- Email: [email protected]
The identification of a victim using the DGGE method for trace deposits collected on adhesive film
Forensic Science International 132 (2003) 157–160
The identification of a victim using the DGGE method for trace deposits collected on adhesive film Masahiro Mukaidaa,*, Yuzo Takada-Matuzakia, Tomoo Masudaa, Hiroko Kimurab a b
Department of Forensic Medicine, National Defense Medical College, Namiki 3-2, Tokorozawa 359-8513, Japan Department of Forensic Medicine, Juntendo University School of Medicine, Hongo 2-1-1, Tokyo 113-8421, Japan Received 23 July 2002; received in revised form 25 December 2002; accepted 7 January 2003
Abstract The denaturant gradient gel electrophoresis (DGGE) method was used in order to simultaneously estimate the genotypes of different factors in a gel plate consisting of one sheet. A genotype analysis of the blood groups (MN, Duffy, Kidd type) and serotype (Gc system) was carried out. DNA samples were extracted from trace deposits which were transferred on adhesive film from a blood trace obtained from a car tire after a fatal car accident. The reference DNA was prepared from the victim’s blood. The PCR amplification fragments were amplified from the gene which controlled each blood group. The primers were designed in order to analyze the genotypes with one to three base substitutions in the amplification product. The denaturant concentration limit of the gel for the DGGE method to detect each genotype of the blood groups (MN, Duffy, Kidd type and Gc system) and other conditions of electrophoresis were performed according to previously methods. The each genotype of the blood groups and the Gc system were all simultaneously distinguished in one plate. # 2003 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Personal identification; Denaturant gradient gel electrophoresis (DGGE); PCR; Adhesive film; Blood groups
1. Introduction Blood stains and strands of hair, etc. are generally used as analytical samples. In many cases, a blood group is also used for the personal identification. In such cases, multiple genetic markers must be analyzed. Many of the genes which control the blood groups show each polymorphism with one to three base substitutions [1–5]. As a result, the identification can be facilitated, when the change of one base can be distinguished in a simple operation. On one hand, an electrophoresis analysis of the multiple PCR amplification fragments which have different Tm values is possible in only one sheet of denaturant concentration gradient gel. The separated PCR fragments can be stained as a band in the gel by ethidium bromide solution, because they hold the double chain structure in the gel [6]. In the case *
Corresponding author. Tel.: þ81-42-995-1583; fax: þ81-42-996-5198. E-mail address: [email protected] (M. Mukaida).
where a mutation site in the gene sequences of a target is observed by either a substitution, deficiency or insertion of base, the band will appear at a different place from that of the standard [7]. As a result, it is easy to identify a mutation. From this fact, in a single electrophoresis by DGGE of PCR amplification fragment, both multiple gene information and the genotype of multiple blood groups can be analyzed. The trace deposits adhered to the tire of a car, which escaped after the traffic accident, were analyzed for personal identification using the PCR method. In this case, the genotypes of multiple inherited characters were determined simultaneously with a single gel plate employing the DGGE method.
2. Case The dead body of a 10-year-old boy was discovered on a road one night. A 1.5 t truck discovered near the scene 3 h after the accident attracted suspicion. The driver of the truck gave the following testimony regarding the accident. He
0379-0738/03/$ – see front matter # 2003 Elsevier Science Ireland Ltd. All rights reserved. doi:10.1016/S0379-0738(03)00013-6
158
M. Mukaida et al. / Forensic Science International 132 (2003) 157–160
Fig. 1. The trace material on the surface of the adhesive film. To take samples off the film, cotton swabs dipped in saline was used. The arrows show the sampling points.
started his truck when the signal changed to green at a crossing and then turned right. He stopped his truck at the crossing, because the driver heard a collision noise when turning to the right. He searched for anything unusual on the road, but he found nothing. Thereafter, he left the scene but returned about 3 h later. His reported collision point was about 350 m away from the place where the boy was found. Autopsy findings: The victim demonstrated a large number of abrasions and subcutaneous bleeding. The second cervical vertebra was dislocated, and the cervical spinal cord was also injured. The victim demonstrated tire marks on his left hip and on the extensor side of his left upper limb. The cause of death was diagnosed to be cervical spinal damage.
3. Materials and methods Trace deposits on the surface of the left rear wheel tire of the suspected truck were transferred onto the adhesion film
by attaching the film on the surface of the tire. The collection of the sample from the adhesive film transferred the trace deposits from the surface of the tire was performed wiping small cotton swabs dipped in saline (Fig. 1). A blood sample collected from the victim during the autopsy was used as a reference material. DNA samples were extracted from the sample on the film and the victim’s blood. DNA extraction was performed by a previously reported method [8]. The DNA quantity was measured with an optical density of 260 and 280 nm. DNA samples of normal adult volunteers, whose genotypes were known, were used as references for the typing. Primers were used for amplification of the 207 bp fragment for MN blood group, the 168 bp fragment for the Duffy blood group, the 298 bp fragment for Kidd blood group and the 242 bp fragment for Gc system (Table 1). The PCR fragments were amplified from the gene which controlled each blood group (MN, Duffy, Kidd type) and serotype (Gc system) [8]. The denaturant consisted of urea and formamide
Table 1 Primer sequence, PCR conditions and melting data for the blood group typing Blood group
Primer
Sequence
PCRa (8C)
MN
MNF MNRGC
TTCTCAACTTCTATGTTATACAGC (GC clamp)b GACAGGTCCCCTAAAATAGGGTTA
95/56/72
Duffy
Fy3P Fy4PGC
AAC TGA GAACTCAAGTCAGC (GC clamp) ATGAAGAAGGGCAGTGCAGAGT
95/59/72
Kidd
Jk3FGC Jk4R
(GC clamp) CATGCTGCCATAGGATCATTGC GTTGAAACCCCAGAGTCCAAAGT
95/58/72
Gc
GcE11F GcE11RGC
ACATGTAGTAAGACCTTAC (GC clamp) GATTGGAGTGCATACGTTC
95/50/72
a PCR conditions; after an initial denaturation for 10 min at 95 8C, the DNA samples were amplified for 30 cycles at the denaturation/ annealing/extension temperatures specified for each marker, followed by a final extension for 10 min at 72 8C. The denaturation, annealing and extension times for the PCR were 30 s, 1 min and 50 s, respectively. The amplifications were performed in a 50 ml reaction volume containing 200 mM dNTPs, 1 Reaction buffer 20 mM Tris–HCl pH 7.5, 100 mM KCl, 1 mM DTT, 0.1 mM EDTA, 0.5% Tween 20, 0.5% Nonidet P40, 50% glycerol, 15 mM MgCl2), 2 U AmpliTaqTM Gold (PE Applied Biosystems) and 5 ng genomic DNA. b The GC clamp sequence used for DGGE was 50 -CGC CCG CCG CGC CCC GCG CCC GGC CCG CCG CCC CCG CCC G-30 .
M. Mukaida et al. / Forensic Science International 132 (2003) 157–160
159
Fig. 2. The DGGE of the PCR amplified sample fragments and control fragments in 15–36%: lanes 1–3: MN blood group, lanes 4–6: Duffy blood group, lanes 7–9: Kidd blood group, lanes 10–12: Gc system; lanes 1, 4, 7, 10: control PCR fragments, lanes 2, 5, 8, 11: PCR fragments of victim’s reference DNA, lanes 3, 6, 9, 12: PCR fragments of the DNA sample from trace deposits on the adhesive film. The denaturant gradient gels (16 cm 20 cm 0:1 cm) contained acrylamide (T ¼ 6.5%, C ¼ 3%) and the denaturant with gradient concentration (15–36%) in TBE. The denaturant consisted of urea and formamide in TBE and the 80% denaturant was equivalent to 5.6 M urea and 32% formamide. Electrophoresis was performed at 60 8C and using 100 V at a constant level for 3 h. In addition, the gel was also treated in an ethidium bromide solution.
in TBE and the 80% denaturant was equivalent to 5.6 M urea and 32% formamide. The denaturant concentration limit of the gel used had been previously determined to be suitable for performing a DGGE analysis. In addition, it ranged from 15 to 36% using a computer simulation method. Using this gel, each amplification fragment was separated by electrophoresis at 60 8C and 100 V for 3 h. The gel after electrophoresis was stained with ethidium bromide in order to detect the DNA band.
4. Results 4.1. Normal control The genotype (M/M, M/N and N/N) of the MN blood group, the genotype (Fya/Fya, Fya/Fyb and Fyb/Fyb) of the Duffy blood group, the genotype (Jka/Jka, Jka/Jkb and Jkb/ Jkb) of the Kidd blood group and each allele (GC1S, GC1F and GC2) of the Gc system were all simultaneously distinguished in one plate. The DNA sample from the deposits on the tire and the reference DNA from the victim’s blood were also analyzed using the same method. The genotype (M/M, Fyb/Fyb, Jkb/Jkb, 1F/1F) of the DNA sample from trace deposits collected on the adhesive film was the same type as the genotype of the victim (Fig. 2).
5. Discussion When blood, blood stain or tissue slices specimens can be obtained, it is easy to analyze the multiple genetic markers
from the DNA sample, because DNA samples for such an analysis can be abundantly recovered. A profile analysis using a method with a multi-locus probe developed by Jeffreys is useful for many forensic examinations, but a large quantity of intact DNA is necessary for such an analysis [9]. The amount of DNA necessary for one analysis of restriction fragment length polymorphism (RFLPs) is recovered from ca. 100,000 cells. Using the PCR method, however, the analysis of the STR marker is possible even when typing only a single cell [10,11]. On one hand, many test samples are often polluted or physicochemically changed to various degrees. As the result, the recovered DNA chain may change into fragments. However, DNA samples sometimes brake down into shorter fragments, the band of the STR marker, which is as long as several hundreds base pairs, could not be detected due to of a failure of PCR [8]. On the other hand, various properties have been left in many crime scenes. Small pieces of fiber, animal hair, one strand of human hair and dandruff from the scalp surface are often found at crime scene [12–14]. The information obtained from these specimens plays a very important role in crime investigations. Adhesive tape is often utilized in the collection of these fine trace substances at the crime scene [15]. It is suitable to preserve such collected samples on adhesive tape. In addition, it is easy to distinguish the properties, localization and identification of the materials. In addition, this method is also appropriate for distinguishing different kinds of samples, because it is easy to specifically determine the collection position. The preparation of samples for a DNA analysis in DGGE is possible after performing PCR only one time. By changing the migration position in a detected band, the existence of the
160
M. Mukaida et al. / Forensic Science International 132 (2003) 157–160
mutation site in the fixed range can be judged. As a result, the existence of unknown base substitutions, base deficiencies or base insertions can be also found based on the comparison of changing the migration position. The trace deposits on the surface of the tire were found to belong to the victim based on a genotype analysis of the blood groups. As a result, it was possible to determine multiple gene polymorphisms, with a substitution of only one to three bases, using PCR, DGGE and ethidium bromide staining. An analysis of PCR fragments using DGGE is thus considered to be highly effective for determining multiple genotypes from only trace samples. References [1] A. Seltsam, M. Hallensleben, B. Eiz-Vesper et al., A weak blood group a phenotype caused by a new mutation at the ABO locus, Transfusion 42 (2002) 294–301. [2] A. Akane, H. Mizukami, H. Shiono, Classification of standard alleles of the MN blood group system, Vox Sang 79 (2000) 183–187. [3] M.L. Olsson, M.A. Chester, Polymorphisms at the ABO locus in subgroup a individuals, Transfusion 36 (1996) 309–313. [4] C. Tournamille, C. Le Van Kim, P. Gane et al., Molecular basis and PCR-DNA typing of the Fya/fyb blood group polymorphism, Hum. Genet. 95 (1995) 407–410. [5] S. Lee, X. Wu, M. Reid, Molecular basis of the Kell (K1) phenotype, Blood 85 (1995) 912–916.
[6] J.C. Sutherland, D.C. Monteleone, J.G. Trunk et al., Quantifying DNA damage by gel electrophoresis, Electrophoresis 22 (2001) 843–854. [7] L. Shi, G. Yan, Y. Fu et al., Human TAP1 polymorphisms detected by denaturing gradient gel electrophoresis, Tissue Antigens 49 (1997) 421–426. [8] M. Mukaida, H. Kimura, Y. Takada et al., The personal identification of many samples recovered from under the sea, Forensic Sci. Int. 113 (2000) 79–85. [9] M. Honma, I. Ishiyama, Variability of DNA fingerprint in a Japanese population, Nippon Hoigaku Zasshi 43 (1989) 128– 133. [10] I. Findlay, A. Taylor, P. Quirke et al., DNA fingerprinting from single cells, Nature 389 (1997) 555–556. [11] P.F. Ray, R.M. Winston, A.H. Handyside, Reduced allele dropout in single-cell analysis for preimplantation genetic diagnosis of cystic fibrosis, J. Assist. Reprod. Genet. 13 (1996) 104–106. [12] H. Shiono, Personal identification using DNA polymorphism—the identification of forensic biological materials, Nippon Hoigaku Zasshi 50 (1996) 320–330 (in Japanese). [13] P. Brauner, A. Reshef, A. Gorski, DNA profiling of trace evidence-mitigating evidence in a dog biting case, J. Forensic Sci. 46 (2001) 1232–1234. [14] J.M. Morley, J.E. Bark, C.E. Evans et al., Validation of mitochondrial DNA minisequencing for forensic casework, Int. J. Legal Med. 112 (1999) 241–248. [15] A. Zamir, E. Springer, B. Glattstein, Fingerprints and DNA: STR typing of DNA extracted from adhesive tape after processing for fingerprints, J. Forensic Sci. 45 (2000) 687–688.
The identification of a victim using the DGGE method for trace deposits collected on adhesive film Masahiro Mukaidaa,*, Yuzo Takada-Matuzakia, Tomoo Masudaa, Hiroko Kimurab a b
Department of Forensic Medicine, National Defense Medical College, Namiki 3-2, Tokorozawa 359-8513, Japan Department of Forensic Medicine, Juntendo University School of Medicine, Hongo 2-1-1, Tokyo 113-8421, Japan Received 23 July 2002; received in revised form 25 December 2002; accepted 7 January 2003
Abstract The denaturant gradient gel electrophoresis (DGGE) method was used in order to simultaneously estimate the genotypes of different factors in a gel plate consisting of one sheet. A genotype analysis of the blood groups (MN, Duffy, Kidd type) and serotype (Gc system) was carried out. DNA samples were extracted from trace deposits which were transferred on adhesive film from a blood trace obtained from a car tire after a fatal car accident. The reference DNA was prepared from the victim’s blood. The PCR amplification fragments were amplified from the gene which controlled each blood group. The primers were designed in order to analyze the genotypes with one to three base substitutions in the amplification product. The denaturant concentration limit of the gel for the DGGE method to detect each genotype of the blood groups (MN, Duffy, Kidd type and Gc system) and other conditions of electrophoresis were performed according to previously methods. The each genotype of the blood groups and the Gc system were all simultaneously distinguished in one plate. # 2003 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Personal identification; Denaturant gradient gel electrophoresis (DGGE); PCR; Adhesive film; Blood groups
1. Introduction Blood stains and strands of hair, etc. are generally used as analytical samples. In many cases, a blood group is also used for the personal identification. In such cases, multiple genetic markers must be analyzed. Many of the genes which control the blood groups show each polymorphism with one to three base substitutions [1–5]. As a result, the identification can be facilitated, when the change of one base can be distinguished in a simple operation. On one hand, an electrophoresis analysis of the multiple PCR amplification fragments which have different Tm values is possible in only one sheet of denaturant concentration gradient gel. The separated PCR fragments can be stained as a band in the gel by ethidium bromide solution, because they hold the double chain structure in the gel [6]. In the case *
Corresponding author. Tel.: þ81-42-995-1583; fax: þ81-42-996-5198. E-mail address: [email protected] (M. Mukaida).
where a mutation site in the gene sequences of a target is observed by either a substitution, deficiency or insertion of base, the band will appear at a different place from that of the standard [7]. As a result, it is easy to identify a mutation. From this fact, in a single electrophoresis by DGGE of PCR amplification fragment, both multiple gene information and the genotype of multiple blood groups can be analyzed. The trace deposits adhered to the tire of a car, which escaped after the traffic accident, were analyzed for personal identification using the PCR method. In this case, the genotypes of multiple inherited characters were determined simultaneously with a single gel plate employing the DGGE method.
2. Case The dead body of a 10-year-old boy was discovered on a road one night. A 1.5 t truck discovered near the scene 3 h after the accident attracted suspicion. The driver of the truck gave the following testimony regarding the accident. He
0379-0738/03/$ – see front matter # 2003 Elsevier Science Ireland Ltd. All rights reserved. doi:10.1016/S0379-0738(03)00013-6
158
M. Mukaida et al. / Forensic Science International 132 (2003) 157–160
Fig. 1. The trace material on the surface of the adhesive film. To take samples off the film, cotton swabs dipped in saline was used. The arrows show the sampling points.
started his truck when the signal changed to green at a crossing and then turned right. He stopped his truck at the crossing, because the driver heard a collision noise when turning to the right. He searched for anything unusual on the road, but he found nothing. Thereafter, he left the scene but returned about 3 h later. His reported collision point was about 350 m away from the place where the boy was found. Autopsy findings: The victim demonstrated a large number of abrasions and subcutaneous bleeding. The second cervical vertebra was dislocated, and the cervical spinal cord was also injured. The victim demonstrated tire marks on his left hip and on the extensor side of his left upper limb. The cause of death was diagnosed to be cervical spinal damage.
3. Materials and methods Trace deposits on the surface of the left rear wheel tire of the suspected truck were transferred onto the adhesion film
by attaching the film on the surface of the tire. The collection of the sample from the adhesive film transferred the trace deposits from the surface of the tire was performed wiping small cotton swabs dipped in saline (Fig. 1). A blood sample collected from the victim during the autopsy was used as a reference material. DNA samples were extracted from the sample on the film and the victim’s blood. DNA extraction was performed by a previously reported method [8]. The DNA quantity was measured with an optical density of 260 and 280 nm. DNA samples of normal adult volunteers, whose genotypes were known, were used as references for the typing. Primers were used for amplification of the 207 bp fragment for MN blood group, the 168 bp fragment for the Duffy blood group, the 298 bp fragment for Kidd blood group and the 242 bp fragment for Gc system (Table 1). The PCR fragments were amplified from the gene which controlled each blood group (MN, Duffy, Kidd type) and serotype (Gc system) [8]. The denaturant consisted of urea and formamide
Table 1 Primer sequence, PCR conditions and melting data for the blood group typing Blood group
Primer
Sequence
PCRa (8C)
MN
MNF MNRGC
TTCTCAACTTCTATGTTATACAGC (GC clamp)b GACAGGTCCCCTAAAATAGGGTTA
95/56/72
Duffy
Fy3P Fy4PGC
AAC TGA GAACTCAAGTCAGC (GC clamp) ATGAAGAAGGGCAGTGCAGAGT
95/59/72
Kidd
Jk3FGC Jk4R
(GC clamp) CATGCTGCCATAGGATCATTGC GTTGAAACCCCAGAGTCCAAAGT
95/58/72
Gc
GcE11F GcE11RGC
ACATGTAGTAAGACCTTAC (GC clamp) GATTGGAGTGCATACGTTC
95/50/72
a PCR conditions; after an initial denaturation for 10 min at 95 8C, the DNA samples were amplified for 30 cycles at the denaturation/ annealing/extension temperatures specified for each marker, followed by a final extension for 10 min at 72 8C. The denaturation, annealing and extension times for the PCR were 30 s, 1 min and 50 s, respectively. The amplifications were performed in a 50 ml reaction volume containing 200 mM dNTPs, 1 Reaction buffer 20 mM Tris–HCl pH 7.5, 100 mM KCl, 1 mM DTT, 0.1 mM EDTA, 0.5% Tween 20, 0.5% Nonidet P40, 50% glycerol, 15 mM MgCl2), 2 U AmpliTaqTM Gold (PE Applied Biosystems) and 5 ng genomic DNA. b The GC clamp sequence used for DGGE was 50 -CGC CCG CCG CGC CCC GCG CCC GGC CCG CCG CCC CCG CCC G-30 .
M. Mukaida et al. / Forensic Science International 132 (2003) 157–160
159
Fig. 2. The DGGE of the PCR amplified sample fragments and control fragments in 15–36%: lanes 1–3: MN blood group, lanes 4–6: Duffy blood group, lanes 7–9: Kidd blood group, lanes 10–12: Gc system; lanes 1, 4, 7, 10: control PCR fragments, lanes 2, 5, 8, 11: PCR fragments of victim’s reference DNA, lanes 3, 6, 9, 12: PCR fragments of the DNA sample from trace deposits on the adhesive film. The denaturant gradient gels (16 cm 20 cm 0:1 cm) contained acrylamide (T ¼ 6.5%, C ¼ 3%) and the denaturant with gradient concentration (15–36%) in TBE. The denaturant consisted of urea and formamide in TBE and the 80% denaturant was equivalent to 5.6 M urea and 32% formamide. Electrophoresis was performed at 60 8C and using 100 V at a constant level for 3 h. In addition, the gel was also treated in an ethidium bromide solution.
in TBE and the 80% denaturant was equivalent to 5.6 M urea and 32% formamide. The denaturant concentration limit of the gel used had been previously determined to be suitable for performing a DGGE analysis. In addition, it ranged from 15 to 36% using a computer simulation method. Using this gel, each amplification fragment was separated by electrophoresis at 60 8C and 100 V for 3 h. The gel after electrophoresis was stained with ethidium bromide in order to detect the DNA band.
4. Results 4.1. Normal control The genotype (M/M, M/N and N/N) of the MN blood group, the genotype (Fya/Fya, Fya/Fyb and Fyb/Fyb) of the Duffy blood group, the genotype (Jka/Jka, Jka/Jkb and Jkb/ Jkb) of the Kidd blood group and each allele (GC1S, GC1F and GC2) of the Gc system were all simultaneously distinguished in one plate. The DNA sample from the deposits on the tire and the reference DNA from the victim’s blood were also analyzed using the same method. The genotype (M/M, Fyb/Fyb, Jkb/Jkb, 1F/1F) of the DNA sample from trace deposits collected on the adhesive film was the same type as the genotype of the victim (Fig. 2).
5. Discussion When blood, blood stain or tissue slices specimens can be obtained, it is easy to analyze the multiple genetic markers
from the DNA sample, because DNA samples for such an analysis can be abundantly recovered. A profile analysis using a method with a multi-locus probe developed by Jeffreys is useful for many forensic examinations, but a large quantity of intact DNA is necessary for such an analysis [9]. The amount of DNA necessary for one analysis of restriction fragment length polymorphism (RFLPs) is recovered from ca. 100,000 cells. Using the PCR method, however, the analysis of the STR marker is possible even when typing only a single cell [10,11]. On one hand, many test samples are often polluted or physicochemically changed to various degrees. As the result, the recovered DNA chain may change into fragments. However, DNA samples sometimes brake down into shorter fragments, the band of the STR marker, which is as long as several hundreds base pairs, could not be detected due to of a failure of PCR [8]. On the other hand, various properties have been left in many crime scenes. Small pieces of fiber, animal hair, one strand of human hair and dandruff from the scalp surface are often found at crime scene [12–14]. The information obtained from these specimens plays a very important role in crime investigations. Adhesive tape is often utilized in the collection of these fine trace substances at the crime scene [15]. It is suitable to preserve such collected samples on adhesive tape. In addition, it is easy to distinguish the properties, localization and identification of the materials. In addition, this method is also appropriate for distinguishing different kinds of samples, because it is easy to specifically determine the collection position. The preparation of samples for a DNA analysis in DGGE is possible after performing PCR only one time. By changing the migration position in a detected band, the existence of the
160
M. Mukaida et al. / Forensic Science International 132 (2003) 157–160
mutation site in the fixed range can be judged. As a result, the existence of unknown base substitutions, base deficiencies or base insertions can be also found based on the comparison of changing the migration position. The trace deposits on the surface of the tire were found to belong to the victim based on a genotype analysis of the blood groups. As a result, it was possible to determine multiple gene polymorphisms, with a substitution of only one to three bases, using PCR, DGGE and ethidium bromide staining. An analysis of PCR fragments using DGGE is thus considered to be highly effective for determining multiple genotypes from only trace samples. References [1] A. Seltsam, M. Hallensleben, B. Eiz-Vesper et al., A weak blood group a phenotype caused by a new mutation at the ABO locus, Transfusion 42 (2002) 294–301. [2] A. Akane, H. Mizukami, H. Shiono, Classification of standard alleles of the MN blood group system, Vox Sang 79 (2000) 183–187. [3] M.L. Olsson, M.A. Chester, Polymorphisms at the ABO locus in subgroup a individuals, Transfusion 36 (1996) 309–313. [4] C. Tournamille, C. Le Van Kim, P. Gane et al., Molecular basis and PCR-DNA typing of the Fya/fyb blood group polymorphism, Hum. Genet. 95 (1995) 407–410. [5] S. Lee, X. Wu, M. Reid, Molecular basis of the Kell (K1) phenotype, Blood 85 (1995) 912–916.
[6] J.C. Sutherland, D.C. Monteleone, J.G. Trunk et al., Quantifying DNA damage by gel electrophoresis, Electrophoresis 22 (2001) 843–854. [7] L. Shi, G. Yan, Y. Fu et al., Human TAP1 polymorphisms detected by denaturing gradient gel electrophoresis, Tissue Antigens 49 (1997) 421–426. [8] M. Mukaida, H. Kimura, Y. Takada et al., The personal identification of many samples recovered from under the sea, Forensic Sci. Int. 113 (2000) 79–85. [9] M. Honma, I. Ishiyama, Variability of DNA fingerprint in a Japanese population, Nippon Hoigaku Zasshi 43 (1989) 128– 133. [10] I. Findlay, A. Taylor, P. Quirke et al., DNA fingerprinting from single cells, Nature 389 (1997) 555–556. [11] P.F. Ray, R.M. Winston, A.H. Handyside, Reduced allele dropout in single-cell analysis for preimplantation genetic diagnosis of cystic fibrosis, J. Assist. Reprod. Genet. 13 (1996) 104–106. [12] H. Shiono, Personal identification using DNA polymorphism—the identification of forensic biological materials, Nippon Hoigaku Zasshi 50 (1996) 320–330 (in Japanese). [13] P. Brauner, A. Reshef, A. Gorski, DNA profiling of trace evidence-mitigating evidence in a dog biting case, J. Forensic Sci. 46 (2001) 1232–1234. [14] J.M. Morley, J.E. Bark, C.E. Evans et al., Validation of mitochondrial DNA minisequencing for forensic casework, Int. J. Legal Med. 112 (1999) 241–248. [15] A. Zamir, E. Springer, B. Glattstein, Fingerprints and DNA: STR typing of DNA extracted from adhesive tape after processing for fingerprints, J. Forensic Sci. 45 (2000) 687–688.