occurred. Occasional koilocytes in the upper layers and some degree of hyperplasia in parabasal layers characteristic of papillomatous transformation were observed (Figs. 4B, E and H). By day 18, further stratification and differentiation occurred with apparent cornification on the top of the epithelia. Koilocytosis and parakaratosis characteristic of papillomatous transformation were seen in both wild type and E1^E4 HPV-11 mutant N-Tert raft cultures (Figs. 4C, F and I). Although there were some variation in the thickness of the epithelia of the raft cultures, there was no apparent difference between the morphology of the HPV-11 wild type and the E1^E4 mutant cultures. Papillomatous transformation and morphology were unaffected by the truncation of HPV-11 E1^E4 protein.
To examine the role of HPV-11 E1^E4 in the viral life cycle, we further compared the productive functions of the HPV-11 viral life cycle in N-Tert organotypic raft cultures with or without full-length HPV-11 E1^E4. In order to make sure that any difference that we observed was not due to random nucleotide changes in regions other than the designed position in E4, we used two separately derived E1^E4 mutant clones and multiple HPV-11 episomal DNA containing cell populations for raft cultures. In situ hybridization using an HPV-11 DNA probe showed that viral DNA amplification was detected in both HPV-11 N-Tert rafts with or without full-length E1^E4 at days 14 and 18. The number and intensity of positive signals varies across each raft culture, which may be due to local variations in the stages of differentiation and in the state and copy numbers of the episomal HPV-11 genomes present in individual cells. Overall, however, there was no apparent difference for the viral DNA amplification in the presence or absence of the full-length E1^E4. The truncated E1^E4 is expected to be non-functional or non-expressing and acts as an E1^E4 null mutant since functional domains, including the arrest domain and cytokeratin association domain as well as dimmerization domain, were all eliminated or disrupted. These results indicate that E1^E4 protein is dispensable for HPV-11 DNA amplification in our system. Our findings differ from a recent study with cottontail rabbit papillomavirus (CRPV), which showed that E1^E4 is required for viral DNA amplification and capsid antigen synthesis (Peh et al., 2004). This difference may be due to the heterogeneity of the life cycles between CRPV and HPV. Rabbit
L. Fang et al. / Virology 351 (2006) 271–279
275
Fig. 4. Papillomatous transformation and stratification of HPV-11 N-Tert organotypic raft cultures. Hematoxylin and eosin staining of HPV-11 organotypic raft culture sections. (A, B and C) HPV-11 wild type (W-2) N-Tert organotypic raft culture tissue sections harvested at days 10, 14 and 18 respectively. (D, E and F) HPV-11 E1^E4 mutant (1-3) N-Tert organotypic raft culture tissue sections harvested at days 10, 14 and 18 respectively. (G, H and I) HPV-11 E1^E4 mutant (3-3) N-Tert organotypic raft culture tissue sections harvested at days 10, 14 and 18 respectively. Cells indicated by arrows are koilocytes.
oral papillomavirus (ROPV) is the animal model and animal viral type that mostly resembles the life cycle of the mucosal HPVs rather than CRPV (Christensen et al., 1996; Peh et al., 2002). In addition, viral DNA amplification was occasionally observed in the absence of E4 expression in lesions caused by CRPV (Peh et al., 2002), suggesting that E4 may not be absolutely required for viral DNA amplification. Southern blot analysis of HPV-31 E1^E4 mutant or wild type genome transfected human keratinocytes differentiated in semi-solid media showed reduction of viral DNA amplification but not complete abolishment of viral DNA amplification with an E1^E4 null mutant viral genome compared to the wild type genome (Wilson et al., 2005). However, our experiments indicate that mutant HPV-11 E1^E4 genome amplified to a comparable level as the wild type HPV-11 E1^E4 genome if not more (Fig. 5), suggesting that HPV-11 E1^E4 is not required for viral DNA amplification. The N-Tert cell line was immortalized by the catalytic subunit of human telomerase and was deficient in p16INK4a expression (Dickson et al., 2000). It seemed unlikely that telomerase activity and the lack of p16INK4a could have complemented E1^E4 function because E1^E4 has been shown to arrest cells in the G2/M phase of the cell cycle and the cell cycle arrest is associated with cytoplasmic retention of cyclin B1 and CDK1 complex (Davy et al., 2005), while p16INK4a is a CDK inhibitor of CDK4/6 and cyclin Ds that controls G1 progression in mammalian cells (Sherr and Roberts, 2004). Our results showed that HPV-11 E1^E4 is dispensable for the viral life cycle in N-Tert cells grown in raft culture. This suggests that, if E1^E4 plays a role in the HPV-11
viral life cycle, it must be in late stages after viral DNA amplification. Materials and methods Culture of N-Tert cell line N-Tert cells are human foreskin keratinocytes immortalized with the catalytic subunit of human telomerase (Dickson et al., 2000). The N-Tert cell line was cultured in E-media (Meyers, 1996) with 5 % fetal calf serum and 5 ng/ml of epidermal growth factor in the presence of mitomycin-C-treated J2 3T3 mouse fibroblasts feeder cells (Meyers et al., 1992). J2 3T3 mouse fibroblasts were kindly provided by Dr. Craig Meyers (Penn State University, College of Medicine, Hershey) and were treated with 8 μg/ml of mitomycin C (Roche Applied Science, Indianapolis, IN) for 2–4 h at 37 °C. Treated cells were then washed three times with PBS before trypsinization and added to plates containing epithelial cells. Mutagenesis of HPV-11 E1^E4 The C-terminal truncation of E1^E4 protein was constructed in the backbone of the HPV-11 genome (HPV-11-Hershey). A single nucleotide change (T→A) was introduced at position 3346 to generate a stop codon in the open reading frame of E4 while the overlapping E2 amino acid sequence was unaffected. The mutant was predicted to express a truncated E1^E4 protein of the N-terminal 12 amino acids of the 90 amino acid full-
276
L. Fang et al. / Virology 351 (2006) 271–279
Fig. 5. Detection of HPV-11 viral DNA amplification in HPV-11 N-Tert organotypic raft cultures. In situ hybridization of HPV-11 N-Tert organotypic raft culture tissue sections for HPV-11 DNA. (A and B) HPV-11 wild type (W-2) N-Tert organotypic raft culture tissue sections harvested at days 14 and 18 respectively. (C and D) HPV11 E1^E4 mutant (1-3) N-Tert organotypic raft culture tissue sections harvested at days 14 and 18 respectively. (E and F) HPV-11 E1^E4 mutant (3-3) N-Tert organotypic raft culture tissue sections harvested at days 14 and 18 respectively. Dark purple staining pointed by arrows are positive stained cells for HPV-11 DNA.
length E1^E4. The mutagenesis was performed using the QuickChange II XL site-directed mutagenesis kit (Stratagene, La Jolla, CA), according to the manufacturer's instructions. Primer pairs used to generate the mutant were as follows: 5′CGAGAAGT ATCCATAGCTGAACCTACTACATACACC-3′ and 5′-GGTGTATGTAGTAGGTTCAGCTATGGATACTTCTCG-3′. Mutation was confirmed by sequencing the entire region of E4 to make sure that no other nucleotide changes were present. Multiple mutants were used for generating HPV-11 episomal DNA containing cell lines and organotypic raft cultures to make sure that any changes observed were not due to random mutations in the rest of the HPV-11 genome. Establishment of HPV-11 episomal containing N-Tert cells As previously described (McLaughlin-Drubin et al., 2003; Meyers et al., 1992, 2002) with minor modifications, for each electroporation, HPV-11 DNA, the pBT-1 clone of HPV-11Hershey, was linearized and separated from the vector sequence by digestion with BamHI, which has a cutting site at nucleotide 7072 in the L1 region. Linearized HPV-11 DNA (7.5 μg), 1 μg pSV2-neo, which encodes the neomycin resistance gene, and 42.5 μg of salmon sperm DNA, in a total volume of 24.25 μl, were added to N-Tert cells (5 × 106) in a volume of 250 μl of E-media containing 10% fetal bovine
serum (FBS) and 5 mM N,N-bis (2-hydroxyethyl)-2aminoethanesulfonic acid and electroporated at 210 V and 960 μF by using the Gene Pulser Xcell (Bio-Rad Laboratories, Hercules, CA). The electroporated cell suspension was added to 10 ml E-media containing 10% FBS and centrifuged at 25 × g for 10 min. The resulting cell pellet was resuspended in E-media containing 10% FBS and added to a 100 mm tissue culture plate containing mitomycin-treated J2 3T3 feeder cells. Cells were then selected twice with 500 μg/ml of G418 for 24 h each time, beginning 72 h after electroporation. After the first selection, mitomycin-treated J2 3T3 feeder cells were added and culture was maintained for 24 h without G418 before a second round of G418 selection was carried out. G418-resistant cell populations grown out from a few colonies were maintained in culture for about 1 month without further selection until they were 70–80% confluent. The first week after electroporation, cells were cultured in E-media with 10% fetal calf serum and 5 ng/ml of epidermal growth factor. Cells were then cultured in E-media with 5% fetal calf serum and 5 ng/ml of epidermal growth factor until split (70–80% confluent). After splitting, cells were cultured in E-media with 5% fetal calf serum. Mitomycin-treated J2 3T3 feeder cells were added as needed to cover the plate. Cell populations containing HPV-11 DNA were identified by Southern blot analysis.
L. Fang et al. / Virology 351 (2006) 271–279
Organotypic raft culture Epithelial raft cultures were established and maintained as previously described (McCance et al., 1988; Meyers, 1996; Meyers et al., 1992). Briefly, mouse fibroblasts 3T3 J-2 were trypsinized and resuspended in 10% reconstitution buffer (Meyers, 1996), 10% 10× DMEM (Life Technologies, Gaithersburg, MD) (Meyers, 1996), 2.4 μl/ml 10 M NaOH and 80% collagen to 2.1 × 105 cells/ml on ice. The mixture was then aliquoted into 6-well plates at 3 ml per well and incubated at 37 °C for 2–4 h to allow solidification. E-media (2 ml) was then added to each well to allow the matrix to equilibrate. Human epithelial cells were trypsinized and resuspended at 1 × 106 cell/ml in E-media, and 1 ml of cell suspension was added to each well of the 6-well plate on top of the dermal equivalent from above. Epithelial cells were allowed to attach to the dermal equivalent for 2–4 h. After removal of E-media, collagen epithelia were transferred onto the grids in 100 mm tissue culture plates using a spatula. E-media was added to the culture plates until the media was just touching the under-side of the collagen. Epithelial tissues were allowed to stratify and differentiate at the air–liquid interface over 18 days. Rafts were harvested at various time points and fixed in 10% buffered formalin and embedded in paraffin for sectioning. Cellular and viral DNA extraction Cell pellets were resuspended in 3 ml of Hirt extraction buffer containing 400 mM NaCl, 10 mM Tris–Cl, pH 7.4, and 10 mM EDTA with a final concentration of 50 μg/ml RNase A and 0.2% SDS. The mixtures were then incubated at 37 °C overnight with rocking. Proteinase K was then added to a final concentration of 50 μg/ml, and the mixtures were rocked at 37 °C for an additional 3 h. DNA was sheared by passing through an 18-gauge needle 10 times. DNA was then extracted twice with an equal volume of phenol/chloroform/isoamyl alcohol (25:24:1) and extracted once with an equal volume of chloroform. DNA was precipitated overnight at 4 °C with 2 volumes of ethanol and 0.1 volume of 3 M NaOAc. Precipitated DNA was centrifuged at 12,000 × g for 30 min. Pellets were washed with 70% ethanol and dried. Pellets were then resuspended in 100 μl TE buffer. Southern blot analysis for HPV genome Total DNA (5 μg) was digested with BamHI to linearize the HPV-11 genome. XhoI, which does not cut the HPV-11 genomes, was used as a non-cut control. Enzyme digested DNA was separated on a 0.8% agarose gel and transferred to nitrocellulose membrane with a LKB2016-100 VacuGene vacuum blot (Amersham Pharmacia, Piscataway, NJ) as described by the manufacturer. The resulting membrane was pre-hybridized in 35.6% (v/v) deionized formamide, 1× Denhardt's solution, 0.02 M NaH2PO4, 5× SSC buffer (0.75 M NaCl and 75 mM sodium citrate, pH 7) and 0.1 mg/ml denatured and sheared salmon DNA. The HPV DNA probes were prepared by gel purification of the 8 kb HPV cloned insert
277
from recombinant vectors and labeled with the “Ready to Go” DNA labeling kit (Amersham Pharmacia, Piscataway, NJ). Labeled probe was purified with a ProbeQuant G50 microcolumn (Amersham Pharmacia, Piscataway, NJ). Purified probe was denatured and added to hybridization solution containing 10% (w/v) dextran sulfate, 35.6% (v/v) deionized formamide, 1× Denhardt's solution, 0.02 M NaH2PO4 and 5× SSC buffer (0.75 M NaCl and 75 mM sodium citrate, pH 7) and incubated with the membrane at 46 °C overnight. Membranes were washed 4 times with 2× SSC/0.1% SDS for 15 min each at room temperature. The membrane was then washed twice with 0.1× SSC/0.1% SDS for 30 min each at 50 °C and subjected to autoradiography to detect HPV DNA. RT-PCR analysis of HPV-11 E1^E4 transcripts RT-PCR analysis of HPV-11 E1^E4 transcripts was performed as described previously (Ludmerer et al., 2000; Smith et al., 1995). Briefly, total RNA (200 ng) extracted from infected A431 cells was reverse transcribed in the presence of RT buffer, 5 mM MgCl2, 1 mM of dNTPs, 5 μM 11-DO ( 3 6 8 4 GCCCAATGCCACGTTGAAGA 3 6 6 5 ) and A-DO (1036GGAGCAATGATCTTGA TCTTC1016 ) primers and 2.5 U of reverse transcriptase in a total volume of 20 μl and incubated at 42 °C for 1 h. The product was amplified using nested primer sets and two 30-cycle PCR rounds to detect the HPV-11 E1^E4 spliced transcript. Detection of the spliced transcript eliminated possible detection of a signal caused by DNA contamination. β-actin primer sets were included in PCR reactions to serve as an internal control for RNA integrity. Following cDNA synthesis, primers 11-UO (778GCTGGGCACACTAAA TATTGT798 ) and A-UO (395 GATGACCC AGATCATGTTTG414) were used for 30 cycles of PCR (temperature file: 94 °C/30 s, 60 °C/30 s, 72 °C/55 s with a final extension of 72 °C/10 min). A portion (5 μl of 100 μl) of the PCR reaction mixture was then utilized for a second 30 cycles of PCR primed with primers 11-UI (808CTGCGCACCAAAACCATAACA 828 ), 11-DI ( 3578 TAGGCGTAGCTGCACTGTGA 3 5 5 9 ), A-DI ( 8 5 2 ACTCCATGCCCAGG AAGGAAGG 831 ) and A-UI ( 423 AACACCCCAGCCAT GTACGTTG444) using the same temperature profile. PCRs were conducted according to the manufacturer's instruction (GeneAmp RNA PCR kit from Perkin-Elmer, Branchburg, NJ). The final concentration of deoxynucleotide triphosphates during PCR was 0.2 mM, and final concentrations of primers were 0.2 μM in all cases. The expected size of amplified product was 273 bp for the E1^E4 product and 429 bp for the β-actin product. Protein extraction and Western blot analysis Epithelial layers of organotypic raft cultures peeled from the collagen were washed with ice-cold PBS and homogenized on ice in 0.3 ml ice-cold Empigen BB extraction buffer containing 2% Empigen BB® (Calbiochem-Novabiochem Corporation, San Diego, CA), 5 mM EDTA, 0.1 mM PMSF, 10 μM pepstatin A, 10 μM leupeptin and 25 μg/ml aprotinin in PBS. Samples were then centrifuged at 15,000 × g for 15 min at 4 °C to pellet
278
L. Fang et al. / Virology 351 (2006) 271–279
insoluble debris. Supernatants containing solubilized cellular and viral proteins were collected and stored at −70 °C. The protein concentration of each sample was determined using the BioRad Protein Assay (Hercules, CA). Proteins were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulose membranes using a mini transblot apparatus (Bio-Rad, Richmond, CA). Proteincontaining membranes were blocked overnight at room temperature in 5% milk in Tris-buffered saline containing 0.1% Tween 20 (TBS-T). Primary (1473 anti-E4) and secondary antibodies (anti-rabbit) were diluted in 5% milk in TBS-T. Each antibody incubation time is usually 1 h to overnight. Following each antibody incubation, membranes were washed 3 × 15 min in TBS-T. Antibody binding was detected by enhanced chemiluminescence (Renaissance® Western Blot Chemiluminescence Reagent Plus, NEN™ Life Science Products, Inc., Boston, MA) with subsequent exposure to film. The anti-HPV11 E1^E4 (1473 anti-E4) and relevant preimmune sera were developed by John Doorbar and were used at 1:2500 dilution for detection of HPV-11 E1^E4 by Western blot analysis. In situ hybridization A biotin label was incorporated into DNA using the random priming method (Amersham, Cleveland, OH). Deparaffinized, rehydrated sections of formalin-fixed, paraffin-embedded tissues were digested with pepsin (4 mg/ml in 0.1 N HCl) and washed in Tris–HCl, pH 7.5, dehydrated and covered with a hybridization cocktail containing 0.6 M NaCl, 10 mM Tris pH 7.4, 0.5 mM EDTA, 1 mg/ml bovine serum albumin (BSA), 0.02% polyvinylpyrrolidone (PVP) (w/v), 0.02% Ficoll (w/v), 0.15 mg/ml yeast tRNA, 5 mM DTT, 10% dextran sulfate (w/v), 50% formamide (v/v) and 1 ng/μl labeled DNA. Probe and tissue were denatured together by heating the slides at 100 °C for 6 min. After heat denaturation, slides were incubated in a moist chamber at 37 °C for 2 h, washed 3 times for 10 min each in 2× SSC (0.3 M NaCl and 30 mM sodium citrate, pH 7.0) and incubated with avidin-conjugated alkaline phosphatase for 30 min. After washing in Tris–HCl buffer (pH 9.5) for 3 × 10 min, the McGady reagent was used to develop signal color and sections were counterstained with Nuclear Fast Red. Acknowledgments This work was supported by NIH grants P01 AI37829 and 5 PO1 HD41752. Funding was also from the PA Department of Health, Health Research Formula Funding Program as a part of the PA Tobacco Settlement Legislation, and a Penn State Cancer Research Institute Grant of the Penn State College of Medicine. We thank Dr. J. Rheinwald and Dr. M. Dickson at Department of Medicine and Harvard Skin Disease Research Center, Harvard University, for the permission of using their N-Tert cell line. References Bedell, M.A., Hudson, J.B., Golub, T.R., Turyk, M.E., Hosken, M., Wilbanks, G.D., Laimins, L.A., 1991. Amplification of human papillomavirus
genomes in vitro is dependent on epithelial differentiation. J. Virol. 65 (5), 2254–2260. Brandsma, J.L., Xiao, W., 1993. Infectious virus replication in papillomas induced by molecularly cloned cottontail rabbit papillomavirus DNA. J. Virol. 67 (1), 567–571. Brandsma, J.L., Yang, Z.H., Barthold, S.W., Johnson, E.A., 1991. Use of a rapid, efficient inoculation method to induce papillomas by cottontail rabbit papillomavirus DNA shows that the E7 gene is required. Proc. Natl. Acad. Sci. U. S. A. 88 (11), 4816–4820. Bryan, J.T., Brown, D.R., 2000. Association of the human papillomavirus type 11 E1()E4 protein with cornified cell envelopes derived from infected genital epithelium. Virology 277 (2), 262–269. Christensen, N.D., Cladel, N.M., Reed, C.A., Budgeon, L.R., Welsh, P.A., Patrick, S.D., Kreider, J.W., 1996. Laboratory production of infectious stocks of rabbit oral papillomavirus. J. Gen. Virol. 77 (Pt. 8), 1793–1798. Davy, C.E., Jackson, D.J., Wang, Q., Raj, K., Masterson, P.J., Fenner, N.F., Southern, S., Cuthill, S., Millar, J.B., Doorbar, J., 2002. Identification of a G(2) arrest domain in the E1 wedge E4 protein of human papillomavirus type 16. J. Virol. 76 (19), 9806–9818. Davy, C.E., Jackson, D.J., Raj, K., Peh, W.L., Southern, S.A., Das, P., Sorathia, R., Laskey, P., Middleton, K., Nakahara, T., Wang, Q., Masterson, P.J., Lambert, P.F., Cuthill, S., Millar, J.B., Doorbar, J., 2005. Human papillomavirus type 16 E1 E4-induced G2 arrest is associated with cytoplasmic retention of active Cdk1/cyclin B1 complexes. J. Virol. 79 (7), 3998–4011. de Villiers, E.M., 2001. Taxonomic classification of papillomaviruses. Papillomavirus Rep. 12 (3), 57–63. Dickson, M.A., Hahn, W.C., Ino, Y., Ronfard, V., Wu, J.Y., Weinberg, R.A., Louis, D.N., Li, F.P., Rheinwald, J.G., 2000. Human keratinocytes that express hTERT and also bypass a p16(INK4a)-enforced mechanism that limits life span become immortal yet retain normal growth and differentiation characteristics. Mol. Cell. Biol. 20 (4), 1436–1447. Doorbar, J., Ely, S., Sterling, J., McLean, C., Crawford, L., 1991. Specific interaction between HPV16 E1^E4 and cytokeratins results in collapse of the epithelial cell intermediate filament network. Nature 352 (6338), 824–827. Doorbar, J., Foo, C., Coleman, N., Medcalf, L., Hartley, O., Prospero, T., Napthine, S., Sterling, J., Winter, G., Griffin, H., 1997. Characterization of events during the late stages of HPV16 infection in vivo using high-affinity synthetic Fabs to E4. Virology 238 (1), 40–52. Doorbar, J., Elston, R.C., Napthine, S., Raj, K., Medcalf, E., Jackson, D., Coleman, N., Griffin, H.M., Masterson, P., Stacey, S., Mengistu, Y., Dunlop, J., 2000. The E1E4 protein of human papillomavirus type 16 associates with a putative RNA helicase through sequences in its C terminus. J Virol 74 (21), 10081–10095. Fang, L., Meyers, C., Budgeon, L.R., Howett, M.K., 2006. Induction of Productive Human Papillomavirus Type 11 Life Cycle in Epithelial Cells Grown in Organotypic Raft Cultures. Virology 347 (1), 28–35. Fecile, M.L., 1995. PhD Penn State University, Hershey. Flores, E.R., Allen-Hoffmann, B.L., Lee, D., Lambert, P.F., 2000. The human papillomavirus type 16 E7 oncogene is required for the productive stage of the viral life cycle. J. Virol. 74 (14), 6622–6631. Howley, P.M., 1996. Papillomavirinae: The viruses and their replication, In: Fields, B.N., Knipe, D.M., Howley, P.M. (Eds.), third ed. Fields Virology, vol. 2. Lippincott-Raven Publishers, Philadelphia, PA, pp. 2045–2076. 2 vols. Ko, M.J., Chu, C.Y., 2004. Disseminated human papillomavirus type 11 infection in a patient with pemphigus vulgaris: confirmed by DNA analysis. J. Am. Acad. Dermatol. 51 (5 Suppl.), S190–S193. Ludmerer, S.W., McClements, W.L., Wang, X.M., Ling, J.C., Jansen, K.U., Christensen, N.D., 2000. HPV11 mutant virus-like particles elicit immune responses that neutralize virus and delineate a novel neutralizing domain. Virology 266 (2), 237–245. McCance, D.J., Kopan, R., Fuchs, E., Laimins, L.A., 1988. Human papillomavirus type 16 alters human epithelial cell differentiation in vitro. Proc. Natl. Acad. Sci. U. S. A. 85 (19), 7169–7173. McLaughlin-Drubin, M.E., Wilson, S., Mullikin, B., Suzich, J., Meyers, C., 2003. Human papillomavirus type 45 propagation, infection, and neutralization. Virology 312 (1), 1–7.
L. Fang et al. / Virology 351 (2006) 271–279 Meyers, C., 1996. Organotypic (raft) epithelial tissue culture system for the differentiation-dependent replication of papillomavirus. Methods Cell Sci. 18, 201–210. Meyers, C., Frattini, M.G., Hudson, J.B., Laimins, L.A., 1992. Biosynthesis of human papillomavirus from a continuous cell line upon epithelial differentiation. Science 257 (5072), 971–973. Meyers, C., Bromberg-White, J.L., Zhang, J., Kaupas, M.E., Bryan, J.T., Lowe, R.S., Jansen, K.U., 2002. Infectious virions produced from a human papillomavirus type 18/16 genomic DNA chimera. J. Virol. 76 (10), 4723–4733. Middleton, K., Peh, W., Southern, S., Griffin, H., Sotlar, K., Nakahara, T., ElSherif, A., Morris, L., Seth, R., Hibma, M., Jenkins, D., Lambert, P., Coleman, N., Doorbar, J., 2003. Organization of human papillomavirus productive cycle during neoplastic progression provides a basis for selection of diagnostic markers. J. Virol. 77 (19), 10186–10201. Nakahara, T., Nishimura, A., Tanaka, M., Ueno, T., Ishimoto, A., Sakai, H., 2002. Modulation of the cell division cycle by human papillomavirus type 18 E4. J. Virol. 76 (21), 10914–10920. Peh, W.L., Middleton, K., Christensen, N., Nicholls, P., Egawa, K., Sotlar, K., Brandsma, J., Percival, A., Lewis, J., Liu, W.J., Doorbar, J., 2002. Life cycle heterogeneity in animal models of human papillomavirus-associated disease. J. Virol. 76 (20), 10401–10416. Peh, W.L., Brandsma, J.L., Christensen, N.D., Cladel, N.M., Wu, X., Doorbar, J., 2004. The viral E4 protein is required for the completion of the cottontail rabbit papillomavirus productive cycle in vivo. J. Virol. 78 (4), 2142–2151. Raj, K., Berguerand, S., Southern, S., Doorbar, J., Beard, P., 2004. E1^E4
279
protein of human papillomavirus type 16 associates with mitochondria. J. Virol. 78 (13), 7199–7207. Roberts, S., Ashmole, I., Gibson, L.J., Rookes, S.M., Barton, G.J., Gallimore, P.H., 1994. Mutational analysis of human papillomavirus E4 proteins: identification of structural features important in the formation of cytoplasmic E4/cytokeratin networks in epithelial cells. J. Virol. 68 (10), 6432–6445. Shah, K.V., Howley, P.M., 1996. Papillomaviruses, In: Fields, Bernard N., Knipe, David M., Howley, P.M. (Eds.), third ed. Fields Virology, vol. 2. Lippincott-Raven, Philadelphia, pp. 2077–2109. 2 vols. Sherr, C.J., Roberts, J.M., 2004. Living with or without cyclins and cyclindependent kinases. Genes Dev. 18 (22), 2699–2711. Smith, L.H., Foster, C., Hitchcock, M.E., Leiserowitz, G.S., Hall, K., Isseroff, R., Christensen, N.D., Kreider, J.W., 1995. Titration of HPV-11 infectivity and antibody neutralization can be measured in vitro. J. Invest. Dermatol. 105 (3), 438–444. Stubenrauch, F., Laimins, L.A., 1999. Human papillomavirus life cycle: active and latent phases. Semin. Cancer Biol. 9 (6), 379–386. Wang, Q., Griffin, H., Southern, S., Jackson, D., Martin, A., McIntosh, P., Davy, C., Masterson, P.J., Walker, P.A., Laskey, P., Omary, M.B., Doorbar, J., 2004. Functional analysis of the human papillomavirus type 16 E1 = E4 protein provides a mechanism for in vivo and in vitro keratin filament reorganization. J. Virol. 78 (2), 821–833. Wilson, R., Fehrmann, F., Laimins, L.A., 2005. Role of the E1–E4 protein in the differentiation-dependent life cycle of human papillomavirus type 31. J. Virol. 79 (11), 6732–6740.