- Email: [email protected]
The importance of KRAS mutations and EGF61A>G polymorphism to the effect of cetuximab and irinotecan in metastatic colorectal cancer
original article
Annals of Oncology 20: 879–884, 2009 doi:10.1093/annonc/mdn712 Published online 29 January 2009
The importance of KRAS mutations and EGF61A>G polymorphism to the effect of cetuximab and irinotecan in metastatic colorectal cancer K.-L. Garm Spindler1*, N. Pallisgaard2, A. A. Rasmussen3, J. Lindebjerg4, R. F. Andersen2, D. Cru¨ger3 & A. Jakobsen1 1
Background: The effect of anti-epidermal growth factor receptor (EGFR) antibodies (mAb) in metastatic colorectal cancer seems limited to KRAS wild-type (wt) tumours, but still a major fraction of KRASwt patients are nonresponders and supplementary selection criteria are needed. We investigated methodological aspects of KRAS testing and the predictive and prognostic value of KRAS status combined with three EGFR-related gene polymorphisms [singlenucleotide polymorphisms (SNPs)] in patients treated with cetuximab and irinotecan. Patients and methods: The study included 71 patients referred to third-line cetuximab–irinotecan. Blood samples were analysed for SNPs. KRAS analysis was carried out by sequencing analysis and quantitative PCR (DxS kit) in primary tumour and distant metastases. Results: There was a clear correlation between KRAS status in primary tumours and metastasis. The DxS kit presented the highest sensitivity. Response was confined to KRASwt patients (40% response rate versus 0%, P < 0.123), which translated into a significant difference in PFS. The EGF61A>G polymorphism showed relation to clinical outcome. A combined biomarker analysis showed a 19% progression rate in KRASwt-EGF61 homozygote patients and 60% in the EGF61A/G patients (P = 0.006) and a significant increase in overall survival (17.1 versus 5.9 months, log-rank, P = 0.002). Conclusion: The combined biomarker analysis maybe an attractive approach to selection of patients for third-line treatment including anti-EGFR mAbs. Key words: cetuximab–irinotecan, EGF61A>G, gene polymorphisms, KRAS, mCRC
introduction Recent advances in the treatment of metastatic colorectal cancer (mCRC) have included introduction of agents targeting the epidermal growth factor receptor (EGFR). Especially mAbs, which inhibit ligand binding to the extracellular domain, have demonstrated activity. The BOND trial showed efficacy of cetuximab in combination with irinotecan in chemotherapyrefractory patients with mCRC, and a randomised trial showed advantage of panitumumab versus best supportive care in this setting [1, 2]. Furthermore, EGFR inhibitors are moving from third-line into first-line therapy and larger adjuvant studies are ongoing [3, 4]. A substantial amount of patients will experience side-effects, and the consequences of administrating these agents to inappropriately selected patients are clearly a waste of time and *Correspondence to: Dr K.-L. Garm Spindler, Department of Oncology, Vejle Hospital, Kabbeltoft 25, 7100 Vejle, Denmark. Tel: +45-79406002; Fax: +45-79406709; E-mail: [email protected]
financial resources and most importantly, an exposure of these patients to unnecessary toxic effects. With the increasing use of these drugs, there is an urgent need for reliable selection criteria, but unfortunately EGFR testing by immunohistochemistry has no predictive value in this setting [1, 5, 6]. Recently, data from an increasing number of retrospective trials have suggested that response to EGFR inhibitor cetuximab seems confined to KRAS wild-type (wt) tumours [7–11]. Furthermore, results from a large randomised trial showed a clear benefit from panitumumab treatment in KRASwt patients in terms of response and progression-free survival (PFS), whereas patients with KRAS mutant tumours did not respond to treatment and had no survival benefit [12]. KRAS is a small G-protein, which is part of the important intracellular Ras/Raf/MAPK pathway. It has a self-inactivating capability and is normally tightly regulated. Activating mutations in the KRAS oncogene lead to a constitutively active KRAS protein and dysregulation of the RAS-dependent
ª The Author 2009. Published by Oxford University Press on behalf of the European Society for Medical Oncology. All rights reserved. For permissions, please email: [email protected]
original article
Received 9 June 2008; revised 12 October 2008; revised 17 October 2008; accepted 20 October 2008
Downloaded from http://annonc.oxfordjournals.org/ at UNIVERSITY OF PITTSBURGH on June 21, 2015
Department of Oncology; 2Department of Biochemistry; 3Department of Clinical Genetics; 4Department of Pathology, Danish Colorectal Cancer Group South, Vejle Hospital, Vejle, Denmark
original article
materials and methods patient material A total of 71 patients at the Department of Oncology, Vejle Hospital, Denmark, were included in the study from April 2005 to January 2008. Patients referred to treatment with irinotecan and cetuximab were included after informed consent. Eligibility criteria were as follows: histologically confirmed mCRC (adenocarcinomas) refractory to prior fluoropyrimidine, oxaliplatin and irinotecan regimes; Eastern Cooperative Oncology Group performance status of two or less; adequate organ function; age over 18 years and measurable disease according to the Response Evaluation Criteria in Solid Tumours (RECIST) [25], having received at least three cycles of therapy. Treatment consisted of irinotecan (350 mg/m2 every 3 weeks) in combination with cetuximab (400 mg/m2 loading dose followed by weekly 250 mg/m2). Response was classified as complete response, partial response (PR), stable disease (SD) or progressive disease (PD) all according to RECIST. Treatment was terminated upon progression or after prolonged duration of SD in five cases (after 15, 12, 12, 9 and 9 cycles, respectively). Pretreatment blood samples were drawn, and paraffin-embedded tumours and corresponding metastasis were collected from referring pathological
880 | Garm Spindler et al.
departments. The study was conducted in accordance with the Danish law after approval by the Regional Ethics Committee.
KRAS analysis DNA purification. DNA was extracted from formalin-fixed paraffinembedded tissue using QIAamp DNA Mini Kit (QIAGEN, CA, USA) after histological confirmation of viable tumour cells in haematoxylin– eosin-stained slides. sequencing analysis. Part of KRAS exon 2 (GenBank accession number L00045) was amplified by PCR using sense primer 5#TTAACCTTATGTGTGACATGTTCTAAT and antisense primer 5#CATGAAAATGGTCAGAGAAACC. Approximately 10 ng of DNA was used in a 20 ll PCR containing 1· Phusion High-Fidelity buffer added 1.5 mM MgCl2, 200 lM dNTPs (each), 0.4 lM of each primer and 0.2 Units Phusion High-Fidelity DNA polymerase (FINNZYM, Espoo, Finland). Thermocycling steps were as follows: 98C for 2 min; 45 cycles of 98C for 20 s, 63C for 20 s and 72C for 20 s; followed by 72C for 2 min. PCR products were purified using the Illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare, Hilleroed, Denmark). The presence of appropriate PCR products was confirmed by agarose gel electrophoresis. PCR products were sequenced in both directions with nested primers (sense primer: 5#TGTGTGACATGTTCTAATATAGTCACAT and antisense primer: 5#GGTCCTGCACCAGTAATATGC) by using BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA) followed by capillary electrophoresis on an ABI 3130 Genetic Analyzer (Applied Biosystems). Mutations were identified by visual inspection of DNA sequence electropherograms generated by Sequence Analysis Software v5.2 (Applied Biosystems). KRAS detection by DxS kit. Mutant KRAS was determined by a predeveloped kit identifying seven somatic mutations in codons 12 and 13 (DxS Ltd, Manchester, UK). Allele-specific real-time quantitative PCR (qPCR) was carried out on ABI 7900 HT Sequence Detection System (Applied Biosystems) according to the manufacturer’s recommendation. gene polymorphism analysis. Genomic DNA was extracted from whole blood using the Maxwell 16 DNA Purification Kit (Promega Corporation, Madison, WI). Normal colonic tissue was used for DNA extraction in three patients because of inadequate blood samples. PCR was carried out on a ABI 7900 HT Sequence Detection System (Applied Biosystems) using EGF61 and EGFR R521K predeveloped assays (Pre-Developed Assay Reagents, Applied Biosystems, no. c__27031637_10 and c__16170352_20, respectively) according to the manufacturer’s protocol. The EGFR-216G>T analysis was carried out as previously described and results were verified by sequencing [23].
statistics Fisher#s exact or Chi-square test was used for comparison of different frequencies and to evaluate Hardy–Weinberg equilibrium of allelic frequencies. Clinical follow-up data were obtained from prospectively collected clinical record forms. Overall survival (OS) was calculated from the date of inclusion to the date of death from any cause or last followup. PFS was defined as time from enrolment until disease progression or death. If a patient had not progressed and was still alive, the PFS was censored at the time of last follow-up. OS and PFS were estimated using the Kaplan–Meier method and compared using the log-rank test. [Hazard ratios (HRs) were calculated by the Cox–Mantel test and presented as HR with 95% confidence interval (CI).] All P values referred to two-tailed tests and were considered significant when <0.05. All statistics were calculated using the NCSS Statistical Software (Saugus, MA).
Volume 20 | No. 5 | May 2009
Downloaded from http://annonc.oxfordjournals.org/ at UNIVERSITY OF PITTSBURGH on June 21, 2015
pathway. KRAS mutations are considered an early event of colorectal tumour genesis and are present in 20%–50% of colorectal tumours [7, 8, 11–14]. KRAS mutations have traditionally been detected by sequencing analysis, but recently a commercially available kit has been used in different trials. Since KRAS testing may have a positive predictive value of 100% for lack of response, methodological aspects such as sensitivity is of uttermost importance. Knowledge of KRAS status in primary tumours compared with distant metastasis and the importance of tumour heterogeneity is sparse in the literature [9, 15]. This issue is very important to the clinical value of KRAS testing. Furthermore, selection of patients based on KRAS status may prevent a group of patients from unnecessary toxic effects, but there is still a major fraction of nonresponding patients among the KRASwt patients, which underline the need for supplementary predictive markers to combine with KRAS analysis. Recently, focus has been drawn to single-nucleotide polymorphisms (SNPs) related to the EGFR signalling [16]. The EGF61A>G SNP (rs4444903) that is located in the EGF 5#untranslated region (UTR) influences EGF gene expression and holds predictive information [9, 16–19]. We previously investigated the functional influence of this SNP in colorectal cancer (CRC) patients and results suggested a dysregulation according to genotype and a different outcome after cetuximab–irinotecan treatment [20, 21]. The EGFR-216G>T SNP (rs17289) is associated with increased promoter activity and EGFR gene expression [22, 23], and finally, the EGFR R521K SNP (rs11543848) has shown potential influence on outcome in mCRC [16, 24]. The aim of the present study was to investigate the predictive and prognostic value of KRAS status combined with three different EGFR-related SNPs in patients treated with cetuximab and irinotecan. Furthermore, we aimed at investigating methodological aspects of KRAS testing by comparing two different methods for analysis and finally the KRAS status in primary colorectal tumour and corresponding distant metastases.
Annals of Oncology
original article
Annals of Oncology
results patient characteristics Table 1 presents the baseline characteristics of 71 eligible patients and shows that 48% were women compared with 52% men and a median age of 61 years. The median number of cetuximab–irinotecan cycles was six (range 3–15) and 57 patients (80%) presented some degree of skin toxicity, compared with 13 patients (18.3%), who failed to develop a reaction. Eighteen (25%) patients achieved a PR, compared with 28 (39%) with SD, and a total of 25 (35%) patients progressing (PD) after only three cycles.
Characteristic
Patients (n = 71), n (%)
Age, years Median 61 Range 38–77 Gender Female 34 (48) Male 37 (52) ECOG performance status 0 41 (58) 1 24 (34) 2 6 (8) No. of prior chemotherapy regimes for metastatic disease 2 55 (77) 3 16 (23) Primary surgery for CRC Yes 64 (90) No 7 (10) Preoperative chemoradiation Yes 10 (14) No 61 (86) Anatomic site Colon 24 (34) Rectosigmoideum 22 (31) Rectum 25 (35) No. of metastatic sites 1–2 33 (46) 3–5 38 (54) No. of cycles Median 6 Range 3–15 Best response PR 18 (25) SD 28 (39) PD 25 (35) Worst toxicity /rash grade 0 13 (18) 1 36 (51) 2 12 (17) 3 9 (13) Not reported 1 (1) ECOG, Eastern Cooperative Oncology Group; CRC, colorectal cancer, PR, partial response; SD, stable disease; PD, progressive disease.
Volume 20 | No. 5 | May 2009
clinicopathological parameters and outcome Except from cetuximab-related skin rash, patient characteristics were not significantly associated with the outcome (data not shown). The presence and severity of skin rash related to clinical benefit in terms of response rates (RRs) and survival. The RR for patients with a skin reaction was significantly higher than in patients without a rash (data not shown). Skin rash positively affected PFS (log-rank, P = 0.02), but not OS (data not shown). KRAS analysis KRAS analysis in primary tumours by the different methods was carried out. A total of 64 patients had sufficient material for DNA analysis by the DxS qPCR kit and 59 samples were available for the sequencing method. The remaining samples had either limited material or poor quality of the DNA. The DxS qPCR kit detected a larger number of mutations compared with the sequencing method (20 and 13, respectively), confirming the higher sensitivity of the qPCR method. In three cases, the PCR failed by sequencing analysis, with a subsequent successful analysis by the kit. Of note, a single 13GGC>TGC mutation was detected by the sequencing methods and not by the DxS qPCR kit. This is in agreement with the directives of the kit, which is not designed to detect this specific codon 13 mutation. Based on the higher sensitivity and PCR success rate, the DxS kit was chosen for analysis of metastatic tissue. A comparison of KRAS status in primary tumours and metastasis is available from Table 2. None of the KRASwt primary tumours had mutations in corresponding metastasis and only two distant metastases failed to express KRAS mutation, while detected in the primary tumours. The results demonstrate a clear correlation between primary tumour and metastasis, indicating a limited role of tumour heterogeneity. Clinical results suggested that response was confined to KRASwt tumours as presented in Table 3. A total of 22 of 64 patients (34%) available for successful KRAS analysis harboured mutations. The KRASwt patients presented with a RR of 40% compared with 0% in patients with KRAS mutations. The difference was highly significant (P < 0.123). Survival analysis showed that the median PFS in KRASwt patients was 8.0 months (95% CI 4.2–8.4) compared with 2.3 months in KRAS mutant patients (95% CI 2.1–3.9) (log-rank, P < 0.0088). The median OS was 8.7 months (95% CI 6.4–11.0) versus 11.1 months (95% CI 8.0–14.4), but the difference did not reach statistical significance (P = 0.46). gene polymorphism analysis The frequencies of the genotypes and RR according to the different genotypes are presented in Table 3, indicating
doi:10.1093/annonc/mdn712 | 881
Downloaded from http://annonc.oxfordjournals.org/ at UNIVERSITY OF PITTSBURGH on June 21, 2015
Table 1. Patient characteristics
survival data At time of analysis, 46 (65%) patients had died and 25 (35%) were still alive. The median observation time for all patients was 8.0 months (range 1.9–30 months) with a median OS time of 10.8 months (95% CI 8.0–13.8). Eight patients were alive and free from progression at time of analysis and the median PFS was 5.1 months (95% CI 2.8–6.4).
original article
Annals of Oncology
Table 2. KRAS status in 31 primary tumours and corresponding distant metastases by the DxS qPCR kit analysis Primary tumour, DxS KRAS mutation detected Metastasis, DxS KRAS mutation detected Metastasis, DxS KRAS wild type
Primary tumour, DxS KRAS wild type
9
0
2
20
Table 3. Response according to the different markers Total, n (%)
PR
SD
PD
RR
KRAS wild type KRAS mutation EGF 61 A/A EGF 61 A/G EGF 61 G/G EGFR-216 G/G EGFR-216 G/T EGFR-216 T/T EGFR R521K G/G EGFR R521K G/A EGFR R521K A/A
42 22 34 27 10 29 38 4 40 28 3
17 0 8 4 6 7 10 1 14 3 1
11 12 17 9 2 13 14 1 13 15 0
14 10 9 14 2 9 14 2 13 10 2
40% 0% 24% 15% 60% 24% 33% 25% 35% 11% 33%
(66) (34) (48) (38) (14) (41) (54) (6) (56) (39) (4)
P < 0.123 P = 0.02
P = 0.99
P = 0.07
PR, partial response; SD, stable disease; PD, progressive disease; RR, response rate; EGF, epidermal growth factor; EGFR, epidermal growth factor receptor.
a nonsignificant difference between the EGFR-216 and EGFR R521K genotypes, but a significant difference between RR of the EGF61 genotypes (P = 0.02). The results indicated a higher risk of early progression in the EGF61A/G patients compared with the EGF61 A/A or G/G patients (P = 0.02). Furthermore, survival analysis showed a significantly different OS and PFS between the heterozygote and homozygote patients, indicating a different outcome from treatment between the two groups (Figure 1A and B).
combined biomarker analysis The KRAS status, EGF61 genotype and skin rash showed significant association with response and survival in the present material. Of note, there was no correlation between skin toxicity and KRAS (P = 0.48) or EGF61 genotype (P = 0.34) or between KRAS and EGF61 status (P = 0.21). A combined biomarker analysis was carried out including EGF61 genotype analysis on the KRASwt patients. The study included 42 KRASwt patients and survival curves are presented in Figure 1C and D. Most importantly, the rate of progression was 19% in the EGF61 homozygotes compared with 60% in the EGF61A/G patients (P = 0.006), which translated into a marked significant OS benefit of the homozygote patients. These patients had a median OS of 17.1 months (95% CI 11.1–18.2) compared with 5.9 months (95% CI 3.8–9.8) for the EGF61A/G group (log-rank, P = 0.002). The same applied to PFS as
882 | Garm Spindler et al.
discussion The present study provides important information on methodological aspects of KRAS testing, essential to ensure a reliable comparison between clinical studies and a safe application of this apparently strong predictive marker in the clinical settings. The results illustrate the higher sensitivity of the DxS kit compared with the standard sequencing analysis, and based on the present comparison between primary tumours and metastases, the use of KRAS testing in a single sample from the primary tumour seems reliable for predictive purposes. Different retrospective studies have shown that response to anti-EGFR mAb is confined to KRASwt tumours, as also presented here [7, 8, 10, 11, 12, 26, 27]; Twenty-two (34%) patients harboured mutations and demonstrated tumour resistance and a shorter PFS than the KRASwt patients. However, there is a large group of nonresponders among the KRASwt patients that present markers have failed to identify and the need for further investigational studies is obvious. This study is the first to focus on supplementary biomarker analysis on a subgroup of KRASwt patients. We confirmed previous results on the role of skin reactions during treatment, which showed a clear correlation to the outcome of clinical studies [1, 12, 28]. The present data suggested a correlation to response, PFS and OS in agreement with the results of the large panitumumab trial, which demonstrated that patients with KRASwt and worst grade skin toxicity experienced better PFS and OS [12]. However, this was not confirmed by Lievre et al. [11], who failed to demonstrate a correlation to PFS and suggested that KRAS status is a more powerful predictor of resistance to cetuximab. However, skin toxicity is not a baseline feature and might occur late in treatment. Consequently, it has limited value as pretreatment selection criteria. On the other hand, the appearance of skin reactions might become guidance for termination of or dosing during treatment, but unfortunately the result of the EVEREST study has not provided the clinicians with a clear strategy for dose escalation as expected [29], and consequently the role of skin toxicity remains unsolved. A large number of potential alternative markers have been investigated, including EGFR gene copy number assessment, but data are inconsistent and much debated [26, 27, 30]. The present study investigated three relevant SNPs related to the EGFR regulation based on previous literature and functional studies [20]. Only the EGF61 polymorphism presented a clear clinical impact, suggesting an important role of the ligands as also confirmed by Khambada-Ford et al. [14], who investigated the expression of amphiregulin and epiregulin in these patients. Most importantly, they reported that patients with KRASwt and high gene expression of EGFR binding ligands were more likely to obtain disease control. However, gene expression analysis requires fresh tumour tissue sampling, which is not always available as a clinical procedure, and the present SNP analysis on a simple blood sample is thus a very convenient candidate marker.
Volume 20 | No. 5 | May 2009
Downloaded from http://annonc.oxfordjournals.org/ at UNIVERSITY OF PITTSBURGH on June 21, 2015
Genotype
presented in Figure 1C, indicating a strong clinical relevance of this combination.
original article
Annals of Oncology
A
B
1,000
0,750
Survival
Survival
0,750 0,500 0,250 0,000 0,0
1,000
0,500 0,250
7,5
15,0
22,5
0,000 0,0
30,0
PFS in months
C
D
26,3
35,0
1,000
Survival
0,750
0,500
0,250
0,500 0,250
6,3
12,5
18,8
25,0
PFS in months
0,000 0,0
6,3
12,5
18,8
25,0
OS in months
Figure 1. Survival curves. (A) Progression-free survival (PFS) and EGF61 heterozygotes versus homozygotes. The median PFS was 7.8 months [95% confidence interval (CI) 4.4–8.4] in the homozygous (blue) group compared with 2.8 months in the EGF61A/G patients (red) (95% CI 2.1–4.1) [hazard ratio (HR) = 1.68; 95% CI 0.96–2.93; P = 0.03]. (B) Overall survival and EGF61 heterozygotes versus homozygotes. The median overall survival (OS) was 14.4 months (95% CI 10.1–18.2) in the homozygous (blue) group compared with 9.1 in the heterozygous (red) patients (95% CI 5.9–10.8) (HR = 1.81; 95% CI 0.96–3.41; P = 0.04). (C) PFS for patients tested KRASwt according to EGF61A>G. Red: KRASwt-homozygous patients, median PFS = 8.4 months (95% CI 8.0–10.5); blue: KRASwt-heterozygous patients, median PFS = 2.5 months (95% CI 2.0–5.1) (HR = 2.74; 95% CI 1.11–6.78; P = 0.0017). (D) Overall survival for patients tested KRASwt according to EGF61 A>G. Red: KRASwt-homozygous patients, median OS = 17 months (95% CI 11.1–18.2); Blue: KRASwt-heterozygous patients, median OS = 5.9 months (95% CI 3.8–9.8) (HR = 3.22; 95% CI 1.19–8.67; P = 0.0006).
The EGF61 SNP implies a substitution of G by A at locus 61 in the 5#-UTR of the EGF gene and has a functional influence on EGF production. Monoclonal cells are reported to produce significantly lower levels of EGF in A/A genotypes than cells from G-containing variants and furthermore, gene expression levels differ according to genotype in glioblastomas and normal colon [18, 20]. Previous studies by Zhang and recently by Graziano et al. are diverging concerning the association between the EGF61 genotypes and favourable outcome [16, 17]. Dr Zhang presented a higher OS in patients with the A/A compared with G-containing variants, which is theoretically in agreement with preclinical studies, indicting that the G allele is more active than the A and consequently associated with higher EGF levels [18, 19]. However, these results are in contrast to the study by Graziano et al. [16], which indicates that EGF upregulation maybe associated with better outcome in the G-containing patients. The favourable effect of the G/G genotype is counterintuitive, but could be explained by the possibility of EGF-inducing apoptosis and growth inhibition as demonstrated in experimental systems. Interestingly, the present results show an unfavourable outcome in KRASwt patients harbouring the A/G variant, compared with the A/A and G/G patients, which again is in
Volume 20 | No. 5 | May 2009
contrast to previous findings. However, investigations of EGF gene expression in CRC and normal colon have shown that G-containing variants have a functional influence on normal colon but not in colorectal tumours, suggesting a dysregulation in the tumours [20]. Also, the correlation between EGF gene expression in tumours and normal colon seemed strongest in the A/G group compared with the A/A and G/G patients (Spindler, Jakobsen et al., unpublished data), indicating a resolved regulation in these genotypes compared with the latter, and thus a potentially increased ability to compete with cetuximab binding in the EGF61A/G patients. Results indicated that the EGF61 homozygote patients had a lower risk of treatment failure than the EGF61A/G patients, which translated into an increased median OS of 17.1 months compared with 5.9 months. The difference in PFS between the two groups was significant, however less pronounced. Only the present study has combined the marker with KRAS analysis and analysed a subgroup of KRASwt patients, which seems a reasonable clinical approach that deserves further investigation. Due to the low number of events and the exploratory nature of this study, a multivariate analysis was not carried out on the present material. However, a Bonferroni correction of the statistical test on the EGF61 marker did not weaken the results on response or log-rank
doi:10.1093/annonc/mdn712 | 883
Downloaded from http://annonc.oxfordjournals.org/ at UNIVERSITY OF PITTSBURGH on June 21, 2015
0,750
Survival
17,5
OS in months
1,000
0,000 0,0
8,8
original article testing in the wt patients (data not shown). Further studies, preferably in larger prospective settings with a relevant control group, would contribute to the evidence of this promising approach. In addition to elucidating methodological aspects of KRAS testing, we present a feasible potential supplementary marker for predicting patient outcome, when combining the KRAS analysis with EGF61 status. The marker combination showed a clear benefit from treatment in the KRASwt-EGF61 homozygote patients in terms of decreased risk of treatment failure and a significant survival benefit.
funding Cancer Foundation.
We thank Birgit Roed Sørensen, Lone Frischknecht, Lene Byriel, Kaja Skovsga˚rd and Dorte Mengers Flindt for excellent technical assistance and Karin Larsen for proofreading.
references 1. Cunningham D, Humblet Y, Siena S et al. Cetuximab monotherapy and cetuximab plus irinotecan in irinotecan-refractory metastatic colorectal cancer. N Engl J Med 2004; 351(4): 337–345. 2. Van Cutsem E, Peeters M, Siena S et al. Open-label phase III trial of panitumumab plus best supportive care compared with best supportive care alone in patients with chemotherapy-refractory metastatic colorectal cancer. J Clin Oncol 2007; 25(13): 1658–1664. 3. Koehne C. Cetuximab plus FOLFIRI first-line in metastatic colorectal cancer (mCRC): the randomized phase III CRYSTAL trial. 9th World Congress on Gastrointestinal Cancer Annual Meeting, Barcelona, Spain, 2007; (Abstr O-0031). 4. Scheithauer W. Cetuximab plus irinotecan in patients (pts) with metastatic colorectal cancer (mCRC) failing prior oxaliplatin-based therapy: the EPIC trial Sobrero A. 14th European Cancer Conference, Barcelona, Spain, 2005; 23(9): 1803–1810. 5. Chung KY, Shia J, Kemeny NE et al. Cetuximab shows activity in colorectal cancer patients with tumors that do not express the epidermal growth factor receptor by immunohistochemistry. J Clin Oncol 2008; 19(4): 717–723. 6. Hecht JR, Patnaik A, Berlin J et al. Panitumumab monotherapy in patients with previously treated metastatic colorectal cancer. Cancer 2007; 110(5): 980–988. 7. Benvenuti S, Sartore-Bianchi A, Di NF et al. Oncogenic activation of the RAS/RAF signaling pathway impairs the response of metastatic colorectal cancers to antiepidermal growth factor receptor antibody therapies. Cancer Res 2007; 67(6): 2643–2648. 8. De Roock W, Piessevaux H, De Shutter J et al. KRAS wild-type state predicts survival and is associated to early radiological response in metastatic colorectal cancer treated with cetuximab. Ann Oncol 2008; 19(3): 508–515. 9. Di Fiore F, Blanchard F, Charbonnier F et al. Clinical relevance of KRAS mutation detection in metastatic colorectal cancer treated by Cetuximab plus chemotherapy. Br J Cancer 2007; 96(8): 1166–1169. 10. Khambata-Ford S, Garrett CR, Meropol NJ et al. Expression of epiregulin and amphiregulin and K-ras mutation status predict disease control in metastatic colorectal cancer patients treated with cetuximab. J Clin Oncol 2007; 25(22): 3230–3237. 11. Lievre A, Bachet JB, Boige V et al. KRAS mutations as an independent prognostic factor in patients with advanced colorectal cancer treated with cetuximab. J Clin Oncol 2008; 26(3): 374–379.
884 | Garm Spindler et al.
12. Amado RG, Wolf M, Peeters M et al. Wild-type KRAS is required for panitumumab efficacy in patients with metastatic colorectal cancer. J Clin Oncol 2008; 26(10): 1626–1634. 13. Bos JL. ras oncogenes in human cancer: a review. Cancer Res 1989; 49(17): 4682–4689. 14. Khambata-Ford S, Garrett CR, Meropol NJ et al. Expression of epiregulin and amphiregulin and K-ras mutation status predict disease control in metastatic colorectal cancer patients treated with cetuximab. J Clin Oncol 2007; 25(22): 3230–3237. 15. Thebo JS, Senagore AJ, Reinhold DS, Stapleton SR. Molecular staging of colorectal cancer: K-ras mutation analysis of lymph nodes upstages Dukes B patients. Dis Colon Rectum 2000; 43(2): 155–159. 16. Graziano F, Ruzzo A, Loupakis F et al. Pharmacogenetic profiling for cetuximab plus irinotecan therapy in patients with refractory advanced colorectal cancer. J Clin Oncol 2008; 26(9): 1427–1434. 17. Zhang W, Gordon M, Press OA et al. Cyclin D1 and epidermal growth factor polymorphisms associated with survival in patients with advanced colorectal cancer treated with Cetuximab. Pharmacogenet Genomics 2006; 16(7): 475–483. 18. Shahbazi M, Pravica V, Nasreen N et al. Association between functional polymorphism in EGF gene and malignant melanoma. Lancet 2002; 359(9304): 397–401. 19. Bhowmick DA, Zhuang Z, Wait SD, Weil RJ. A functional polymorphism in the EGF gene is found with increased frequency in glioblastoma multiforme patients and is associated with more aggressive disease. Cancer Res 2004; 64(4): 1220–1223. 20. Spindler KL, Nielsen JN, Ornskov D et al. Epidermal growth factor (EGF) A61G polymorphism and EGF gene expression in normal colon tissue from patients with colorectal cancer. Acta Oncol 2007; 46(8): 1113–1117. 21. Spindler KL. The predictive value of EGF A61G gene polymorphism in third-line treatment with cetuximab and irinotecan of patients with metastatic colorectal cancer. ASCO 2008 Gastrointestinal Cancer Symposium, Orlando, FL, 2008. (Abstr 413). 22. Liu W, Innocenti F, Wu MH et al. A functional common polymorphism in a Sp1 recognition site of the epidermal growth factor receptor gene promoter. Cancer Res 2005; 65(1): 46–53. 23. Spindler KL, Lindebjerg J, Nielsen JN et al. Epidermal growth factor receptor analyses in colorectal cancer: a comparison of methods. Int J Oncol 2006; 29(5): 1159–1165. 24. Wang WS, Chen PM, Chiou TJ et al. Epidermal growth factor receptor R497K polymorphism is a favorable prognostic factor for patients with colorectal carcinoma. Clin Cancer Res 2007; 13(12): 3597–3604. 25. Therasse P, Arbuck SG, Eisenhauer EA et al. New guidelines to evaluate the response to treatment in solid tumors. European Organization for Research and Treatment of Cancer, National Cancer Institute of the United States, National Cancer Institute of Canada. J Natl Cancer Inst 2000; 92(3): 205–216. 26. Italiano A, Follana P, Caroli FX et al. Cetuximab shows activity in colorectal cancer patients with tumors for which FISH analysis does not detect an increase in EGFR gene copy number. Ann Surg Oncol 2008; 15(2): 649–654. 27. Sartore-Bianchi A, Moroni M, Veronese S et al. Epidermal growth factor receptor gene copy number and clinical outcome of metastatic colorectal cancer treated with panitumumab. J Clin Oncol 2007; 25(22): 3238–3245. 28. Lenz HJ, Van CE, Khambata-Ford S et al. Multicenter phase II and translational study of cetuximab in metastatic colorectal carcinoma refractory to irinotecan, oxaliplatin, and fluoropyrimidines. J Clin Oncol 2006; 24(30): 4914–4921. 29. Tajpar S, Peeters M, Humblet H et al. Phase I/II study of cetuximab doseescalation in patients with metastatic colorectal cancer (MCRC) with no or slight skin reaction on cetuximab standard dose treatment (EVEREST): pharmacokinetic (PK), pharmacodynamics (PD) and efficacy data. J Clin Oncol 2007; 25 (Suppl): 172s (Abstr 4037). 30. Cappuzzo F, Finocchiaro G, Rossi E et al. EGFR FISH assay predicts for response to cetuximab in chemotherapy refractory colorectal cancer patients. Ann Oncol 2008; 19(4): 717–723.
Volume 20 | No. 5 | May 2009
Downloaded from http://annonc.oxfordjournals.org/ at UNIVERSITY OF PITTSBURGH on June 21, 2015
acknowledgements
Annals of Oncology
Annals of Oncology 20: 879–884, 2009 doi:10.1093/annonc/mdn712 Published online 29 January 2009
The importance of KRAS mutations and EGF61A>G polymorphism to the effect of cetuximab and irinotecan in metastatic colorectal cancer K.-L. Garm Spindler1*, N. Pallisgaard2, A. A. Rasmussen3, J. Lindebjerg4, R. F. Andersen2, D. Cru¨ger3 & A. Jakobsen1 1
Background: The effect of anti-epidermal growth factor receptor (EGFR) antibodies (mAb) in metastatic colorectal cancer seems limited to KRAS wild-type (wt) tumours, but still a major fraction of KRASwt patients are nonresponders and supplementary selection criteria are needed. We investigated methodological aspects of KRAS testing and the predictive and prognostic value of KRAS status combined with three EGFR-related gene polymorphisms [singlenucleotide polymorphisms (SNPs)] in patients treated with cetuximab and irinotecan. Patients and methods: The study included 71 patients referred to third-line cetuximab–irinotecan. Blood samples were analysed for SNPs. KRAS analysis was carried out by sequencing analysis and quantitative PCR (DxS kit) in primary tumour and distant metastases. Results: There was a clear correlation between KRAS status in primary tumours and metastasis. The DxS kit presented the highest sensitivity. Response was confined to KRASwt patients (40% response rate versus 0%, P < 0.123), which translated into a significant difference in PFS. The EGF61A>G polymorphism showed relation to clinical outcome. A combined biomarker analysis showed a 19% progression rate in KRASwt-EGF61 homozygote patients and 60% in the EGF61A/G patients (P = 0.006) and a significant increase in overall survival (17.1 versus 5.9 months, log-rank, P = 0.002). Conclusion: The combined biomarker analysis maybe an attractive approach to selection of patients for third-line treatment including anti-EGFR mAbs. Key words: cetuximab–irinotecan, EGF61A>G, gene polymorphisms, KRAS, mCRC
introduction Recent advances in the treatment of metastatic colorectal cancer (mCRC) have included introduction of agents targeting the epidermal growth factor receptor (EGFR). Especially mAbs, which inhibit ligand binding to the extracellular domain, have demonstrated activity. The BOND trial showed efficacy of cetuximab in combination with irinotecan in chemotherapyrefractory patients with mCRC, and a randomised trial showed advantage of panitumumab versus best supportive care in this setting [1, 2]. Furthermore, EGFR inhibitors are moving from third-line into first-line therapy and larger adjuvant studies are ongoing [3, 4]. A substantial amount of patients will experience side-effects, and the consequences of administrating these agents to inappropriately selected patients are clearly a waste of time and *Correspondence to: Dr K.-L. Garm Spindler, Department of Oncology, Vejle Hospital, Kabbeltoft 25, 7100 Vejle, Denmark. Tel: +45-79406002; Fax: +45-79406709; E-mail: [email protected]
financial resources and most importantly, an exposure of these patients to unnecessary toxic effects. With the increasing use of these drugs, there is an urgent need for reliable selection criteria, but unfortunately EGFR testing by immunohistochemistry has no predictive value in this setting [1, 5, 6]. Recently, data from an increasing number of retrospective trials have suggested that response to EGFR inhibitor cetuximab seems confined to KRAS wild-type (wt) tumours [7–11]. Furthermore, results from a large randomised trial showed a clear benefit from panitumumab treatment in KRASwt patients in terms of response and progression-free survival (PFS), whereas patients with KRAS mutant tumours did not respond to treatment and had no survival benefit [12]. KRAS is a small G-protein, which is part of the important intracellular Ras/Raf/MAPK pathway. It has a self-inactivating capability and is normally tightly regulated. Activating mutations in the KRAS oncogene lead to a constitutively active KRAS protein and dysregulation of the RAS-dependent
ª The Author 2009. Published by Oxford University Press on behalf of the European Society for Medical Oncology. All rights reserved. For permissions, please email: [email protected]
original article
Received 9 June 2008; revised 12 October 2008; revised 17 October 2008; accepted 20 October 2008
Downloaded from http://annonc.oxfordjournals.org/ at UNIVERSITY OF PITTSBURGH on June 21, 2015
Department of Oncology; 2Department of Biochemistry; 3Department of Clinical Genetics; 4Department of Pathology, Danish Colorectal Cancer Group South, Vejle Hospital, Vejle, Denmark
original article
materials and methods patient material A total of 71 patients at the Department of Oncology, Vejle Hospital, Denmark, were included in the study from April 2005 to January 2008. Patients referred to treatment with irinotecan and cetuximab were included after informed consent. Eligibility criteria were as follows: histologically confirmed mCRC (adenocarcinomas) refractory to prior fluoropyrimidine, oxaliplatin and irinotecan regimes; Eastern Cooperative Oncology Group performance status of two or less; adequate organ function; age over 18 years and measurable disease according to the Response Evaluation Criteria in Solid Tumours (RECIST) [25], having received at least three cycles of therapy. Treatment consisted of irinotecan (350 mg/m2 every 3 weeks) in combination with cetuximab (400 mg/m2 loading dose followed by weekly 250 mg/m2). Response was classified as complete response, partial response (PR), stable disease (SD) or progressive disease (PD) all according to RECIST. Treatment was terminated upon progression or after prolonged duration of SD in five cases (after 15, 12, 12, 9 and 9 cycles, respectively). Pretreatment blood samples were drawn, and paraffin-embedded tumours and corresponding metastasis were collected from referring pathological
880 | Garm Spindler et al.
departments. The study was conducted in accordance with the Danish law after approval by the Regional Ethics Committee.
KRAS analysis DNA purification. DNA was extracted from formalin-fixed paraffinembedded tissue using QIAamp DNA Mini Kit (QIAGEN, CA, USA) after histological confirmation of viable tumour cells in haematoxylin– eosin-stained slides. sequencing analysis. Part of KRAS exon 2 (GenBank accession number L00045) was amplified by PCR using sense primer 5#TTAACCTTATGTGTGACATGTTCTAAT and antisense primer 5#CATGAAAATGGTCAGAGAAACC. Approximately 10 ng of DNA was used in a 20 ll PCR containing 1· Phusion High-Fidelity buffer added 1.5 mM MgCl2, 200 lM dNTPs (each), 0.4 lM of each primer and 0.2 Units Phusion High-Fidelity DNA polymerase (FINNZYM, Espoo, Finland). Thermocycling steps were as follows: 98C for 2 min; 45 cycles of 98C for 20 s, 63C for 20 s and 72C for 20 s; followed by 72C for 2 min. PCR products were purified using the Illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare, Hilleroed, Denmark). The presence of appropriate PCR products was confirmed by agarose gel electrophoresis. PCR products were sequenced in both directions with nested primers (sense primer: 5#TGTGTGACATGTTCTAATATAGTCACAT and antisense primer: 5#GGTCCTGCACCAGTAATATGC) by using BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA) followed by capillary electrophoresis on an ABI 3130 Genetic Analyzer (Applied Biosystems). Mutations were identified by visual inspection of DNA sequence electropherograms generated by Sequence Analysis Software v5.2 (Applied Biosystems). KRAS detection by DxS kit. Mutant KRAS was determined by a predeveloped kit identifying seven somatic mutations in codons 12 and 13 (DxS Ltd, Manchester, UK). Allele-specific real-time quantitative PCR (qPCR) was carried out on ABI 7900 HT Sequence Detection System (Applied Biosystems) according to the manufacturer’s recommendation. gene polymorphism analysis. Genomic DNA was extracted from whole blood using the Maxwell 16 DNA Purification Kit (Promega Corporation, Madison, WI). Normal colonic tissue was used for DNA extraction in three patients because of inadequate blood samples. PCR was carried out on a ABI 7900 HT Sequence Detection System (Applied Biosystems) using EGF61 and EGFR R521K predeveloped assays (Pre-Developed Assay Reagents, Applied Biosystems, no. c__27031637_10 and c__16170352_20, respectively) according to the manufacturer’s protocol. The EGFR-216G>T analysis was carried out as previously described and results were verified by sequencing [23].
statistics Fisher#s exact or Chi-square test was used for comparison of different frequencies and to evaluate Hardy–Weinberg equilibrium of allelic frequencies. Clinical follow-up data were obtained from prospectively collected clinical record forms. Overall survival (OS) was calculated from the date of inclusion to the date of death from any cause or last followup. PFS was defined as time from enrolment until disease progression or death. If a patient had not progressed and was still alive, the PFS was censored at the time of last follow-up. OS and PFS were estimated using the Kaplan–Meier method and compared using the log-rank test. [Hazard ratios (HRs) were calculated by the Cox–Mantel test and presented as HR with 95% confidence interval (CI).] All P values referred to two-tailed tests and were considered significant when <0.05. All statistics were calculated using the NCSS Statistical Software (Saugus, MA).
Volume 20 | No. 5 | May 2009
Downloaded from http://annonc.oxfordjournals.org/ at UNIVERSITY OF PITTSBURGH on June 21, 2015
pathway. KRAS mutations are considered an early event of colorectal tumour genesis and are present in 20%–50% of colorectal tumours [7, 8, 11–14]. KRAS mutations have traditionally been detected by sequencing analysis, but recently a commercially available kit has been used in different trials. Since KRAS testing may have a positive predictive value of 100% for lack of response, methodological aspects such as sensitivity is of uttermost importance. Knowledge of KRAS status in primary tumours compared with distant metastasis and the importance of tumour heterogeneity is sparse in the literature [9, 15]. This issue is very important to the clinical value of KRAS testing. Furthermore, selection of patients based on KRAS status may prevent a group of patients from unnecessary toxic effects, but there is still a major fraction of nonresponding patients among the KRASwt patients, which underline the need for supplementary predictive markers to combine with KRAS analysis. Recently, focus has been drawn to single-nucleotide polymorphisms (SNPs) related to the EGFR signalling [16]. The EGF61A>G SNP (rs4444903) that is located in the EGF 5#untranslated region (UTR) influences EGF gene expression and holds predictive information [9, 16–19]. We previously investigated the functional influence of this SNP in colorectal cancer (CRC) patients and results suggested a dysregulation according to genotype and a different outcome after cetuximab–irinotecan treatment [20, 21]. The EGFR-216G>T SNP (rs17289) is associated with increased promoter activity and EGFR gene expression [22, 23], and finally, the EGFR R521K SNP (rs11543848) has shown potential influence on outcome in mCRC [16, 24]. The aim of the present study was to investigate the predictive and prognostic value of KRAS status combined with three different EGFR-related SNPs in patients treated with cetuximab and irinotecan. Furthermore, we aimed at investigating methodological aspects of KRAS testing by comparing two different methods for analysis and finally the KRAS status in primary colorectal tumour and corresponding distant metastases.
Annals of Oncology
original article
Annals of Oncology
results patient characteristics Table 1 presents the baseline characteristics of 71 eligible patients and shows that 48% were women compared with 52% men and a median age of 61 years. The median number of cetuximab–irinotecan cycles was six (range 3–15) and 57 patients (80%) presented some degree of skin toxicity, compared with 13 patients (18.3%), who failed to develop a reaction. Eighteen (25%) patients achieved a PR, compared with 28 (39%) with SD, and a total of 25 (35%) patients progressing (PD) after only three cycles.
Characteristic
Patients (n = 71), n (%)
Age, years Median 61 Range 38–77 Gender Female 34 (48) Male 37 (52) ECOG performance status 0 41 (58) 1 24 (34) 2 6 (8) No. of prior chemotherapy regimes for metastatic disease 2 55 (77) 3 16 (23) Primary surgery for CRC Yes 64 (90) No 7 (10) Preoperative chemoradiation Yes 10 (14) No 61 (86) Anatomic site Colon 24 (34) Rectosigmoideum 22 (31) Rectum 25 (35) No. of metastatic sites 1–2 33 (46) 3–5 38 (54) No. of cycles Median 6 Range 3–15 Best response PR 18 (25) SD 28 (39) PD 25 (35) Worst toxicity /rash grade 0 13 (18) 1 36 (51) 2 12 (17) 3 9 (13) Not reported 1 (1) ECOG, Eastern Cooperative Oncology Group; CRC, colorectal cancer, PR, partial response; SD, stable disease; PD, progressive disease.
Volume 20 | No. 5 | May 2009
clinicopathological parameters and outcome Except from cetuximab-related skin rash, patient characteristics were not significantly associated with the outcome (data not shown). The presence and severity of skin rash related to clinical benefit in terms of response rates (RRs) and survival. The RR for patients with a skin reaction was significantly higher than in patients without a rash (data not shown). Skin rash positively affected PFS (log-rank, P = 0.02), but not OS (data not shown). KRAS analysis KRAS analysis in primary tumours by the different methods was carried out. A total of 64 patients had sufficient material for DNA analysis by the DxS qPCR kit and 59 samples were available for the sequencing method. The remaining samples had either limited material or poor quality of the DNA. The DxS qPCR kit detected a larger number of mutations compared with the sequencing method (20 and 13, respectively), confirming the higher sensitivity of the qPCR method. In three cases, the PCR failed by sequencing analysis, with a subsequent successful analysis by the kit. Of note, a single 13GGC>TGC mutation was detected by the sequencing methods and not by the DxS qPCR kit. This is in agreement with the directives of the kit, which is not designed to detect this specific codon 13 mutation. Based on the higher sensitivity and PCR success rate, the DxS kit was chosen for analysis of metastatic tissue. A comparison of KRAS status in primary tumours and metastasis is available from Table 2. None of the KRASwt primary tumours had mutations in corresponding metastasis and only two distant metastases failed to express KRAS mutation, while detected in the primary tumours. The results demonstrate a clear correlation between primary tumour and metastasis, indicating a limited role of tumour heterogeneity. Clinical results suggested that response was confined to KRASwt tumours as presented in Table 3. A total of 22 of 64 patients (34%) available for successful KRAS analysis harboured mutations. The KRASwt patients presented with a RR of 40% compared with 0% in patients with KRAS mutations. The difference was highly significant (P < 0.123). Survival analysis showed that the median PFS in KRASwt patients was 8.0 months (95% CI 4.2–8.4) compared with 2.3 months in KRAS mutant patients (95% CI 2.1–3.9) (log-rank, P < 0.0088). The median OS was 8.7 months (95% CI 6.4–11.0) versus 11.1 months (95% CI 8.0–14.4), but the difference did not reach statistical significance (P = 0.46). gene polymorphism analysis The frequencies of the genotypes and RR according to the different genotypes are presented in Table 3, indicating
doi:10.1093/annonc/mdn712 | 881
Downloaded from http://annonc.oxfordjournals.org/ at UNIVERSITY OF PITTSBURGH on June 21, 2015
Table 1. Patient characteristics
survival data At time of analysis, 46 (65%) patients had died and 25 (35%) were still alive. The median observation time for all patients was 8.0 months (range 1.9–30 months) with a median OS time of 10.8 months (95% CI 8.0–13.8). Eight patients were alive and free from progression at time of analysis and the median PFS was 5.1 months (95% CI 2.8–6.4).
original article
Annals of Oncology
Table 2. KRAS status in 31 primary tumours and corresponding distant metastases by the DxS qPCR kit analysis Primary tumour, DxS KRAS mutation detected Metastasis, DxS KRAS mutation detected Metastasis, DxS KRAS wild type
Primary tumour, DxS KRAS wild type
9
0
2
20
Table 3. Response according to the different markers Total, n (%)
PR
SD
PD
RR
KRAS wild type KRAS mutation EGF 61 A/A EGF 61 A/G EGF 61 G/G EGFR-216 G/G EGFR-216 G/T EGFR-216 T/T EGFR R521K G/G EGFR R521K G/A EGFR R521K A/A
42 22 34 27 10 29 38 4 40 28 3
17 0 8 4 6 7 10 1 14 3 1
11 12 17 9 2 13 14 1 13 15 0
14 10 9 14 2 9 14 2 13 10 2
40% 0% 24% 15% 60% 24% 33% 25% 35% 11% 33%
(66) (34) (48) (38) (14) (41) (54) (6) (56) (39) (4)
P < 0.123 P = 0.02
P = 0.99
P = 0.07
PR, partial response; SD, stable disease; PD, progressive disease; RR, response rate; EGF, epidermal growth factor; EGFR, epidermal growth factor receptor.
a nonsignificant difference between the EGFR-216 and EGFR R521K genotypes, but a significant difference between RR of the EGF61 genotypes (P = 0.02). The results indicated a higher risk of early progression in the EGF61A/G patients compared with the EGF61 A/A or G/G patients (P = 0.02). Furthermore, survival analysis showed a significantly different OS and PFS between the heterozygote and homozygote patients, indicating a different outcome from treatment between the two groups (Figure 1A and B).
combined biomarker analysis The KRAS status, EGF61 genotype and skin rash showed significant association with response and survival in the present material. Of note, there was no correlation between skin toxicity and KRAS (P = 0.48) or EGF61 genotype (P = 0.34) or between KRAS and EGF61 status (P = 0.21). A combined biomarker analysis was carried out including EGF61 genotype analysis on the KRASwt patients. The study included 42 KRASwt patients and survival curves are presented in Figure 1C and D. Most importantly, the rate of progression was 19% in the EGF61 homozygotes compared with 60% in the EGF61A/G patients (P = 0.006), which translated into a marked significant OS benefit of the homozygote patients. These patients had a median OS of 17.1 months (95% CI 11.1–18.2) compared with 5.9 months (95% CI 3.8–9.8) for the EGF61A/G group (log-rank, P = 0.002). The same applied to PFS as
882 | Garm Spindler et al.
discussion The present study provides important information on methodological aspects of KRAS testing, essential to ensure a reliable comparison between clinical studies and a safe application of this apparently strong predictive marker in the clinical settings. The results illustrate the higher sensitivity of the DxS kit compared with the standard sequencing analysis, and based on the present comparison between primary tumours and metastases, the use of KRAS testing in a single sample from the primary tumour seems reliable for predictive purposes. Different retrospective studies have shown that response to anti-EGFR mAb is confined to KRASwt tumours, as also presented here [7, 8, 10, 11, 12, 26, 27]; Twenty-two (34%) patients harboured mutations and demonstrated tumour resistance and a shorter PFS than the KRASwt patients. However, there is a large group of nonresponders among the KRASwt patients that present markers have failed to identify and the need for further investigational studies is obvious. This study is the first to focus on supplementary biomarker analysis on a subgroup of KRASwt patients. We confirmed previous results on the role of skin reactions during treatment, which showed a clear correlation to the outcome of clinical studies [1, 12, 28]. The present data suggested a correlation to response, PFS and OS in agreement with the results of the large panitumumab trial, which demonstrated that patients with KRASwt and worst grade skin toxicity experienced better PFS and OS [12]. However, this was not confirmed by Lievre et al. [11], who failed to demonstrate a correlation to PFS and suggested that KRAS status is a more powerful predictor of resistance to cetuximab. However, skin toxicity is not a baseline feature and might occur late in treatment. Consequently, it has limited value as pretreatment selection criteria. On the other hand, the appearance of skin reactions might become guidance for termination of or dosing during treatment, but unfortunately the result of the EVEREST study has not provided the clinicians with a clear strategy for dose escalation as expected [29], and consequently the role of skin toxicity remains unsolved. A large number of potential alternative markers have been investigated, including EGFR gene copy number assessment, but data are inconsistent and much debated [26, 27, 30]. The present study investigated three relevant SNPs related to the EGFR regulation based on previous literature and functional studies [20]. Only the EGF61 polymorphism presented a clear clinical impact, suggesting an important role of the ligands as also confirmed by Khambada-Ford et al. [14], who investigated the expression of amphiregulin and epiregulin in these patients. Most importantly, they reported that patients with KRASwt and high gene expression of EGFR binding ligands were more likely to obtain disease control. However, gene expression analysis requires fresh tumour tissue sampling, which is not always available as a clinical procedure, and the present SNP analysis on a simple blood sample is thus a very convenient candidate marker.
Volume 20 | No. 5 | May 2009
Downloaded from http://annonc.oxfordjournals.org/ at UNIVERSITY OF PITTSBURGH on June 21, 2015
Genotype
presented in Figure 1C, indicating a strong clinical relevance of this combination.
original article
Annals of Oncology
A
B
1,000
0,750
Survival
Survival
0,750 0,500 0,250 0,000 0,0
1,000
0,500 0,250
7,5
15,0
22,5
0,000 0,0
30,0
PFS in months
C
D
26,3
35,0
1,000
Survival
0,750
0,500
0,250
0,500 0,250
6,3
12,5
18,8
25,0
PFS in months
0,000 0,0
6,3
12,5
18,8
25,0
OS in months
Figure 1. Survival curves. (A) Progression-free survival (PFS) and EGF61 heterozygotes versus homozygotes. The median PFS was 7.8 months [95% confidence interval (CI) 4.4–8.4] in the homozygous (blue) group compared with 2.8 months in the EGF61A/G patients (red) (95% CI 2.1–4.1) [hazard ratio (HR) = 1.68; 95% CI 0.96–2.93; P = 0.03]. (B) Overall survival and EGF61 heterozygotes versus homozygotes. The median overall survival (OS) was 14.4 months (95% CI 10.1–18.2) in the homozygous (blue) group compared with 9.1 in the heterozygous (red) patients (95% CI 5.9–10.8) (HR = 1.81; 95% CI 0.96–3.41; P = 0.04). (C) PFS for patients tested KRASwt according to EGF61A>G. Red: KRASwt-homozygous patients, median PFS = 8.4 months (95% CI 8.0–10.5); blue: KRASwt-heterozygous patients, median PFS = 2.5 months (95% CI 2.0–5.1) (HR = 2.74; 95% CI 1.11–6.78; P = 0.0017). (D) Overall survival for patients tested KRASwt according to EGF61 A>G. Red: KRASwt-homozygous patients, median OS = 17 months (95% CI 11.1–18.2); Blue: KRASwt-heterozygous patients, median OS = 5.9 months (95% CI 3.8–9.8) (HR = 3.22; 95% CI 1.19–8.67; P = 0.0006).
The EGF61 SNP implies a substitution of G by A at locus 61 in the 5#-UTR of the EGF gene and has a functional influence on EGF production. Monoclonal cells are reported to produce significantly lower levels of EGF in A/A genotypes than cells from G-containing variants and furthermore, gene expression levels differ according to genotype in glioblastomas and normal colon [18, 20]. Previous studies by Zhang and recently by Graziano et al. are diverging concerning the association between the EGF61 genotypes and favourable outcome [16, 17]. Dr Zhang presented a higher OS in patients with the A/A compared with G-containing variants, which is theoretically in agreement with preclinical studies, indicting that the G allele is more active than the A and consequently associated with higher EGF levels [18, 19]. However, these results are in contrast to the study by Graziano et al. [16], which indicates that EGF upregulation maybe associated with better outcome in the G-containing patients. The favourable effect of the G/G genotype is counterintuitive, but could be explained by the possibility of EGF-inducing apoptosis and growth inhibition as demonstrated in experimental systems. Interestingly, the present results show an unfavourable outcome in KRASwt patients harbouring the A/G variant, compared with the A/A and G/G patients, which again is in
Volume 20 | No. 5 | May 2009
contrast to previous findings. However, investigations of EGF gene expression in CRC and normal colon have shown that G-containing variants have a functional influence on normal colon but not in colorectal tumours, suggesting a dysregulation in the tumours [20]. Also, the correlation between EGF gene expression in tumours and normal colon seemed strongest in the A/G group compared with the A/A and G/G patients (Spindler, Jakobsen et al., unpublished data), indicating a resolved regulation in these genotypes compared with the latter, and thus a potentially increased ability to compete with cetuximab binding in the EGF61A/G patients. Results indicated that the EGF61 homozygote patients had a lower risk of treatment failure than the EGF61A/G patients, which translated into an increased median OS of 17.1 months compared with 5.9 months. The difference in PFS between the two groups was significant, however less pronounced. Only the present study has combined the marker with KRAS analysis and analysed a subgroup of KRASwt patients, which seems a reasonable clinical approach that deserves further investigation. Due to the low number of events and the exploratory nature of this study, a multivariate analysis was not carried out on the present material. However, a Bonferroni correction of the statistical test on the EGF61 marker did not weaken the results on response or log-rank
doi:10.1093/annonc/mdn712 | 883
Downloaded from http://annonc.oxfordjournals.org/ at UNIVERSITY OF PITTSBURGH on June 21, 2015
0,750
Survival
17,5
OS in months
1,000
0,000 0,0
8,8
original article testing in the wt patients (data not shown). Further studies, preferably in larger prospective settings with a relevant control group, would contribute to the evidence of this promising approach. In addition to elucidating methodological aspects of KRAS testing, we present a feasible potential supplementary marker for predicting patient outcome, when combining the KRAS analysis with EGF61 status. The marker combination showed a clear benefit from treatment in the KRASwt-EGF61 homozygote patients in terms of decreased risk of treatment failure and a significant survival benefit.
funding Cancer Foundation.
We thank Birgit Roed Sørensen, Lone Frischknecht, Lene Byriel, Kaja Skovsga˚rd and Dorte Mengers Flindt for excellent technical assistance and Karin Larsen for proofreading.
references 1. Cunningham D, Humblet Y, Siena S et al. Cetuximab monotherapy and cetuximab plus irinotecan in irinotecan-refractory metastatic colorectal cancer. N Engl J Med 2004; 351(4): 337–345. 2. Van Cutsem E, Peeters M, Siena S et al. Open-label phase III trial of panitumumab plus best supportive care compared with best supportive care alone in patients with chemotherapy-refractory metastatic colorectal cancer. J Clin Oncol 2007; 25(13): 1658–1664. 3. Koehne C. Cetuximab plus FOLFIRI first-line in metastatic colorectal cancer (mCRC): the randomized phase III CRYSTAL trial. 9th World Congress on Gastrointestinal Cancer Annual Meeting, Barcelona, Spain, 2007; (Abstr O-0031). 4. Scheithauer W. Cetuximab plus irinotecan in patients (pts) with metastatic colorectal cancer (mCRC) failing prior oxaliplatin-based therapy: the EPIC trial Sobrero A. 14th European Cancer Conference, Barcelona, Spain, 2005; 23(9): 1803–1810. 5. Chung KY, Shia J, Kemeny NE et al. Cetuximab shows activity in colorectal cancer patients with tumors that do not express the epidermal growth factor receptor by immunohistochemistry. J Clin Oncol 2008; 19(4): 717–723. 6. Hecht JR, Patnaik A, Berlin J et al. Panitumumab monotherapy in patients with previously treated metastatic colorectal cancer. Cancer 2007; 110(5): 980–988. 7. Benvenuti S, Sartore-Bianchi A, Di NF et al. Oncogenic activation of the RAS/RAF signaling pathway impairs the response of metastatic colorectal cancers to antiepidermal growth factor receptor antibody therapies. Cancer Res 2007; 67(6): 2643–2648. 8. De Roock W, Piessevaux H, De Shutter J et al. KRAS wild-type state predicts survival and is associated to early radiological response in metastatic colorectal cancer treated with cetuximab. Ann Oncol 2008; 19(3): 508–515. 9. Di Fiore F, Blanchard F, Charbonnier F et al. Clinical relevance of KRAS mutation detection in metastatic colorectal cancer treated by Cetuximab plus chemotherapy. Br J Cancer 2007; 96(8): 1166–1169. 10. Khambata-Ford S, Garrett CR, Meropol NJ et al. Expression of epiregulin and amphiregulin and K-ras mutation status predict disease control in metastatic colorectal cancer patients treated with cetuximab. J Clin Oncol 2007; 25(22): 3230–3237. 11. Lievre A, Bachet JB, Boige V et al. KRAS mutations as an independent prognostic factor in patients with advanced colorectal cancer treated with cetuximab. J Clin Oncol 2008; 26(3): 374–379.
884 | Garm Spindler et al.
12. Amado RG, Wolf M, Peeters M et al. Wild-type KRAS is required for panitumumab efficacy in patients with metastatic colorectal cancer. J Clin Oncol 2008; 26(10): 1626–1634. 13. Bos JL. ras oncogenes in human cancer: a review. Cancer Res 1989; 49(17): 4682–4689. 14. Khambata-Ford S, Garrett CR, Meropol NJ et al. Expression of epiregulin and amphiregulin and K-ras mutation status predict disease control in metastatic colorectal cancer patients treated with cetuximab. J Clin Oncol 2007; 25(22): 3230–3237. 15. Thebo JS, Senagore AJ, Reinhold DS, Stapleton SR. Molecular staging of colorectal cancer: K-ras mutation analysis of lymph nodes upstages Dukes B patients. Dis Colon Rectum 2000; 43(2): 155–159. 16. Graziano F, Ruzzo A, Loupakis F et al. Pharmacogenetic profiling for cetuximab plus irinotecan therapy in patients with refractory advanced colorectal cancer. J Clin Oncol 2008; 26(9): 1427–1434. 17. Zhang W, Gordon M, Press OA et al. Cyclin D1 and epidermal growth factor polymorphisms associated with survival in patients with advanced colorectal cancer treated with Cetuximab. Pharmacogenet Genomics 2006; 16(7): 475–483. 18. Shahbazi M, Pravica V, Nasreen N et al. Association between functional polymorphism in EGF gene and malignant melanoma. Lancet 2002; 359(9304): 397–401. 19. Bhowmick DA, Zhuang Z, Wait SD, Weil RJ. A functional polymorphism in the EGF gene is found with increased frequency in glioblastoma multiforme patients and is associated with more aggressive disease. Cancer Res 2004; 64(4): 1220–1223. 20. Spindler KL, Nielsen JN, Ornskov D et al. Epidermal growth factor (EGF) A61G polymorphism and EGF gene expression in normal colon tissue from patients with colorectal cancer. Acta Oncol 2007; 46(8): 1113–1117. 21. Spindler KL. The predictive value of EGF A61G gene polymorphism in third-line treatment with cetuximab and irinotecan of patients with metastatic colorectal cancer. ASCO 2008 Gastrointestinal Cancer Symposium, Orlando, FL, 2008. (Abstr 413). 22. Liu W, Innocenti F, Wu MH et al. A functional common polymorphism in a Sp1 recognition site of the epidermal growth factor receptor gene promoter. Cancer Res 2005; 65(1): 46–53. 23. Spindler KL, Lindebjerg J, Nielsen JN et al. Epidermal growth factor receptor analyses in colorectal cancer: a comparison of methods. Int J Oncol 2006; 29(5): 1159–1165. 24. Wang WS, Chen PM, Chiou TJ et al. Epidermal growth factor receptor R497K polymorphism is a favorable prognostic factor for patients with colorectal carcinoma. Clin Cancer Res 2007; 13(12): 3597–3604. 25. Therasse P, Arbuck SG, Eisenhauer EA et al. New guidelines to evaluate the response to treatment in solid tumors. European Organization for Research and Treatment of Cancer, National Cancer Institute of the United States, National Cancer Institute of Canada. J Natl Cancer Inst 2000; 92(3): 205–216. 26. Italiano A, Follana P, Caroli FX et al. Cetuximab shows activity in colorectal cancer patients with tumors for which FISH analysis does not detect an increase in EGFR gene copy number. Ann Surg Oncol 2008; 15(2): 649–654. 27. Sartore-Bianchi A, Moroni M, Veronese S et al. Epidermal growth factor receptor gene copy number and clinical outcome of metastatic colorectal cancer treated with panitumumab. J Clin Oncol 2007; 25(22): 3238–3245. 28. Lenz HJ, Van CE, Khambata-Ford S et al. Multicenter phase II and translational study of cetuximab in metastatic colorectal carcinoma refractory to irinotecan, oxaliplatin, and fluoropyrimidines. J Clin Oncol 2006; 24(30): 4914–4921. 29. Tajpar S, Peeters M, Humblet H et al. Phase I/II study of cetuximab doseescalation in patients with metastatic colorectal cancer (MCRC) with no or slight skin reaction on cetuximab standard dose treatment (EVEREST): pharmacokinetic (PK), pharmacodynamics (PD) and efficacy data. J Clin Oncol 2007; 25 (Suppl): 172s (Abstr 4037). 30. Cappuzzo F, Finocchiaro G, Rossi E et al. EGFR FISH assay predicts for response to cetuximab in chemotherapy refractory colorectal cancer patients. Ann Oncol 2008; 19(4): 717–723.
Volume 20 | No. 5 | May 2009
Downloaded from http://annonc.oxfordjournals.org/ at UNIVERSITY OF PITTSBURGH on June 21, 2015
acknowledgements
Annals of Oncology