- Email: [email protected]
The identification of a MYB transcription factor controlling anthocyanin biosynthesis regulation in Chrysanthemum flowers
Scientia Horticulturae 194 (2015) 278–285
Contents lists available at ScienceDirect
Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti
The identification of a MYB transcription factor controlling anthocyanin biosynthesis regulation in Chrysanthemum flowers Xiao-fen Liu a,b,c,1 , Li-li Xiang a,b,c,1 , Xue-ren Yin a,b,c , Donald Grierson a,d , Fang Li a,b,∗ , Kun-song Chen a,b,c a
College of Agriculture & Biotechnology, Zhejiang University, Zijingang Campus, Hangzhou 310058, PR China Zhejiang Provincial Key Laboratory of Horticultural Plant Integrative Biology, Zhejiang University, Zijingang Campus, Hangzhou 310058, PR China c The State Agriculture Ministry Laboratory of Horticultural Plant Growth, Development and Quality Improvement, Zhejiang University, Zijingang Campus, Hangzhou 310058, PR China d Plant & Crop Sciences Division, School of Biosciences, University of Nottingham, Sutton Bonington Campus, Loughborough LE12 5RD, UK b
a r t i c l e
i n f o
Article history: Received 9 July 2015 Received in revised form 8 August 2015 Accepted 11 August 2015 Keywords: Chrysanthemum Anthocyanin biosynthesis MYB transcription factor Transient assay
a b s t r a c t Metabolism of anthocyanin in Chrysanthemum (Chrysanthemum morifolium Ramat.) is catalyzed by several biosynthetic enzymes, however, the underlying transcriptional regulatory mechanisms remain unknown. In the present research, four MYB transcription factors, CmMYB3-6, were isolated from ‘Amadea’ Chrysanthemum, by RNA-seq and RACE. Among the four CmMYBs, CmMYB3 and CmMYB6 were expressed concurrently with the expression of biosynthetic genes and accumulation of anthocyanin during flower development. In order to study the transcription regulatory role of CmMYB3 and CmMYB6 in anthocyanin biosynthesis, the promoter region of CmDFR was isolated. Dual luciferase assay showed that CmMYB6 significantly activated the CmDFR promoter more than 8-fold. Furthermore, the combination of CmMYB6 and MrbHLH1 (from Myrica rubra involved in anthocyanin biosynthesis) resulted in approximately 34fold induction of the CmDFR promoter. Using a transient over-expression system in Nicotiana tabacum leaves, CmMYB6 and MrbHLH1 co-expression lead to transient anthocyanin accumulation. Thus, CmMYB6 is proposed as a novel transcription factor in Chrysanthemum anthocyanin biosynthesis. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Flower color is a crucial trait for ornamental plants. Chrysanthemum (Chrysanthemum morifolium Ramat.) is a widely grown and important ornamental (Teixeira da Silva et al., 2012). Different cultivars of Chrysanthemum exhibited various colors, such as white, yellow, yellow green, orange, pink, red, dark red, purple and brown (Hong et al., 2012). Thus, Chrysanthemum is an important ornamental for the analysis of flower color production in different types. However, the most widely grown Chrysanthemum cultivars used for standard cut flowers are white or yellow. Therefore, additional
Abbreviations: TFs, transcription factors; RACE, rapid amplification of cDNA ends; ORFs, open reading fragments; CTAB, cetyltrimethylammonium bromide; OPCR, real-time PCR; DFR, dihydroflavonol 4-reductase; MCS, multiple cloning sites. ∗ Corresponding author at: Zhejiang Provincial Key Laboratory of Horticultural Plant Integrative Biology, Zhejiang University, Zijingang Campus, Hangzhou 310058, PR China. Fax: +86 571 88982224. E-mail address: [email protected] (F. Li). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.scienta.2015.08.018 0304-4238/© 2015 Elsevier B.V. All rights reserved.
color research would be of benefit for improving the color for these commercially important standard cut Chrysanthemums. Anthocyanins are one of the important groups of plants pigments (Holton and Cornish, 1995; Tanaka et al., 2008). Their differential accumulation causes the different colors in most flowers, varying from salmon and scarlet through red and purple to blue. The pathway of anthocyanin biosynthesis has been well characterized in many plants, such as Arabidopsis, petunia, dahlia, etc. (Springob et al., 2003; Koes et al., 2005; Ohno et al., 2011; Jaakola, 2013). In Chrysanthemum, seven anthocyanin biosynthetic genes, from CmCHS to CmUFGT, have been isolated from the Chrysanthemum cultivar ‘Lijin’, which accumulates anthocyanin in the ligulate flowers. CmCHS, CmCHI and CmF3 H were expressed more highly at early development stages, while CmF3H, CmDFR, CmANS and CmUFGT were coordinately expressed throughout all of the stages of ray floret development (Huang et al., 2013). These results suggest that anthocyanin accumulation in Chrysanthemums was due to coordinate expression of biosynthetic genes, which might be manipulated by transcription factors (TFs), such as MYB that was reported most recently by Hong et al. (2015).
X.-f. Liu et al. / Scientia Horticulturae 194 (2015) 278–285
279
Fig. 1. Phylogenetic tree of MYBs and deduced protein sequence alignment. (a) Sequence alignment of MYBs related to flavonoid biosynthesis regulation in other plants compared to six MYBs from Chrysanthemum. Lines indicate the R2 and R3 conserved domains, respectively. (b) Phylogenetic tree of 137 MYBs, including 126 from Arabidopsis, 6 from Chrysanthemum and 3 from other ornamentals related to anthocyanin biosynthesis regulation.
280
X.-f. Liu et al. / Scientia Horticulturae 194 (2015) 278–285 Table 1 Primers used in RACE PCR. Genes CmMYB3
RACE
3
5
Fig. 2. Anthocyanin contents at four different developmental stages of ‘Amadea’ flowers, from S0 to S3, young leaves (YL) and stems (YS). The vertical bars represent S.E. of three biological replicates.
MYB TFs play the central role during the regulation of anthocyanin biosynthesis (Allan et al., 2008; Jaakola, 2013; Xu et al., 2015). Many results revealed that the different capacities for anthocyanin biosynthesis could be traced to the different transcriptional levels of MYB TFs regulating anthocyanin accumulation. For example, high-light induced anthocyanin pigmentation in Lc petunia was regulated by endogenous MYB TFs (Albert et al., 2009), over-expression of GMYB10 from Gerbera hybrid lead to strongly enhanced accumulation of anthocyanin pigments as well as to an altered pigmentation pattern in transgenic gerbera plants (Laitinen et al., 2008), high transcriptional levels of LhMYB12-Lat was specifically associated with splatter spot development which arises simply from the deposition of anthocyanin pigments in the tepal epidermis of Asiatic hybrid lily (Lilium spp.) cv ‘Latvia’ (Yamagishi et al., 2012), while the disruption of VvmybA1 expression resulting from a retrotransposon-induced mutation was associated with the loss of anthocyanin biosynthesis in white cultivars of Vitis vinifera (Kobayashi et al., 2004), and a decrease in MrMYB1 resulted in lack of anthocyanin biosynthesis in bagged Chinese bayberry fruits (Niu et al., 2010). As mentioned above, although the contribution of anthocyanin accumulation to Chrysanthemums flower color is well established, the roles of transcription factors, including MYB, controlling the expression of structural genes have rarely been investigated. Most recently, three MYB members were reported as candidates in anthocyanin regulation in Chrysanthemum based on clustering analysis and their expression patterns (Hong et al., 2015). However, more information and identification of MYBs were needed to study the mechanism of anthocyanin biosynthesis in Chrysanthemum flowers. In the present research, four MYB TFs, named CmMYB3, CmMYB4, CmMYB5 and CmMYB6, were isolated from Chrysanthemum, ‘Amadea’, which accumulated anthocyanin in the flowers. Based on the transcriptional levels, CmMYB3 and CmMYB6 showed a positive correlation with anthocyanin accumulation. However, only CmMYB6 could active the CmDFR promoter and induce anthocyanin biosynthesis in tobacco leaves when transiently coexpressed with MrbHLH1, a previously characterized anthocyanin regulator from bayberry (Myrica rubra) fruit (Liu et al., 2013a,b). 2. Materials and methods 2.1. Plant materials Ray florets of Chrysanthemum (C. morifolium Ramat.), ‘Amadea’, were collected at four different developmental stages, S0, S1, S2 and S3, based on different degrees of blooming (Fig. 2). The young leaves
CmMYB4
3
CmMYB5
3
CmMYB6
5
Primers
Sequences (5 −3 )
GSP1 GSP2 GSP1 GSP2 GSP1 GSP2 GSP1 GSP2 GSP1 GSP2
CAGGTGGTCTTTGATAGCAGCCC CCCTCCTACGATAACCATTCCACAAACG TTTGATTTCGTTGTCTGTTCGCCCGG CAGTCTACAACTCTTCCCACACC AGTCTAAATATGGGAAGGTCACCTG GGTAAAAGCTGTCGTCTCAGGTGGATC GGAATTGGCGCGAACTTCCTAAATATGC CGACATGGGAAACAAGTATGTGGTC CGATGGGTGACGAGATATACCCTG CTGTTGCCTAGAAGCTTGTGAAGC
which were located next to the flowers, and stems which were 2 cm close proximity to the flowers, were also harvested. Chrysanthemums were obtained from Fengdao Company, Yunnan Province, China, during the 2014 season. Each sample included three biological replicates, approximately 10 g for each replicate, and was frozen in liquid nitrogen immediately after being cut into small pieces, and stored at −80 ◦ C.
2.2. Anthocyanin analysis The anthocyanin contents in ‘Amadea’ flowers were detected by the pH differential spectrophotometry method described in Wrolstad et al. (1982). Flower anthocyanin contents were extracted from 1 g samples in methanol/0.05% HCl and the absorbance at 510 and 700 nm measured using a UV-2550 spectrophotometer (SHIMADZU). To avoid the influence of chlorophyll, the determination of anthocyanin accumulated in ‘Amadea’ young leaves and stems, as well as tobacco leaves in transient over-expression experiments, was carried out according to the method described in Carrie and Gregory (2009). Powders of frozen leaves or stems were extracted in methanol/1% HCl overnight at 4 ◦ C in the dark, the chlorophyll was then removed with chloroform before the absorbance at 530 and 657 nm was measured. Relative anthocyanin content was calculated on a per g fresh weight basis by ((A530–A657)/mg FW tissue) × 1000.
2.3. MYB transcription factor isolation and analysis The Chrysanthemum RNA-Seq database was obtained with a mixed RNA pool which including the RNA extracted from four different developmental stages of flowers, young leaves and stems of ‘Amadea’. The library construction, sequencing and data analysis were all conducted by Novogene in Beijing. Four MYB unigenes were chosen from the RNA-seq database, which possibly had the ability to participate in anthocyanin biosynthesis regulation. Due to the previous reports on CmMYB1 (related to lignin and flavonoid biosynthesis regulation, Zhu et al., 2013) and CmMYB2 (related to drought and salinity tolerance, Shan et al., 2012), the four unigenes were designated as CmMYB3-6, from the partial coding regions, the 3 and 5 -ends were obtained by RACE (rapid amplification of cDNA ends, Clontech, USA), using the primers listed in Table 1. The ORFs (open reading fragments) of CmMYBs were analyzed by ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). The phylogenetic relationship between these CmMYBs and R2R3 MYBs in Arabidopsis (Dubos et al., 2010), as well as those related to anthocyanin biosynthesis in other plant species was analyzed by means of MEGA v. 5.0 (Tamura et al., 2011). Sequence homology and alignment were carried out with BLASTn (http://blast.ncbi.nlm.nih.gov/ Blast.cgi) and Clustal X (Thompson et al., 1997), respectively.
X.-f. Liu et al. / Scientia Horticulturae 194 (2015) 278–285 Table 2 Primers used in real time PCR to study the expression of CmMYBs.
281
Table 3 Primers used in cloning of CmMYBs and CmDFR promoter into SK or LUC vectors.
Genes
Primers
Sequences (5 −3 )
Genes
Primers
Sequences (5 −3 )
CmMYB3
Forward Reversed Forward Reversed Forward Reversed Forward Reversed
TCATCTAGCACGGTTTCGTATG TGGCACACTTGTATTTGTACACGT TGGACTATAGAAGCTTGGAGATGA GCTTGCATACGACTATACGAGTGA AATCGGCAGCATCACAGAGA CACACGAACTCCTTCTTTAACTTG ACGGCGAAATAGGGTGGTCATTAG GGATTGCAATATCATAGTTGGTCCG
CmMYB3
Forward Reversed Forward Reversed Forward Reversed Forward Reversed
ATGGGAAGAGCACCGTGTTGC TTAAGAAAGAAGCCATGCATC ATGGGAAGGTCACCTTGTTG TTATTTCATCTCCAAGCTTC ATGGTGAGAGCACCTTGTATTGAC TCAACACACGAACTCCTTCTTTAAC ATGGGGGAGTACAGAAAAATG TCATAGTTGGTCCGAATTTA
CmMYB4 CmMYB5 CmMYB6
2.4. Gene expression Total RNA was extracted according to a modified CTAB (cetyltrimethylammonium bromide) method (Chang et al., 1993). Genomic DNA was removed by DNase I (Fermentas, USA), and 1 g of DNA-free RNA was used to synthesize first-strand cDNA (Bio-rad, USA). The CmMYB expression patterns were studied by QPCR (real-time PCR) with the primers listed in Table 2 following the manufacturers’ instructions with Ssofast EvaGreen supermix (Bio-rad, USA). While the primers for the biosynthetic genes were referred to Huang et al. (2013). Expression levels at different development stages of flowers were expressed as a ratio relative to values at S0 developmental stage which was set at 1. The gene specificities of primers were confirmed by melting curves and PCR product sequencing (Yin et al., 2008). Ct value of CmACT (GenBank AB770471) was used to normalize all of the QPCR reactions. No-template controls and melting curve analyses were included for each gene and each PCR reaction.
CmMYB4 CmMYB5 CmMYB6
(35S::REN), which were analyzed with the manufacturer’s instructions using a Dual-Luciferase Reporter Assay System (Promega, USA) and a Modulus Luminometer (Promega, USA), was applied to measure the TF-promoter interactions. For each interaction, three independent experiments were carried out with at least four biological replicates for each. 2.7. Transient over-expression In order to verify the function of CmMYB6 in inducing anthocyanin biosynthesis, transient over-expression in tobacco leaves (Nicotiana tabacum) was utilized as described in previous reports (Liu et al., 2013a,b). GV3101 (MP90) containing both or either of CmMYB6 and MrbHLH1 was infiltrated into tobacco leaves either singly or in pairs. The patches in tobacco leaves were photographed eight days after infiltration to show anthocyanin development, and then cut into pieces and frozen in liquid nitrogen before the detection of anthocyanin content. Each assay was carried out with three independent experiments with three biological replicates for each.
2.5. CmDFR promoter isolation and analysis 3. Results Dihydroflavonol 4-reductase (DFR) genes have been widely characterized as key anthocyanin biosynthetic genes (Holton and Cornish, 1995). In the present research, CmDFR mRNA accumulation was also correlated with anthocyanin content in Chrysanthemum flowers. Thus CmDFR was chosen for promoter isolation. The promoter region of CmDFR was isolated by genome walking. Genomic DNA was extracted from young leaves of ‘Amadea’ using the DNA extracting kit (Qiagen, Germen). The construction of genome walker libraries and genomic walking PCR were carried out with a universal genome walker kit (Clontech, USA) following the manufacturer’s instructions and the method described in Yin et al. (2010). Primers used in genomic walking PCR included GSP1 (5 -CTCAAAGTCCATAGGGGTGGCAACATG-3 ) and GSP2 (5 -CCATGGGCGCTAAATCCGCCTTCCATAATGTC-3 ). Conserved cis-element motifs located in the CmDFR promoter were scanned by online software PLACE (http://www.dna.affrc.go.jp/ PLACE/signalscan.html, Higo et al., 1999). 2.6. Dual luciferase assay Dual luciferase assay has been widely used to study the transcriptional regulatory roles of transcription factors on target promoters (Hellens et al., 2005; Xu et al., 2014; Montefiori et al., 2015; Zeng et al., 2015). The ORFs of four CmMYBs and the CmDFR promoter were amplified, using primers listed in Table 3 and were recombined into the MCS (multiple cloning sites) of the pGreenII 0029 62-SK or pGreenII 0800-LUC vectors, respectively. The fulllength of MrbHLH1 from Myrica rubra involved in anthocyanin biosynthesis was obtained and constructed by Liu et al. (2013b). All constructs were individually electroporated into Agrobacterium tumefaciens GV3101 (MP90) before being infiltrated into tobacco leaves (Nicotiana benthamiana). The ratio of enzyme activities of firefly luciferase (CmDFR::LUC) to renilla luciferase
3.1. CmMYB gene isolation and analysis To isolate the key MYB transcription factor related to the regulation of anthocyanin biosynthesis, a Chrysanthemum RNA-Seq database was created with mixed RNA pool from ‘Amadea’ which included four different developmental stages of flowers, young leaves and stems. A total of 103 unigenes which contained the conserved MYB domains were identified from the database (data not shown). Among these MYB unigenes, four members designated CmMYB3-6 were selected for investigation as to their possible functions in anthocyanin biosynthesis regulation. The deduced protein sequences of CmMYB3 (GenBank KR002094), CmMYB4 (KR002095), CmMYB5 (KR002096) and CmMYB6 (KR002097) contained 318, 261, 215 and 254 amino acids, respectively. All of these CmMYBs belong to the R2R3 MYB class according to the conserved domains (Fig. 1a). Phylogenetic analysis indicated that only CmMYB6 was clustered with anthocyanin related MYB genes from other plants, such as AtMYB75 (AtPAP1) in Arabidopsis, GbMYB1 (BAJ17661) in Gynura bicolor, PhAN2 (AAF66727) in petunia (Fig. 1b). CmMYB3, CmMYB4 and CmMYB5 were close to AtMYB12 (flavonol-specific transcriptional activator), CmMYB1 (lignin biosynthesis related repressor), and AtMYB34 (a regulator of tryptophan biosynthesis), respectively (Fig. 1b). 3.2. Anthocyanin analysis in ‘Amadea’ flowers During the development of ‘Amadea’ flowers, the flower color gradually changed from white to purple (Fig. 2). Further study showed that anthocyanin content in these petals increased dramatically corresponding to the formation of purple flower color. No anthocyanin could be detected while the petals remained enclosed
282
X.-f. Liu et al. / Scientia Horticulturae 194 (2015) 278–285
Fig. 3. The relative expression of seven anthocyanin biosynthetic genes during the development of ‘Amadea’ flowers. Expression levels were expressed as a ratio relative to the S0 developmental stage which was set at 1. The vertical bars represent S.E. of three biological replicates.
by the bracts (S0 and S1, Fig. 2). However, as soon as the purple flower color appeared in part or entire petals, anthocyanin was accumulated and increased dramatically from 0.03 (S2) to 0.35 (S3) mg/gFW (Fig. 2). Young leaves and stems were also tested, however, their anthocyanin contents were undetectable (Fig. 2). 3.3. Expression of anthocyanin biosynthetic genes and CmMYB genes The anthocyanin biosynthetic genes in Chrysanthemum were reported by Huang et al. (2013), including CHS, CHI, F3H, F3 H, DFR, ANS and UFGT. Most of these genes were up-regulated during flower development, although slight differences were observed between their expression patterns. Relative expression of CmDFR and CmUFGT increased throughout the developmental stages of flower, CmCHS, CmCHI, CmF3H and CmANS peaked at stage S2, while the transcriptional level of CmF3 H was stable during S0–S1 and slowly decreased from S1 to S3 (Fig. 3). The accumulation of CmCHS and CmUFGT mRNAs increased 12 times at S2 and 6 times at S3, respectively (Fig. 3). Unlike the biosynthetic genes, the four CmMYBs were differentially expressed during different stages of flower development. Both CmMYB3 and CmMYB6 exhibited increasing expression patterns, with CmMYB3 peaking at the S2 stage whereas the highest expression CmMYB6 was at S3 (Fig. 4). The approximately 12fold increasing extent of CmMYB6 mRNA was substantially higher
than that of CmMYB3 mRNA (Fig. 4). The transcriptional levels of CmMYB4 and CmMYB5 showed only a weak correlation with anthocyanin biosynthesis and the expression of biosynthetic genes during the different developmental stages. Expression of CmMYB4 declined during stages S0–S2, while CmMYB5 remained constant from S0–S2 and with a rapid drop at S3 (Fig. 4). Different tissue expression patterns were also found for these four CmMYBs. Expression of CmMYB4 was constant among flowers, young leaves and stems (Fig. 5). CmMYB5 was highly expressed in stem, while CmMYB3 and CmMYB6 were more abundant in flowers (Fig. 5). Thus, based on the expression patterns, CmMYB3 and CmMYB6 were the most likely candidates for the regulation of anthocyanin biosynthesis in Chrysanthemum. 3.4. Transcriptional regulation of CmMYB on CmDFR In order to investigate the possible regulatory roles of CmMYB genes in anthocyanin biosynthesis, the promoter of CmDFR (Supporting File) was obtained using genome walking technology, due to the lack of a Chrysanthemum genome sequence. A 769 bp region of the CmDFR promoter was cloned and the TATA box located −80 bp away from the ATG (Fig. 6a). Cis-elements recognized by MYB or bHLH were found in the CmDFR promoter, for example, MYBPZM (CCWACC), MYB1AT (WAACCA) and MYBATRD22 (CACATG), recognized by MYB, and E-box (CANNTG) and ACEs (ACGT containing elements), recognized by bHLH (Fig. 6a).
X.-f. Liu et al. / Scientia Horticulturae 194 (2015) 278–285
283
Fig. 4. The relative expression of four CmMYB genes at four developmental stages of ‘Amadea’ flowers analyzed by real-time PCR. Expression levels were expressed as a ratio relative to the S0 developmental stage which was set at 1.The vertical bars represent S.E. of three biological replicates.
Fig. 5. The relative expression of four CmMYB genes in different tissues of ‘Amadea’ including flowers in S3, young leaves (YL) and stems (YS). The vertical bars represent S.E. of three biological replicates.
Dual luciferase assay was carried out to analyze the in vivo regulatory roles of CmMYB genes. The results indicated that only CmMYB6 could trans-activate the CmDFR promoter, with an approximately 8-fold induction (Fig. 6b), while CmMYB3-5 were not able to influence CmDFR promoter activity. MYB and bHLH transcription factors usually generate synergistic effects on anthocyanin biosynthesis. Here, the previously isolated anthocyanin biosynthesis regulator, MrbHLH1 (Liu et al., 2013b), was employed. In the presence of CmMYB6 and MrbHLH1, the relative activities of the CmDFR promoter were amplified approximately 34-fold (Fig. 6b). However, the other three members, including CmMYB3, CmMYB4 and CmMYB5, remained unable to activate the CmDFR promoter, even when co-expressed with MrbHLH1 (Fig. 6b).
3.5. Transient over-expression of CmMYB6 in tobacco leaves
Fig. 6. In vivo interactions between CmMYB genes and CmDFR promoters. (a) Schematics of CmDFR promoter indicated with thick lines (promoter lengths are marked), circle (TATA box), triangles (MYB recognized cis-elements), squares (bHLH recognized cis-elements) and rectangles (LUC). (b) Dual luciferase analyses. Error bars are the S.E. of four replicates.
To confirm the functions of CmMYBs in regulating anthocyanin biosynthesis, their effects on anthocyanin accumulation were tested following transient over-expression in tobacco leaves. CmMYB3, CmMYB4 and CmMYB5 were unable to induce anthocyanin biosynthesis in tobacco leaves, when co-expressed with MrbHLH1 (data not shown), which was in agreement with the results of the dual luciferase assay (Fig. 6). In contrast, co-expression of CmMYB6 and MrbHLH1 triggered an obvious accumulation of anthocyanin in tobacco leaves (Fig. 7a,b). Further analyses indicated that when CmMYB6 and MrbHLH1were co-expressed in leaves the anthocyanin content was >4.0 mg/g
284
X.-f. Liu et al. / Scientia Horticulturae 194 (2015) 278–285
Fig. 7. Transient over-expression of CmMYB6 in Nicotiana tabacum leaves causes anthocyanin production and is increased synergistically by co-expression with MrbHLH1. (a) Color development due to transient transformation with either CmMYB6 or MrbHLH1 and empty vector together.; or with CmMYB6 and MrbHLH1 together in N. tabacum leaves. Digital images of infiltration sites on the reverse sides of tobacco leaves were taken 8 days after infiltration. (b) The infiltrated leaf patches were extracted with acidified methanol (1% concentrated HCl) for detection of anthocyanin contents. The four tubes relate to the four treatments corresponding to images in (a). (c) Anthocyanin contents of tobacco leaves after infiltrated with different genes. Error bars are the S.E. of three replicate reactions.
FW, which is much higher than in the leaves expressing CmMYB6 (0.03 mg/g FW) or MrbHLH1 (0.04 mg/g FW) alone (Fig. 7c). 4. Discussion Flower colors, mainly conferred by anthocyanins, carotenoids or betalains, play an irreplaceable role in ornamental flower traits (Quattrocchio et al., 1993; Ohno et al., 2011; Xu et al., 2015; Hsu et al., 2015). The anthocyanin metabolic pathway is regulated by transcription factors MYB, bHLH and WD40 where the MYB TFs played the central role (Baudry et al., 2004; Xu et al., 2015). Chrysanthemum contains thousands of cultivars which are classed into nine groups based on different flower colors that are mainly influenced by anthocyanin contents (Hong et al., 2012). Anthocyanin accumulation in a purple Chrysanthemum cultivar, ‘Fandango’, had been identified by Stickland, (1972) forty years ago. However, the transcriptional regulation of anthocyanin in Chrysanthemum is much less well understood compared with other plants. Although the seven biosynthetic genes have already been isolated, transcription factors related to anthocyanin regulation were studied most recently only in the correlation between their expression patterns and anthocyanin contents (Hong et al., 2015). The gene function in anthocyanin regulation still remained unknown which limits further study the mechanism of flower color production. In this study, anthocyanin was also found to be the main purple pigment in Chrysanthemum cultivar ‘Amadea’, in agreement with the result in Chrysanthemum cultivar ‘Lijin’ (Huang et al., 2013). The genes for the seven enzymes encoded by CmCHS, CmCHI, CmF3H, CmF3 H, CmDFR, CmANS and CmUFGT showed similar expression patterns during flower development in ‘Amadea’
and purple colored series ‘Lijin’, and their mRNAs increased dramatically concomitantly with anthocyanin accumulation, excepted CmF3 H (Fig. 3; Huang et al., 2013). Coordinated expression pattern of biosynthetic genes during anthocyanin accumulation has also been found in other plants, such as dahlia, bayberry, etc. (Ohno et al., 2011; Liu et al., 2013b). Among the three anthocyanin related TFs, MYBs have the highest specificity compared with bHLH and WD40 (Baudry et al., 2004). Among four CmMYBs studied here, CmMYB6 was most closely related to MYB members such as AtMYB75 (AtPAP1), GbMYB1 and PhAN2 (Fig. 1b), which are associated with anthocyanin biosynthesis regulation in other plants (Quattrocchio et al., 1993; Borevitz et al., 2000; Shimizu et al., 2011). The deduced amino acid sequence of CmMYB6 contained a conserved [D/E]Lx2[R/K]x3Lx6Lx3R motif required for interaction with R/B-like bHLH proteins (Zimmermann et al., 2004) and a characteristic identifier, ANDV, of dicot anthocyanin-promoting MYBs (Lin-Wang et al., 2010; Fig. 1a). Furthermore, expression of CmMYB6 coincided with anthocyanin accumulation and positively activated the CmDFR promoter. These characteristics were in accordance with MYB members related to regulation of anthocyanin biosynthesis in other plants. For example, down-regulation of PhAN2 reduced the activity of PhDFR and reduced anthocyanin contents when its transcriptional level decreased (Quattrocchio et al., 1993); while MrMYB1 in bayberry induced several biosynthetic genes, including activation of the MrDFR promoter during anthocyanin accumulation when coexpressed with MrbHLH1 (Liu et al., 2013b). Based on these results, it appears that CmMYB6 is a novel MYB TF related to anthocyanin biosynthesis regulation in Chrysanthemum. Transient expression with tobacco leaves has been used to identify gene function, especially related to anthocyanin regulation. Transcription complexes, MdMYB10–MdbHLH3 and MrMYB1–MrbHLH1, induced significant anthocyanin patches in tobacco leaves when they were transiently expressed, which was then verified through transformation, producing anthocyanin-rich plants (Espley et al., 2007; Liu et al., 2013b). Similar transient expression results were also found in this study, as anthocyanin content increased dramatically in tobacco leaves when CmMYB6 was co-expressed with MrbHLH1, indicating that CmMYB6 is an important gene for the regulation of Chrysanthemum anthocyanin biosynthesis. Acknowledgments This research was supported by the National High Technology Research and Development Program of China [2013AA102700], the National Natural Science Foundation of China [31401909], and the China Postdoctoral Science Foundation [2014M551758]. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.scienta.2015. 08.018. References Albert, N.W., Lewis, D.H., Zhang, H., Irving, L.J., Jameson, P.E., Davies, K.M., 2009. Light-induced vegetative anthocyanin pigmentation in Petunia. J. Exp. Bot. 60, 2191–2202. Allan, A.C., Hellens, R.P., Laing, W.A., 2008. MYB transcription factors that color our fruit. Trends Plant Sci. 13, 99–102. Baudry, A., Heim, M.A., Dubreucq, B., Caboche, M., Weisshaar, B., Lepiniec, L., 2004. TT2, TT8, and TTG1 synergistically specify the expression of BANYULS and proanthocyanidin biosynthesis in Arabidopsis thaliana. Plant J. 39, 366–380. Borevitz, J.O., Xia, Y., Blount, J., Dixon, R.A., Lamb, C., 2000. Activation tagging identifies a conserved MYB regulator of phenylpropanoid biosynthesis. Plant Cell 12, 2383–2394.
X.-f. Liu et al. / Scientia Horticulturae 194 (2015) 278–285 Carrie, C.S., Gregory, N.H., 2009. The impact of supplemental carbon sources on Arabidopsis thaliana growth, chlorophyll content and anthocyanin accumulation. Plant Growth Regul. 59, 255–271. Chang, S., Puryear, J., Cairney, J., 1993. A simple and efficient method for isolating RNA from pine trees. Plant Mol. Biol. Rep. 11, 113–116. Dubos, C., Stracke, R., Grotewold, E., Weisshaar, B., Martin, C., Lepiniec, L., 2010. MYB transcription factors in Arabidopsis. Trends Plant Sci. 15, 573–581. Espley, R.V., Hellens, R.P., Putterill, J., Stevenson, D.E., Kutty-Amma, S., Allan, A.C., 2007. Red coloration in apple fruit is due to the activity of the MYB transcription factor, MdMYB10. Plant J. 49, 414–427. Hellens, R.P., Allan, A.C., Friel, E.N., Bolitho, K., Grafton, K., Templeton, M.D., Karunairetnam, S., Gleave, A.P., Laing, W.A., 2005. Transient expression vectors for functional genomics, quantification of promoter activity and RNA silencing in plants. Plant Methods 1, 13. Higo, K., Ugawa, Y., Iwamoto, M., Korenaga, T., 1999. Plant cis-acting regulatory DNA elements (PLACE) database: 1999. Nucleic Acids Res. 27, 297–300. Holton, T.A., Cornish, E.C., 1995. Genetics and biochemistry of anthocyanin biosynthesis. Plant Cell 7, 1071–1083. Hong, Y., Bai, X.X., Sun, W., Jia, F.W., Dai, S.L., 2012. The numerical classification of Chrysanthemum flower color phenotype. Acta Hortic. Sin. 39, 1330–1340. Hong, Y., Tang, X.J., Huang, H., Zhang, Y., Dai, S.L., 2015. Transcriptomic analyses reveal species-specific light-induced anthocyanin biosynthesis in Chrysanthemum. BMC Genom. 16, 202, http://dx.doi.org/10.1186/s12864-0151428-1. Hsu, C.C., Chen, Y.Y., Tsai, W.C., Chen, W.H., Chen, H.H., 2015. Three R2R3-MYB transcription factors regulate distinct floral pigmentation patterning in Phalaenopsis orchids. Plant Physiol., http://dx.doi.org/10.1104/pp.114.254599. Huang, H., Hu, K., Han, K.T., Xiang, Q.Y., Dai, S.L., 2013. Flower color modification of Chrysanthemum by suppression of F3 H and overexpression of the exogenous Seneciocruentus F3 5 H gene. PLoS One 8, e74395. Jaakola, L., 2013. New insights into the regulation of anthocyanin biosynthesis in fruits. Trends Plant Sci. 18, 477–483. Kobayashi, S., Goto-Yamamoto, N., Hirochika, H., 2004. Retrotransposon-induced mutations in grape skin color. Science 304, 982. Koes, R., Verweij, W., Quattrocchio, F., 2005. Flavonoids: a colorful model for the regulation and evolution of biochemical pathways. Trends Plant Sci. 10, 236–242. Laitinen, E., Ainasoja, M., Broholm, S.K., Teeri, T.H., Elomaa, P., 2008. Identification of target genes for a MYB-type anthocyanin regulator in Gerbera hybrida. J. Exp. Bot. 59, 3691–3703. Lin-Wang, K., Bolitho, K., Grafton, K., Kortstee, A., Karunairetnam, S., McGhie, T., Espley, R., Hellens, R., Allan, A.C., 2010. An R2R3 MYB transcription factor associated with regulation of the anthocyanin biosynthetic pathway in Rosaceae. BMC Plant Biol. 10, 50. Liu, X.F., Feng, C., Zhang, M.M., Yin, X.R., Xu, C.J., Chen, K.S., 2013a. The MrWD40-1 Gene of Chinese bayberry (Myrica rubra) interacts with MYB and bHLH to enhance anthocyanin accumulation. Plant Mol. Biol. Rep. 31, 1474–1484. Liu, X.F., Yin, X.R., Allan, A.C., Lin-Wang, K., Shi, Y.N., Huang, Y.J., Ferguson, I.B., Xu, C.J., Chen, K.S., 2013b. The role of MrbHLH1 and MrMYB1 in regulating anthocyanin biosynthetic genes in tobacco and Chinese bayberry (Myrica rubra) during anthocyanin biosynthesis. Plant Cell Tiss. Org. Cult. 115, 285–298. Montefiori, M., Brendolise, C., Dare, A.P., Lin-Wang, K., Davies, K.M., Hellens, R.P., Allan, A.C., 2015. In the Solanaceae, a hierarchy of bHLHs confer distinct target specificity to the anthocyanin regulatory complex. J. Exp. Bot., http://dx.doi. org/10.1093/jxb/eru494. Niu, S.S., Xu, C.J., Zhang, W.S., Zhang, B., Li, X., Lin-Wang, K., Ferguson, I.B., Allan, A.C., Chen, K.S., 2010. Coordinated regulation of anthocyanin biosynthesis in Chinese bayberry (Myrica rubra) fruit by a R2R3 MYB transcription factor. Planta 231, 887–899. Ohno, S., Hosokawa, M., Hoshino, A., Kitamura, Y., Morita, Y., Park, K., Nakashima, A., Deguchi, A., Tatsuzawa, F., Doi, M., Iida, S., Yazawa, S., 2011. A bHLH transcription factor, DvIVS, is involved in regulation of anthocyanin synthesis in dahlia (Dahlia variabilis). J. Exp. Bot. 62, 5105–5116.
285
Quattrocchio, F., Wing, J.F., Leppen, H., Mol, J., Koes, R.E., 1993. Regulatory genes controlling anthocyanin pigmentation are functionally conserved among plant species and have distinct sets of target genes. Plant Cell 5, 1497–1512. Shan, H., Chen, S.M., Jiang, J.F., Chen, F.D., Chen, Y., Gu, C.S., Li, P.L., Song, A.P., Zhu, X.R., Gao, H.S., Zhou, G.Q., Li, T., Yang, X., 2012. Heterologous expression of the Chrysanthemum R2R3-MYB transcription factor CmMYB2 enhances drought and salinity tolerance, increases hypersensitivity to ABA and delays flowering in Arabidopsis thaliana. Mol. Biotechnol. 51, 160–173. Shimizu, Y., Maeda, K., Kato, M., Shimomura, K., 2011. Co-expression of GbMYB1 and GbMYC1 induces anthocyanin accumulation in roots of cultured Gynura bicolor DC. plantlet on methyl jasmonate treatment. Plant Physiol. Biochem. 49, 159–167. Springob, K., Nakajima, J., Yamazaki, M., Saito, K., 2003. Recent advances in the biosynthesis and accumulation of anthocyanins. Nat. Prod. Rep. 20, 288–303. Stickland, R.G., 1972. Changes in anthocyanin, carotenoid, chlorophyll, and protein in developing florets of the Chrysanthemum. Ann. Bot. 36, 459–469. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Tanaka, Y., Sasaki, N., Ohmiya, A., 2008. Biosynthesis of plant pigments: anthocyanins, betalains and carotenoids. Plant J. 54, 733–749. Teixeira da Silva, J.A., Shinoyama, H., Aida, R., Matsushita, Y., Raj, S.K., Chen, F., 2012. Chrysanthemum biotechnology: quo vadis? Crit. Rev. Plant Sci. 32, 21–52. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTAL X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882. Wrolstad, R.E., Culbertson, J.D., Cornwell, C.J., Mattick, L.R., 1982. Detection of adulteration in blackberry juice concentrates and wines. J. Assoc. Off. Anal. Chem. 65, 1417–1423. Xu, Q., Yin, X.R., Zeng, J.K., Ge, H., Song, M., Xu, C.J., Li, X., Ferguson, I.B., Chen, K.S., 2014. Activator- and repressor-type MYB transcription factors are involved in chilling injury induced flesh lignification in loquat via their interactions with the phenylpropanoid pathway. J. Exp. Bot. 65, 4349–4359. Xu, W., Dubos, C., Lepiniec, L., 2015. Transcriptional control of flavonoid biosynthesis by MYB-bHLH-WDR complexes. Trends Plant Sci. 20, 176–185. Yamagishi, M., Yoshida, Y., Nakayama, M., 2012. The transcription factor LhMYB12 determines anthocyanin pigmentation in the tepals of Asiatic hybrid lilies (Lilium spp.) and regulates pigment quantity. Mol. Breeding 30, 913–925. Yin, X.R., Allan, A.C., Chen, K.S., Ferguson, I.B., 2010. Kiwifruit EIL and ERF genes involved in regulating fruit ripening. Plant Physiol. 153, 1280–1292. Yin, X.R., Chen, K.S., Allan, A.C., Wu, R.m., Zhang, B., Lallu, N., Ferguson, I.B., 2008. Ethylene-induced modulation of genes associated with the ethylene signalling pathway in ripening kiwifruit. J. Exp. Bot. 59, 2097–2108. Zeng, J.K., Li, X., Xu, Q., Chen, J.Y., Yin, X.R., Ferguson, I.B., Chen, K.S., 2015. EjAP 2-1, an AP2/ERF gene, is anovel regulator of fruit lignification induced by chilling injury, via interaction with EjMYB transcription factors. Plant Biotechnol. J., http://dx.doi.org/10.1111/pbi.12351 (in press). Zhu, L., Shan, H., Chen, S.M., Jiang, J.F., Gu, C.S., Zhou, G.Q., Chen, Y., Song, A.P., Chen, F.D., 2013. The heterologous expression of the Chrysanthemum R2R3-MYB transcription factor CmMYB1 alters lignin composition and represses flavonoid synthesis in Arabidopsis thaliana. PLoS One 8, e65680. Zimmermann, I.M., Heim, M.A., Weisshaar, B., Uhrig, J.F., 2004. Comprehensive identification of Arabidopsis thaliana MYB transcription factors interacting with R/B-like BHLH proteins. Plant J. 40, 22–34.
Contents lists available at ScienceDirect
Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti
The identification of a MYB transcription factor controlling anthocyanin biosynthesis regulation in Chrysanthemum flowers Xiao-fen Liu a,b,c,1 , Li-li Xiang a,b,c,1 , Xue-ren Yin a,b,c , Donald Grierson a,d , Fang Li a,b,∗ , Kun-song Chen a,b,c a
College of Agriculture & Biotechnology, Zhejiang University, Zijingang Campus, Hangzhou 310058, PR China Zhejiang Provincial Key Laboratory of Horticultural Plant Integrative Biology, Zhejiang University, Zijingang Campus, Hangzhou 310058, PR China c The State Agriculture Ministry Laboratory of Horticultural Plant Growth, Development and Quality Improvement, Zhejiang University, Zijingang Campus, Hangzhou 310058, PR China d Plant & Crop Sciences Division, School of Biosciences, University of Nottingham, Sutton Bonington Campus, Loughborough LE12 5RD, UK b
a r t i c l e
i n f o
Article history: Received 9 July 2015 Received in revised form 8 August 2015 Accepted 11 August 2015 Keywords: Chrysanthemum Anthocyanin biosynthesis MYB transcription factor Transient assay
a b s t r a c t Metabolism of anthocyanin in Chrysanthemum (Chrysanthemum morifolium Ramat.) is catalyzed by several biosynthetic enzymes, however, the underlying transcriptional regulatory mechanisms remain unknown. In the present research, four MYB transcription factors, CmMYB3-6, were isolated from ‘Amadea’ Chrysanthemum, by RNA-seq and RACE. Among the four CmMYBs, CmMYB3 and CmMYB6 were expressed concurrently with the expression of biosynthetic genes and accumulation of anthocyanin during flower development. In order to study the transcription regulatory role of CmMYB3 and CmMYB6 in anthocyanin biosynthesis, the promoter region of CmDFR was isolated. Dual luciferase assay showed that CmMYB6 significantly activated the CmDFR promoter more than 8-fold. Furthermore, the combination of CmMYB6 and MrbHLH1 (from Myrica rubra involved in anthocyanin biosynthesis) resulted in approximately 34fold induction of the CmDFR promoter. Using a transient over-expression system in Nicotiana tabacum leaves, CmMYB6 and MrbHLH1 co-expression lead to transient anthocyanin accumulation. Thus, CmMYB6 is proposed as a novel transcription factor in Chrysanthemum anthocyanin biosynthesis. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Flower color is a crucial trait for ornamental plants. Chrysanthemum (Chrysanthemum morifolium Ramat.) is a widely grown and important ornamental (Teixeira da Silva et al., 2012). Different cultivars of Chrysanthemum exhibited various colors, such as white, yellow, yellow green, orange, pink, red, dark red, purple and brown (Hong et al., 2012). Thus, Chrysanthemum is an important ornamental for the analysis of flower color production in different types. However, the most widely grown Chrysanthemum cultivars used for standard cut flowers are white or yellow. Therefore, additional
Abbreviations: TFs, transcription factors; RACE, rapid amplification of cDNA ends; ORFs, open reading fragments; CTAB, cetyltrimethylammonium bromide; OPCR, real-time PCR; DFR, dihydroflavonol 4-reductase; MCS, multiple cloning sites. ∗ Corresponding author at: Zhejiang Provincial Key Laboratory of Horticultural Plant Integrative Biology, Zhejiang University, Zijingang Campus, Hangzhou 310058, PR China. Fax: +86 571 88982224. E-mail address: [email protected] (F. Li). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.scienta.2015.08.018 0304-4238/© 2015 Elsevier B.V. All rights reserved.
color research would be of benefit for improving the color for these commercially important standard cut Chrysanthemums. Anthocyanins are one of the important groups of plants pigments (Holton and Cornish, 1995; Tanaka et al., 2008). Their differential accumulation causes the different colors in most flowers, varying from salmon and scarlet through red and purple to blue. The pathway of anthocyanin biosynthesis has been well characterized in many plants, such as Arabidopsis, petunia, dahlia, etc. (Springob et al., 2003; Koes et al., 2005; Ohno et al., 2011; Jaakola, 2013). In Chrysanthemum, seven anthocyanin biosynthetic genes, from CmCHS to CmUFGT, have been isolated from the Chrysanthemum cultivar ‘Lijin’, which accumulates anthocyanin in the ligulate flowers. CmCHS, CmCHI and CmF3 H were expressed more highly at early development stages, while CmF3H, CmDFR, CmANS and CmUFGT were coordinately expressed throughout all of the stages of ray floret development (Huang et al., 2013). These results suggest that anthocyanin accumulation in Chrysanthemums was due to coordinate expression of biosynthetic genes, which might be manipulated by transcription factors (TFs), such as MYB that was reported most recently by Hong et al. (2015).
X.-f. Liu et al. / Scientia Horticulturae 194 (2015) 278–285
279
Fig. 1. Phylogenetic tree of MYBs and deduced protein sequence alignment. (a) Sequence alignment of MYBs related to flavonoid biosynthesis regulation in other plants compared to six MYBs from Chrysanthemum. Lines indicate the R2 and R3 conserved domains, respectively. (b) Phylogenetic tree of 137 MYBs, including 126 from Arabidopsis, 6 from Chrysanthemum and 3 from other ornamentals related to anthocyanin biosynthesis regulation.
280
X.-f. Liu et al. / Scientia Horticulturae 194 (2015) 278–285 Table 1 Primers used in RACE PCR. Genes CmMYB3
RACE
3
5
Fig. 2. Anthocyanin contents at four different developmental stages of ‘Amadea’ flowers, from S0 to S3, young leaves (YL) and stems (YS). The vertical bars represent S.E. of three biological replicates.
MYB TFs play the central role during the regulation of anthocyanin biosynthesis (Allan et al., 2008; Jaakola, 2013; Xu et al., 2015). Many results revealed that the different capacities for anthocyanin biosynthesis could be traced to the different transcriptional levels of MYB TFs regulating anthocyanin accumulation. For example, high-light induced anthocyanin pigmentation in Lc petunia was regulated by endogenous MYB TFs (Albert et al., 2009), over-expression of GMYB10 from Gerbera hybrid lead to strongly enhanced accumulation of anthocyanin pigments as well as to an altered pigmentation pattern in transgenic gerbera plants (Laitinen et al., 2008), high transcriptional levels of LhMYB12-Lat was specifically associated with splatter spot development which arises simply from the deposition of anthocyanin pigments in the tepal epidermis of Asiatic hybrid lily (Lilium spp.) cv ‘Latvia’ (Yamagishi et al., 2012), while the disruption of VvmybA1 expression resulting from a retrotransposon-induced mutation was associated with the loss of anthocyanin biosynthesis in white cultivars of Vitis vinifera (Kobayashi et al., 2004), and a decrease in MrMYB1 resulted in lack of anthocyanin biosynthesis in bagged Chinese bayberry fruits (Niu et al., 2010). As mentioned above, although the contribution of anthocyanin accumulation to Chrysanthemums flower color is well established, the roles of transcription factors, including MYB, controlling the expression of structural genes have rarely been investigated. Most recently, three MYB members were reported as candidates in anthocyanin regulation in Chrysanthemum based on clustering analysis and their expression patterns (Hong et al., 2015). However, more information and identification of MYBs were needed to study the mechanism of anthocyanin biosynthesis in Chrysanthemum flowers. In the present research, four MYB TFs, named CmMYB3, CmMYB4, CmMYB5 and CmMYB6, were isolated from Chrysanthemum, ‘Amadea’, which accumulated anthocyanin in the flowers. Based on the transcriptional levels, CmMYB3 and CmMYB6 showed a positive correlation with anthocyanin accumulation. However, only CmMYB6 could active the CmDFR promoter and induce anthocyanin biosynthesis in tobacco leaves when transiently coexpressed with MrbHLH1, a previously characterized anthocyanin regulator from bayberry (Myrica rubra) fruit (Liu et al., 2013a,b). 2. Materials and methods 2.1. Plant materials Ray florets of Chrysanthemum (C. morifolium Ramat.), ‘Amadea’, were collected at four different developmental stages, S0, S1, S2 and S3, based on different degrees of blooming (Fig. 2). The young leaves
CmMYB4
3
CmMYB5
3
CmMYB6
5
Primers
Sequences (5 −3 )
GSP1 GSP2 GSP1 GSP2 GSP1 GSP2 GSP1 GSP2 GSP1 GSP2
CAGGTGGTCTTTGATAGCAGCCC CCCTCCTACGATAACCATTCCACAAACG TTTGATTTCGTTGTCTGTTCGCCCGG CAGTCTACAACTCTTCCCACACC AGTCTAAATATGGGAAGGTCACCTG GGTAAAAGCTGTCGTCTCAGGTGGATC GGAATTGGCGCGAACTTCCTAAATATGC CGACATGGGAAACAAGTATGTGGTC CGATGGGTGACGAGATATACCCTG CTGTTGCCTAGAAGCTTGTGAAGC
which were located next to the flowers, and stems which were 2 cm close proximity to the flowers, were also harvested. Chrysanthemums were obtained from Fengdao Company, Yunnan Province, China, during the 2014 season. Each sample included three biological replicates, approximately 10 g for each replicate, and was frozen in liquid nitrogen immediately after being cut into small pieces, and stored at −80 ◦ C.
2.2. Anthocyanin analysis The anthocyanin contents in ‘Amadea’ flowers were detected by the pH differential spectrophotometry method described in Wrolstad et al. (1982). Flower anthocyanin contents were extracted from 1 g samples in methanol/0.05% HCl and the absorbance at 510 and 700 nm measured using a UV-2550 spectrophotometer (SHIMADZU). To avoid the influence of chlorophyll, the determination of anthocyanin accumulated in ‘Amadea’ young leaves and stems, as well as tobacco leaves in transient over-expression experiments, was carried out according to the method described in Carrie and Gregory (2009). Powders of frozen leaves or stems were extracted in methanol/1% HCl overnight at 4 ◦ C in the dark, the chlorophyll was then removed with chloroform before the absorbance at 530 and 657 nm was measured. Relative anthocyanin content was calculated on a per g fresh weight basis by ((A530–A657)/mg FW tissue) × 1000.
2.3. MYB transcription factor isolation and analysis The Chrysanthemum RNA-Seq database was obtained with a mixed RNA pool which including the RNA extracted from four different developmental stages of flowers, young leaves and stems of ‘Amadea’. The library construction, sequencing and data analysis were all conducted by Novogene in Beijing. Four MYB unigenes were chosen from the RNA-seq database, which possibly had the ability to participate in anthocyanin biosynthesis regulation. Due to the previous reports on CmMYB1 (related to lignin and flavonoid biosynthesis regulation, Zhu et al., 2013) and CmMYB2 (related to drought and salinity tolerance, Shan et al., 2012), the four unigenes were designated as CmMYB3-6, from the partial coding regions, the 3 and 5 -ends were obtained by RACE (rapid amplification of cDNA ends, Clontech, USA), using the primers listed in Table 1. The ORFs (open reading fragments) of CmMYBs were analyzed by ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). The phylogenetic relationship between these CmMYBs and R2R3 MYBs in Arabidopsis (Dubos et al., 2010), as well as those related to anthocyanin biosynthesis in other plant species was analyzed by means of MEGA v. 5.0 (Tamura et al., 2011). Sequence homology and alignment were carried out with BLASTn (http://blast.ncbi.nlm.nih.gov/ Blast.cgi) and Clustal X (Thompson et al., 1997), respectively.
X.-f. Liu et al. / Scientia Horticulturae 194 (2015) 278–285 Table 2 Primers used in real time PCR to study the expression of CmMYBs.
281
Table 3 Primers used in cloning of CmMYBs and CmDFR promoter into SK or LUC vectors.
Genes
Primers
Sequences (5 −3 )
Genes
Primers
Sequences (5 −3 )
CmMYB3
Forward Reversed Forward Reversed Forward Reversed Forward Reversed
TCATCTAGCACGGTTTCGTATG TGGCACACTTGTATTTGTACACGT TGGACTATAGAAGCTTGGAGATGA GCTTGCATACGACTATACGAGTGA AATCGGCAGCATCACAGAGA CACACGAACTCCTTCTTTAACTTG ACGGCGAAATAGGGTGGTCATTAG GGATTGCAATATCATAGTTGGTCCG
CmMYB3
Forward Reversed Forward Reversed Forward Reversed Forward Reversed
ATGGGAAGAGCACCGTGTTGC TTAAGAAAGAAGCCATGCATC ATGGGAAGGTCACCTTGTTG TTATTTCATCTCCAAGCTTC ATGGTGAGAGCACCTTGTATTGAC TCAACACACGAACTCCTTCTTTAAC ATGGGGGAGTACAGAAAAATG TCATAGTTGGTCCGAATTTA
CmMYB4 CmMYB5 CmMYB6
2.4. Gene expression Total RNA was extracted according to a modified CTAB (cetyltrimethylammonium bromide) method (Chang et al., 1993). Genomic DNA was removed by DNase I (Fermentas, USA), and 1 g of DNA-free RNA was used to synthesize first-strand cDNA (Bio-rad, USA). The CmMYB expression patterns were studied by QPCR (real-time PCR) with the primers listed in Table 2 following the manufacturers’ instructions with Ssofast EvaGreen supermix (Bio-rad, USA). While the primers for the biosynthetic genes were referred to Huang et al. (2013). Expression levels at different development stages of flowers were expressed as a ratio relative to values at S0 developmental stage which was set at 1. The gene specificities of primers were confirmed by melting curves and PCR product sequencing (Yin et al., 2008). Ct value of CmACT (GenBank AB770471) was used to normalize all of the QPCR reactions. No-template controls and melting curve analyses were included for each gene and each PCR reaction.
CmMYB4 CmMYB5 CmMYB6
(35S::REN), which were analyzed with the manufacturer’s instructions using a Dual-Luciferase Reporter Assay System (Promega, USA) and a Modulus Luminometer (Promega, USA), was applied to measure the TF-promoter interactions. For each interaction, three independent experiments were carried out with at least four biological replicates for each. 2.7. Transient over-expression In order to verify the function of CmMYB6 in inducing anthocyanin biosynthesis, transient over-expression in tobacco leaves (Nicotiana tabacum) was utilized as described in previous reports (Liu et al., 2013a,b). GV3101 (MP90) containing both or either of CmMYB6 and MrbHLH1 was infiltrated into tobacco leaves either singly or in pairs. The patches in tobacco leaves were photographed eight days after infiltration to show anthocyanin development, and then cut into pieces and frozen in liquid nitrogen before the detection of anthocyanin content. Each assay was carried out with three independent experiments with three biological replicates for each.
2.5. CmDFR promoter isolation and analysis 3. Results Dihydroflavonol 4-reductase (DFR) genes have been widely characterized as key anthocyanin biosynthetic genes (Holton and Cornish, 1995). In the present research, CmDFR mRNA accumulation was also correlated with anthocyanin content in Chrysanthemum flowers. Thus CmDFR was chosen for promoter isolation. The promoter region of CmDFR was isolated by genome walking. Genomic DNA was extracted from young leaves of ‘Amadea’ using the DNA extracting kit (Qiagen, Germen). The construction of genome walker libraries and genomic walking PCR were carried out with a universal genome walker kit (Clontech, USA) following the manufacturer’s instructions and the method described in Yin et al. (2010). Primers used in genomic walking PCR included GSP1 (5 -CTCAAAGTCCATAGGGGTGGCAACATG-3 ) and GSP2 (5 -CCATGGGCGCTAAATCCGCCTTCCATAATGTC-3 ). Conserved cis-element motifs located in the CmDFR promoter were scanned by online software PLACE (http://www.dna.affrc.go.jp/ PLACE/signalscan.html, Higo et al., 1999). 2.6. Dual luciferase assay Dual luciferase assay has been widely used to study the transcriptional regulatory roles of transcription factors on target promoters (Hellens et al., 2005; Xu et al., 2014; Montefiori et al., 2015; Zeng et al., 2015). The ORFs of four CmMYBs and the CmDFR promoter were amplified, using primers listed in Table 3 and were recombined into the MCS (multiple cloning sites) of the pGreenII 0029 62-SK or pGreenII 0800-LUC vectors, respectively. The fulllength of MrbHLH1 from Myrica rubra involved in anthocyanin biosynthesis was obtained and constructed by Liu et al. (2013b). All constructs were individually electroporated into Agrobacterium tumefaciens GV3101 (MP90) before being infiltrated into tobacco leaves (Nicotiana benthamiana). The ratio of enzyme activities of firefly luciferase (CmDFR::LUC) to renilla luciferase
3.1. CmMYB gene isolation and analysis To isolate the key MYB transcription factor related to the regulation of anthocyanin biosynthesis, a Chrysanthemum RNA-Seq database was created with mixed RNA pool from ‘Amadea’ which included four different developmental stages of flowers, young leaves and stems. A total of 103 unigenes which contained the conserved MYB domains were identified from the database (data not shown). Among these MYB unigenes, four members designated CmMYB3-6 were selected for investigation as to their possible functions in anthocyanin biosynthesis regulation. The deduced protein sequences of CmMYB3 (GenBank KR002094), CmMYB4 (KR002095), CmMYB5 (KR002096) and CmMYB6 (KR002097) contained 318, 261, 215 and 254 amino acids, respectively. All of these CmMYBs belong to the R2R3 MYB class according to the conserved domains (Fig. 1a). Phylogenetic analysis indicated that only CmMYB6 was clustered with anthocyanin related MYB genes from other plants, such as AtMYB75 (AtPAP1) in Arabidopsis, GbMYB1 (BAJ17661) in Gynura bicolor, PhAN2 (AAF66727) in petunia (Fig. 1b). CmMYB3, CmMYB4 and CmMYB5 were close to AtMYB12 (flavonol-specific transcriptional activator), CmMYB1 (lignin biosynthesis related repressor), and AtMYB34 (a regulator of tryptophan biosynthesis), respectively (Fig. 1b). 3.2. Anthocyanin analysis in ‘Amadea’ flowers During the development of ‘Amadea’ flowers, the flower color gradually changed from white to purple (Fig. 2). Further study showed that anthocyanin content in these petals increased dramatically corresponding to the formation of purple flower color. No anthocyanin could be detected while the petals remained enclosed
282
X.-f. Liu et al. / Scientia Horticulturae 194 (2015) 278–285
Fig. 3. The relative expression of seven anthocyanin biosynthetic genes during the development of ‘Amadea’ flowers. Expression levels were expressed as a ratio relative to the S0 developmental stage which was set at 1. The vertical bars represent S.E. of three biological replicates.
by the bracts (S0 and S1, Fig. 2). However, as soon as the purple flower color appeared in part or entire petals, anthocyanin was accumulated and increased dramatically from 0.03 (S2) to 0.35 (S3) mg/gFW (Fig. 2). Young leaves and stems were also tested, however, their anthocyanin contents were undetectable (Fig. 2). 3.3. Expression of anthocyanin biosynthetic genes and CmMYB genes The anthocyanin biosynthetic genes in Chrysanthemum were reported by Huang et al. (2013), including CHS, CHI, F3H, F3 H, DFR, ANS and UFGT. Most of these genes were up-regulated during flower development, although slight differences were observed between their expression patterns. Relative expression of CmDFR and CmUFGT increased throughout the developmental stages of flower, CmCHS, CmCHI, CmF3H and CmANS peaked at stage S2, while the transcriptional level of CmF3 H was stable during S0–S1 and slowly decreased from S1 to S3 (Fig. 3). The accumulation of CmCHS and CmUFGT mRNAs increased 12 times at S2 and 6 times at S3, respectively (Fig. 3). Unlike the biosynthetic genes, the four CmMYBs were differentially expressed during different stages of flower development. Both CmMYB3 and CmMYB6 exhibited increasing expression patterns, with CmMYB3 peaking at the S2 stage whereas the highest expression CmMYB6 was at S3 (Fig. 4). The approximately 12fold increasing extent of CmMYB6 mRNA was substantially higher
than that of CmMYB3 mRNA (Fig. 4). The transcriptional levels of CmMYB4 and CmMYB5 showed only a weak correlation with anthocyanin biosynthesis and the expression of biosynthetic genes during the different developmental stages. Expression of CmMYB4 declined during stages S0–S2, while CmMYB5 remained constant from S0–S2 and with a rapid drop at S3 (Fig. 4). Different tissue expression patterns were also found for these four CmMYBs. Expression of CmMYB4 was constant among flowers, young leaves and stems (Fig. 5). CmMYB5 was highly expressed in stem, while CmMYB3 and CmMYB6 were more abundant in flowers (Fig. 5). Thus, based on the expression patterns, CmMYB3 and CmMYB6 were the most likely candidates for the regulation of anthocyanin biosynthesis in Chrysanthemum. 3.4. Transcriptional regulation of CmMYB on CmDFR In order to investigate the possible regulatory roles of CmMYB genes in anthocyanin biosynthesis, the promoter of CmDFR (Supporting File) was obtained using genome walking technology, due to the lack of a Chrysanthemum genome sequence. A 769 bp region of the CmDFR promoter was cloned and the TATA box located −80 bp away from the ATG (Fig. 6a). Cis-elements recognized by MYB or bHLH were found in the CmDFR promoter, for example, MYBPZM (CCWACC), MYB1AT (WAACCA) and MYBATRD22 (CACATG), recognized by MYB, and E-box (CANNTG) and ACEs (ACGT containing elements), recognized by bHLH (Fig. 6a).
X.-f. Liu et al. / Scientia Horticulturae 194 (2015) 278–285
283
Fig. 4. The relative expression of four CmMYB genes at four developmental stages of ‘Amadea’ flowers analyzed by real-time PCR. Expression levels were expressed as a ratio relative to the S0 developmental stage which was set at 1.The vertical bars represent S.E. of three biological replicates.
Fig. 5. The relative expression of four CmMYB genes in different tissues of ‘Amadea’ including flowers in S3, young leaves (YL) and stems (YS). The vertical bars represent S.E. of three biological replicates.
Dual luciferase assay was carried out to analyze the in vivo regulatory roles of CmMYB genes. The results indicated that only CmMYB6 could trans-activate the CmDFR promoter, with an approximately 8-fold induction (Fig. 6b), while CmMYB3-5 were not able to influence CmDFR promoter activity. MYB and bHLH transcription factors usually generate synergistic effects on anthocyanin biosynthesis. Here, the previously isolated anthocyanin biosynthesis regulator, MrbHLH1 (Liu et al., 2013b), was employed. In the presence of CmMYB6 and MrbHLH1, the relative activities of the CmDFR promoter were amplified approximately 34-fold (Fig. 6b). However, the other three members, including CmMYB3, CmMYB4 and CmMYB5, remained unable to activate the CmDFR promoter, even when co-expressed with MrbHLH1 (Fig. 6b).
3.5. Transient over-expression of CmMYB6 in tobacco leaves
Fig. 6. In vivo interactions between CmMYB genes and CmDFR promoters. (a) Schematics of CmDFR promoter indicated with thick lines (promoter lengths are marked), circle (TATA box), triangles (MYB recognized cis-elements), squares (bHLH recognized cis-elements) and rectangles (LUC). (b) Dual luciferase analyses. Error bars are the S.E. of four replicates.
To confirm the functions of CmMYBs in regulating anthocyanin biosynthesis, their effects on anthocyanin accumulation were tested following transient over-expression in tobacco leaves. CmMYB3, CmMYB4 and CmMYB5 were unable to induce anthocyanin biosynthesis in tobacco leaves, when co-expressed with MrbHLH1 (data not shown), which was in agreement with the results of the dual luciferase assay (Fig. 6). In contrast, co-expression of CmMYB6 and MrbHLH1 triggered an obvious accumulation of anthocyanin in tobacco leaves (Fig. 7a,b). Further analyses indicated that when CmMYB6 and MrbHLH1were co-expressed in leaves the anthocyanin content was >4.0 mg/g
284
X.-f. Liu et al. / Scientia Horticulturae 194 (2015) 278–285
Fig. 7. Transient over-expression of CmMYB6 in Nicotiana tabacum leaves causes anthocyanin production and is increased synergistically by co-expression with MrbHLH1. (a) Color development due to transient transformation with either CmMYB6 or MrbHLH1 and empty vector together.; or with CmMYB6 and MrbHLH1 together in N. tabacum leaves. Digital images of infiltration sites on the reverse sides of tobacco leaves were taken 8 days after infiltration. (b) The infiltrated leaf patches were extracted with acidified methanol (1% concentrated HCl) for detection of anthocyanin contents. The four tubes relate to the four treatments corresponding to images in (a). (c) Anthocyanin contents of tobacco leaves after infiltrated with different genes. Error bars are the S.E. of three replicate reactions.
FW, which is much higher than in the leaves expressing CmMYB6 (0.03 mg/g FW) or MrbHLH1 (0.04 mg/g FW) alone (Fig. 7c). 4. Discussion Flower colors, mainly conferred by anthocyanins, carotenoids or betalains, play an irreplaceable role in ornamental flower traits (Quattrocchio et al., 1993; Ohno et al., 2011; Xu et al., 2015; Hsu et al., 2015). The anthocyanin metabolic pathway is regulated by transcription factors MYB, bHLH and WD40 where the MYB TFs played the central role (Baudry et al., 2004; Xu et al., 2015). Chrysanthemum contains thousands of cultivars which are classed into nine groups based on different flower colors that are mainly influenced by anthocyanin contents (Hong et al., 2012). Anthocyanin accumulation in a purple Chrysanthemum cultivar, ‘Fandango’, had been identified by Stickland, (1972) forty years ago. However, the transcriptional regulation of anthocyanin in Chrysanthemum is much less well understood compared with other plants. Although the seven biosynthetic genes have already been isolated, transcription factors related to anthocyanin regulation were studied most recently only in the correlation between their expression patterns and anthocyanin contents (Hong et al., 2015). The gene function in anthocyanin regulation still remained unknown which limits further study the mechanism of flower color production. In this study, anthocyanin was also found to be the main purple pigment in Chrysanthemum cultivar ‘Amadea’, in agreement with the result in Chrysanthemum cultivar ‘Lijin’ (Huang et al., 2013). The genes for the seven enzymes encoded by CmCHS, CmCHI, CmF3H, CmF3 H, CmDFR, CmANS and CmUFGT showed similar expression patterns during flower development in ‘Amadea’
and purple colored series ‘Lijin’, and their mRNAs increased dramatically concomitantly with anthocyanin accumulation, excepted CmF3 H (Fig. 3; Huang et al., 2013). Coordinated expression pattern of biosynthetic genes during anthocyanin accumulation has also been found in other plants, such as dahlia, bayberry, etc. (Ohno et al., 2011; Liu et al., 2013b). Among the three anthocyanin related TFs, MYBs have the highest specificity compared with bHLH and WD40 (Baudry et al., 2004). Among four CmMYBs studied here, CmMYB6 was most closely related to MYB members such as AtMYB75 (AtPAP1), GbMYB1 and PhAN2 (Fig. 1b), which are associated with anthocyanin biosynthesis regulation in other plants (Quattrocchio et al., 1993; Borevitz et al., 2000; Shimizu et al., 2011). The deduced amino acid sequence of CmMYB6 contained a conserved [D/E]Lx2[R/K]x3Lx6Lx3R motif required for interaction with R/B-like bHLH proteins (Zimmermann et al., 2004) and a characteristic identifier, ANDV, of dicot anthocyanin-promoting MYBs (Lin-Wang et al., 2010; Fig. 1a). Furthermore, expression of CmMYB6 coincided with anthocyanin accumulation and positively activated the CmDFR promoter. These characteristics were in accordance with MYB members related to regulation of anthocyanin biosynthesis in other plants. For example, down-regulation of PhAN2 reduced the activity of PhDFR and reduced anthocyanin contents when its transcriptional level decreased (Quattrocchio et al., 1993); while MrMYB1 in bayberry induced several biosynthetic genes, including activation of the MrDFR promoter during anthocyanin accumulation when coexpressed with MrbHLH1 (Liu et al., 2013b). Based on these results, it appears that CmMYB6 is a novel MYB TF related to anthocyanin biosynthesis regulation in Chrysanthemum. Transient expression with tobacco leaves has been used to identify gene function, especially related to anthocyanin regulation. Transcription complexes, MdMYB10–MdbHLH3 and MrMYB1–MrbHLH1, induced significant anthocyanin patches in tobacco leaves when they were transiently expressed, which was then verified through transformation, producing anthocyanin-rich plants (Espley et al., 2007; Liu et al., 2013b). Similar transient expression results were also found in this study, as anthocyanin content increased dramatically in tobacco leaves when CmMYB6 was co-expressed with MrbHLH1, indicating that CmMYB6 is an important gene for the regulation of Chrysanthemum anthocyanin biosynthesis. Acknowledgments This research was supported by the National High Technology Research and Development Program of China [2013AA102700], the National Natural Science Foundation of China [31401909], and the China Postdoctoral Science Foundation [2014M551758]. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.scienta.2015. 08.018. References Albert, N.W., Lewis, D.H., Zhang, H., Irving, L.J., Jameson, P.E., Davies, K.M., 2009. Light-induced vegetative anthocyanin pigmentation in Petunia. J. Exp. Bot. 60, 2191–2202. Allan, A.C., Hellens, R.P., Laing, W.A., 2008. MYB transcription factors that color our fruit. Trends Plant Sci. 13, 99–102. Baudry, A., Heim, M.A., Dubreucq, B., Caboche, M., Weisshaar, B., Lepiniec, L., 2004. TT2, TT8, and TTG1 synergistically specify the expression of BANYULS and proanthocyanidin biosynthesis in Arabidopsis thaliana. Plant J. 39, 366–380. Borevitz, J.O., Xia, Y., Blount, J., Dixon, R.A., Lamb, C., 2000. Activation tagging identifies a conserved MYB regulator of phenylpropanoid biosynthesis. Plant Cell 12, 2383–2394.
X.-f. Liu et al. / Scientia Horticulturae 194 (2015) 278–285 Carrie, C.S., Gregory, N.H., 2009. The impact of supplemental carbon sources on Arabidopsis thaliana growth, chlorophyll content and anthocyanin accumulation. Plant Growth Regul. 59, 255–271. Chang, S., Puryear, J., Cairney, J., 1993. A simple and efficient method for isolating RNA from pine trees. Plant Mol. Biol. Rep. 11, 113–116. Dubos, C., Stracke, R., Grotewold, E., Weisshaar, B., Martin, C., Lepiniec, L., 2010. MYB transcription factors in Arabidopsis. Trends Plant Sci. 15, 573–581. Espley, R.V., Hellens, R.P., Putterill, J., Stevenson, D.E., Kutty-Amma, S., Allan, A.C., 2007. Red coloration in apple fruit is due to the activity of the MYB transcription factor, MdMYB10. Plant J. 49, 414–427. Hellens, R.P., Allan, A.C., Friel, E.N., Bolitho, K., Grafton, K., Templeton, M.D., Karunairetnam, S., Gleave, A.P., Laing, W.A., 2005. Transient expression vectors for functional genomics, quantification of promoter activity and RNA silencing in plants. Plant Methods 1, 13. Higo, K., Ugawa, Y., Iwamoto, M., Korenaga, T., 1999. Plant cis-acting regulatory DNA elements (PLACE) database: 1999. Nucleic Acids Res. 27, 297–300. Holton, T.A., Cornish, E.C., 1995. Genetics and biochemistry of anthocyanin biosynthesis. Plant Cell 7, 1071–1083. Hong, Y., Bai, X.X., Sun, W., Jia, F.W., Dai, S.L., 2012. The numerical classification of Chrysanthemum flower color phenotype. Acta Hortic. Sin. 39, 1330–1340. Hong, Y., Tang, X.J., Huang, H., Zhang, Y., Dai, S.L., 2015. Transcriptomic analyses reveal species-specific light-induced anthocyanin biosynthesis in Chrysanthemum. BMC Genom. 16, 202, http://dx.doi.org/10.1186/s12864-0151428-1. Hsu, C.C., Chen, Y.Y., Tsai, W.C., Chen, W.H., Chen, H.H., 2015. Three R2R3-MYB transcription factors regulate distinct floral pigmentation patterning in Phalaenopsis orchids. Plant Physiol., http://dx.doi.org/10.1104/pp.114.254599. Huang, H., Hu, K., Han, K.T., Xiang, Q.Y., Dai, S.L., 2013. Flower color modification of Chrysanthemum by suppression of F3 H and overexpression of the exogenous Seneciocruentus F3 5 H gene. PLoS One 8, e74395. Jaakola, L., 2013. New insights into the regulation of anthocyanin biosynthesis in fruits. Trends Plant Sci. 18, 477–483. Kobayashi, S., Goto-Yamamoto, N., Hirochika, H., 2004. Retrotransposon-induced mutations in grape skin color. Science 304, 982. Koes, R., Verweij, W., Quattrocchio, F., 2005. Flavonoids: a colorful model for the regulation and evolution of biochemical pathways. Trends Plant Sci. 10, 236–242. Laitinen, E., Ainasoja, M., Broholm, S.K., Teeri, T.H., Elomaa, P., 2008. Identification of target genes for a MYB-type anthocyanin regulator in Gerbera hybrida. J. Exp. Bot. 59, 3691–3703. Lin-Wang, K., Bolitho, K., Grafton, K., Kortstee, A., Karunairetnam, S., McGhie, T., Espley, R., Hellens, R., Allan, A.C., 2010. An R2R3 MYB transcription factor associated with regulation of the anthocyanin biosynthetic pathway in Rosaceae. BMC Plant Biol. 10, 50. Liu, X.F., Feng, C., Zhang, M.M., Yin, X.R., Xu, C.J., Chen, K.S., 2013a. The MrWD40-1 Gene of Chinese bayberry (Myrica rubra) interacts with MYB and bHLH to enhance anthocyanin accumulation. Plant Mol. Biol. Rep. 31, 1474–1484. Liu, X.F., Yin, X.R., Allan, A.C., Lin-Wang, K., Shi, Y.N., Huang, Y.J., Ferguson, I.B., Xu, C.J., Chen, K.S., 2013b. The role of MrbHLH1 and MrMYB1 in regulating anthocyanin biosynthetic genes in tobacco and Chinese bayberry (Myrica rubra) during anthocyanin biosynthesis. Plant Cell Tiss. Org. Cult. 115, 285–298. Montefiori, M., Brendolise, C., Dare, A.P., Lin-Wang, K., Davies, K.M., Hellens, R.P., Allan, A.C., 2015. In the Solanaceae, a hierarchy of bHLHs confer distinct target specificity to the anthocyanin regulatory complex. J. Exp. Bot., http://dx.doi. org/10.1093/jxb/eru494. Niu, S.S., Xu, C.J., Zhang, W.S., Zhang, B., Li, X., Lin-Wang, K., Ferguson, I.B., Allan, A.C., Chen, K.S., 2010. Coordinated regulation of anthocyanin biosynthesis in Chinese bayberry (Myrica rubra) fruit by a R2R3 MYB transcription factor. Planta 231, 887–899. Ohno, S., Hosokawa, M., Hoshino, A., Kitamura, Y., Morita, Y., Park, K., Nakashima, A., Deguchi, A., Tatsuzawa, F., Doi, M., Iida, S., Yazawa, S., 2011. A bHLH transcription factor, DvIVS, is involved in regulation of anthocyanin synthesis in dahlia (Dahlia variabilis). J. Exp. Bot. 62, 5105–5116.
285
Quattrocchio, F., Wing, J.F., Leppen, H., Mol, J., Koes, R.E., 1993. Regulatory genes controlling anthocyanin pigmentation are functionally conserved among plant species and have distinct sets of target genes. Plant Cell 5, 1497–1512. Shan, H., Chen, S.M., Jiang, J.F., Chen, F.D., Chen, Y., Gu, C.S., Li, P.L., Song, A.P., Zhu, X.R., Gao, H.S., Zhou, G.Q., Li, T., Yang, X., 2012. Heterologous expression of the Chrysanthemum R2R3-MYB transcription factor CmMYB2 enhances drought and salinity tolerance, increases hypersensitivity to ABA and delays flowering in Arabidopsis thaliana. Mol. Biotechnol. 51, 160–173. Shimizu, Y., Maeda, K., Kato, M., Shimomura, K., 2011. Co-expression of GbMYB1 and GbMYC1 induces anthocyanin accumulation in roots of cultured Gynura bicolor DC. plantlet on methyl jasmonate treatment. Plant Physiol. Biochem. 49, 159–167. Springob, K., Nakajima, J., Yamazaki, M., Saito, K., 2003. Recent advances in the biosynthesis and accumulation of anthocyanins. Nat. Prod. Rep. 20, 288–303. Stickland, R.G., 1972. Changes in anthocyanin, carotenoid, chlorophyll, and protein in developing florets of the Chrysanthemum. Ann. Bot. 36, 459–469. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Tanaka, Y., Sasaki, N., Ohmiya, A., 2008. Biosynthesis of plant pigments: anthocyanins, betalains and carotenoids. Plant J. 54, 733–749. Teixeira da Silva, J.A., Shinoyama, H., Aida, R., Matsushita, Y., Raj, S.K., Chen, F., 2012. Chrysanthemum biotechnology: quo vadis? Crit. Rev. Plant Sci. 32, 21–52. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTAL X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882. Wrolstad, R.E., Culbertson, J.D., Cornwell, C.J., Mattick, L.R., 1982. Detection of adulteration in blackberry juice concentrates and wines. J. Assoc. Off. Anal. Chem. 65, 1417–1423. Xu, Q., Yin, X.R., Zeng, J.K., Ge, H., Song, M., Xu, C.J., Li, X., Ferguson, I.B., Chen, K.S., 2014. Activator- and repressor-type MYB transcription factors are involved in chilling injury induced flesh lignification in loquat via their interactions with the phenylpropanoid pathway. J. Exp. Bot. 65, 4349–4359. Xu, W., Dubos, C., Lepiniec, L., 2015. Transcriptional control of flavonoid biosynthesis by MYB-bHLH-WDR complexes. Trends Plant Sci. 20, 176–185. Yamagishi, M., Yoshida, Y., Nakayama, M., 2012. The transcription factor LhMYB12 determines anthocyanin pigmentation in the tepals of Asiatic hybrid lilies (Lilium spp.) and regulates pigment quantity. Mol. Breeding 30, 913–925. Yin, X.R., Allan, A.C., Chen, K.S., Ferguson, I.B., 2010. Kiwifruit EIL and ERF genes involved in regulating fruit ripening. Plant Physiol. 153, 1280–1292. Yin, X.R., Chen, K.S., Allan, A.C., Wu, R.m., Zhang, B., Lallu, N., Ferguson, I.B., 2008. Ethylene-induced modulation of genes associated with the ethylene signalling pathway in ripening kiwifruit. J. Exp. Bot. 59, 2097–2108. Zeng, J.K., Li, X., Xu, Q., Chen, J.Y., Yin, X.R., Ferguson, I.B., Chen, K.S., 2015. EjAP 2-1, an AP2/ERF gene, is anovel regulator of fruit lignification induced by chilling injury, via interaction with EjMYB transcription factors. Plant Biotechnol. J., http://dx.doi.org/10.1111/pbi.12351 (in press). Zhu, L., Shan, H., Chen, S.M., Jiang, J.F., Gu, C.S., Zhou, G.Q., Chen, Y., Song, A.P., Chen, F.D., 2013. The heterologous expression of the Chrysanthemum R2R3-MYB transcription factor CmMYB1 alters lignin composition and represses flavonoid synthesis in Arabidopsis thaliana. PLoS One 8, e65680. Zimmermann, I.M., Heim, M.A., Weisshaar, B., Uhrig, J.F., 2004. Comprehensive identification of Arabidopsis thaliana MYB transcription factors interacting with R/B-like BHLH proteins. Plant J. 40, 22–34.