The influence of powdery mildew (Erysiphe graminisf.sp.hordei) on the accumulation of transcripts from low-temperature-responsive genes in barley

Physiological and Molecular Plant Pathology (1998) 52, 353–369 Article No. : pp980146

The influence of powdery mildew (Erysiphe graminis f.sp. hordei) on the accumulation of transcripts from low-temperature-responsive genes in barley P. O’H*$, P. G. A", M. A. H#, M. A. D# and R. J. S" " Department of Biological Sciences, IENS, Lancaster University, LA1 4YQ, U.K., # Department of Genetics and Biochemistry, University of Newcastle on Tyne, NE2 4HH, U.K., and $ Dept. of Biological Sciences, Durham University, South Rd. Durham DH1 3LE, U.K. (Accepted for publication February 1998)

Members of two barley gene families, blt4 and blt101, previously shown to be upregulated in winter cultivar Igri by a period of low temperature treatment, responded to challenge and infection by Erysiphe graminis f.sp. hordei. There was at normal temperature a transient and modest increase in transcript accumulation of blt4 genes in shoots and leaves within hours of inoculation. When plants with established infections were transferred to low temperature, transcription of blt 4 and blt 101, in leaves and shoots, was less than that in uninfected plants. The degree of inhibition of transcript accumulation in both leaves and shoots was positively related to the area of leaf inoculated and was weakest, but detectable, in uninoculated tissues. Infected plants subject to a freezing and regrowth test showed no significantly increased susceptibility to freezing injury compared to non-infected plants. Survivors and non survivors of this test showed no significant difference in transcript accumulation of these genes in leaves harvested immediately prior to the test. # 1998 Academic Press

INTRODUCTION

Most cereal crops in Northern Europe are grown using winter cultivars, sown in the autumn and capable, after cold acclimation, of surviving freezing temperatures. Generally, they are higher yielding than spring cultivars [22 ]. Yield advantages may be lost, however, if conditions are suitable for pathogen build up following autumn sowing [17, 27]. First, winter cereals provide biotrophic pathogens with a green bridge between growing seasons, retarding spring growth on winter crops and facilitating disease development on spring sown crops. Second, whilst the pathogen population probably declines over winter as green leaf area decreases, a number of studies show that infection could contribute to plant loss by reducing the cold hardiness of leaves, [36, 37 ]. Over the next 25 years mean winter temperatures are predicted to rise by up to 2±0 °C, leading to the possibility of a reduction in plant cold hardiness. As a result, both increased temperatures and an increase in pathogen numbers may occur. Sudden *To whom correspondence should be addressed. Abbreviations used in text : ABA, abscisic acid ; LTP, lipid transfer protein ; NT, normal temperature ; LT, low temperature ; SAR, systemic acquired resistance. 0885–5765}98}060353­17 $30.00}0

# 1998 Academic Press

354

P. O’Hara et al.

frosts may become more common during this period of climate change with the consequent risk of serious plant damage or loss. Given that breeding excessive hardiness may allow increased surivival rates amongst leaf pathogens as well as reducing plant growth, the development of appropriate new cultivars for these conditions will benefit from a better understanding of how, at a molecular level, interactions between stress responses affect cold acclimation. The degree of cold hardiness shown by plants is a function of both environment and genotype, making the process of cold acclimation and the task of understanding it a complex one. A number of biochemical and physiological changes occur that are either regulated by, or result from, low temperature induced changes in gene transcription [24 ]. More than 30 low temperature response genes have been identified in plants, including several in the winter barley, cv. Igri [11, 13, 14, 15, 20 ]. A number of barley low temperature (blt) genes, with different regulatory mechanisms [12 ], and distinct patterns of transcription in response to other stress conditions [42, 52 ], were chosen for investigation of possible pathogen effects in cv. Igri. Many of the blt genes belong to small, multi-gene families. The best characterized of these is the transcriptionally regulated blt4 gene family, which encode small basic polypeptides predicted to be non specific lipid transfer proteins (LTP) [23, 52 ]. Changes in lipid composition and saturation are widely considered to be important in low temperature acclimation and freezing tolerance [24, 25 ]. In Šitro, LTPs have been shown to shuttle lipid molecules between membranes. However, their role in ŠiŠo is not clear. It is probable that they are not free in the cytosol, but are membrane bound or are secreted and localized in the cell wall [28 ]. Four members of the blt4 family have been cloned [13, 52 ] of which blt4±9 and blt4±1 have been used in this study. Expression of the blt4 gene family is tissue specific, blt4±9 is expressed more abundantly in shoot meristems than in leaves, while the reverse is true for blt4±1. Neither is expressed in roots. There is an increase in expression of blt4 genes in response to a number of environmental stresses, including low temperature, drought and nutrient limitation, as well as exogenous application of ABA [12, 23, 42, 52 ]. The relative response to stress factors varies between the blt4 genes, e.g. blt4±9 exhibits only 10 % of the blt4±1 response to drought, but a greater response to low temperature. One gene from each of the blt14 and blt101 families was also included in the study. Neither responds to exogenous ABA application or to drought. Blt101, which is transcriptionally controlled, has no homology to recorded gene sequences and encodes a small hydrophobic protein [12, 20 ]. Two blt101 genes are present in the barley genome. Gene blt101±1, which is expressed throughout the plant, was used. However, the extensive homology within the blt101 gene family may result in some hybridization of probes derived from blt101±1 to other blt101 family members in northern blots. Three members of the post transcriptionally regulated blt14 family have been cloned and show some tissue specificity in response to low temperature [12, 14 ]. Blt14±1 is the best characterized and was used in this study. It is abundant in shoots and roots, but not leaves. The nature and probable role of the protein encoded by blt14 is unknown. Powdery mildew (Erysiphe graminis) is an obligate biotrophic pathogen of cereals and its development is restricted to the epidermal layer of host cells. Transcription of blt4±9 and blt4±1 is also confined to epidermal cells in developing barley leaves, as shown by in situ localization using an anti-sense riboprobe [16 ]. Furthermore, blt4 cognates from

Influence of powdery mildew on transcript accumulation

355

a barley spring cultivar show increased levels of transcription following infection with powdery mildew [38 ]. The protein products of these genes inhibit growth of several pathogens, including E. graminis. Tissue printing suggests that the proteins are mainly accumulated externally on the cell walls of epidermal cells and in vascular tissue [39 ]. To begin to determine whether mildew infection in autumn affects cold hardening, we investigated the effect of established mildew infections on the transcription of several blt genes following low temperature treatment, and whether any effects were associated with a change in freeze tolerance in the laboratory. We began by determining the effect of infection on transcription at normal temperature and whether, if effects occurred at low temperature, they were localized to infected tissue or were detectable in the uninfected (shoot) tissue.

MATERIALS AND METHODS

Plant growth conditions Barley, cv. Igri, was grown in M3 Levington compost with eight plants per 6§ pot. Plants were grown in a temperature regime of 20 °C day}15 °C night, with a 10-hour photoperiod photon flux density of 450³50 µmol m−# s−". When the first true leaf was fully expanded, plants were inoculated or left untreated. Plants subject to a normal temperature regime (NT ; 20 °C day}15 °C night) were then grown on for 7 or 14 days, unless otherwise stated. Low temperature (LT) treated plants were plants which were transferred after 7 days’ post inoculation growth at NT to a cold cabinet, 6 °C day}2 °C night, for a further 7 days, with the same photoperiod and irradiance levels as for NT treated plants. Shoot sections were collected by removing the outermost leaf sheath bases and excising 1–2 cm above the root node. Unless otherwise stated in the text or figure legend, only the first true leaf was used for leaf samples. All material was frozen in liquid nitrogen and stored at ®80 °C immediately after collection. Pathogen inoculations Plants were inoculated with race CC}214 (supplied by the National Institute of Agricultural Botany, Cambridge, U.K.), either in a settling tower, by shaking fresh conidia from heavily infected plants at the top of the tower, or by inserting small sections of pre-inoculated water agar (1–2 mm thick and 1–2 cm long) in the curl on the abaxial surface of the developing leaf [26 ]. A settling tower was used to ensure even dispersal of spores on the agar dishes. Mock inoculations were made using untreated agar. Spore counts varied between 1¬10%–10' spores cm−#. Except for experiments in which samples were collected during the pre-sporulation stages of fungal development, plants were grown for at least 7 days post inoculation at NT, to allow infection to develop at least to the start of sporulation (and also to provide a check on the success of inoculation). For experiments involving sampling during the presporulation stage, RNA extractions were only made if " 95 % of tester plants, i.e. inoculated but not harvested, showed signs of sporulation when grown for 7 days after inoculation. Progress of infection was also monitored by examining stained epidermal leaf peels [2 ] under the light microscopy.

356

P. O’Hara et al.

RNA extraction Plant material was extracted using guanidinium isothiocyanate, either with 2±5–10 g of frozen tissue as described in Dunn et al. [14 ] ; or with 1–2 mg of frozen tissue in a miniprep method using Trizol reagent (Gibco BRL). This method was adapted by preparing the homogenate in liquid nitrogen using a mortar and pestle, and including an extra chloroform extraction. RNA was analysed and quantified using a twin beam spectrophotometer (Pye Unicam SP1800) ; 5–10 ug of RNA was loaded and run on denaturing formaldehyde gels [45 ]. Northern blot analysis Northern blots were prepared by transfer of the gels overnight in 20¬SSC (3  NaCl, 0±3  sodium citrate, pH 7±0) onto Hybond-N membranes (Amersham), which were baked at 80 °C for 2 h. Gene specific probes were prepared from the 3« untranslated region of each cDNA and labelled using Amersham’s Rediprime or Megaprime system and $#P alpha dCTP. Unincorporated nucleotides were removed using Nuc columns (Stratagene). Hybridization was performed for 16 h at 42 °C in 50 % formamide buffer [45 ]. Blots were washed at high stringency – 2¬SSPE (0±36  NaCl, 20 m sodium phosphate, 2 m EDTA pH 7±7), 0±1 % (w}v) SDS at 25 °C for 10 min, twice, 1¬SSPE, 0±1 % (w}v) SDS at 50 °C : for 15 min, 0±1¬SSPE, 0±1 % (w}v) SDS at 50 °C for 10 min, twice – and then exposed to autoradiography film (Kodak X-ray film RX). DNA extraction DNA was extracted from barley after the method of Graham [21 ]. DNA was prepared from wheat and maize, following Trizol (Gibco BRL) extraction of RNA. Southern blot analysis Ten microgrammes of restricted DNA were loaded in each lane of an agarose gel. The gels were blotted to Hybond-N membranes (Amersham). Probes were made as described for northern analysis using the Megaprime system and unincorporated activity removed using Sephadex G-50 drip columns (Pharmacia). Blots were hybridized in 10–20 ml of hybridization buffer (as per Amersham protocol) at 60 °C for 16 h. Blots were washed at low stringency – 2¬SSPE, 0±1 % SDS at 25 °C for 10 min, twice, followed by 1¬SSPE, 0±1 % SDS at 60 °C for 15 min – and for high stringency with additional washes of 0±1¬SSPE, 0±1 % SDS at 60 °C for 10 min twice. Densitometric analysis Autoradiograms and polaroid images of the gels were scanned with a Microtek scanner into Adobe photoshop then analysed using NIH Image Analysis software, version 1±94. Duplicate gels and blots of an RNA dilution series, and a dilution series of $#P-labelled loading buffer, were used to prepared standard curves for calibration of ethidium staining and autoradiographic signals. Sample loading on gels was assessed by ethidium staining of the 28S ribosomal bands. An adjustment was made for differences in loading by using the ratio of the calibrated values for the ethidium and autoradiograph signals to normalize the results, which are expressed in arbitrary

Influence of powdery mildew on transcript accumulation

357

densitometric units. Samples common to several blots were used to normalize the results between blots further. Results based on single blots are shown without error bars. In figures showing results based on more than one blot, the mean and .. is shown. PCR PCR was performed on a Perkins Elmer thermocycler using the following primers. BLT 101±1 GOD1 5« CAAGTGAAGCGAATTCTGGGCTCTGCAA 3« GOD3 5« GATCACAAAGAATTCGGCCGACGAATGC 3« BETA TUBULIN ; RD1 5« GTCGACGAGAACAGCACGAG 3« RD1535 5« ATGCGTGAAATTGTTAGTTA 3« Reactions were performed in 25 µl, with final concentrations : dNTPs (0±2 m each), Primers (2±5 ng µl−" each), PCR buffer (Gilbco), MgCl (1±5 m), Taq polymerase # (Gibco) 1±25U., template (50–250 ng). Cycling parameters ; denaturation : 95 °C for 1 min, annealing : 55 °C for 1 min, extension : 72 °C for 3 min. Total no. of cycles – 30. A final extension was made : 72 °C for 10 min. Freezing experiments A recirculating chiller and water bath, with a 60 % ethylene glycol}water coolant mixture in the circulation system, were used to produce temperatures between 20 °C and ®10 °C. Whole plants were removed from their growth medium. Most of the aerial portion above the shoot and leaf bases was removed and stored at ®80 °C for later RNA preparation. The roots were trimmed and the remainder of the plant was placed in an empty boiling tube and lowered into the coolant but not submerged. The coolant temperature was lowered, being held for 30 min at each consecutively lower temperature (­20, ­5, 0, ®1, ®2, ®3, ®4, ®5, ®6, ®7, ®8 °C). Temperature was monitored at the plant surface as well as in the chiller. Ice was added to the root area of the plant in each tube, just before 0 °C, to prevent supercooling. The system was calibrated a number of times and temperatures were stepped down through the same values for each experiment, and held at those temperatures for 30 min between ramping. A minimum of 16 plants were removed at each temperature step and replanted in fresh medium. Scoring for survival was done after 3 weeks. Previously harvested leaves from survivors and non survivors at each temperature were pooled, because of the small numbers of plants available, and total RNA extracted. Total RNA was also extracted from individual plants from each temperature at which the two classes appeared, in case the pools suppressed any significant differences. In order to minimize the effect of any differences in the overall time spent below 0 °C or variation in the physiological status of plants in different experiments, results for the regrowth tests were also examined using a paired t-test. NT grown plants did not survive below ®2 °C and the pools represented survivors and non-survivors that had been subject to freezing temperatures between 0 °C and ®2 °C. Similar pools for LT grown plants represented plants subject to freezing temperatures between ®4 °C and ®7 °C.

358

P. O’Hara et al.

RESULTS

Effects of pre-sporulation stages of infection on transcription of blt genes at normal temperature Transcription of the selected blt genes (blt4±1, blt4±9, blt101±1 and blt14) was investigated by measuring steady state levels of mRNA, in plants inoculated by the settling tower method. Figure 1 shows results from one of several experiments made to examine transcript accumulation at different times during the pre-sporulation stages of fungal development. Inoculation resulted in an early increase in transcript accumulation of both blt 4±1 and blt4±9. In shoots, blt4±9 transcript accumulation was maximal 3 h postinoculation and thereafter decreased to baseline values within 6 h of inoculation (Fig. 1A). In leaves, blt4±1 transcription was maximal 6 h post inoculation and decreased within 12 h (Fig. 1B). There was no corresponding increase in transcript levels of either blt14±1 or blt101±1 (data not shown). Two experiments also showed elevated blt4±9 transcript accumulation in shoots, but not accumulation of blt101±1 or blt14±1 transcripts, at an early stage in the host}plant interaction (data not shown). Effects of post-sporulation stages of infection on transcription of blt genes at normal and low temperature Figure 2 summarizes normalized results from three to five experiments in which all plants were grown and inoculated at NT before half were transferred to LT 7 days after inoculation. At NT the only increase in transcript abundance occurred with blt4±9 in shoot meristems (Fig. 2C). This latter response, in uninfected tissue from infected plants, indicates that the fungal infection has a systemic effect on gene transcription. Although absolute levels of transcripts were low, fungal infection at NT caused a reduction in transcript levels of blt4±1 and blt101±1 in leaves (Fig. 2A, B). Infection had no effect on NT levels of blt101±1 or blt14±1 in shoots. In uninfected plants, the LT treatment resulted in a three- to four-fold increase in the transcript abundance of all genes, as previously reported [13, 14, 20, 23 ]. Maximum levels of induction were typically twice those induced 4–6 h after inoculation at NT (Fig. 1). With the exception of blt14±1 in shoots (Fig. 2E), LT induction of gene transcription or accumulation of transcripts was less in infected than in healthy plants, and this was true even for blt4±9 in shoots (Fig. 2C). In order to test if fungal RNA had diluted out blt mRNA, blots were probed with a full length mildew beta tubulin cDNA. It is probable that beta tubulin is constitutively expressed. Whilst the arrest of fungal growth at LT results in lower levels of transcription than at NT, beta tubulin transcripts were still evident. There was no relationship between the levels of mildew beta tubulin transcript abundance and blt transcript levels (data not shown), indicating that the presence of fungal RNA was not a significant factor in explaining changes in blt transcript abundance. No novel bands were detectable on Southern blots of restricted genomic DNA extracted from uninfected and highly infected leaves, using the gene specific blt 3« probes used for northern analysis. PCR using primers specific to these same genes also gave no novel bands in infected samples. Thus it is unlikely that similar sequences are transcribed by E. graminis.

Influence of powdery mildew on transcript accumulation

359

1.2

Normalized densitometric units

(A) blt 4.9 – shoot sample 1

0.8

0.6

0.4

0.2

0

1h

3h

6h

12 h

1 day 2 days 3 days 4 days 5 days 7 days 1 day 7 days NI NI Time after inoculation

1.6 (B) blt 4.1 – leaf sample Normalized densitometric units

1.4 1.2 1 0.8 0.6 0.4 0.2 0 1h

3h

6h

12 h

1 day 2 days 3 days 4 days 5 days 7 days 1 day 7 days Time after inoculation

NI

NI

F. 1. Northern blot analysis, quantified by densitometry, of blt transcript accumulation in barley. Plants were sampled between 1 h and 7 days after inoculation with mildew. Plants were grown at NT (20 °C day ; 15 °C night) throughout. Uninoculated controls (NI) are shown for comparison. (A) blt4±9 expression in the shoot region and (B) blt4±1 expression in the first true leaf. Results are based on duplicate blots normalized to common LT samples, shown in Fig. 2.

Inoculum load and the extent of the effects of infection Experiments were conducted to determine whether the inhibition of low temperatureinduced transcription of blt genes or increase in mRNA turnover was similar in different tissues and whether it was dependent upon the inoculum load on the plant.

360

Normalized densitometric units

Normalized densitometric units

(B) blt 101.1 – leaf sample

2.0

1.5

1.0

0.5

0

NT n.i.

NT i.

LT n.i.

2.0

1.5

1.0

0.5

NT n.i.

NT i.

LT n.i.

LT i.

1.6 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0

LT i.

(C) blt 4.9 – shoot sample

0

Normalized densitometric units

(A) blt 4.1 – leaf sample

Normalized densitometric units

Normalized densitometric units

2.5

P. O’Hara et al.

1.0

NT n.i.

NT i.

LT n.i.

(D) blt 101.1 – shoot sample

0.8 0.6 0.4 0.2 0

NT n.i.

NT i.

LT n.i.

(E) blt 14.1 – shoot sample 2.0

1.5

1.0

0.5

0

NT n.i.

NT i.

LT n.i.

LT i.

LT i.

F. 2. Northern blot analysis, quantified by densitometry, of blt transcript accumulation in the shoot region and the first true leaf of mildew-infected and non-infected barley. Half the plants were transferred from NT (20 °C day ; 15 °C night) to LT (6 °C day ; 2 °C night) 7 days after inoculation. All plants were sampled 7 days later. (A) and (B) leaf samples probed with blt4±1 and blt101±1. (C), (D) and (E) shoot samples probed with blt4±9, blt101±1 and blt14, respectively. Results are based on three experiments for NT treated plants and five experiments for LT treated plants. n.i. ¯ non infected ; i. ¯ infected.

LT i.

Influence of powdery mildew on transcript accumulation

361

First and second leaves, and shoots, were separately sampled from plants in which the area infected was varied by inoculating plants either directly in a settling tower or indirectly with a small strip of inoculated agar applied to leaf 1. The agar strip was derived from dishes placed under the settling tower when inoculating plants ; thus, although spore densities within inoculated areas were similar in both directly and indirectly inoculated plants, inoculum loads on the plants were different. All plants were transferred to LT 7 days after inoculation and sampled after a further 7 days. Figure 3 shows typical results from one of three experiments. Although the agar strip inoculation method caused a smaller response (compare L1 a.i. with L1 w.p.n.i. within Fig. 3A and, also, within 3B), infection reduced the transcript accumulation of both blt 4±1 and blt 101±1 in both leaves 1 and 2. The apparent inhibition was greater when whole plants were inoculated than when only a section of leaf 1 was inoculated. Samples from leaf 1 contained both healthy and inoculated areas, indicating that there was either a lesser or no effect on uninoculated areas. The effect of infection on leaf 2, which was not expanded at the time of inoculation, suggests that infection has effects outside the inoculated area, albeit weaker than in the inoculated area. This conclusion must be tentative since, although microscopic examination of stained leaf peels indicated no infection on leaf 2, poorly attached early infection structures arising from a second cycle of (natural) re-infection could have been removed when preparing samples. However, a systemic effect was clearly demonstrated because in shoots from LT treated plants, both inoculation methods caused a significant reduction in transcript levels of blt4±9 and blt101±1 (Fig. 3C, D). Freezing and regrowth experiments Freezing and regrowth tests were made on infected and uninfected plants to test whether infection resulted in enhanced susceptibility to freezing injury and whether there was any correlation between blt gene transcript accumulation and ability to withstand freezing injury. Inoculated and non-inoculated plants underwent freezing treatment in parallel. Matched samples from all the freezing and regrowth experiments could therefore be used to test if there was any significant difference between the number of survivors and non-survivors, relating to inoculated and non-inoculated plants, at any temperature where there was " 0 ! 100 % survivors. Localized inoculation, using the agar strip method, had no affect on susceptibility to freezing injury in NT or LT grown plants (Fig. 4). The paired t-test indicated that there was no significant difference in survivability between inoculated and noninoculated plants. (LT : 0±2 ! P(t, ®0±79) ! 0±5 (n ¯ 216 plants)) (NT : 0±2 ! P (t, 1±1) ! 0±5 (n ¯ 248 plants)). When whole plants were inoculated, using the settling tower, control plants survived better than infected plants but no significant difference was found at the 0±1 confidence limit (LT : 0±1 ! P(t, ®2±09) ! 0±2 (n ¯ 107 plants)) (NT : 0±1 ! P(t, 2±08) ! 0±2 (n ¯ 96 plants)). However, both the small sample size and the difference in stature between infected and null control plants, which prevented the selection of matched samples, detracted from statistical analysis. Northern blot analysis of blt transcripts in the leaves of survivors and non-survivors of the freezing regrowth experiments was used to assess whether blt transcript accumulation was correlated with the ability to withstand freezing. Leaves were

P. O’Hara et al.

Densitometric units

362 2.0 1.8 1.6 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0

(A) blt 4.1 – leaf sample

L1 a.i.

L1 a.n.i.

L1 w.p.i.

L1 L2 w.p.n.i. a.i. Inoculation

L2 a.n.i.

L2 w.p.i.

L2 w.p.n.i.

L1 L2 w.p.n.i. a.i. Inoculation

L2 a.n.i.

L2 w.p.i.

L2 w.p.n.i.

0.8 Densitometric units

0.7

(B) blt 101.1 – leaf sample

0.6 0.5 0.4 0.3 0.2 0.1 0

L1 a.i.

L1 a.n.i.

L1 w.p.i.

1 Normalized densitometric units

0.9

(C) blt 4.9 – shoot sample

0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0

a.i.

a.n.i.

w.p.i.

w.p.n.i.

w.p.i.

w.p.n.i.

Inoculation 0.8 Normalized densitometric units

(D) blt 101.1 – shoot sample 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0

a.i.

a.n.i. Inoculation

Influence of powdery mildew on transcript accumulation

363 80

(A)

70

40 30 20

% Survivors

60 50

10 –6

–5

–4

–3 Temperature (°C)

–2

–1

(B)

0

100

60 40 20 –8

–6

–4 Temperature (°C)

–2

0

F. 4. Regrowth, following exposure to freezing temperatures, of barley uninfected or inoculated locally (agar method) with mildew. Mean percentage of survivors is plotted against temperature at which plants were finally held before replanting. In each experiment 16 plants were used for each category at each temperature. Results are based on three experiments. (A) NT (20 °C day ; 15 °C night) grown plants. (B) LT (6 °C day ; 2 °C night) grown plants. (E), non inoculated ; (D), agar inoculated.

harvested immediately prior to freezing and subsequently selected and pooled according to whether the plant survived. Figure 5 shows typical results, and shows comparisons for both inoculation methods. Considering four experiments involving localized inoculation (agar strip) and two experiments using settling tower inoculation, there was, as previously found (Figs 2 and 3), a consistent decreased accumulation of blt transcripts in infected plants as compared to null treated control plants. However, there was no consistent difference in the accumulation of blt transcripts in survivor and F. 3. Northern blot analysis, quantified by densitometry, of blt transcript accumulation in the leaves and the shoot region of LT (6 °C day ; 2 °C night) treated barley subject to different loads of mildew inoculum. All plants were transferred from NT (20 °C day ; 15 °C night) to LT 7 days after inoculation. (A) blt4±1 expression and (B) blt101±1 expression in leaves – results are shown for a single northern blot from one experiment. (C) blt4±9 expression and (D) blt101±1 expression in shoots – results are based on blots from three experiments. L1 ¯ the first true leaf, L2 ¯ youngest mature leaf. a.i. ¯ agar inoculated with spores ; a.n.i. ¯ agar not inoculated with spores ; w.p.i. ¯ whole plant inoculation ; w.p.n.i. ¯ whole plant no inoculation.

% Survivors

80

364

P. O’Hara et al.

non-survivor plants. In addition, such differences as existed between survivors and non-survivors of uninfected plants in any one experiment were not reproducible. DISCUSSION

When comparing transcript accumulation in mildew infected and uninfected plants, two factors may affect the analysis. First, if fungal mRNA is present in the extract, the proportion of a plant mRNA in the total extract would be diminished and thus the accumulation of that transcript would appear to be decreased. An analysis using beta2

(A) blt 4.1 – leaf sample

Densitometric units

1.8 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0

a.i.

w.p.i.

a.n.i.

Inoculum 4.5

Densitometric units

4

(B) blt 101.1 – leaf sample

3.5 3 2.5 2 1.5 1 0.5 0

a.i.

w.p.i.

a.n.i.

Inoculum F. 5. Comparison of blt transcript accumulation, by northern blot analysis and quantified by densitometry, in the first true leaf of barley, harvested prior to testing, from survivors and nonsurvivors of a freezing and regrowth test. Plants subject to different loads of mildew inoculum are compared with uninfected controls. Leaves were divided into pools of survivors and non-survivors, following exposure to freezing temperatures of 0 °C to ®2 °C for NT grown plants and ®4 °C to ®7 °C for LT grown plants. (A) blt4±1 expression and (B) blt101 expression. Results are from a single blot. NT, 20 °C day, 5 °C night ; LT, 6 °C day, 2 °C night. a.i. ¯ agar inoculated ; w.p.i. ¯ whole plant inoculated ; a.n.i. ¯ agar not inoculated. (*) Survivors}NT ; (8) nonsurvivors}NT ; (+) survivors}LT ; (9) non-survivors}LT.

Influence of powdery mildew on transcript accumulation

365

tubulin as a constitutively expressed gene in powdery mildew showed that this situation did not occur, either because fungal mRNA is not efficiently extracted by the techniques employed or because it formed too small a fraction of the total extract to be of consequence. Second, if fungal mRNA contained transcripts complementary to the probes used, these could contribute to the northern blot analysis and consequently the accumulation of the plant transcript would appear to be increased. The use of 3« specific plant gene probes mitigated against this possibility and cognates to blt4 and blt101 were shown not to be present in the mildew genome. Inoculation with powdery mildew induced a brief accumulation of blt4 transcripts in NT grown plants within 3–6 h (Fig. 1). A similar experiment using the blt4±9 cognate (ltp2), on a barley spring cultivar and with both virulent and avirulent races, showed a single peak at 12–16 h after inoculation [38 ]. A biphasic response to E. graminis infection has been described for other defence-related genes [4–8 ], with induction corresponding first to primary germ tube contact (4–6 h) and second to attempted penetration by the appressorial germ tube (15–18 h) [47–49 ]. It remains to be determined if a biphasic response occurs with blt4 genes in winter barley, as the second peak of response may have occurred between sampling points. Changes in membrane potential and permeability, the production of active oxygen species, alterations in the morphology and location of organelles and the cytoskeleton, and modifications of the host cell wall have been reported, within minutes or a few hours, following contact between host cells and the pathogen or pathogen-associated components [30 ]. Changes in gene transcription accompany or enable many of these early defence responses [9, 53 ], often in both compatible and incompatible reactions. However, much of this work has been done in cell culture or using isolated protoplasts, and there is evidence in planta of a different spatio-temporal response pattern, with induced defence reactions being delayed or expressed more weakly in compatible interactions [3, 10 ]. The primary germ tubes of powdery mildew conidia penetrate the cuticle, with concomitant formation of a cytoplasmic aggregate, halo and papilla as well as an increased rate of cytoplasmic streaming in the host cell, indicating that the host cell has detected and reacted to the pathogen during the preparation of the infection court [33 ]. Recognition of non-self at the molecular level, which is not based on a gene-for-gene system, has received limited attention to date. Relatively unspecific determinant(s) derived from either the host or the pathogen and including breakdown products from chitinase or cutinase activity, have been postulated to act as an initial elicitor of the plant response. Non-specific esterase}cutinase activity, which may aid penetration [32 ] or be incidental to other processes [41 ], has been detected in the liquid exudate released by conidia of E. graminis on barley before primary germ tube development [40 ]. The free cutin monomers, that are released by this activity, have been implicated as signal molecules [44, 46 ]. A defence role for the LTPs encoded by the blt4 gene family, which may be involved in the transport of cutin monomers to extracellular sites of cutin formation [50 ], has been proposed [18 ]. Consequently, upregulation of blt4 genes in response to cuticle degradation is an attractive idea. Suppression of upregulation by the pathogen might assist its development in the pre-prenetration phase. With the exception of blt14±1, the accumulation of blt gene transcripts after LT treatment, was less in infected plants than in uninfected controls (Fig. 2). The systemic

366

P. O’Hara et al.

effects observed suggest that signal translocation is involved [35 ], though whether the messenger molecule originates from the fungus or the host plant is not distinguished. The muting of transcript accumulation appears dose-related. The localized and lower inoculum load resulting from inoculation with an agar strip had substantially less effect than the widespread and heavier load applied in the settling tower, suggesting that the signal resulting from the former method is either decreased in amplitude and}or duration. It might therefore be expected that the extent of the relative decrease in transcript accumulation would be dependent upon the development of the fungal parasite. It is notable that muted transcript accumulation in infected LT treated plants is found for blt4 and blt101±1 genes, which are transcriptionally regulated in respect to LT treatment, but not for blt14±1 which is post-transcriptionally regulated. This correlation with transcriptional regulation is corroborated by our finding (results not reported here) that two other blt genes, blt63 and blt 801 [11, 15 ], which are transcribed predominantly in shoots and differ in their control mechanisms for LT treatment, exhibit similar responses. The regulation of LPT1 in Arabidopsis involves sequences which are similar to the putative regulatory elements of genes involved in phenyl propanoid biosynthesis [51 ], which suggests that the regulation of some LT genes may be linked to that controlling systemic acquired resistance (SAR) and pathogen response. Similar sequences are present in the blt4±9 gene (52) and one is present in blt101±1 (unpublished data). Thus it is plausible that the systemic muting of blt transcript accumulation could employ a mechanism(s) linked to the SAR response. Although it is unclear what function blt4 proteins serve either in cold acclimation or during fungal infection, it is interesting that proteins with general antimicrobial activity, homologous to LTPs, have also been isolated from onions [43 ]. There are other examples of proteins that are cold regulated and probably pathogen induced. These include a cold-induced chitinase isolated from the crown stem of bermudagrass [19 ] and antifreeze proteins, similar to PR proteins, including one that is a chitinase, found in the apoplast and epidermal cells of acclimated winter rye [1 ]. The response elicited in shoots of plants having restricted contact with the fungus, whilst less marked, was not significantly different from the response in tissues having widespread exposure to the pathogen. As it is the shoot meristem that both perceives low temperature and acclimatizes to cold, this implies that limited infection could potentially affect the low temperature response. However, the results of the freezing and regrowth tests in combination with transcription studies on the same plants do not support this notion (Figs 4 and 5). Over the limited period examined in these experiments, infection does not compromise the plant’s ability to survive freezing injury. This implies that in infected plants transcription of these genes alone may be neither necessary nor sufficient for growth or survival at low temperature. This conflicts with the strong correlation between increased transcript accumulation of these genes and the ability of uninfected plants to cold acclimate [42 ]. The significance of the reduction in blt transcription in LT grown infected plants is also difficult to assess, in the absence of information about protein turnover. It is possible that the cell content of blt proteins is sufficient for adequate functioning of the plant under the low temperature conditions used in these experiments even in infected

Influence of powdery mildew on transcript accumulation

367

plants. Others have shown that heavily infected plants are more susceptible to freezing injury [36, 37 ] over long periods of time. Plausibly, a heavier infection of longer duration than used here would sufficiently decrease blt gene transcription and, hence, blt protein content to account for that susceptibility. We thank J. Queally for technical assistance. This work was supported by a grant from the BBSRC under the BAGEC initiative (PG 89}539(GER)).

REFERENCES 1. Antikainen M, Griffith M, Zhang J, Hon WC, Yang DSC, Pihakaskimaunsbach K. 1996. Immunolocalisation of antifreeze proteins in winter rye leaves, crowns, and roots by tissue printing. Plant Physiology 110 : 845–857. 2. Ayres PG, Woolacott B. 1980. Effects of soil water level on the development of adult plant resistance to powdery mildew in barley. Annals of Applied Biology 94 : 255–263. 3. Bell JN, Ryder TB, Wingate VPM, Bailey JA, Lamb CJ. 1986. Differential accumulation of plant defense response gene transcripts in a compatible and incompatible plant-pathogen interaction. Molecular and Cellular Biology 6 : 1615–1623. 4. Boyd LA, Smith PH, Green RM, Brown KM. 1994. The relationship between the expression of defense related genes and mildew development in barley. Molecular Plant–Microbe Interactions 7 : 401–410. 5. Brandt J, Thordal-Christensen H, Vad K, Gregersen PL, Collinge DB. 1992 A pathogen induced gene of barley encodes a protein showing high similarity to a protein kinase regulator. The Plant Journal 2 : 815–820. 6. Clark TA, Zeyen RJ, Carver TLW, Smith AG, Bushnell WR. 1995. Epidermal cell cytoplasmic events and response gene transcript accumulation during Erysiphe graminis attack in isogenic barley lines differing at the Ml-o locus. Physiological and Molecular Plant Pathology 46 : 1–16. 7. Clark TA, Zeyen RJ, Smith AG, Bushnell WR, Szabo LJ, Vance CP. 1993. Host response gene transcript accumulation in relation to visible cytological events during Erysiphe graminis attack in isogenic barley lines differing at the Ml-a locus. Physiological and Molecular Plant Pathology 43 : 283–298. 8. Clark TA, Zeyen RJ, Smith AG, Carver TLW, Vance CP. 1994. Phenylalanine ammonia lyase mRNA accumulation, enzyme activity, and cytoplasmic response in barley isolines, differing at Ml-a and Ml-o loci. attacked by Erysiphe graminis f.sp. hordei. Physiological and Molecular Plant Pathology 44 : 171–185. 9. Dixon RA, Harrison MJ, Lamb CJ. 1994. Early events in the activation of plant defense responses. Annual ReŠiew of Phytopathology 32 : 479–501. 10. Dixon RA, Paiva NL. 1995. Stress-induced phenylpropanoid metabolism. Plant Cell 7 : 1085–1097. 11. Dunn MA, Brown K, Lightowlers R, Hughes MA. 1996. A low-temperature-responsive gene from barley encodes a protein with single-stranded nucleic acid-binding activity which is phosphorylated in Šitro. Plant Molecular Biology 30 : 947–959. 12. Dunn MA, Goddard NJ, Zhang L, Pearce RS, Hughes MA. 1994. Low-temperature-responsive barley genes have different control mechanisms. Plant Molecular Biology 0 : 1–10. 13. Dunn MA, Goddard NJ, Zhang L, Pearce RS, Quigley AS, Jack PL. 1991. Nucleotide sequence and molecular analysis of the low temperature induced cereal gene BLT4. Molecular and General Genetics 229 : 389–394. 14. Dunn MA, Hughes MA, Pearce RS, Jack PL. 1990. Molecular characterisation of a barley gene induced by cold treatment. Journal of Experimental Botany 41 : 1405–1413. 15. Dunn MA, Morris A, Jack PL, Hughes MA. 1993. A low-temperature-responsive translation elongation factor 1α from barley (Hordeum Šulgare L.). Plant Molecular Biology 23 : 221–225. 16. Dunn MA, White AJ, Vural S, Hughes MA. Identification of promoter elements in a low temperature responsive gene (blt4±9) from barley (Hordeum Šulgare L.). Plant Mol Biol (In press). 17. Frank JA, Hatley OE. 1988. The effect of planting date and epidemics of powdery mildew on winter wheat. Plant Disease 72 : 661–664. 18. Garcı! a-Olmedo F, Molina A, Segura A, Moreno M. 1995. The defensive role of nonspecific lipidtransfer proteins in plants. Trends in Microbiology 3 : 72–74. 19. Gatschet MJ, Taliaferro CM, Porter DR, Anderson MP, Anderson JA, Jackson KW. 1996. A cold-regulated protein from bermudagrass crowns is a chitinase. Crop Science 36 : 712–718.

368

P. O’Hara et al.

20. Goddard NJ, Dunn MA, Zhang L, White AJ, Jack PL, Hughes MA. 1993. Molecular analysis and spatial expression pattern of a low temperature specific barley gene, blt101. Plant Molecular Biology 23 : 871–879. 21. Graham DE. 1978. The isolation of high molecular weight DNA from whole organisms or large tissue masses. Analytical Biochemistry 85 : 609–613. 22. Hay RKM, Walker AJ. 1989. An Introduction to the Physiology of Crop Yield. Harlow : Longman. 23. Hughes MA, Dunn MA, Pearce RS, White AJ, Zhang L. 1992. An abscisic acid – responsive, low temperature barley gene has homology with a maize phospholipid transfer protein. Plant, Cell and EŠironment 15 : 861–865. 24. Hughes MA, Dunn MA. 1996. The molecular biology of plant acclimation to low temperature. Journal of Experimental Botany 47 : 291–305. 25. Ishizaki-Nishizawa O, Fujii T, Azuma M, Sekiguchi K, Murata N, Ohtani T, Toguri T. 1996. Low-temperature resistance of higher plants is significantly enhanced by a nonspecific cyanobacterial desaturase. Nature Biotechnology 14 : 1003–1006. 26. Jacobs Th, Kiriswa FKL. 1993. The relation between the developmental stage of wheat and barley and the latency period and infection frequency of leaf rust. Cereal Research Communications 21 : 195–200. 27. Jenkyn JE, Bainbridge A. 1978. Biology and pathology of cereal powdery mildews. In : Spencer DM (ed.). The Powdery Mildews. London : Academic Press, 283–321. 28. Kader JC. 1996. Lipid-transfer proteins in plants. Annual ReŠiew of Plant Physiology and Plant Molecular Biology 47 : 627–654. 29. Knogge W. 1996. Fungal infection of plants. The Plant Cell 8 : 1711–1722. 30. Kobayashi I, Murdoch LJ, Kunoh H, Hardham AR. 1995. Cell biology of early events in the plant resistance response to infection by pathogenic fungi. Canadian Journal of Botany 73 (Suppl. 1) : S418–S425. 31. Kobayashi I, Watanabe H, Kunoh H. 1995. Induced accessibility and enhanced inaccessibility at the cellular level in barley coleoptiles. XIV. Evidence for elicitor(s) and suppressor(s) of host inaccessibility from Erysiphe graminis. Physiological and Molecular Plant Pathology 46 : 445–456. 32. Kolattukudy PE. 1985. Enzymatic penetration of the plant cuticle by fungal pathogens. Annual ReŠiew of Phytopathology 2 : 223–250. 33. Kunoh H, Ishizaki H, Nakaya K. 1977. Cytological studies of early stages of powdery mildew in barley leaves and wheat leaves. II. Significance of the primary germ tube of Erysiphe graminis on barley leaves. Physiological Plant Pathology 10 : 191–199. 34. Kunoh H, Komura T, Kobayashi I, Yamaoka N. 1990. Induced accessibility and enhanced inaccessibility at the cellular level in barley coleoptiles. VII. Enhancement of inaccessibility at the prepenetration stage of a pathogen. Physiological and Molecular Plant Pathology 37 : 399–407. 35. Lamb CJ, Lawton MA, Dron M, Dixon RA. 1989. Signals and transduction mechanisms for activation of plant defenses against microbial attack. Cell 56 : 215–224. 36. McAinsh MR, Ayres PG, Hetherington AM. 1990a. The effect of soil phosphate on injury to winter barley caused by mildew. Annals of Botany 65 : 417–423. 37. McAinsh MR, Ayres PG, Hetherington AM. 1990b. The effects of brown rust and phosphate on cold acclimation in winter barley. Annals of Botany 66 : 101–110. 38. Molina A, Garcia-Olmedo F. 1993. Developmental and pathogen-induced expression of three barley genes encoding lipid transfer proteins. The Plant Journal 4 : 983–991. 39. Molina A, Segura A, Garcia-Olmedo F. 1993. Lipid transfer proteins (nsLTPs) from barley and maize leaves are potent inhibitors of bacterial and fungal plant pathogens. FEBS 316 : 119–122. 40. Nicholson RL, Yoshioka H, Yamaoka N, Kunoh H. 1988. Preparation of the infection court by Erysiphe graminis. II. Release of esterase enzyme from conidia in response to a contact stimulus. Experimental Mycology 12 : 336–349. 41. Nicholson RL, Kunoh H. 1995. Early interactions, adhesion and establishment of the infection court by Erysiphe graminis. Canadian Journal of Botany 73 (Suppl. 1) : S609–S615. 42. Pearce RS, Dunn MA, Rixon JA, Harrison P, Hughes MA. 1996. Expression of cold inducible genes and frost hardiness in the crown meristem of young barley (Hordeum Šulgare L. cv Igri) plants grown in different environments. Plant Cell and EnŠironment 19 : 275–290. 43. Phillippe B, Cammue BPA, Thevissen K, Hendriks M, Eggermont K, Goderis IJ, Proost P, Vandamme J, Osborn RW, Guerbette F, Kader JC, Broekaert WF. 1995. A potent antimicrobial protein from onion seeds showing sequence homology to plant lipid transfer proteins. Plant Physiology 109 : 445–455. 44. Podila GK, Dickman MB, Kolattukudy PE. 1988. Transcriptional activation of a cutinase gene in isolated fungal nuclei by plant cutin monomers. Science 242 : 922–925. 45. Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular Cloning : A Laboratory Manual. 2nd Edition. Plainview, NY : Cold Spring Harbour Lab. Press.

Influence of powdery mildew on transcript accumulation

369

46. Schweizer P, Jeanguenat A, Whitacre D, Me! traux J-P, Mo$ singer E. 1996. Induction of resistance in barley against Erysiphe graminis f.sp. hordei by free cutin monomers. Physiological and Molecular Plant Pathology 49 : 103–120. 47. Scott-Craig JS, Kerby B, Stein BD, Somerville SC. 1995. Expression of an extracellular peroxidase that is induced in barley (Hordeum Šulgare) by the powdery mildew pathogen (Erysiphe graminis f.sp. hordei). Physiological and Molecular Plant Pathology 47 : 407–418. 48. Shiraishi T, Yamada T, Nicholson RL, Kunoh H. 1995. Phenylalanine ammonia-lyase in barley : activity enhancement in response to Erysiphe graminis f.sp. hordei (race 1) a pathogen, and Erysiphe pisi, a nonpathogen. Physiological and Molecular Plant Pathology 46 : 153–162. 49. Shiraishi T, Yamada T, Oku H, Yoshioka H. 1991. Suppressor production as a key factor for fungal pathogenesis. In : Patil SS, Ouchi S, Mills D, Vance C (eds.). Molecular Strategies of Pathogens and Host Plants. New York : Springer-Verlag, 151–162. 50. Sterk P, Booij H, Schellekens GA, Van Kammen A, De Vries SC. 1991. Cell-specific expression of the carrot EP2 lipid transfer protein. Plant Cell 3 : 907–921. 51. Thoma S, Hecht U, Kippers A, Botella J, De Vries S, Somerville C. 1994. Tissue-specific expression of a gene encoding a cell wall-localised lipid transfer protein from Arabidopsis. Plant Physiology 105 : 35–45. 52. White AJ, Dunn MA, Brown K, Hughes MA. 1994. Comparative analysis of genomic sequence and expression of a lipid transfer protein gene family in winter barley. Journal of Experimental Botany 45 : 1885–1892. 53. Zhu Q, Droge-Laser W, Dixon RA, Lamb C. 1996. Transcriptional activation of plant defense genes. Current Opinion in Genetics and DeŠelopment 6 : 624–630.