The influence of dietary β-glucan, PAMP exposure and Aeromonas salmonicida on apoptosis modulation in common carp (Cyprinus carpio)

Fish & Shellfish Immunology 33 (2012) 846e856

Contents lists available at SciVerse ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

The influence of dietary b-glucan, PAMP exposure and Aeromonas salmonicida on apoptosis modulation in common carp (Cyprinus carpio) J.J. Miest a, A. Falco a, N.P.M. Pionnier a, P. Frost b, I. Irnazarow b, G.T. Williams a, D. Hoole a, * a b

School of Life Sciences, Huxley Building, Keele University, ST5 5BG Keele, United Kingdom Polish Academy of Sciences, Institute Ichthyobiology & Aquaculture, Golysz, Poland

a r t i c l e i n f o

a b s t r a c t

Article history: Received 9 March 2012 Received in revised form 9 July 2012 Accepted 27 July 2012 Available online 5 August 2012

The association between b-glucan (MacroGardÒ) supplemented feed and apoptosis in immune-related organs of common carp (Cyprinus carpio) was studied using fluorescence microscopy and real-time PCR. In addition the effect of Aeromonas salmonicida, LPS and Poly(I:C) injections on this relationship was evaluated. Whilst acridine orange staining revealed that apoptosis levels were independent of MacroGardÒ and LPS/Poly(I:C) administration or their combination, it was shown that injection with A. salmonicida increased the percentage of apoptotic cells irrespective of the feeding regime. It was apparent that in all the treatments gene expression profiles displayed organ and time dependency. For example no effect was observed at 7 days of MacroGardÒ administration while 25 days of feeding led to increased iNOS expression and differential up-regulation of anti- or pro-apoptotic genes depending on organ. This may indicate differences in NO sensitivity. MacroGardÒ also led to an elevation of pro- as well as anti-apoptotic genes in LPS or Poly(I:C) injected fish, while LPS/Poly(I:C) alone had little effect. A. salmonicida caused enhanced iNOS expression and it is possible that the type of apoptosis pathway induced is organ dependent as Caspase 9 is induced in mid-gut but not in pronephros. These results indicate that MacroGardÒ feeding alone or in combination with other pathogenic factors did not induce significant apoptosis in immune organs. Ó 2012 Elsevier Ltd. All rights reserved.

Keywords: Apoptosis Beta-glucan PAMPs Aeromonas salmonicida Carp

1. Introduction Disease outbreak leads to major economic losses and a significant restriction of economic growth in the aquaculture industry [1]. Prevention rather than disease treatment is therefore of high priority and has led to several studies on how the acquired and innate immune response can be evoked to improve fish health. Polysaccharides, such as b-glucan, from fungi, bacteria, or plants, are widely used as immunostimulants in fish diets. These substances are preferred to other methods of treatment such as antibiotics because, as they occur naturally in the environment, they are less likely to raise concern about residues in food fish and have a reduced impact on the environment [2].

* Corresponding author. Tel.: þ44 0 1782 733673; fax: þ44 0 1782 733516. E-mail addresses: [email protected] (J.J. Miest), alberto.falcogracia@ wur.nl (A. Falco), [email protected] (N.P.M. Pionnier), pbf_23@ hotmail.com (P. Frost), [email protected] (I. Irnazarow), g.t.williams@ biol.keele.ac.uk (G.T. Williams), [email protected], [email protected] (D. Hoole). 1050-4648/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsi.2012.07.014

In aquaculture, b-glucan has been shown to promote disease resistance [3e6] and to enhance the immune response in various fish species such as common carp (Cyprinus carpio), sea bass (Dicentrarchus labrax), and rainbow trout (Oncorhynchus mykiss) [7]. However the beneficial effects of b-glucan that have been reported by several authors [5,8e11] appear to be strongly dependent on dose, duration of treatment and route of administration. In some circumstances a low dose of b-glucan, e.g. 0.1% in the diet, causes positive, stress-reducing effects while a high dosage such as 1% can be detrimental [12]. These adverse effects can lead to a suppressed immune response during and after the stress experience, and may render the animals more susceptible to an infection. In sea bass, oral administration of b-glucan affects the respiratory burst activity of macrophages [13]. This production of reactive oxygen species has been associated with cell death in other studies [14e16] and could therefore lead to apoptosis in fish treated with b-glucan. For example, a reduction in cell viability has been noted in vitro in lobster granulocytes exposed to a low dose of b-glucan (0.005e0.025% in the form of MacroGardÒ) [17], and cell death induced by apoptosis has also been observed in human and murine cancer cells [18,19] and murine lymphocytes [20] exposed to this polysaccharide.

J.J. Miest et al. / Fish & Shellfish Immunology 33 (2012) 846e856

Various pathogens have also been associated with apoptosis, either caused by the host during the immune response or by the pathogen itself to ensure its survival and propagation [21]. Due to this known influence of b-glucan on production of oxygen radicals (ROS and NO) and the immune response we hypothesise that immunomodulation will influence the apoptosis process. We also hypothesise that this will be mainly executed via the intrinsic apoptosis pathway since ROS and NO can cause cell damage. Apoptosis is manifested in morphological and genetic alterations involved in the “suicide” program of cell death. Morphological changes include cell shrinkage, and nucleus fragmentation as well as membrane blebbing. Genes involved in apoptosis can be divided into anti-apoptotic (apoptosis inhibiting) and proapoptotic genes, which mediate their effects through two main pathways: the intrinsic pathway induced by DNA damage and cellular stress, and the extrinsic pathway initiated by external signals such as cytokines and bacterial toxins. Apoptosis research in fish has received attention in the last decade mainly because of the possibility to use zebrafish as model for mammalian apoptosis. Most of the pathways associated with apoptosis seem to be conserved throughout the animal kingdom but only few have been experimentally confirmed in fish [22,23]. In this communication we utilise this high conservation between pathways and will draw upon knowledge available on these pathways in the teleost and the mammalian system. The genes investigated in the presented study were chosen to aid the elucidation of the hypothesis that immunomodulation can lead to intrinsic apoptosis via NO synthesis (i.e. iNOS gene). The functions of the used apoptosis-related genes in carp have been previously characterised in our group [24e26]. In addition we chose two members of signalling pathways that are known to be involved in apoptosis and b-glucan signalling in mammals (i.e. p38, Nemo). This study concentrates on the gene expression in those organs which are related to the oral delivery of an immunomodulator and the immune response (i.e. mid-gut, spleen, pronephros and liver). We report here for the first time the association between b-glucan and apoptosis in the immune cells of a fish, C. carpio, and evaluate how this association is affected by exposure to a bacterial pathogen, Aeromonas salmonicida, and the pathogen associated patterns (PAMPs) LPS and Poly(I:C). In addition this publication contributes to the advancement of knowledge about apoptosis in the aquaculture model C. carpio. 2. Materials & methods 2.1. Effects of MacroGardÒ feeding Common carp with an average weight of 40 g were supplied by Fair Fisheries, UK and kept in individual tanks with circulated water at 16  C at Keele University, UK under a 12/12 h light/dark cycle. The fish were divided into two experimental groups, distributed to 4 tanks and fed a MacroGardÒ free control diet for two weeks. Following this acclimatization phase one group of fish was kept on the control diet (1% bodyweight per day) while the other group were fed 1% bodyweight of a 0.1% MacroGardÒ containing feed, which corresponds to 10 mg/kg bodyweight MacroGardÒ per day (recommended dose by commercial supplier Biorigin, Brazil). Both experimental diets were supplied and formulated by Tetra GmbH (Germany) and the exact food composition is described by Falco et al. [27]. Before sampling, animals were killed with a lethal dose of 2-Phenoxyethanol (Sigma Aldrich, UK) and organ samples (liver, mid-gut, pronephros, spleen) of 5 fish per treatment were taken at 7 and 25 days of MacroGardÒ feeding. A small amount of pronephros tissue was used for morphological analysis of apoptosis utilising acridine orange staining. The remaining organs were

847

stored in RNAlater (Invitrogen, UK) at 80  C for analysis of gene expression. 2.2. Injections of LPS and Poly(I:C) LPS (from Escherichia coli 0111:B4) and Poly(I:C) were purchased from Invivogen, UK. After 25 days of feeding (MacroGardÒ or control diet), fish were allocated to three treatment groups within their feeding regime and intraperitoneally injected with 100 ml PBS containing either LPS (4 mg/kg) or Poly(I:C) (5 mg/kg), or just PBS alone. Therefore 6 different treatments were carried out (i.e. control fed þ PBS, control fed þ LPS, control fed þ Poly(I:C), MacroGardÒ fed þ PBS, MacroGardÒ fed þ LPS, MacroGardÒ fed þ Poly(I:C)). Sampling was carried out as described earlier at 1, 3 and 7 days post injection with 4 fish per treatment and time point. Cellular apoptosis levels were analysed on all three sampling days while gene expression was only measured on day 1 and 7. The described feeding regime was continued until sampling. The sampling days thus correspond to day 26 and 32 of the feeding regime; however we defined them as day 1 and 7 post injection in reference to the PAMP exposure. 2.3. A. salmonicida challenge Carp (average weight 78.4 g) of the Ukrainian line [28] were kept in recirculating water at 20  C in the facilities of the Polish Academy of Sciences, Golyz. All experimental fish were fed control feed (0% MacroGardÒ) for a 3 week acclimatization phase. Fish were then divided into two groups and subjected to two week feeding regime, conducted as described above (0% and 0.1% MacroGardÒ feed). A non-virulent A. salmonicida strain (Polish strain A449) [29] was chosen for the injection to ensure survival of the fish over the experimental period. A. salmonicida were grown in lysogeny broth for 18 h at 25  C, concentrated by centrifugation at 1600 g for 10 min, and the bacterial pellet reconstituted in PBS. Bacterial concentration was determined via OD measurement at 540 nm (UV-1601 PC, UVeVisible Spectrophotometer, Shimadzu) and alignment with a McFarland scale. Fish were either exposed to a non-lethal dose of A. salmonicida carried out by intraperitoneal injection (1  108 bacteria/fish in 250 ml PBS) or PBS alone. Hence 4 treatments were carried out: control feed þ PBS, control feed þ A. salmonicida, MacroGardÒ feed þ PBS, MacroGardÒ feed þ A. salmonicida. Feeding was stopped after the A. salmonicida injection and 5 fish were sampled for each treatment at 6, 12, 24, 72 and 120 h post exposure to the bacteria. Fish were killed with a lethal dose of 0.2% Prospicin (2% etomidate, produced by Inland Fisheries Institute, Poland) [30] and pronephros and mid-gut samples were removed, and processed for microscopical as well as gene expression analysis. 2.4. Apoptosis analysis via acridine orange staining A pronephric cell suspension was prepared as described by Verburg-van Kemenade et al. (1994) [31] with slight modifications. In brief, the organ was removed and a small part disrupted through a 100 mm cell strainer (BD Falcon) with modified RPMI1640 (Medium with 0.3 g/L L-glutamine (Sigma Aldrich, UK) with 0.5% sterile water, 0.05% pooled non-heat inactivated carp serum, 0.05 mM b-mercaptoethanol (Sigma Aldrich, UL), penicillin (50 U/ml) and streptomycin (50 mg/ml) (Sigma Aldrich, UK)). The resulting cell suspension was mixed 1:1 with 10 mg/ml acridine orange dissolved in sterile water (Sigma Aldrich, UK) and analysed with a UV microscope (Nikon Eclipse E400) either with a FITC e Rhodamin filter or a B-2a filter. Apoptosis was determined by

848

J.J. Miest et al. / Fish & Shellfish Immunology 33 (2012) 846e856

noting the number of cells with nuclear fragmentation in a population of 200 cells. 2.5. Gene expression by real time RT-PCR 2.5.1. RNA extraction RNA was extracted from pronephros, mid-gut, spleen and liver using the RNeasy Mini Kit (Qiagen, UK) following the manufacturer’s instructions. The RNA concentration was determined by nanodrop 1000 (Thermo Scientific, UK) and normalised to a common concentration with DEPC treated water (Invitrogen, UK) before proceeding with cDNA synthesis. 2.5.2. cDNA synthesis 0.5 mg RNA were added to 4 ml 25 mM MgCl2, 2 ml 10 PCR Buffer II, 1 ml 10 mM dNTPs, 0.5 ml 50 mM random hexamers, 0.5 ml 40 U/ml and 0.5 ml of 50 U/ml MuLV reverse transcriptase (all Invitrogen, UK). The samples were adjusted to 20 ml with DEPC-treated water and incubated at 25  C for 10 min followed by 30 min at 42  C. Reactions were inactivated by incubation at 95  C for 5 min. Samples were diluted 1:10 with DEPC treated water and stored at 20  C. 2.5.3. Real time RT-PCR Primers specific for carp iNOS, Apaf-1, IAP, p53, p38, Mcl-1b, Caspase 9, Nemo and Bcl-2 were used (Table 1). The ribosomal 40S gene served as reference gene for the analysis [32]. For the RTPCR 2 ml of cDNA (corresponding to 5 ng of RNA) were added to 10 ml of 2 Power SYBRÒ Green Master Mix (Applied Biosystems), 1.8 ml of 10 mM forward and reverse primer each and adjusted to 20 ml with DEPC treated water. RT-PCR was carried out in an ABI 7000 real-time cycler (Applied Biosystems) with 2 min at 50  C, 10 min at 95  C and 40 cycles of 15 s at 95  C and 1 min at 60  C. After each run melting curves of PCR products were obtained between 60 and 90  C with 1  C intervals. Analysis of gene expression was carried out according to the 2DDCt method [33] target genes were normalised against the reference gene 40S, and x-fold change calculated in relation to the control group of each time point. 2.6. Statistical analysis All data are presented as mean  SEM. Statistical data analysis was carried out using GraphPad Prism 5 and SPSS 19 (IBM). Data

were tested for normality and equal distribution of variances. Gene expression data were normalised using log-transformation while percentage data (apoptosis level) were arc-sin transformed prior to analysis. Two-way ANOVA were performed to test for significant differences between time points and treatments with subsequent Bonferroni post-hoc analysis. Significance was defined as p  0.05. 3. Results 3.1. Effect of dietary MacroGardÒ Oral administration of MacroGardÒ over a period of 25 days had no effect on apoptosis levels in pronephric cells as established by acridine orange staining (Fig. 1). However MacroGardÒ feeding affected the expression of genes associated with the apoptotic process, although this was dependent on the organ analysed (Fig. 2). MacroGardÒ feeding had least effect on the liver and pronephros, whereas in the spleen and mid-gut, feeding the polysaccharide supplemented diet affected expression of pro- and antiapoptotic genes (F ¼ 4e11, p  0.05). Additionally the duration of the experiment influenced apoptotic gene expression mainly in spleen and mid-gut (expression values higher on day 25 compared to day 7) (F ¼ 7e11, p  0.05) but not in pronephros and liver. Oral administration of MacroGardÒ (Figs. 2 and 3) for 7 days did not affect the expression of apoptotic genes although an up-regulation of iNOS in liver was noted (p  0.01). This gene was also induced after 25 days of feeding in all the studied organs (p  0.01). At this time point up-regulation of the anti-apoptotic gene Bcl-2 occurred in all organs (p  0.01) except the liver while the pro-apoptotic gene Caspase 9 was only induced in spleen (p  0.01). 3.2. Influence of PAMPs Carp that had been fed with either control feed or a MacroGardÒ supplemented diet for 25 days had a differential response to the injection with PBS, LPS or Poly(I:C). The morphological analysis of pronephric cells showed no significant difference between these treatments but the duration of experimentation influenced the apoptosis level in the Poly(I:C) injected fish (F ¼ 5.6, p ¼ 0.008) where the greatest apoptotic levels were noted on day 3 postinjection. However, since the percentage of apoptotic cells was around 0.5e1% it can be concluded that apoptosis levels were not elevated from expected baseline apoptosis (Fig. 1).

Table 1 Primers utilised for gene expression analysis by for the real-time PCR. Gene name and Genbank ID/reference

Primer type

Sequence (50 / 30 )

Gene function

40S

AB012087/[32] [24]

Caspase 9

EC394517.1

Apaf-1

EU490407

Bcl-2

EU490408/[24]

IAP

[24]

Mcl-1b

CA967090.2

p38

AB023481

Nemo

JQ639082/M. Adamek personal communication

iNOS

AJ242906

CCGTGGGTGACATCGTTACA TCAGGACATTGAACCTCACTGTCT CCAAACGCAGCATGACTAAAGA CGTGCTCAGTTTGGCCTTCT CGAGAGGGAGTCAGGCTTTC TCAGAAGGGATTGGCAGAGG CGCTCACAGGTCACACTAGAACTG AGATACTCACCGGTCCTCCACTT TGTCCCACCAGATGACATTCAG TCCCACCAAACTCAAAGAAAGG CGTGGAGTGGAGGATATGTCTCA TCCTGTTCCCGACGCATACT TGGAGCAGAAAGGAGAAGATGTG GCATACCATTGCCCCAAATG CGGCTGACTGATGATGAAATGA GCATCCAGTTGAGCATGATCTCT CGCTGAAGAACGAGAGG CTCCTGTGATTGGCTTG TGGTCTCGGGTCTCGAATGT CAGCGCTGCAAACCTATCATC

Housekeeping gene

p53

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

Pro-apoptotic Intrinsic pathway Pro-apoptotic Intrinsic pathway Pro-apoptotic Intrinsic pathway Anti-apoptotic Intrinsic pathway Anti-apoptotic Intrinsic pathway Anti-apoptotic Intrinsic pathway MKK signalling p53 activation NF-kB signalling NO production Intrinsic pathway

J.J. Miest et al. / Fish & Shellfish Immunology 33 (2012) 846e856

849

Fig. 1. Percentage of apoptotic cells in the analysed pronephric cell population. Apoptosis was defined as cells with fragmented nucleus as detected by acridine orange staining. a) MacroGardÒ feeding B ¼ control feed, : ¼ MacroGardÒ feed. All other graphs: white bar ¼ control feed þ PBS injection, black bar ¼ MacroGardÒ feed þ PBS injection, white with stripes ¼ control feed þ respective injection, black with stripes ¼ MacroGardÒ feed þ respective injection. b) MacroGardÒ feeding and LPS injection, c) MacroGardÒ feeding and Poly(I:C) injection, d) MacroGardÒ feed and A. salmonicida injection. Graphs show mean  SEM. a & d: n ¼ 5, b & c: n ¼ 4. *: p  0.05, **: p  0.01, ***: p  0.001.

Fig. 2. Gene expression during 25 days MacroGardÒ feeding. Carp were fed with 0.1% MacroGardÒ supplemented feed and organ samples were taken at 7 (white bars) and 25 (black bars) days of feeding. The figures display the x-fold gene expression to the control (¼1, not shown). The bars represent mean  SEM of n ¼ 3. Significance is defines as p  0.05. Asterisks represent levels of significance: *: p  0.05, **: p  0.01, ***: p  0.001.

850

J.J. Miest et al. / Fish & Shellfish Immunology 33 (2012) 846e856

Fig. 3. Gene expression during LPS exposure. Carp were fed for 25 days with control or MacroGardÒ supplemented feed prior to i.p. injection with LPS. Sampling occurred 1 and 7 days post injection. The bars represent mean  SEM of n ¼ 4 and are defined as follows: white: control feed/PBS injection, black: MacroGardÒ feed/PBS injection, white with stripes: control feed/LPS injection, black with stripes: MacroGardÒ feed/LPS injection. Statistical significance is defined as p  0.05. Asterisks symbolise level of significance: *: p  0.05, **: p  0.01, ***: p  0.001.

3.2.1. Handling effects in MacroGardÒ fed fish In the PBS-injected control group the mid-gut and pronephros were similarly affected by the feeding of MacroGardÒ (Fig. 4), which caused an increase in gene expression of pro- as well as antiapoptotic genes (e.g. IAP and Apaf-1) 7 days after the PBS injection (p ¼ 0.05e0.001). In contrast, in the spleen down-regulation of iNOS (p  0.01) and IAP (p  0.05), and up-regulation of Apaf-1 (p  0.01) occurred at 1 and 7 days post-injection respectively. The reduction in iNOS gene expression 1 day post injection was also observed in mid-gut (p  0.01) whilst in liver a significant 13-fold increase (p  0.05) was noted at the same time. The major effects of MacroGardÒ feeding appeared to occur in liver where expressions of the anti-apoptotic genes Bcl-2 (p  0.05) and IAP (p  0.001) were about 9 times higher than in the control.

3.2.2. LPS effects In the LPS study (Fig. 3) mainly pro-apoptotic genes were influenced by the feeding and injection treatments (F ¼ 3e32, p  0.05) in all organs. However, although the experimental duration influenced the expression of all tested genes (F ¼ 6e32, p  0.05), the response was dependent on the organ examined. For example, it was found that spleen and pronephros were most affected by the treatments, while gene expression in the spleen was least influenced by the experimental duration. In fish fed control diet and injected with LPS there was little discernible effect on genes involved in apoptosis in most organs examined with the only significant effects being observed in liver (iNOS, IAP, p38). In contrast, LPS injection in the MacroGardÒ fed fish induced gene expression of mainly pro-apoptotic genes (e.g. Caspase 9, Apaf-1)

J.J. Miest et al. / Fish & Shellfish Immunology 33 (2012) 846e856

851

Fig. 4. Gene expression during Poly(I:C) exposure. Carp were fed for 25 days with control or MacroGardÒ supplemented feed prior to i.p. injection with Poly(I:C). Sampling occurred 1 and 7 days post injection. The bars represent mean  SEM of n ¼ 4 and are defined as follows: white: control feed/PBS injection, black: MacroGardÒ feed/PBS injection, white with stripes: control feed/Poly(I:C) injection, black with stripes: MacroGardÒ feed/Poly(I:C) injection. Statistical significance is defined as p  0.05. Asterisks symbolise level of significance *: p  0.05, **: p  0.01, ***: p  0.001.

and IAP in pronephros (p  0.05). This stands in stark contrast to mid-gut, liver and spleen where expression of those genes involved in apoptosis was apparently not significantly affected. When the two LPS treatments were compared a clear influence of MacroGardÒ feeding on the LPS effect was observed in pronephros. MacroGardÒ caused higher mRNA levels for Caspase 9 (Day 1) (p  0.001) and Apaf-1 (Day 1 and 7) (p  0.01) in fish that were injected with LPS compared to the LPS injected control fed group. 3.2.3. Poly(I:C) effects In the study involving Poly(I:C) injection and MacroGardÒ feeding (Fig. 4) the pro- and anti-apoptotic genes in the mid-gut were most influenced by the treatments (F ¼ 3e16, p  0.05), experimental duration (F ¼ 18e50, p  0.0002) and the interaction between these two parameters (F ¼ 3e10, p  0.05). In contrast,

only the expression of pro-apoptotic genes (i.e. iNOS, Apaf-1, p53 and p38) was significantly (F ¼ 5e10, p  0.001) affected in the spleen. In the mid-gut of the control fed group the injection of Poly(I:C) reduced IAP (p  0.05) and iNOS (p  0.01) expression by about 50% compared to the PBS injected control at day 1 and day 7 p.i. respectively. iNOS expression was however not influenced in any other organ whereas the IAP gene was up-regulated in liver (p  0.01). While Poly(I:C) did not influence gene expression in pronephros it did cause an increase in Caspase 9 mRNA levels and reduced Bcl-2 expression on day 1 p.i. in the spleen (p  0.05). In the MacroGardÒ fed fish the injection of Poly(I:C) affected the expression of some genes in pronephros and mid-gut. For example, iNOS expression was up-regulated in pronephros on day 7 (p  0.01) and, whilst the liver was not affected by the treatment,

852

J.J. Miest et al. / Fish & Shellfish Immunology 33 (2012) 846e856

the mid-gut experienced a significant (p  0.05) enhancement of the IAP and Caspase 9 genes on day 1 (p  0.05). The major influences were seen when the two injection groups were compared. MacroGardÒ feeding therefore influenced the expression of pro- as well as anti-apoptotic genes in all organs. As mentioned earlier, iNOS expression is increased in the Poly(I:C) injected fish due to MacroGardÒ feeding in pronephros (p  0.01) but also in liver (p  0.05). Anti-apoptotic genes are up-regulated in mid-gut (IAP, p  0.01) and liver (IAP & Bcl-2, p  0.05) whilst pro-apoptotic genes (Caspase 9, Apaf-1, p53) are not influenced in spleen and liver but their gene expression was increased in pronephros and mid-gut (p  0.05). 3.3. A. salmonicida effects In carp which were fed MacroGardÒ supplemented diets for 14 days prior to an injection of A. salmonicida the level of apoptosis in the pronephric cells was elevated on exposure to the injection (F ¼ 13.7, p ¼ 0.0001) and peaked at day 1 post injection (F ¼ 2.3, p ¼ 0.04). Post-hoc analysis established that the feeding of MacroGardÒ had no effect on apoptosis levels, however the injection of A. salmonicida induced a rise in the number of apoptotic cells when compared to the control (p  0.05) (Fig. 1). Samples that were taken prior to the injection (time 0) to establish the effects of MacroGardÒ feeding, revealed that after 14 days there was no significant effect on the expression of those genes analysed except for a down-regulation of p53 and IAP in midgut (Fig. 5). In the presented study we only display the time points that revealed statistical differences and the full data set is available in the supplementary material. In the pronephros (Fig. 6) the expression of all the genes analysed was influenced by the applied treatment (F ¼ 2e13, p  0.05) while the time course of the experiment also affected all genes with the exception of the antiapoptotic genes IAP and Bcl-2 (F ¼ 3e8, p  0.01). This was most noticeable at 6 h p.i. In mid-gut the treatments only affected iNOS and IAP expression (F ¼ 3, p  0.05), while experimental duration altered the expression of all genes analysed with the exception of Apaf-1 (F ¼ 2e11, p  0.05). Post-hoc analysis revealed that in pronephros all detected effects on gene expression occurred at 6 h p.i. (Fig. 6). This is in contrast to mid-gut, where the main effects were noted 24 h p.i. In the PBS injected group dietary MacroGardÒ did not have any significant effect on genes analysed in mid-gut and in pronephros

Fig. 5. Gene expression after 14 days of MacroGardÒ feeding carp were fed for 14 days with MacroGardÒ and gene expression was analysed in pronephros (white bars) and gut (black bars). The bars display the x-fold gene expression relative to the control (not shown) and represent mean  SEM of n ¼ 5. Statistical significance is defined as p  0.05 and asterisks symbolise level of significance *: p  0.05, **: p  0.01.

with the exception of Apaf-1 which was reduced by about 50% (p  0.05). A. salmonicida injection in the control diet fed fish caused a striking (approximately 15-fold) enhancement of iNOS expression in pronephros (p  0.001) and mid-gut (p  0.05) 6 h after the infection. At 24 h p.i. Mcl-1b was up-regulated (p  0.05) whilst p38 (p  0.001) was down-regulated in mid-gut. In fish that had been fed with MacroGardÒ prior to the injection there was a greater influence on gene expression in the pronephros than in mid-gut. In pronephros A. salmonicida injection in combination with MacroGardÒ feeding enhanced gene expression of iNOS and anti- as well as pro-apoptotic genes (p  0.05). In mid-gut and pronephros there was a significant difference between the two injection groups i.e. fed control diet or MacroGardÒ. In the pronephros MacroGardÒ caused an enhancement of expression of the gene encoding p38 while in mid-gut an up-regulation of the p53 gene was observed. 4. Discussion Although previous studies [18,19] have shown that b-glucan induces apoptosis in a range of mammalian cells, and that several pathogens can increase apoptotic levels in lower vertebrates [21], our studies have highlighted, for the first time, the complexity of the interaction between this immunostimulant, bacterial and viral PAMPs and bacterial pathogens. The effects of both MacroGardÒ and pathogen are dependent on organ, dose, diet treatment regime and time period. 4.1. MacroGardÒ and apoptosis When carp were fed with the recommended dose of MacroGardÒ no significant effect on the apoptosis process was detected in the analysed organs after 7 and 14 days. However after feeding the glucan supplemented diet for 25 days higher mRNA levels of antiapoptotic genes were observed in mid-gut and pronephros in combination with enhanced iNOS gene expression. The latter is in agreement with the finding that long-term exposure to b-glucan leads to the production of oxygen radicals in rainbow trout [34], which is apparently associated with anti-apoptotic properties in pronephros and mid-gut. Even though the levels of nitric oxide produced were not ascertained it is known that NO at low levels is anti-apoptotic [35]. Since no elevated apoptosis levels were observed in the pronephros throughout the MacroGardÒ feeding period and because anti-apoptotic gene levels were increased it is possible that NO levels were not high enough to induce apoptosis. In contrast, in the spleen the expression of pro-apoptotic genes was enhanced in addition to anti-apoptotic genes. This enhancement might also be associated with the observed up-regulation of iNOS gene expression as it has been shown that NO, which was not determined in this study, can also act as a pro-apoptotic agent [35]. The differential apoptotic effects of MacroGardÒ on the pronephros and spleen might be related to the higher sensitivity of splenic leucocytes to NO toxicity in comparison to pronephric leucocytes [36,37]. As the increase in pro-apoptotic genes was only noted on day 25 it is possible that long-term feeding of b-glucan might be associated with increased levels of this form of cell death. This would explain the reduction in immunostimulating effects noted by some authors after long-term feeding b-glucan [8,38] and would support the use of pulse feeding [39]. The up-regulation of NF-kB essential modulator (Nemo) suggests the involvement of the NF-kB pathway in the b-glucan signalling pathway in common carp, similar to that occurring in mammals [40]. However, our studies reveal that the induction of this pathway may be time and organ dependent.

J.J. Miest et al. / Fish & Shellfish Immunology 33 (2012) 846e856

853

Fig. 6. Gene expression after A. salmonicida injection. Carp were fed with control or MacroGardÒ supplemented diet for 14 days prior to an injection with A. salmonicida. This figure only shows the time points where significant effects occurred (i.e. 6 h of pronephros and 6, 12 and 72 h for mid-gut); the full data set is available as supplementary data. The bars show the x-fold gene expression relative to the PBS injected control (white bar). The other bars are defined as follows: black: MacroGardÒ fed/PBS injection, white with stripes: control fed/A. salmonicida injected, black with stripes: MacroGardÒ fed/A. salmonicida injected. The bars represent mean  SEM of n ¼ 5 and significance is defined as p  0.05. Asterisks symbolise level of significance *: p  0.05, **: p  0.01, ***: p  0.001.

4.2. MacroGardÒ effects on LPS and Poly(I:C) induced gene expression In investigations to study the effect of MacroGardÒ feeding on apoptosis associated with bacterial and viral PAMPs, the expression of both pro- and anti-apoptotic genes was influenced in the MacroGardÒ fed PBS injected control group. This apparent contradiction is perhaps explained by the fact that the stress-induced glucocorticoid cortisol is known as an apoptosis-inducer [41] and therefore higher cortisol levels, possibly induced by the handling, could affect the levels of apoptosis within the organs examined. However, b-glucan feeding can reduce negative stress effects by decreasing cortisol levels in trout [12]. This positive aspect of b-glucan feeding is supported by the observed reduction of iNOS expression in mid-gut and spleen and could indicate a possible anti-inflammatory effect in response to b-glucan exposure [27]. Such an iNOS down-regulation has also been observed in LPS stimulated murine macrophages that had been previously treated with b-glucan [42]. Lipopolysaccharide (LPS), also known as endotoxin, is a membrane component of gram-negative bacteria, which has been associated with septic shock in mammals. In contrast, lower vertebrates appear to be more resistant to endotoxin, and in fish, LPS has been associated with a range of immune responses, for example the production of cytokines, activation of the respiratory burst and enhancement of phagocytosis [43]. In vitro studies have also shown that LPS exposure induced NO production and iNOS gene expression in various primary fish cell cultures [44,45]. In our study LPS injection did not significantly induce iNOS up-regulation in the organs examined, which is in line with the finding that feeding 0.1% A. salmonicida LPS to carp juveniles did not affect

cytokine profiles or iNOS expression levels in the mid-gut [46]. This contradiction to LPS induced iNOS in the mammalian model [47,48] is possibly due to the lack of a functional equivalent to the mammalian LPS receptor TLR 4 in fish [49,50]. Interestingly, feeding MacroGardÒ did not cause any further induction of iNOS which suggests that this substance does not intensify LPS cytotoxicity. Indeed, some authors have noted anti-oxidative properties of b-glucan which could be involved in protection against apoptosis [51] and a reduction of iNOS gene expression [42]. Our observation that LPS alone did not cause apoptosis or the up-regulation of pro-apoptotic genes is in contrast to previous studies showing that LPS can induce apoptosis in vivo in the thymus of mice [52], in fish lymphocytes in vitro [53] and fish ovary in vivo [54]. A delineation of the LPS induced apoptosis pathways between mammals and teleost has previously been suggested [53,55]. Whilst in mammals LPS mainly activates the extrinsic pathway, the intrinsic pathway predominates in fish. In this study we demonstrated for the first time the involvement of Bcl-2 in the LPS induced apoptotic process which corroborates the involvement of the intrinsic pathway. The effects of the combined treatment with dietary MacroGardÒ and LPS were mainly observed in the pronephros where an upregulation of pro-apoptotic genes and IAP was detected. This differential effect on organs may be related to the different cellular composition of the organs examined, as has been suggested in mammalian systems [20,56]; however since LPS recognition differs in fish and mammals [49,50] it will need further studies to elucidate the mechanism of this combined b-glucan and LPS effect. It is also important to bear in mind that immune stimulation will increase the proportion of proliferating cells and, over a longer period, will alter the proportions of the cell types present in the

854

J.J. Miest et al. / Fish & Shellfish Immunology 33 (2012) 846e856

mixed populations being analysed. This will, in itself, produce some modulation of the levels of expression of the genes being studied. Poly(I:C) (Polyinosinic:polycytidylic acid) has been used by several workers to mimic the double stranded RNA associated with many viral infections [57]. This PAMP has been shown to induce apoptosis in human Jurkat E T-cells [58] and in a rainbow trout macrophage cell line (RTS11) [59]. In fish genes from the extrinsic pathway as well as from the intrinsic pathway have been shown to be induced as a response to Poly(I:C) exposure [60e62]. Fibroblast and epithelial cell lines seem to be less sensitive to Poly(I:C) induced apoptosis and additional interferon exposure is required to induce cytotoxicity [59,63]. Therefore it would appear that Poly(I:C) induction of apoptosis via the extrinsic and intrinsic pathway is dependent on species and cell type [64]. The anti-apoptotic and the pro-apoptotic effects of Poly(I:C) noted in our study support these previous observations as the gene expression in liver was primarily anti-apoptotic in nature whilst the spleen had a greater sensitivity to apoptosis. The latter is in agreement with the enhancement of Caspase 9 and 3 in spleen of yellow croaker after Poly(I:C) exposure [61,62]. In our studies although Poly(I:C) alones did not affect apoptosis in the mid-gut, Poly(I:C) in combination with MacroGardÒ feeding, it did induce Caspase 9 expression and also higher mRNA levels of IAP, perhaps indicating sensitisation of the mid-gut cells. The effects of Poly(I:C) on the expression of apoptosis-related genes does appear to be time related as the observed effects were only noted 1 day after injection. This is in line with previous studies that showed that Caspase 9 and 3 gene expression is activated within 12 h of Poly(I:C) exposure but declines again at 72 h postexposure [61,62]. Poly(I:C) injection did not affect iNOS gene expression in the majority of the organs analysed, although a reduction was noted in the mid-gut. This is in contrast to previous studies which have shown that Poly(I:C) exposure leads to an increased iNOS gene expression in zebrafish cell lines, rainbow trout pronephric leucocytes, and in zebrafish larvae and adults [65e67]. It is possible that the Poly(I:C) concentration used was not sufficient to induce iNOS expression, or that a possible iNOS expression peak was missed with the chosen sampling points. As in mammals [68e71], LPS and Poly(I:C) induced the NF-kB and the p38 signalling pathways, although this occurred primarily in the MacroGardÒ fed group. These PAMPs and b-glucan therefore might have cumulative effects on these pathways, which, in fish, appear to be time- and organ-dependent. 4.3. A. salmonicida injection causes apoptosis and changes in gene expression A. salmonicida, a motile gram-negative bacterium, is the causative agent of furunculosis in salmonids and other freshwater fish [72]. The bacterium and virulence factors of aeromonads have been noted to induce apoptosis in vitro utilising various cell types e.g. human intestinal epithelial cells [73], murine macrophages [74], and fish lymphocytes [75]. However, in vivo studies on apoptosis involving the viable bacterium are rare, although several workers [76] have highlighted the importance of such investigations in relationship to the pathology induced by the infection. Reports have shown that b-glucan enhances protection against aeromonad infections in tench (Tinca tinca) [77], zebrafish (Danio rerio) [5], chinook salmon (Oncorhynchus tshawytscha) [78], rohu (Labeo rohita) [8], and common carp [79,80]. In our study we have shown, for the first time, that a non-lethal injection of A. salmonicida affects apoptosis in carp and that b-glucan affects this process. The A. salmonicida injection led to morphological changes in the pronephros associated with apoptosis during the first 24 h. The lack of enhanced apoptosis-related gene expression is consistent with

the generally post-transcriptional nature of the mechanisms controlling apoptosis in the short term [81], and might also mean that the induction of apoptosis by this bacterium is via the extrinsic pathway as the genes analysed are primarily involved in the intrinsic pathway. Indeed, Galindo et al. [73] reported that Aeromonas hydrophila enterotoxin can induce apoptosis via the extrinsic and the intrinsic pathway. The association between A. salmonicida and the intrinsic and extrinsic pathways of apoptosis appears to be affected by the feeding of MacroGardÒ as Caspase 9 gene expression was not induced in the MacroGardÒ fed and injected fish. This could be associated with the previously noted anti-inflammatory effects of MacroGardÒ [27]. In summary, we have established for the first time that MacroGardÒ either on its own or in combination with PAMPs or bacterial injection does not cause apoptosis in immune related organs when administered orally at a concentration of 0.1%. We have also shown that A. salmonicida injection induces apoptosis in fish independent of the feeding regime and that iNOS mRNA levels were substantially elevated in response to the bacterial challenge. Acknowledgements We would like to thank the technicians/hatchery staff at the Ichthyobiology & Aquaculture in Go1ysz and Keele University. For assistance with statistical analysis we want to thank Dr. Anthony Polwart and Dr. Daniel Bray. We are indebted to Dr Alicija Kozinska from Veterinary Institute in Pulawy (Poland) for supplying the Aeromonas salmonicida. For the formulation and provision of the experimental feed we thank Dr. Gerd Grobheider and Tetra GmbH and we are grateful to Dr. Rolf Nordmø and Biorigin for providing us with MacroGardÒ. The research leading to these results has received funding from the European Community’s Seventh Framework Programme ([FP7/2007-2013] under grant agreement n PITN-GA-2008-214505). References [1] FAO. The state of world fisheries and aquaculture. Rome; 2010. p. 197. [2] Gannam AL, Schrock RM. Immunostimulants in fish diets. In: Lim C, Webster CD, editors. Nutrition and fish health. Food Products Press; 2001. p. 235e66. [3] Lauridsen JH, Buchmann K. Effects of short- and long-term glucan feeding of rainbow trout (Salmonidae) in the susceptibility of Ichthyophthirius multifiliis infection. Acta Ichthyol Piscat 2010;40:61e6. [4] Gopalakannan A, Arul V. Enhancement of the innate immune system and disease-resistant activity in Cyprinus carpio by oral administration of b-glucan and whole cell yeast. Aquaculture Research 2010;41:884e92. [5] Rodriguez I, Chamorro R, Novoa B, Figueras A. b-Glucan administration enhances disease resistance and some innate immune responses in zebrafish (Danio rerio). Fish & Shellfish Immunology 2009;27:369e73. [6] Siwicki AK, Anderson DP, Rumsey GL. Dietary intake of immunostimulants by rainbow trout affects non-specific immunity and protection against furunculosis. Veterinary Immunology and Immunopathology 1994;41:125e39. [7] Dalmo Ra, Bøgwald J. b-glucans as conductors of immune symphonies. Fish & Shellfish Immunology 2008;25:384e96. [8] Misra C, Das B, Mukherjee S, Pattnaik P. Effect of long term administration of dietary b-glucan on immunity, growth and survival of Labeo rohita fingerlings. Aquaculture 2006;255:82e94. [9] Couso N, Castro R, Magariños B, Obach A, Lamas J. Effect of oral administration of glucans on the resistance of gilthead seabream to pasteurellosis. Aquaculture 2003;219:99e109. [10] Guselle NJ, Markham RJF, Speare DJ. Intraperitoneal administration of b-1,3/ 1,6-glucan to rainbow trout, Oncorhynchus mykiss (Walbaum), protects against Loma salmonae. Journal of Fish Diseases 2006;29:375e81. [11] Guselle NJ, Markham RJF, Speare DJ. Timing of intraperitoneal administration of b-1,3/1,6 glucan to rainbow trout, Oncorhynchus mykiss (Walbaum), affects protection against the microsporidian Loma salmonae. Journal of Fish Diseases 2007;30:111e6. [12] Jeney G, Galeotti M, Volpatti D, Jeney Z, Anderson DP. Prevention of stress in rainbow trout (Oncorhynchus mykiss) fed diets containing different doses of glucan. Aquaculture 1997;154:1e15. [13] Bonaldo A, Thompson KD, Manfrin A, Adams A, Murano E, Mordenti AL, et al. The influence of dietary b-glucans on the adaptive and innate immune

J.J. Miest et al. / Fish & Shellfish Immunology 33 (2012) 846e856

[14]

[15] [16] [17]

[18]

[19]

[20]

[21]

[22] [23] [24]

[25]

[26]

[27]

[28] [29]

[30] [31]

[32]

[33] [34]

[35]

[36]

[37]

[38]

[39] [40] [41]

[42]

responses of European sea bass (Dicentrarchus labrax) vaccinated against vibriosis. Italian Journal of Animal Sciences 2007;6:151e64. Forman HJ, Torres M. Reactive oxygen species and cell signaling: respiratory burst in macrophage signaling. American Journal of Respiratory and Critical Care Medicine 2002;166:S4e8. Park JB. Phagocytosis induces superoxide formation and apoptosis in macrophages. Experimental and Molecular Medicine 2003;35:325e35. Simon HU, Haj-Yehia A, Levi-Schaffer F. Role of reactive oxygen species (ROS) in apoptosis induction. Apoptosis 2000;5:415e8. Hauton C, Smith VJ. In vitro cytotoxicity of crustacean immunostimulants for lobster (Homarus gammarus) granulocytes demonstrated using the neutral red uptake assay. Fish & Shellfish Immunology 2004;17:65e73. Kim MJ, Hong SY, Kim SK, Cheong C, Park HJ, Chun HK, et al. b-glucan enhanced apoptosis in human colon cancer cells SNU-C4. Nutrition Research and Practice 2009;3:180e4. Kobayashi H, Yoshida R, Kanada Y, Fukuda Y, Yagyu T, Inagaki K, et al. Suppressing effects of daily oral supplementation of beta-glucan extracted from Agaricus blazei Murill on spontaneous and peritoneal disseminated metastasis in mouse model. Journal of Cancer Research and Clinical Oncology 2005;131: 527e38. Soltys J, Quinn MT. Modulation of endotoxin- and enterotoxin-induced cytokine release by in vivo treatment with b-(1,6)-branched b-(1,3)-glucan. Infection and Immunity 1999;67:244e52. Hoole D, Williams GT. The role of apoptosis in non-mammalian host-parasite relationships. In: Wiegertjes GF, Flik G, editors. Host-parasite interactions. Garland Science/BIOS Scientific Publishers; 2004. p. 13e44. Krumschnabel G, Podrabsky JE. Fish as model systems for the study of vertebrate apoptosis. Apoptosis 2009;14:1e21. Eimon PM, Ashkenazi A. The zebrafish as a model organism for the study of apoptosis. Apoptosis 2010;15:331e49. Cols Vidal M. Cellular and molecular analysis on apoptosis in the immune cells of common carp (Cyprinus Carpio L.). Doctoral dissertation. Keele University; 2006. Cols Vidal M, Hoole D, Williams GT. Characterisation of cDNAs of key genes involved in apoptosis in common carp (Cyprinus carpio L.). Fish & Shellfish Immunology 2008;25:494e507. Cols Vidal M, Williams GT, Hoole D. Characterisation of a carp cell line for analysis of apoptosis. Developmental and Comparative Immunology 2009;33: 801e5. Falco A, Frost P, Miest J, Pionnier N, Irnazarow I, Hoole D. Reduced inflammatory response to Aeromonas salmonicida infection in common carp (Cyprinus carpio L.) fed with b-glucan supplements. Fish & Shellfish Immunology 2012;32:1051e7. Bia1owa˛ s H, Irnazarow I, Rakus K, Jurecka P, Pilarczyk A. Carp breeds of Poland. Ministry of Agriculture of the Russian Federation; 2008. Reith M, Singh R, Curtis B, Boyd J, Bouevitch A, Kimball J, et al. The genome of Aeromonas salmonicida subsp. salmonicida A449: insights into the evolution of a fish pathogen. BMC Genomics 2008;9:427.  K, Siwicki A. Propiscin e a safe new anaesthetic for fish. Archives of Kazun Polish Fisheries 2001;9:36e43. Verburg-van Kemenade B, Groeneveld A, van Rens B, Rombout J. Characterization of macrophages and neutrophilic granulocytes from the pronephros of carp (Cyprinus carpio). Journal of Experimental Biology 1994; 187:143e58. Huttenhuis HBT, Taverne-Thiele AJ, Grou CPO, Bergsma J, Saeij JPJ, Nakayasu C, et al. Ontogeny of the common carp (Cyprinus carpio L.) innate immune system. Developmental & Comparative Immunology 2006;30:557e74. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2DDCT method. Methods 2001;25:402e8. Jørgensen JB, Sharp GJE, Secombes CJ, Robertsen B. Effect of a yeast-cell-wall glucan on the bactericidal activity of rainbow trout macrophages. Fish & Shellfish Immunology 1993;3:267e77. Dimmeler S, Zeiher AM. Nitric oxide and apoptosis: another paradigm for the double-edged role of nitric oxide. Nitric Oxide-Biology and Chemistry 1997;1: 275e81. Saeij JPJ, Van Muiswinkel WB, Groeneveld A, Wiegertjes GF. Immune modulation by fish kinetoplastid parasites: a role for nitric oxide. Parasitology 2002; 124:77e86. Saeij JPJ, van Muiswinkel WB, van de Meent M, Amaral C, Wiegertjes GF. Different capacities of carp leukocytes to encounter nitric oxide-mediated stress: a role for the intracellular reduced glutathione pool. Developmental & Comparative Immunology 2003;27:555e68. Verlhac V, Gabaudan J, Obach A, Schuep W, Hole R. Influence of dietary glucan and vitamin C on non-specific and specific immune responses of rainbow trout (Oncorhynchus mykiss). Aquaculture 1996;143:123e33. Bricknell I, Dalmo RA. The use of immunostimulants in fish larval aquaculture. Fish & Shellfish Immunology 2005;19:457e72. Blonska M, Lin X. NF-kB signaling pathways regulated by CARMA family of scaffold proteins. Cell Research 2011;21:55e70. Weyts FAA, Verburg-van Kemenade BML, Flik G, Lambert JGD, Wendelaar Bonga SE. Conservation of apoptosis as an immune regulatory mechanism: effects of cortisol and cortisone on carp lymphocytes. Brain, Behavior, and Immunity 1997;11:95e105. Yang JL, Jang JH, Radhakrishnan V, Vjm YH, Song YS. b-glucan suppresses LPSstimulated NO production through the down-regulation of iNOS expression

[43]

[44]

[45]

[46]

[47]

[48]

[49]

[50] [51]

[52]

[53]

[54]

[55]

[56]

[57]

[58]

[59]

[60]

[61]

[62]

[63]

[64]

[65]

855

and NFkB transactivation in RAW 264.7 macrophages. Food Science and Biotechnology 2008;17:106e13. Swain P, Nayak SK, Nanda PK, Dash S. Biological effects of bacterial lipopolysaccharide (endotoxin) in fish: a review. Fish & Shellfish Immunology 2008;25:191e201. Laing KJ, Hardie LJ, Aartsen W, Grabowski PS, Secombes CJ. Expression of an inducible nitric oxide synthase gene in rainbow trout Oncorhynchus mykiss. Developmental & Comparative Immunology 1999;23: 71e85. Saeij JP, Stet RJ, Groeneveld A, Verburg-van Kemenade LB, van Muiswinkel WB, Wiegertjes GF. Molecular and functional characterization of a fish inducibletype nitric oxide synthase. Immunogenetics 2000;51:339e46. Huttenhuis HBT, Ribeiro ASP, Bowden TJ, Van Bavel C, Taverne-Thiele AJ, Rombout JHWM. The effect of oral immuno-stimulation in juvenile carp (Cyprinus carpio L.). Fish & Shellfish Immunology 2006;21:261e71. Zhang C, Walker LM, Hinson JA, Mayeux PR. Oxidant stress in rat liver after lipopolysaccharide administration: effect of inducible nitric-oxide synthase inhibition. Journal of Pharmacology and Experimental Therapeutics 2000;293: 968e72. Hickey MJ, Sihota E, Amrani A, Santamaria P, Zbytnuik LD, Ng ESM, et al. Inducible nitric oxide synthase (iNOS) in endotoxemia: chimeric mice reveal different cellular sources in various tissues. The FASEB Journal 2002;16: 1141e3. Sepulcre MP, Alcaraz-Pérez F, López-Muñoz A, Roca FJ, Meseguer J, Cayuela ML, et al. Evolution of lipopolysaccharide (LPS) recognition and signaling: fish TLR4 does not recognize LPS and negatively regulates NF-kB activation. The Journal of Immunology 2009;182:1836. Novoa B, Bowman TV, Zon L. Figueras a. LPS response and tolerance in the zebrafish (Danio rerio). Fish & Shellfish Immunology 2009;26:326e31. Sener G, Eksioglu-Demiralp E, Çetiner M, Ercan F, Yegen BÇ. b-glucan ameliorates methotrexate-induced oxidative organ injury via its antioxidant and immunomodulatory effects. European Journal of Pharmacology 2006; 542:170e8. Zhang YH, Takahashi K, Jiang GZ, Kawai M, Fukada M, Yokochi T. In vivo induction of apoptosis (programmed cell death) in mouse thymus by administration of lipopolysaccharide. Infection and Immunity 1993;61: 5044e8. Xiang LX, Peng B, Dong WR, Yang ZF, Shao JZ. Lipopolysaccharide induces apoptosis in Carassius auratus lymphocytes, a possible role in pathogenesis of bacterial infection in fish. Developmental & Comparative Immunology 2008; 32:992e1001. MacKenzie S, Montserrat N, Mas M, Acerete L, Tort L, Krasnov A, et al. Bacterial lipopolysaccharide induces apoptosis in the trout ovary. Reproductive Biology and Endocrinology 2006;4. Laing KJ, Holland J, Bonilla S, Cunningham C, Secombes CJ. Cloning and sequencing of caspase 6 in rainbow trout, Oncorhynchus mykiss, and analysis of its expression under conditions known to induce apoptosis. Developmental and Comparative Immunology 2001;25:303e12. Battle J, Ha T, Li C, Beffa VD, Rice P, Kalbfleisch J, et al. Ligand binding to the (1 / 3)-b-D-glucan receptor stimulates NFkB activation, but not apoptosis in U937 cells. Biochemical and Biophysical Research Communications 1998;249: 499e504. Fortier M-E, Kent S, Ashdown H, Poole S, Boksa P, Luheshi GN. The viral mimic, polyinosinic:polycytidylic acid, induces fever in rats via an interleukin-1dependent mechanism. American Journal of Physiology e Regulatory, Integrative and Comparative Physiology 2004;287:R759e66. Kalai M, Van Loo G, Vanden Berghe T, Meeus A, Burm W, Saelens X, et al. Tipping the balance between necrosis and apoptosis in human and murine cells treated with interferon and dsRNA. Cell Death and Differentiation 2002; 9:981e94. DeWitte-Orr SJ, Zorzitto JR, Sutton LP, Bols NC. Preferential induction of apoptosis in the rainbow trout macrophage cell line, RTS11, by actinomycin D, cycloheximide and double stranded RNA. Fish & Shellfish Immunology 2005; 18:279e95. Jeong J-M, Kim J-W, Park H-J, Song J-H, Kim D-H, Park C-I. Molecular cloning and characterisation of the rock bream, Oplegnathus fasciatus, Fas (CD95/APO1), and its expression analysis in response to bacterial or viral infection. Results in Immunology 2011;1:11e7. Li M, Ding Y, Mu Y, Ao J, Chen X. Molecular cloning and characterization of caspase-3 in large yellow croaker (Pseudosciaena crocea). Fish & Shellfish Immunology 2011;30:910e6. Mu Y, Xiao X, Zhang J, Ao J, Chen X. Molecular cloning and functional characterization of caspase 9 in large yellow croaker (Pseudosciaena crocea). Developmental & Comparative Immunology 2010;34:300e7. Stewart WE, De Clercq E, Billiau A, Desmyter J, De Somer P. Increased susceptibility of cells treated with interferon to the toxicity of polyriboinosinic$polyribocytidylic acid. Proceedings of the National Academy of Sciences 1972;69:1851e4. Milev-Milovanovic I, Majji S, Thodima V, Deng Y, Hanson L, Arnizaut A, et al. Identification and expression analyses of poly [I:C]-stimulated genes in channel catfish (Ictalurus punctatus). Fish & Shellfish Immunology 2009;26: 811e20. Dios S, Romero A, Chamorro R, Figueras A, Novoa B. Effect of the temperature during antiviral immune response ontogeny in teleosts. Fish & Shellfish Immunology 2010;29:1019e27.

856

J.J. Miest et al. / Fish & Shellfish Immunology 33 (2012) 846e856

[66] Falco A, Mas V, Tafalla C, Perez L, Coll JM, Estepa A. Dual antiviral activity of human alpha-defensin-1 against viral haemorrhagic septicaemia rhabdovirus (VHSV): inactivation of virus particles and induction of a type I interferonrelated response. Antiviral Research 2007;76:111e23. [67] Lepiller S, Franche N, Solary E, Chluba J, Laurens V. Comparative analysis of zebrafish nos2a and nos2b genes. Gene 2009;445:58e65. [68] Alexopoulou L, Holt AC, Medzhitov R, Flavell RA. Recognition of doublestranded RNA and activation of NF-kappaB by toll-like receptor 3. Nature 2001;413:732. [69] Reimer T, Brcic M, Schweizer M, Jungi TW. Poly(I: C) and LPS induce distinct IRF3 and NF-kB signaling during type-I IFN and TNF responses in human macrophages. Journal of Leukocyte Biology 2008;83:1249e57. [70] Neuder LE, Keener JM, Eckert RE, Trujillo JC, Jones SL. Role of p38 MAPK in LPS induced pro-inflammatory cytokine and chemokine gene expression in equine leukocytes. Veterinary Immunology and Immunopathology 2009;129: 192e9. [71] Pisegna S, Pirozzi G, Piccoli M, Frati L, Santoni A, Palmieri G. p38 MAPK activation controls the TLR3-mediated up-regulation of cytotoxicity and cytokine production in human NK cells. Blood 2004;104:4157e64. [72] McCarthy DH. Fish furunculosis. Fisheries Management 1975;6:13e8. [73] Galindo CL, Fadl AA, Sha J, Gutierrez C, Popov VL, Boldogh I, et al. Aeromonas hydrophila cytotoxic enterotoxin activates mitogen-activated protein kinases and induces apoptosis in murine macrophages and human intestinal epithelial cells. Journal of Biological Chemistry 2004;279:37597e612.

[74] Majumdar T, Chattopadhyay P, Saha DR, Sau S, Mazumder S. Virulence plasmid of Aeromonas hydrophila induces macrophage apoptosis and helps in developing systemic infection in mice. Microbial Pathogenesis 2009;46: 98e107. [75] Shao J-z, Liu J, Xiang L-x. Aeromonas hydrophila induces apoptosis in Carassius auratus lymphocytes in vitro. Aquaculture 2004;229:11e23. [76] Silva MT, Do Vale A, Dos Santos NMS. Fish and apoptosis: studies in disease and pharmaceutical design. Current Pharmaceutical Design 2008;14:170e83.  K, Lepa A, G1a˛ bski E. Dietary [77] Siwicki A, Zake˛ s Z, Terech-Majewska E, Kazun macrogard reduces Aeromonas hydrophila mortality in tench (Tinca tinca) through the activation of cellular and humoral defence mechanisms. Reviews in Fish Biology and Fisheries 2010;20:435e9. [78] Nikl L, Evelyn T, Albright L. Trials with an orally and immersion-administered b-1,3 glucan as an immunoprophylactic against Aeromonas salmonicida in juvenile chinook salmon Oncorhynchus tshawytscha. Diseases of Aquatic Organisms 1993;17:191e6. [79] Selvaraj V, Sampath K, Sekar V. Administration of yeast glucan enhances survival and some non-specific and specific immune parameters in carp (Cyprinus carpio) infected with Aeromonas hydrophila. Fish & Shellfish Immunology 2005;19:293e306. [80] Yano T, Matsuyama H, Mangindaan REP. Polysaccharide-induced protection of carp, Cyprinus carpio L., against bacterial infection. Journal of Fish Diseases 1991;14:577e82. [81] Hengartner MO. The biochemistry of apoptosis. Nature 2000;407:770e6.