The influence of anthracosis and p16ink4a gene aberrant methylation on small-sized pulmonary adenocarcinoma

Experimental and Molecular Pathology 90 (2011) 131–136

Contents lists available at ScienceDirect

Experimental and Molecular Pathology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / y e x m p

The influence of anthracosis and p16ink4a gene aberrant methylation on small-sized pulmonary adenocarcinoma☆ Daye Wang a,⁎, Jue Wang a, Yong Li a, Zhili He b, Yong Zhang c a b c

Center of Clinical Pathology, China Capital Medical University, Beijing, China Department of Pathology, Xuanwu Hospital of China Capital Medical University, Beijing, China Department of Pathology, Beijing Tongren affiliated Hospital of China Capital Medical University, Beijing, China

a r t i c l e

i n f o

Article history: Received 29 April 2010 and in revised form 26 October 2010 Available online 10 November 2010 Keywords: Anthracosis p16ink4a gene Aberrant methylation Small-sized pulmonary adenocarcinoma

a b s t r a c t Aims: Anthracosis is the deposition of black dusty material in the pulmonary parenchyma. Previous reports showed anthracosis and p16ink4a gene aberrant methylation are closely related to the promotion and progression of small-sized pulmonary adenocarcinoma. In this study, we investigated the influence of anthracosis and p16ink4a gene aberrant methylation on clinical samples from patients with small-sized adenocarcinoma. Methods and results: DNA was bisulfite modified and methylation-specific PCR was performed to detect p16ink4a gene aberrant methylation; black dusty material was extracted from lung tissues. Anthracotic index (AI) was defined as the absolute absorbance by densitometry. The histopathological diagnosis was concluded according to Noguchi's classification for small-sized pulmonary adenocarcinoma. The mean AI and the frequency of p16ink4a gene aberrant methylation of heavy smokers were significantly higher than that of nonsmokers ( b 0.01 and b 0.05, respectively). The frequency of p16ink4a gene aberrant methylation of early stage small-sized adenocarcinoma was lower than that of advanced and poorly differentiated, while p16ink4a protein expression level of early stage small-sized adenocarcinoma was significantly higher than that of poorly differentiated small-sized adenocarcinoma (P b 0.05). Conclusions: AI and p16ink4a gene aberrant methylation may provide a potential universal biomarker for smallsized adenocarcinoma. © 2010 Elsevier Inc. All rights reserved.

Introduction Lung carcinoma is the leading cause of cancer deaths worldwide, including China, the U.S. and Japan (Shimosato and Noguchi, 2004). Adenocarcinoma is one of the most common histological types of lung carcinoma, and its incidence is still increasing in China. Several leading influential causes may include: 1) adoption of the advanced diagnostic technology for lung cancer, such as thin-slice computed tomography (CT), which provide means of apparently earlier and more accurate diagnosis due to improved detection; 2) changes in cigarette design such as the filter, which could induce tiny dusty granules inhalation and deposition into peripheral pulmonary tissue; 3) air pollution, especially automobile exhaust in urban area (Thun et al., 1997).

☆ This work is supported by Beijing Excellent Talents funded projects (2009D005018000006). ⁎ Corresponding author. Center of Clinical Pathology, China Capital Medical University, No.10 Xitoutiao, You An Men street, Beijing 100069, P.R. China. Fax: +86 10 83911699, +86 10 83911432 (office). E-mail address: [email protected] (D. Wang). 0014-4800/$ – see front matter © 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.yexmp.2010.10.014

Anthracosis is the deposition of black dusty material in pulmonary parenchyma (Fraser et al., 1999). Some researches suggest that background anthracosis is a very convenient indicator for estimating lung exposure to chemical carcinogens such as polycyclic aromatic hydrocarbons (PAHs) (Hou et al., 1998; Wang et al., 2003). PAHs are produced during incomplete combustion of petrol, coal, cellulose, and a large variety of hydrocarbons. Benzo(a)pyrene, one of the PAHs present in air, is considered as one of the most well known carcinogens. There is also a strong correlation between the degree of black dusty material deposition and smoking history (Wang et al., 2003; Mirsadraee and Saeedi, 2005). Hou et al. (1998) and Wang et al. (2003) examined background anthracosis in pulmonary adenocarcinoma by autopsy and surgery, and demonstrated a strong correlation between the degree of black dusty material deposition and histological subtypes of small-sizedsized adenocarcinoma. They found that either relatively advanced and less-differentiated adenocarcinomas tended to develop in severely anthracotic lungs, or that adenocarcinomas which developed in severely anthracotic lungs progressed more readily to advanced or less-differentiated tumors. These findings suggest that the degree of background anthracosis is also a very useful risk factor for estimating the prognosis of pulmonary adenocarcinoma.

132

D. Wang et al. / Experimental and Molecular Pathology 90 (2011) 131–136

Inactivation of the tumor suppressor genes p16ink4a is an important marker in lung carcinogenesis. In particular, the aberrant DNA methylation of the 5’ promoter region of p16 gene is correlated closely with pulmonary adenocarcinoma (Kim et al., 2005; Lyon et al., 2007; Tanaka et al., 2005; Toyooka et al., 2004). In this study, we plan to characterize the synergetic influence of anthracosis and p16ink4a gene aberrant methylation on small-sized pulmonary adenocarcinoma. Materials and methods Tissue specimens Sixty-eight surgically resected lung specimens are from patients (31 males and 37 females) age 46–84 years with a mean age of 67, with peripheral adenocarcinomas measuring ≤ 2 cm across the greatest dimension. According to AJCC/UICC Lung Cancer TNM Staging (7th Edition 2009), all of 68 cases were Stage IA (T1a, N0, M0). They underwent surgery during the period from December 1997 to October 2003 at Beijing TongRen affiliated Hospital of China Capital Medical University (Beijing, China). All patients underwent curative resections and did not receive adjuvant radiotherapy or chemotherapy. There were 20 smokers, 36 nonsmokers, and 12 with unknown smoking history. The smoking index (SI) (the number of cigarettes smoked per day × years of smoking) of 15 smokers was ≥600, and the SI of 5 smokers was b600. A smoker with SI of ≥600 was considered a heavy smoker (Shiba et al., 2000). The surgically resected specimens were fixed in 10% formalin and embedded in paraffin for histological examination. All of the sections (3 μm thick), including the largest cut surface of the tumor, were stained with hematoxylin and eosin and examined by light microscopy. All tumor specimens were classified using the histological criteria proposed by Noguchi et al. (1995) (Fig. 1). Final diagnosis was performed by three pathologists. Informed consents were obtained from all patients for specimen collection. Histological typing We characterized lung adenocarcinomas with sizes ≤2 cm using the Noguchi's histological criteria. Tumors were classified into two groups: replacement type and non-replacement type adenocarcinoma. Replacement type is further divided into three subtypes: localized bronchioloalveolar carcinoma (LBAC) (type A), LBAC with alveolar collapse (type B), and LBAC with foci of fibroblastic proliferation (type C). Non-replacement type is also divided into three subtypes: poorly differentiated adenocarcinoma (type D), bronchial gland type adenocarcinoma (type E), and true papillary adenocarcinoma (type F). Of these 68 cases, 4 cases were diagnosed as type A, 11 cases as type B, 32 cases as type C, 9 cases as type D, 4 cases as type E, and 5 cases as type F and 3 cases as type A + F. Extraction of black dusty material Black dusty material was extracted as previously reported (Wang et al., 2003). Briefly, paraffin-embedded blocks were made from the tumor lesions and non-tumorous regions. For each case, four blocks with one tumor lesion and three non-tumorous regions were selected. Six 10 μm sections from the tumor lesion and two 10 μm sections from each of non-tumorous regions were cut and stored in a 1.5 ml micro centrifuge tubes. After deparaffinization using xylene, dehydrated tissues were digested with Proteinase K (100 μg /ml) and SDS (10%) overnight at 48 °C. Black dusty material was separated by centrifugation for 10 min at 10,000 rpm. The precipitate was washed 3 times with distilled water and homogenized using an Ultraturrax homogenizer (IKA, Stanfer, Germany). The homogenate was then suspended in buffer (1 × Tris-EDTA) and dot-blotted onto a nitrocellulose membrane using Hybri-Slot (Gibco BRL, Gaithersburg, MD).

Density of the blots was analyzed by a GS-800 imaging densitometer (Bio Rad, Hercules, CA). Anthracotic index (AI) was defined as the absolute absorbance (A) by densitometry . Nucleic acid extraction and methylation-specific polymerase chain reaction Approximately six 10 μm sections were cut from the methanolfixed block. The slices were deparaffinized with xylene and genomic DNA was extracted from the tumor and non-tumor samples using the standard technique. A total of 2 μg of genomic DNA obtained from the sample was modified by sodium bisulfite as previously described. The methylation status of the p16 gene promoters was determined by the methylation-specific polymerase chain reaction (PCR) method (Herman et al., 1996). A nested PCR approach was used in the current study. Two sets of primers were designed, one specific for DNA methylated at the promoter region of each gene and the other specific for unmethylated DNA. PCR reactions were performed in a total volume of 25 μL containing 1 × PCR buffer, 0.25 mM each of the deoxynucleotide triphosphates (dNTP), 5% dimethylsulfoxide, 300 ng of each primer, 1 U of Hot-Start Taq polymerase (Takara, Tokyo, Japan), and the modified DNA (approximately 100 ng) sample. PCR was performed in a Takara PCR thermal cycler MP (Takara) using following conditions: initial denaturation at 95 °C for 10 min, followed by 35 cycles of denaturation at 95 °C for 30 s, annealing for 45 s, and extension at 72 °C for 30 s, with a final extension at 72 °C for 7 min. The primer sequences and annealing temperatures, and the sizes of each PCR product, are listed in Table 1. DNA free distilled water was used as a negative control, and DNA from Colo320 cell line was used as a positive control for p16 analysis (Suter et al., 2003). PCR products were analyzed in 2% agarose gel and stained with ethidium bromide. Samples with positive methylation products also were analyzed by methylation-sensitive restriction enzyme digestion of the PCR product. For restriction analysis, the PCR mixture was digested with BstUI under the conditions specified by the manufacturer (New England Biolabs, Beverley, MA). Immunohistochemistry For immunohistochemical analysis of the p16 expression, 4 μm sections were cut from 10% formalin-fixed and paraffin-embedded specimens. Sample sections were deparaffinized in xylene, rehydrated in decreasing concentrations of ethanol, and immunostained by an automated method (Ventana Medical Systems, Tucson, AZ) using an anti-p16 monoclonal antibody (clone G175-405; Pharmingen, San Diego, CA) at a dilution of 1:20. The sections were counterstained with hematoxylin. Slides were evaluated by standard light microscopy. Only nuclear staining was scored and considered positive. Inflammatory cells, reactive stromal cells, and bronchial epithelial cells on the same slide served as positive internal controls for immunostaining. The following scale was used: score 0, no immunoreactivity of tumor cells; score 1, b10% of the tumor cells displayed strong p16 protein staining; score 2, ≥10% of the tumor cells were strongly positive. In current study, we decided to use a score of 0 or 1 as negative for p16 product expression and score 2 as positive.

Statistical analysis Associations of categorical variables were compared by Fisher's exact test (n b 40) or chi-square test (n N 40). Measurement data was compared by t test. Correlation analysis was carried out by Spearman rank correlation analysis. All statistical calculations were performed with SPSS13.0 for Windows. P b 0.05 is considered statistically significant.

D. Wang et al. / Experimental and Molecular Pathology 90 (2011) 131–136

133

Fig. 1. Representative histology of Noguchi's classification for small-sized pulmonary adenocarcinoma. Replacement type adenocarcinoma: A and B; non-replacement type adenocarcinoma: type C–F. (A) Localized bronchioloalveolar carcinoma (LBAC) (H&E × 200). (B) LBAC with foci of collapse of alveolar structure(H&E × 200). (C) LBAC with foci of active fibroblastic proliferation(H&E × 200). (D) Poorly differentiated adenocarcinoma(H&E × 200). (E) Tubular adenocarcinoma(H&E × 200). (F) Papillary adenocarcinoma with compressive and destructive growth (H&E × 100).

Results

Anthracosis, smoking history and p16ink4a expression

First, we categorized the survival of each case in this study and confirmed the appropriateness of applying the classification for smallsized adenocarcinoma of the lung. The 5-year survival rate for patients with tumors of types A and B in this study was 100%, whereas those of patients with type C, type D, and types E and F were 52%, 49% and 39%, respectively (Fig. 2).

Representative AI values of 56 cases with known smoking history and the association between p16 methylation status and SI of the examined patients are shown in Table 2. The mean AI of the male group (31 cases) was significantly higher than that of the female group (37 cases). The mean AI of patients N50 years was slightly higher than that of patients ≤50 years, but not significant. Of 56 cases (20 smokers and

134

D. Wang et al. / Experimental and Molecular Pathology 90 (2011) 131–136

Table 1 MSP primers sequences and PCR conditions. Primer

Primer sequence (5′– 3′)

1st p16F 1st p16R 2nd p16MF 2nd p16MR 2nd p16UF 2nd p16UR

CTACAAACCCTCTACCCACC GAAGAAAGAGGAGGGGTTGG TTATTAGAGGGTGGGGCGGATCGC GACCCCGAACCGCGACCGTAA TTATTAGAGGGTGGGGTGGATTGT CAACCCCAAACCACAACCATAA

Product size

Annealing temperature 60 °C

150 bp

60 °C

151 bp

55 °C

UR: unmethylated reverse; UF: unmethylated forward. MR: methylated reverse; MF: methylated forward. F: forward primer; R: reverse primer; MF: methylated/forward; MR: methylated/ reverse; UF: unmethylated/forward; UR: unmethylated/reverse; bp: base pair; PCR: polymerase chain reaction; MSP: methylation-specific PCR.

36 nonsmokers), ration of male smokers is significantly higher than female smokers. Despite the sex, the mean AI of 20 cases of smokers was significantly higher than 36 cases of nonsmokers. The mean AI of 15 cases of heavy smokers was significantly higher than 41 cases of non-heavy smokers. Smoking index (SI) of ≥600 was considered to be a heavy smoker. These results showed positive correlation between smoking history and anthracosis. Aberrant methylation of the p16 promoter region was detected in 9 of 15 heavy smokers; this is significantly higher than that of nonsmokers (SI = 0) and mild smokers (0 b SI b 600), and is also significantly higher than nonheavy smokers. The ratio of p16 positive immunoreactivity of heavy smokers is significantly higher than mild smokers. Noguchi's classification, smoking history and p16ink4a expression As Table 3 shows, of these 56 cases, 4 cases were diagnosed as type A, 8 cases as type B, 27 cases as type C, 9 cases as type D, 4 cases as type E and 4 cases as type F. Nonsmokers in type A + B (9/12) and in type C (20/27) were significantly higher than in type D (2/27), while heavy smokers in type A + B (2/12) and in type C (5/27) were significantly lower than type D (6/9).These results indicated positive correlation between smoking index and histological typing. Fig. 3A and B shows representative results of methylation-specific PCR analysis. Positivity for aberrant p16 methylation of type C (37%), type D (44%) and type E + F (44%) was higher than type A + B (8%), but not statistically significant. In 12 cases of type A + B, positive immunoreactivity for p16 protein was 83.3% (10/12), higher than type C (13/ 27, 48.2%), but not significant positive immunoreactivity for p16

Table 2 p16ink4a gene aberrant expression and clinical features in patients with small-sized adenocarcinoma of the lung. Clinicopathological features Gender Male Female Age (years) N60 ≤60 Smoking history Smoker (SI N 0) Nonsmoker (SI = 0) Mild smoker (0 b SI b 600) Heavy smoker (SI ≥ 600) Nonheavy smoker (SI b 600) Differentiation Well Moderately Poorly

Case no.

AI (Mean ± SD)

p16 A.M

p16 IHC

M

U

+

−

31 37

0.887 ± 0.180 0.385 ± 0.130

14 10

17 27

18 21

13 16

48 20

0.719 ± 0.147 0.361 ± 0.132

19 5

29 15

25 14

23 6

20 36

1.078 ± 0.311§ 0.364 ± 0.090

9 10#

11 26

10 20

10 16

5

0.429 ± 0.129

0||

5

5

0

15

1.294 ± 0.392

9¶

6

5⁎

10

41

0.371 ± 0.085

11

30

25

16

35 26 7

0.478 ± 0.309 0.570 ± 0.153 0.673 ± 0.178

10 11 3

25 15 4

31 19 4

4 7 3

t

P

2.304

0.024

2.746

0.008

—

—

2.139

0.005

Mean AI: mean anthracotic index ± SE; heavy smoker: smoking index ≥ 600; A.M: aberrant methylation; M: methylation; U: unmethylation; IHC: immunohistochemistry stain; TNM stage: T1a ≤ 2 cm. § Smoker versus nonsmoker, t = 2.746, P = 0.008. Heavy smoker versus nonheavy smoker, t = 2.139, P = 0.005. # Heavy smoker versus nonsmoker, χ2 = 4.703, P = 0.030. || Heavy smoker versus mild smoker, χ2 = 5.455, P = 0.020. ¶ Heavy smoker versus nonheavy smoker, χ2 = 6.212, P = 0.010. ⁎Heavy smoker versus mild smoker, χ2 = 6.667, P = 0.010. Spearman analysis: Mean AI versus smoking history, r = 0.424, p = 0.001. p16 A.M versus smoking history, r = 0.438, p = 0.007.

protein of type A + B was significantly higher than type D (3/9, 33.3%) (Table 3). As Table 4 shows, of 68 cases, 39 tumor cases (57.4%) showed positive immunoreactivity for p16 protein, 29 cases showed negative. Of 39 positive cases, positivity for aberrant p16 methylation was 20.5% (8/39); of 29 negative cases, positivity for aberrant p16 methylation was 55.2% (16/29), there was significant difference between them. Fig. 4 shows the representative positive case.

Table 3 The relationship between Noguchi's classification, smoking index and p16ink4a gene aberrant expression.

Fig. 2. Survival curve of Noguchi's classification for small-sized pulmonary adenocarcinoma.

Noguchi's classification

Case no.

Smoking index

p16 A.M

p16 IHC

0

0–600

≥600

M

U

+

−

Type A + B Type C Type D Type E + F Total

12 27 9 8 56

9⁎ 20§ 2 5 36

1 2 1 1 5

2|| 5¶ 6 2 15

1 10 4 4 19

11 17 5 4 37

10# 13 3 4 30

2 14 6 4 26

A.M: aberrant methylation M: methylation U: unmethylation. IHC: immunohistochemistry stain. ⁎Type A + B versus type D, P = 0.030. § Type C versus type D, P = 0.014. || Type A + B versus type D, P = 0.032. ¶ Type C versus type D, P = 0.012. # Type A + B versus type D, P = 0.032. Spearman analysis: Smoking index versus Noguchi's classification, r = 0.377, p = 0.004. p16 A.M versus Noguchi's classification, r = 0.440, p = 0.001. p16 IHC versus smoking history, r = −0.268, p = 0.046.

D. Wang et al. / Experimental and Molecular Pathology 90 (2011) 131–136

135

Fig. 3. (A) p16ink4a methylation-specific PCR of small-sized pulmonary adenocarcinoma. (B) Bst U1 restriction enzyme treatment.

Discussion Our study showed that the mean AI value and aberrant methylation of p16ink4a in heavy smokers (smoking index ≥ 600) are higher than non-heavy smokers, and showed positive correlation between smoking history and anthracosis (r = 0.42, P = 0.001). We suggest that heavy smoking can lead to increased p16ink4a aberrant methylation frequency. Compared with the WHO classification, Noguchi's smallsized pulmonary adenocarcinoma (diameter ≤ 2 cm) sub-type classification not only bases on the morphology, but also combines the pathology and prognosis. This provides the morphological basis for early diagnosis and prognosis in lung cancer patients. Type A and B are considered to be the early adenocarcinoma in situ, with 5-year survival rate of 100%; type C is the progressive form developed from type A and B. Our study shows that, in type A and B cases, ratio of nonsmokers is higher than in patients with type D (poorly differentiated small-sized adenocarcinoma), and ratio of heavy smokers was lower than that of type D; ratio of nonsmoker in type C is also higher than that in type D. We conclude that the amount of smoking and pulmonary adenocarcinoma are positively correlated in degree of differentiation; that is, the higher amount of smoking, the more easily it leads to a small-sized poorly differentiated adenocarcinoma. Rate of abnormal gene p16ink4a methylation in type A + B was lower than in type C and type D, while the type A + B patients with positive immunohistochemical p16ink4a are higher than type C, significantly higher than type D. In immuTable 4 The relationship between p16ink4a gene aberrant methylation and immunohistochemistry stain. p16 A.M (case no.) M (24) U (44)

p16 IHC(Case No.) + (39)

− (29)

8 31

16 13

χ2

P

8.620

0.003

A.M: aberrant methylation M: methylation U: unmethylation. IHC: immunohistochemistry stain.

Fig. 4. p16ink4a gene immunohistochemistry stain. (A) Pulmonary adenocarcinoma (+, more than 10% tumor cells were stained), original magnification × 400. (B) Positive control: squamous cell carcinoma of the cervix, original magnification × 400.

nohistochemical p16ink4a positive cases, abnormal p16ink4a methylation rate was lower than that in the negative cases, indicating that during the progression from type A, B to type C and type D, abnormal gene methylation p16ink4a continuously down-regulates gene production and p16ink4a abnormal gene methylation inhibits the p16ink4a gene expression. These findings confirmed the close relationship between occurrence of early lung cancer with smoking and progression and abnormal p16ink4a gene methylation. In summary, we examined the degree of background anthracosis and the aberrant methylated status of p16ink4a using surgically resected materials in this study. We concluded that heavy smoking is accountable for heavy black dusty material deposition in background lungs and increased frequency of aberrant methylation of p16ink4a gene; it is also closely related to the progression of pulmonary adenocarcinoma. Our next step will be investigating possibility of obtaining biopsy specimens through the fiberoptic bronchoscope to determine the amount of black dusty material, and to detect the status of p16ink4a gene aberrant methylation. This may provide important information for early discovery and diagnosis of lung cancer in smoking populations. References Fraser, R.S., Müller, N.L., Colman, N., Paré, P.D. (Eds.), 1999. Diagnosis of diseases of the chest, 4th ed. Saunders, Philadelphia, PA. Herman, J.G., Graff, J.R., Myohanen, S., et al., 1996. Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc. Natl Acad. Sci. USA 93, 9821–9826.

136

D. Wang et al. / Experimental and Molecular Pathology 90 (2011) 131–136

Hou, M., Morishita, Y., Iijima, T., et al., 1998. The implication of anthracosis in the development of pulmonary adenocarcinoma. Jpn J. Cancer Res. 89, 1251–1256. Kim, Y.T., Park, S.J., Lee, S.H., et al., 2005. Prognostic implication of aberrant promoter hypermethylation of CpG islands in adenocarcinoma of the lung. J. Thorac. Cardiovasc. Surg. 130 (5), 1378. Lyon, C.M., Klinge, D.M., Liechty, K.C., et al., 2007. Radiation-induced lung adenocarcinoma is associated with increased frequency of genes inactivated by promoter hypermethylation. Radiat. Res. 168 (4), 409–414. Mirsadraee, M., Saeedi, P., 2005. Anthracosis of lung: evaluation of potential underlying causes. J. Bronchol. 12 (2), 84–87. Noguchi, M., Morikawa, A., Kawasaki, M., et al., 1995. Small adenocarcinoma of the lung. Histologic characteristics and prognosis. Cancer 75 (12), 2844–2852. Shiba, M., Kohno, H., Kakizawa, K., et al., 2000. Ki-67 immunostaining and other prognostic factors including tobacco smoking in patients with resected nonsmall cell lung carcinoma. Cancer 89, 1457–1465.

Shimosato, Y., Noguchi, M., 2004. Pulmonary Neoplasms, In: Stacey, E.M., Darryl, C. (Eds.), Sternberg's diagnostic surgical pathology, 4th ed. Lippincott Williams & Wilkins, Philadelphia, PA, pp. 1173–1222. Suter, C.M., Norrie, M., Ku, S.L., et al., 2003. CpG island methylation is a common finding in colorectal cancer cell lines. Br. J. Cancer 88 (3), 413–419. Tanaka, R., Wang, D., Morishita, Y., et al., 2005. Loss of function of p16 gene and prognosis of pulmonary adenocarcinoma. Cancer 103 (3), 608–615. Thun, A.J., Lally, C.A., Flannery, J.T., et al., 1997. Cigarette smoking and changes in the histopathology of lung cancer. J. Natl Cancer Inst. 89, 1580–1586. Toyooka, S., Suzuki, M., Maruyama, R., et al., 2004. The relationship between aberrant methylation and survival in non-small-cell lung cancers. Br. J. Cancer 91 (4), 771–774. Wang, D., Minami, Y., Shu, Y., et al., 2003. The implication of background anthracosis in the development and progression of pulmonary adenocarcinoma. Cancer Sci. 94 (8), 707–711.