The interaction of a Trypanosoma brucei KH-domain protein with a ribonuclease is implicated in ribosome processing

G Model

ARTICLE IN PRESS

MOLBIO-11033; No. of Pages 10

Molecular & Biochemical Parasitology xxx (2016) xxx–xxx

Contents lists available at ScienceDirect

Molecular & Biochemical Parasitology

The interaction of a Trypanosoma brucei KH-domain protein with a ribonuclease is implicated in ribosome processing Smriti Kala a,1 , Vaibhav Mehta a,c,1 , Chun Wai Yip a , Houtan Moshiri a,c , Hamed Shateri Najafabadi a , Ruoyu Ma a , Najmeh Nikpour a , Sara L. Zimmer b , Reza Salavati a,c,∗ a

Institute of Parasitology, McGill University, Quebec, H9X3V9, Canada Department of Biomedical Sciences, University of Minnesota Medical School, Duluth, MN, 55812, USA c Department of Biochemistry, McGill University, McIntyre Medical Building, 3655 Promenade Sir William Osler, Montreal, Quebec H3G 1Y6, Canada b

a r t i c l e

i n f o

Article history: Received 9 March 2016 Received in revised form 8 December 2016 Accepted 9 December 2016 Available online xxx Keywords: Trypanosome Ribosomal RNA 18S rRNA RNA-binding Nuclease

a b s t r a c t Ribosomal RNA maturation is best understood in yeast. While substantial efforts have been made to explore parts of these essential pathways in animals, the similarities and uniquenesses of rRNA maturation factors in non-Opisthokonts remain largely unexplored. Eukaryotic ribosome synthesis requires the coordinated activities of hundreds of Assembly Factors (AFs) that transiently associate with preribosomes, many of which are essential. Pno1 and Nob1 are two of six AFs that are required for the cytoplasmic maturation of the 20S pre-rRNA to 18S rRNA in yeast where it has been almost exclusively analyzed. Specifically, Nob1 ribonucleolytic activity generates the mature 3 -end of 18S rRNA. We identified putative Pno1 and Nob1 homologues in the protist Trypanosoma brucei, named TbPNO1 and TbNOB1, and set out to explore their rRNA maturation role further as they are both essential for normal growth. TbPNO1 is a nuclear protein with limited cytosolic localization relative to its yeast homologue. Like in yeast, it interacts directly with TbNOB1, with indications of associations with a larger AF-containing complex. Interestingly, in the absence of TbPNO1, TbNOB1 exhibits non-specific degradation activity on RNA substrates, and its cleavage activity becomes specific only in the presence of TbPNO1, suggesting that TbPNO1-TbNOB1 interaction is essential for regulation and site-specificity of TbNOB1 activity. These results highlight a conserved role of the TbPNO1-TbNOB1 complex in 18S rRNA maturation across eukaryotes; yet reveal a novel role of their interaction in regulation of TbNOB1 enzymatic activity. © 2016 Elsevier B.V. All rights reserved.

1. Introduction Eukaryotic ribosomal biogenesis is an essential and highly conserved process, studied most extensively in yeast and less so in human, mouse and Xenopus [1–4]. In eukaryotic cells, three of the mature rRNA species, 18S, 5.8S and 25–28S rRNA, are cotranscribed as a polycistronic transcript, which matures through a series of endo- and exonucleolytic processing steps [5]. Large ribonucleoprotein processing complexes assemble while rRNA sequences are modified, external and internal transcribed spacer sequences (ETS and ITS, respectively) are removed, and mature rRNAs are assembled into ribosomal subunits [3,6]. The mature

∗ Corresponding author at: Institute of Parasitology, McGill University, Quebec, H9X3V9, Canada. E-mail address: [email protected] (R. Salavati). 1 Both authors contributed equally to this work.

rRNA sequences undergo extensive covalent nucleotide modification during this process, guided by small nucleolar RNAs [7]. Concurrently, non-ribosomal proteins called Assembly Factors (AFs) associate transiently with assembling ribosomes to facilitate the processing and folding of rRNA to ensure the sequential recruitment of ribosomal proteins for accurate ribosome assembly [6,8,9]. The 60S and 40S pre-ribosomal particles assemble in the nucleolus, and are exported to the cytoplasm where they mature. Both mature subunits are comprised of many ribosomal proteins, with the large 60S subunit (LSU) containing the 25/28S, 5.8S and 5S rRNA, and the small 40S subunit (SSU) containing our focus, the 18S rRNA [6]. The protozoan parasite Trypanosoma brucei, responsible for African sleeping sickness in humans and Nagana in cattle, is positioned, in eukaryotic molecular phylogenetic maps, far from organisms from which our core knowledge of biological processes derives [10,11]. Its RNA metabolism involves exclusive features such as extensive mitochondrial transcript editing, and coupled trans-splicing and polyadenylation of cytosolic mRNAs [12,13].

http://dx.doi.org/10.1016/j.molbiopara.2016.12.003 0166-6851/© 2016 Elsevier B.V. All rights reserved.

Please cite this article in press as: S. Kala, et al., The interaction of a Trypanosoma brucei KH-domain protein with a ribonuclease is implicated in ribosome processing, Mol Biochem Parasitol (2016), http://dx.doi.org/10.1016/j.molbiopara.2016.12.003

G Model MOLBIO-11033; No. of Pages 10 2

ARTICLE IN PRESS S. Kala et al. / Molecular & Biochemical Parasitology xxx (2016) xxx–xxx

results in slowed growth, and reduced cleavage activity at sites 2, 3 and A1 of the 18S rRNA precursor. TbPNO1 associates with four other putative pre-40S ribosome AFs. The majority of TbPNO1 is nuclear with limited cytosolic localization; and its expression patterns exhibit differences from that of yeast. We show that TbNOB1 and TbPNO1 directly interact, and most interestingly, demonstrate likely in vitro site 2-specific endonuclease activity of TbNOB1 only in the presence of TbPNO1. Thus we predict that at least in trypanosomes, TbNOB1 requires its partnering AF TbPNO1 in order to execute specific 18S rRNA 3 end cleavage. 2. Materials and methods Fig. 1. A schematic representation of partial T. brucei and yeast pre-rRNA sequences (not drawn to scale), indicating the cleavages that lead to 18S rRNA production. ETS-External transcribed spacer, ITS-Internal transcribed spacer. * indicates the site where the first cleavage event occurs. (Adapted from [44]).

Likewise, it has distinctive features of rRNA processing, such as fragmentation of the 28S rRNA into six stable fragments [14,15], highly diverged processing enzymes [16], and an 18S rRNA that is the largest known [17,18]. The first cleavage event during the processing of primary rRNA transcripts also exhibits differences. In yeast and metazoans rRNA processing commences by cleavages within the 5 or 3 -ETS sequences [2,4]. For instance, 18S pre-rRNA processing in yeast is initiated by cleavage at site-A0 within the 5 -ETS sequences, followed by A1 to generate the mature 5 -end of 18S rRNA and then A2 within ITS1 to separate the 18S rRNA from the 5.8S/LSU precursor rRNA (Fig. 1, bottom) [2,5]. Initial 5 ETS cleavages further upstream have been observed in vertebrates and other organisms [4,14], yet are notably absent from yeast pre-rRNAs [1]. The process is reversed in T. brucei, where the earliest cleavage event occurs at site 3 within the first ITS, ITS1, to separate the 18S SSU precursor from the 5.8S/LSU precursor (Fig. 1, top) [18,19]. The T. brucei 5 ETS is then removed from pre-18S rRNA by subsequent cleavages at two 5 ETS sites, A’ and A0 (A0 being the initial cleavage site in yeast, as indicated). As in yeast, cleavage at A1 forms the mature 5 -end of T. brucei 18S rRNA. [18,19]. In all species, these steps occur in the nucleolus. The final step of 18S rRNA maturation takes place after export of the 40S precursor to the cytoplasm, where the cleavage at site D (similar or identical to site 2 in T. brucei) [18,19] generates the mature 3 -end of 18S rRNA. In organisms investigated to date, this cleavage step is carried out by the nuclease Nob1, with the overall structure and function of 3 end maturation of the small subunit rRNA apparently universally conserved [20–25]. Nob1 is one of the seven AFs that remain bound to late cytoplasmic pre-40S ribosomes in yeast, the other six being Pno1, Dim1, Enp1, Tsr1, Rio2 and Ltv1 [26]; other sources suggest that late-stage associations with AFs Ppr43 and Rio1 are a possibility [24,27]. All these AFs, with the exception of Ltv1 are essential, and their deletion stalls cytoplasmic maturation of 18S rRNA [28–33]. Nob1 has been shown to directly interact with the RNA-binding AF Pno1 (also called Dim2). Nob1Pno1 interaction is required for optimal yeast ribosome biogenesis, playing a role in cleavage at the 3 -end of 18S rRNA (site D) [34]. The question we address in this work is whether in T. brucei divergent processing within ITS1 in the nucleus is mirrored by differences in the essential cleavage to generate the mature 18S 3 end in the cytosol. Or instead, is this final cytosolic cleavage event, including its enzymology, consistent with what is observed in other eukaryotes and even archaea? We have identified T. brucei homologues of yeast proteins crucial for cytosolic 3 processing of 18S rRNA. Here we report the characterization of Nob1 and Pno1 homologues in T. brucei, TbNOB1 and TbPNO1, which function in many ways remarkably similarly to their yeast counterparts. Silencing of either protein in the T. brucei insect life stage (procyclic form; PF)

2.1. Plasmid constructs 2.1.1. RNAi silencing vectors The plasmid expressing tetracycline (tet)-inducible RNAi for TbPNO1 was constructed by cloning a 460-bp fragment of Tb927.9.11840 from T. brucei PF 29-13 genomic DNA using the primers 5 -ATGACTCGAGAGCAACGGTAATGACGAACC-3 and 5 GTCGAAGCTTTGTGCGTATCTGCAATGACA-3 . Product was digested with XhoI and HindIII (sites underlined), and inserted into similarly digested pZJM (Wang et al., 2000) to create pZJMTbPNO1. pZJM-TbNOB1 was constructed in a similar manner, except that the 599-bp fragment of Tb927.11.10860 was amplified using primers 5 -AGATCTCGAGCAACGCACCTCCATGTATTG-3 and 5 -CACGAAGCTTATTACCGCTACCGCATTCAC-3 , digested with HindIII only, and inserted into pZJM by one sticky end-one blunt end ligation. 2.1.2. Expression constructs To generate C-terminally TAP tagged TbPNO1 for exogenous expression in T. brucei (expression from extra copy of gene introduced in rRNA locus), full-length TbPNO1 was amplified with primers 5 - AGTCCAAGCTTATGCTCTCAGCAGCT-3 and 5 - GAGCTGGATCCAAAGGTATCGTTAAC-3 . After digestion with HindIII and BamHI, the insert was cloned into similarly digested pLEW79-TAP vector (Panigrahi 2003). To generate N-terminal 6X His-tagged TbPNO1 construct for both cell free and recombinant expression in E. coli, full-length TbPNO1 was amplified with primers 5 - TCAGAAGATCTGATGCTCTCAGCAG-3 and 5 ACAGCCTCGAGTTAAAAGGTATCG-3 , digested with BglII and XhoI, and ligated into similarly digested pET30a (Novagen). To generate N-terminal 6X His + Xpress-tagged TbNOB1, full length TbNOB1 was amplified with primers 5 -ATGTAGGATCCATATGTCGTGGGCTGCA3 and 5 -ATCTAGAATTCTATCACTTCCGTCGCGC-3 , digested with BamHI and EcoRI, and ligation into similarly digested pRSET-C (Invitrogen). 2.2. Cell culture and manipulations The T. brucei PF 29-13 cell line [35] was transfected with 10 ␮g of NotI-linearized plasmid. Stable cell lines were selected by growth in SDM-79 medium containing 10% fetal bovine serum, 15 ␮g/ml of G418, and 25 ␮g/ml of hygromycin, with 2.5 ␮g/ml of phleomycin as the selective agent for both RNAi and tagged protein expression cell lines. RNAi silencing was induced with 1 ␮g/ml tet, and the uninduced and induced cells were counted daily to obtain growth curves. The cells were maintained between 1.0 × 106 and 2.5 × 107 cells/ml throughout the course of RNAi induction. 2.3. Purification of TAP-tagged TbPNO1 and mass spectrometry Expression of the TAP-tagged TbPNO1 protein was induced by adding 100 ng/ml of tet to the culture at a density of 1.2 × 106

Please cite this article in press as: S. Kala, et al., The interaction of a Trypanosoma brucei KH-domain protein with a ribonuclease is implicated in ribosome processing, Mol Biochem Parasitol (2016), http://dx.doi.org/10.1016/j.molbiopara.2016.12.003

G Model MOLBIO-11033; No. of Pages 10

ARTICLE IN PRESS S. Kala et al. / Molecular & Biochemical Parasitology xxx (2016) xxx–xxx

cells/ml and grown to a density of 2.0 × 107 cells/ml for about 48 h when expression of the tagged protein was verified by immunoblotting with PAP reagent (Sigma). Tagged TbPNO1 complexes were purified from 2 l of cells by sequential IgG and calmodulin affinity chromatography as described [36]. The TEV and calmodulin eluates obtained by TAP were precipitated, digested in-solution with trypsin and analysed by mass spectrometry (LC–MS/MS) at the Oregon Health and Science University Proteomics Shared Resource (fee for service). These fractions were also used for the in vitro endonuclease assay. 2.4. Co-immunoprecipitation (CoIP) Unlabelled, 6XHis tagged TbPNO1 and TbNOB1 proteins were expressed in the TNT system from their respective expression constructs, as per the manufacturer’s instructions (Promega), and run on a SDS-PAGE gel. Identities of bands were verified by immunoblotting with anti-6X His monoclonal antibody. Immunoblotting also enabled quantification by densitometry using Versadoc (BioRad). For the CoIP of TbPNO1 in the presence or absence of Xpresstagged TbNOB1, both proteins were 35 S-labelled during TNT expression. Equimolar concentrations of the proteins (0.5 pmole), as determined by quantification above, were mixed and incubated for 30 min at room temperature in the same buffer system. Five ␮l of Dynabeads M-280 Sheep anti-Mouse IgG (Invitrogen) were coupled with 0.5 ␮l anti-Xpress antibody (Invitrogen) in IP200 buffer (10 mM Tris pH 7.4, 10 mM MgCl2 , 200 mM KCl, 0.1% Triton X-100 and 1% BSA) by incubation for 1 h at 4 ◦ C with bi-directional mixing and then washed two times with IP200 buffer. Protein mixtures were incubated with antibody-coated beads in IP200 buffer for 15 min at 4 ◦ C with rotation. Beads were washed three times with IP200 buffer and resuspended in 1X SDS loading dye followed by SDS PAGE and visualization of bead-bound proteins by phosphorimaging. 2.5. Recombinant protein purification Expression vectors were individually transformed into E. coli strain BL21 (Rosetta DE3 pLysS; Novagen), grown to a density of 0.6 OD600 and induced with 1 mM IPTG for 3 h at 37 ◦ C (TbPNO1) and for 8 h at 18 ◦ C (TbNOB1). Cells were collected by centrifugation at 8000 rpm for 10 min at 4 ◦ C. Cell pellet from 1 l of induced culture was resuspended in 20 ml of lysis buffer (50 mM TrisCl at pH 8.0, 300 mM NaCl, 10 mM imidazole, 0.1% Triton X and 1X Protease inhibitors). Lysozyme (Sigma) and DNase (protease free; Roche) were added to a final concentration of 1 mg/ml and 20 ␮g/ml, respectively with supplementation of 10 mM MgCl2, for DNase treatment of the lysate at 4 ◦ C for 30 min, followed by centrifugation at 16,000g for 30 min at 4 ◦ C. The cleared lysate was then incubated with 1 ml of IMAC Nickel charged resin (BioRad), which was pre-equilibrated with binding buffer (50 mM NaH2 PO4 at pH 8.0, 500 mM NaCl, and 10 mM imidazole), and the mixture was rotated for 1 h at 4 ◦ C. The resin-lysate slurry was loaded into a disposable 20 ml column, drained by gravity flow and washed with 5 × 10 ml wash buffer (50 mM NaH2 PO4 at pH 8.0, 500 mM NaCl, and 20 mM imidazole). The His-tagged recombinant proteins were eluted with 10 ml of elution buffer (50 mM NaH2 PO4 at pH 8.0, 500 mM NaCl, 500 mM imidazole and 10% glycerol), concentrated to a volume of 2.5 ml using Amicon centrifugal filter device (Millipore) of appropriate size and immediately dialysed in three changes of Tris buffer (20 mM Tris-HCl at pH 7.6 and 50 mM NaCl). Glycerol was added to a final concentration of 30% and the proteins were stored at −80 ◦ C. The concentration of proteins was determined using their His-tags in a quantitative immunoblot with Smart-His

3

tagged protein standards (Genscript) and by using a Versadoc (BioRad) for imaging. 2.6. In vitro transcription and labeling of RNA substrate The RNA substrate encompassing cleavage site 2 was transcribed in vitro by T7 polymerase (Promega) transcription of the synthetic DNA oligonucleotide 5 - TATGTATATTTTTGGTTGCATACTGTGCAATTATACATGCACATAAATATGCTCTTTTTTGTATAATGGATATCAGA**AAATGATCCAGCTGCAGGTTCACCTACAGCTACCTTGTTACGACTTTTGCTTCCTCTATTGAAGCAATATCGGCCCTATAGTGAGTCGTATTA-3 , in combination with a T7 promoter oligonucleotide, complementary to the underlined part of the sequence. The cleavage site 2 is marked by **. An artificial stem structure (indicated by bold letters) was added to the above-mentioned substrate RNA by T7 polymerase transcription of the following DNA oligonucleotide 5 GCCCCGGGCTATGTATATTTTTGGTTGCATACTGTGCAATTATACATGCACATAAATATGCTCTTTTTTGTATAATGGATATCAGA**AAATGATCCAGCTGCAGGTTCACCTACAGCTACCTTGTTACGACTTTTGCTTCCTCTATTGAAGCAATATCGGGCCCGGGGCCCCCTATAGTGAGTCGTATTA 3 . Both substrates were purified on a denaturing polyacrylamide gel and radiolabelled at the 3 -terminus by [5 -32 P] pCp ligation. 2.7. Endonuclease assay The nuclease activity of recombinant TbNOB1 was tested in the presence and absence of recombinant TbPNO1 protein, by using a 3 radiolabeled substrate RNA (described above). Each 30 ␮l reaction consisted of 6 nM labelled RNA that was first heated at 90 ◦ for 2 min, then cooled down at room temp for 1 h, incubated with the indicated protein in a buffer consisting of 25 mM Tris-HCl at pH 7.6, 75 mM NaCl, 5 mM MnCl2 , 1 mM DTT, 100 ␮g/ml BSA, 0.7 unit/␮l RNasin Plus (Promega) and 0.1 ␮g/␮l torula yeast RNA. The reaction was incubated at 30 ◦ C for 3 h and stopped by the addition of 0.3 ␮g/␮l proteinase K and 0.5% SDS with further incubation of 30 min at 37 ◦ C. The RNA was then extracted, precipitated, and resuspended in RNA loading buffer and resolved on a denaturing 9% polyacrylamide, 7 M urea gel and visualized by phosphorimaging. 10 ␮l of the TEV eluate from TbPNO1-TAP was also tested for activity in an identical manner. 2.8. Quantitative real time PCR (qPCR) Real-time PCR was carried out essentially as described [37]. Total RNA was extracted using Trizol Reagent (Invitrogen) from ∼1 × 108 cells of TbPNO1 and TbNOB1 RNAi, in which RNAi was induced by 2 or 4 days of growth in tet and also from equal number of non-induced cells. 10 ␮g of RNA was DNase I treated using the DNA free kit (Ambion). The cDNA templates for real-time PCR were reverse transcribed from 4.5 ␮g of RNA using random hexamers and Taqman Reverse Transcription Reagents (Applied Biosystems) in a 30 ␮l reaction. Each experiment had a control reaction without reverse transcriptase. The 30 ␮l reaction was then diluted sevenfold in water. Amplification reactions were set up in triplicates in a 96-well plate format, and each PCR reaction contained 12.5 ␮l of SYBR Green Master Mix (Applied Biosystems), 5 ␮l of 1.5 ␮M forward oligo, 5 ␮l of 1.5 ␮M reverse oligo, and 2.5 ␮l cDNA template (or −RT control). Thermal dissociation confirmed that the PCR generated a single amplicon. Relative changes in target amplicons were determined using the Pfaffl method [38], with PCR efficiencies calculated by linear regression using LinRegPCR [39]. Data were normalized to ␤-tubulin, and relative changes in target amplicons after RNAi induction, were expressed as fold-changes relative to uninduced control cells.

Please cite this article in press as: S. Kala, et al., The interaction of a Trypanosoma brucei KH-domain protein with a ribonuclease is implicated in ribosome processing, Mol Biochem Parasitol (2016), http://dx.doi.org/10.1016/j.molbiopara.2016.12.003

G Model MOLBIO-11033; No. of Pages 10

ARTICLE IN PRESS S. Kala et al. / Molecular & Biochemical Parasitology xxx (2016) xxx–xxx

4

Primers for TbPNO1-forward: 5 TTATGGGAACAACACAAAATATTCG-3 , reverse: 5 -GCGTGTAAACCTTCGTTGCA-3 . Primers for TbNOB15 -TGCTAGACGGCACAGCTGAT-3 , reverse: 5 forward:  CGCGCACCTCGGAAATAA-3 . Primers for cleavage at site 2- forward: 5 -TGCAGCTGGATCATTTTCTGA-3 , reverse: 5 Primers for GGCATATAGAAACACATACATGTAAAACAT-3 . cleavage at site 3- forward: 5 -TCGCATATTTTCTCCCTGTTGA3 , reverse: 5 -GAAATAGGAAGCCAAGTCATCCA-3 . Primers for cleavage at site A1- forward: 5 - TTCCCCACAGCGGATCAC-3 , reverse: 5 -AGCATATGACTACTGGCAGAATCAA-3 . Primers for ␤-tubulin- forward: 5 -TTCCGCACCCTGAAACTGA-3 , reverse: 5 -TGACGCCGGACACAACAG-3 . 2.9. Indirect immunofluorescence Uninduced cells or cells induced to express the TAP-tagged TbPNO1 were grown to various concentrations in culture (5 × 107 cells/ml can be considered approaching or at stationary stage). Cells were spun down and washed once in TDB (20 mM Na2 HPO4 , 2 mM NaH2 PO4 , 5 mM KCl, 80 mM NaCl, 1 mM MgSO4 and 10 mM glucose [pH 7.4]), resuspended to 6–7 × 106 cells/ml in TDB, and spotted onto coverslips coated with poly-l-Lysine (Sigma). All steps were carried out at room temperature. The parasites were allowed to adhere to the coverslips for 1 h and then fixed for 10 min with 4% paraformaldehyde in PBS. After washing twice with PBS, cells were permeabilized by treatment with 0.2% Triton X-100 in PBS for 15 min. After washing twice with PBS again, cells were blocked for 1 h with 3% BSA in PBS. This was followed by incubation for 1 h, with Rabbit Anti-Protein-A antibody (P3775, Sigma), which was diluted 1:40,000 in PBS. After three washes, the cells were incubated for 1 h in a moist chamber with Alexa Fluor 594 Goat Anti-Rabbit IgG (Invitrogen), which was diluted 1:1000 in PBS containing 3% BSA. After three more washes, the cells were treated for 15 min with a 2 ␮M DAPI solution in PBS to stain DNA. The cells were again washed three times before mounting with Fluoromount-G (Southern Biotech). Fluorescence was observed with a confocal laser scanning microscope, Zeiss LSM 710 (Carl Zeiss, Jena, Germany). Multiple views of TbPNO1-TAP expressing cells were digitally captured. From these images, approximately 100 cells were counted for each cell culture stage into categories of some versus no detection of cytosolic signal, and peripheral nucleolus-concentrated vs evenly-distributed nuclear signal. 3. Results 3.1. TbPNO1 and TbNOB1 are required for normal growth of PF T. brucei Interrogation of the T. brucei genome revealed multiple potential homologues to yeast cytosolic AFs that process the 3 end of 18S rRNA. We chose to first investigate the RNA-binding and catalytic AF homologues. The putative homologue of yeast Pno1 (TbPNO1; Tb927.9.11840) shares 51% sequence identity with Pno1 over most of its length, although TbPNO1 lacks 64 amino acids at its N-terminus (Supplementary Fig. S1). Like Pno1, TbPNO1 possesses a KH domain at the C-terminus. KH domains typically bind RNA, and TbPNO1 contains the fundamental GxxG motif important for this function [40]. Additionally, both the yeast and trypanosome proteins possess another KH-like domain lacking this GxxG motif [34]. As yeast Pno1 is essential, we would expect a severe growth phenotype upon TbPNO1 repression if it functions similarly. We measured the effect of TbPNO1 tetracycline (tet)-induced RNAi-mediated silencing on cell growth in PF cells for six days following induction. Starting at day 3, growth inhibition was observed (Fig. 2A,

top panel), while addition of tet to the parental cell line lacking inducible constructs did not affect its growth (data not shown). TbPNO1 silencing was verified by measurement of TbPNO1 mRNA levels by quantitative (q)RT-PCR following tet induction, as shown in Fig. 2A, bottom panel. The TbPNO1 mRNA abundance in induced cells had decreased by ∼70% as compared to uninduced cells on day 2, and this reduction was maintained through at least day 4. These data demonstrate that TbPNO1 is required for normal cell growth in PF T.brucei. The catalytic AF homologue of interest in T. brucei is TbNOB1 (Tb927.11.10860). TbNOB1 possesses a C-terminal zinc-ribbon domain and an N-terminal PIN domain, as do yeast, archaeal, and metazoan Nob1. The amino acid sequences of yeast Nob1 and TbNOB1 are not as similar as that of the Pno1 and TbPNO1, with only 27% sequence identity over approximately 300 of the 432 predicted amino acids of TbNOB1, with multiple deletions within the region of similarity, including deletion of a portion of the PIN domain immediately following the putative active site (Supplementary Fig. S1). If TbNOB1 is a Nob1 orthologue, it should also be essential for normal growth. Tet-inducible silencing of TbNOB1 resulted in only a small reduction in the mRNA level of TbNOB1 when analyzed by qRTPCR (Fig. 2B, bottom panel): messenger RNA levels of TbNOB1 in induced cells had only decreased by 20% as compared to uninduced cells on day 2, and by ∼40% on day 4. Thus it is not surprising that growth inhibition was milder than that of TbPNO1 silenced cells; nonetheless, the difference between the growth rate of tet-induced and non-induced cells was clear and significant (Fig. 2B, top panel). Similar to the case with TbPNO1 depletion, growth inhibition due to TbNOB1 silencing also started at day 3 (Fig. 2, top panels). Taken together, the effect of TbPNO1 and TbNOB1 silencing on cell growth is consistent with an important cellular function for these proteins. 3.2. TbPNO1 is primarily nuclear with differing patterns of nucleolar association Yeast Pno1 likely accompanies the pre-40S particles during transport from the nucleus to the cytoplasm where the site D cleavage occurs [41]. However, localization is dependent on culture growth phase: it is detected in both locations at early log phase, is progressively depleted from cytoplasm and concentrated in the nucleus at the exponential phase, and detected only in the nucleolus in stationary cells [40]. If TbPNO1 is its T. brucei homologue, we also would expect dual localization and perhaps cell density-dependent localization for TbPNO1. Most importantly, an 18S 3 maturation role requires at least some cytosolic TbPNO1. Lacking adequate TbPNO1-specific antibodies, we determined the localization of exogenously expressed tandem affinity purification (TAP)-tagged TbPNO1 by indirect immunofluorescence targeted to the TAP tag Protein-A moiety. Cells of mixed phenotype were observed, even among cells collected at the same cell culture stage. However, all cells had predominantly nuclear localization, with most cells also exhibiting some degree of cytosolic TbPNO1; representative images are shown in patterns consistent with that observed in yeast. When cytosolic signal was detected, it ranged in intensity from barely above background (most common; top two examples in Fig. 3) to clearly evident but less intense than the nuclear signal. A progressively smaller fraction of cells (∼70% in 5 × 106 cells/ml culture to ∼50% in 1 × 107 cells/ml culture to ∼10% in 5 × 107 cells/ml culture) exhibited some cytosolic localization as cells became more concentrated; paralleling the situation in yeast. A striking result was the non-uniform appearance of the nuclear staining. In the earliest stage of cell culture growth, most cells (>70%) exhibited a concentration of signal about the nucleolar periphery (Fig. 3). This was true to a lesser extent for cells in the middle collection point. Surprisingly, while exclusively nucle-

Please cite this article in press as: S. Kala, et al., The interaction of a Trypanosoma brucei KH-domain protein with a ribonuclease is implicated in ribosome processing, Mol Biochem Parasitol (2016), http://dx.doi.org/10.1016/j.molbiopara.2016.12.003

G Model MOLBIO-11033; No. of Pages 10

ARTICLE IN PRESS S. Kala et al. / Molecular & Biochemical Parasitology xxx (2016) xxx–xxx

5

Fig. 2. The repression of Tb927.9.11840 (TbPNO1) and Tb927.11.10860 (TbNOB1) by RNAi inhibits cell growth. (A) Top panel- Growth of TbPNO1-RNAi cells in the absence or presence of tetracycline (tet) as indicated, was monitored for 6 days. The error bars (small enough to be mostly obscured by data point symbols) indicate standard deviation of four replicates. Bottom panel-The relative abundance of TbPNO1 mRNA in cells in which TbPNO1 was either expressed (light grey bar, normalized to 1) or repressed (dark grey bar) for 2 or 4 days. The relative change in the target amplicon was determined by quantitative real-time RT-PCR analysis of total RNA and normalized to ␤-tubulin. The error bars indicate the standard deviation of three replicates. (B) Top and Bottom panels-same as A, for TbNOB1-RNAi.

olar localization was observed for yeast Pno1 in stationary culture, in stationary trypanosomes (5 × 107 cells/ml) the signal intensity in almost 90% of the cells had become uniform across the nucleus rather than being nucleolus-concentrated. In summary, while TbPNO1 localization is consistent with its function overall, we also observe interesting specific differences in these patterns for which we currently lack an explanation.

3.3. TbPNO1 associates with ribosome assembly factors and directly binds TbNOB1 Yeast Pno1 is one of the seven AFs that remain bound to the late cytoplasmic pre-40S ribosomes. It directly interacts with two other AFs: Nob1 and the kinase Rio2 [26,34]. Thus, we tested whether TbPNO1 is also part of a cytosolic AF complex in T. brucei by analysis of affinity-purified complexes of TbPNO1-TAP. An initial in-house LC–MS/MS analysis of our first preparation of the 1st affinity purification step (TEV) eluate revealed only the presence of TbPNO1 and TbNOB1 (not shown). While this provided some evidence for interaction between these two proteins, other expected AF complex proteins were lacking. Therefore, another purification was performed and sent to a facility experienced in high-sensitivity identification of peptides in trypanosome preparations. Co-purified proteins in eluates following the 1st affin-

ity purification step (TEV) and 1st + 2nd affinity purification steps (TEV + calmodulin) are reported in Table 1. As expected, the greatest number of unique peptides in both eluates were TbPNO1-derived. Interestingly, among common contaminants and other ribosomal proteins found, four potential homologues of yeast AFs co-purified with tagged TbPNO1 in the TEV eluate. These include TbNOB1 and a putative Rio2, homologues of the yeast Pno1 direct interactors, with Tsr1 and Enp1 AF homologues also present. With the exception of a single peptide from the Enp1 homologue, peptides of TbPNO1, TbNOB1, and the AFs were completely absent from a TEV eluate of TAP-tagged mRNA 3 UTR-binding protein DRBD13 (unpublished) identically processed and analyzed. Therefore, TbNOB1 and the Rio2, Tsr1, and Enp1 homologue peptides in TbPNO1 TEV eluate are unlikely to be contaminants. A homologue of yeast methylase Dim1 was not detected although a putative gene encoding such a protein is present in T.brucei (Tb927.6.1610). No candidate for a homologue of the non-essential yeast AF Ltv1 was found in the T.brucei genome, and so its absence from the eluted complex is to be expected. However, we cannot rule out that we are missing some interactions due to the size or location of the TAP tag used for purification. Overall, purification of TbPNO1-containing complexes demonstrates that yeast and T. brucei cytosolic AFs associations may be more similar than they are different.

Please cite this article in press as: S. Kala, et al., The interaction of a Trypanosoma brucei KH-domain protein with a ribonuclease is implicated in ribosome processing, Mol Biochem Parasitol (2016), http://dx.doi.org/10.1016/j.molbiopara.2016.12.003

G Model

ARTICLE IN PRESS

MOLBIO-11033; No. of Pages 10

S. Kala et al. / Molecular & Biochemical Parasitology xxx (2016) xxx–xxx

6

Fig. 3. Localization of TAP-tagged TbPNO1. TAP-tagged TbPNO1 protein was detected in various patterns in the nucleus, as revealed by co-localization with anti protein-A antibody detecting TbPNO1-TAP and DAPI that stains the nucleus and kinetoplast. Most frequently the nuclear signal intensity was concentrated at the nucleolar periphery. Some but not all cells also exhibited TbPNO1-TAP signal in the cytoplasm, usually at a barely detectable level. An uninduced control not expressing the TAP-tag did not show any staining with the anti protein-A antibody. Supplemental Fig. S2 contains additional uninduced controls that include examples from all stages of culture growth.

Table 1 List of the putative assembly factors that co-purify with TbPNO1-TAP in the TEV and calmodulin eluates.

TEV Eluate

Calmodulin Eluate

Gene ID

Sequence coverage (%)

# Unique peptides

Predicted homolog in yeast

Tb927.9.11840 (TbPNO1) Tb927.11.10860 (TbNOB1) Tb927.6.2840 Tb927.8.1410 Tb927.6.1900 Tb927.9.11840 (TbPNO1) Tb927.11.10860 (TbNOB1)

34.1 38.4 21.1 7.7 14.1 45 39.6

69 63 13 8 9 14 9

Pno1 (or Dim2) Nob1 Rio2 Tsr1 Enp1 Pno1 (or Dim2) Nob1

The calmodulin eluate with its additional purification stringency may be expected to contain only the proteins most stably associated with TbPNO1. In fact, only TbNOB1 among the expected AFs was detected in both calmodulin elutions. The absence of any other AFs in the calmodulin eluate suggests that TbPNO1 has a direct interaction with TbNOB1, and only weak or secondary interactions with other putative AFs. In an attempt to confirm these interactions, we generated a TbNOB1 TAP-tag cell line in PF T.brucei. Correct integration of the pLew79-TAP-TbNOB1 plasmid into the genome was demonstrated (not shown). However, tagged TbNOB1 expression could not be detected by immunoblotting with PAP reagent or an antibody against the Calmodulin binding protein tag. TbNOB1 expression with an alterative (PTP) tag was also unsuccessful. Therefore, alternative strategies were employed to verify TbPNO1 and TbNOB1 interactions.

To determine whether TbPNO1 and TbNOB1 interact directly as suggested by the conservation of the Pno1:Nob1 interacting domain [34], we performed an in vitro coimmunoprecipitation (CoIP) experiment. Both proteins separately were 35 S-methionine labeled during expression in a cell-free coupled transcriptiontranslation system. Labeled TbPNO1 and TbNOB1 were then mixed together and incubated, after which they were immunoprecipitated with bead-bound antibody specific to the Xpress tag on TbNOB1. Fig. 4A shows that TbPNO1 appears in the eluate from the beads only in the presence of TbNOB1. This specific interaction is much stronger than the background level of TbPNO1 appearing in the mock pull-down that lacks TbNOB1. This confirms that TbPNO1 and TbNOB1 directly interact with each other.

Please cite this article in press as: S. Kala, et al., The interaction of a Trypanosoma brucei KH-domain protein with a ribonuclease is implicated in ribosome processing, Mol Biochem Parasitol (2016), http://dx.doi.org/10.1016/j.molbiopara.2016.12.003

G Model MOLBIO-11033; No. of Pages 10

ARTICLE IN PRESS S. Kala et al. / Molecular & Biochemical Parasitology xxx (2016) xxx–xxx

7

Fig. 4. TbPNO1 and TbNOB1 interact in vitro, and TbNOB1 demonstrates likely site 2-specific endonuclease activity in vitro in the presence of TbPNO1. (A) SDS-PAGE analysis of products of co-immunoprecipitation of 35 S-methionine labeled TbPNO1 with 35 S-methionine labeled TbNOB1 protein using an antibody against the Xpress tag on TbNOB1 protein for immunoprecipitation (last lane). Included as a control for indiscriminate binding of TbPNO1 to Xpress tag antibody beads is a mock immunoprecipitation using TbPNO1 but not TbNOB1 (first lane). Demonstration of successful Xpress tag immunoprecipitation of TbNOB1 in the absence of TbPNO1 is provided in the middle lane. (B) Affinity purified TbNOB1 and TbPNO1 proteins used in the in vitro endonuclease assay, as analyzed by SDS-PAGE and Coomassie staining. Molecular weight markers are indicated. (C) In vitro endonuclease assay to monitor cleavage at site 2. The 32 P labeled substrate RNA encompasses the cleavage site 2. Specific cleavage product is not detected in the presence of 2 ␮M of purified TbPNO1 or 0.4–1 ␮M of purified TbNOB1, which does demonstrate non-specific ribonuclease activity. When added in the presence of TbPNO1, the non-specific ribonuclease activity of TbNOB1 is largely inhibited, and a cleavage product of a size corresponding to site 2-specific endonuclease activity of TbNOB1 is observed. The specific cleavage product is also produced in the presence of the TEV eluate fraction of TbPNO1-TAP tagged cells. The marker is RNase T1-digested substrate, so products corresponding to cleavages after “G” nucleotides in the substrate are observed.

3.4. TbNOB1 demonstrates ribonuclease activity consistent with site 2-specific cleavage in the presence of TbPNO1 Yeast site D cleavage to generate the 3 end of 18S rRNA is analogous to site 2 cleavage in trypanosomes. As TbPNO1 and TbNOB1 interact with each other and with AF homologues in ways similar to that of yeast, we hypothesized that TbNOB1 would perform site 2 specific cutting in vitro. Furthermore, because the Pno1-Nob1 interaction in yeast results in higher Nob1 binding affinity for its substrate in vitro [23], we analyzed the impact of the presence of TbPNO1 on TbNOB1’s cleavage activity. We purified recombinant, 6xHis-tagged TbNOB1 and TbPNO1 proteins from E. coli, and analyzed these by SDS-PAGE (Fig. 4B) for these experiments. Both proteins migrate in PAGE as expected for their predicted size. Additional minor bands are most likely recombinant protein degradation products rather than E. coli proteins, as the minor bands are different sizes in each protein purification and the vast majority are smaller than the purified recombinant protein. The majority of TbNOB1 was in the insoluble pellet during E. coli extract clarification prior to column purification (Supplementary Fig. S3), so it is unsurprising that the final preparation of TbNOB1 appears less pure than TbPNO1. The identity of each protein was confirmed by immunoblotting with anti-6xHis antibody (not shown). In vitro cleavage assays were performed with purified TbNOB1 and a 150 bp RNA oligonucleotide comprising of pre-18S rRNA

sequence encompassing site 2 as a substrate. Surprisingly, site 2-specific endonuclease activity was not observed. Rather, incubation of the 3 -radiolabeled substrate with all tested concentrations (0.4–1 ␮M) of purified TbNOB1 resulted in considerable nonspecific substrate degradation (Fig. 4C, lanes 1, 3, & 4). Interestingly, in the presence of 2 ␮M of TbPNO1, nonspecific degradation by TbNOB1 was substantially reduced and a distinct band, presumably generated by precise endonucleolytic cleavage at site 2, was observed (Fig. 4C, lanes 5 & 6). The gel location of the cleavage product was slightly above that of the 74 nt fragment of the same substrate digested with RNase T1, exactly as expected since cleavage site conservation would result in a 77 nt fragment. Precise cleavage activity requires TbNOB1 and is not the result of contaminating E. coli ribonucleases, as the RNA substrate incubated with 2 ␮M of TbPNO1 alone (purified using the same methods at TbNOB1) does not produce the site 2 cleavage product or any other products when compared to untreated substrate (Fig. 4C, lanes 1 & 2). The simplest explanation for these results is that TbPNO1 regulates the nuclease activity of TbNOB1 in vitro, and targets TbNOB1 cleavage specifically to site 2. To determine if TbNOB1 and TbPNO1 perform similarly in a more biologically relevant context, the substrate was incubated with TEV eluate of the TbPNO1-TAP purification, containing TbPNO1, TbNOB1 and other AFs (Table 1). A robust cleavage product of a size consistent with

Please cite this article in press as: S. Kala, et al., The interaction of a Trypanosoma brucei KH-domain protein with a ribonuclease is implicated in ribosome processing, Mol Biochem Parasitol (2016), http://dx.doi.org/10.1016/j.molbiopara.2016.12.003

G Model MOLBIO-11033; No. of Pages 10 8

ARTICLE IN PRESS S. Kala et al. / Molecular & Biochemical Parasitology xxx (2016) xxx–xxx

a cut at site 2 was also observed upon incubation of the RNA substrate, similar to activity of recombinant TbNOB1 and TbPNO1. In an attempt to determine whether TbNOB1 nonspecific activity in the absence of TbPNO1 was exoribunucleolytic or endoribonucleolytic, we repeated the in vitro RNA degradation assay, this time encompassing the 5 and 3 ends of the substrate RNA with a stem structure. Such a stem loop should prohibit exoribonucleolytic activity while still allowing both site-2 and nonspecific endonucleolytic cleavages. Indeed, this substrate was not degraded in the presence of TbNOB1 alone. However, the TbPNO1 mediated site 2specific endonuclease activity of TbNOB1 was also lost (data not shown). Possibly, the artificial stem-embedded substrate was not optimally folded for TbPNO1 binding, TbNOB1 binding, or active site access to substrate. Together, the in vitro assays show that TbNOB1 purified from E. coli exhibits a nonspecific and currently undefined degradation activity, but in the presence of TbPNO1, this activity is regulated to result primarily in cleavage of an 18S-like substrate right at or at most 1–2 nt away from site 2. Therefore, it is highly likely that a complex containing both TbNOB1 and TbPNO1 are responsible for generation of the mature 18S 3 end.

3.5. Repression of TbPNO1 and TbNOB1 reduces in vivo cleavage activity at sites 2, 3 and A1 Yeast site D cleavage in the cytosol requires Nob1 [20–22], while Pno1 is also required for nucleolar pre-rRNA processing at cleavage sites A1 and A2 [34,40–42]. The role of Nob1 in A1 and A2 cleavage has not been determined to our knowledge, despite its co-localization to nucleolus and cytosol in yeast [20]. To examine whether the presence of TbPNO1 or TbNOB1 influences cleavage at the trypanosome cut sites corresponding to A1 and 2, we examined cleavage upon TbPNO1 and TbNOB1 silencing. Additionally, we investigated the effect of their silencing on the initial nucleolar cut site 3 specific to trypanosomes. Efficiency of processing was measured by qRT-PCR amplification with primers flanking each cleavage site (Fig. 5A). If the RNA is intact within the region spanned by the primers, the target will be amplified; hence amplification at an earlier threshold cycle is a reflection of less cleavage activity at the examined site. Relative amplification at the three cleavage sites was measured in day 2 and 4 induced and uninduced TbPNO1 and TbNOB1 RNAi cells lines (Fig. 5B). Repression of TbPNO1 resulted in lower amplification threshold cycles, and hence reduced cleavage activity, at all the sites tested. The cleavage at site 3 was most affected (3.5–4 fold), followed by cleavages at site A1 (2–3 fold) and site 2 (around two fold). Interestingly, repression of TbNOB1 for 4 days resulted in a two-fold decrease in the cleavage activity at both sites 2 and 3, although it only had a nominal effect on the cleavage activity at site-A1 and on all 3 sites on day 2. Considering that the mRNA level of TbNOB1 had only decreased by 20% on day 2 and 40% on day 4 of RNAi (Fig. 2B, lower panel), the observed two-fold decrease in cleavage activity on day 4 samples may reflect that sites 2 and 3 are primarily TbNOB1 substrates in vivo. In order to rule out secondary effects caused by the RNAi induced growth defects, we also performed qRT-PCR amplification of these cleavage sites on RNA extracted from an unrelated RNAi cell line at a time point when growth is similarly impacted. No change was observed in levels of any of the three target amplicons at the 6th day post RNAi induction of Tb927.10.7910 [43], a putative mitochondrial post-transcriptional regulator of RNA editing (Supplementary Fig. S4). These data suggest that in trypanosomes, TbPNO1 is involved in pre-rRNA processing at cleavage sites A1 and 2 while TbNOB1 functions primarily at the cytosolic site 2 (analogous to D), which models the situation in yeast. Interestingly however, we also demonstrate that both proteins play a role in cleavage at site 3 that is the initial cleavage site for the precursor

rRNA in trypanosomes but not in yeast or other model organisms analyzed.

4. Discussion Ribosomal synthesis and maturation is fundamental to virtually every cellular function. Therefore, it is not surprising that despite the great evolutionary divergence between trypanosomes and yeast, the function of cytosolic AFs responsible for 18S 3 maturation is largely conserved. In fact, this same maturation process in archaea is known to include orthologues of yeast Rio2, Dim1, Pno1 and Nob1 [23]. The central findings of our study are as follows: TbPNO1 exhibits a localization pattern consistent with a role mainly in the nucleus, but minor cytosolic localization suggests that some TbPNO1 accompanies the 20S particle out of the nucleus for final cytosolic-localized processing steps. TbPNO1 and TbNOB1 interact directly in vivo and in vitro, and at least sometimes these are likely part of a larger AF factor-containing complex. Silencing of TbPNO1 and partial silencing of TbNOB1 result in inhibition of the same or nearly identical cleavage sites as their yeast homologues, and additionally inhibit cleavage at the precursor rRNA initial processing site specific to trypanosomes only. Finally, we show that in vitro, TbNOB1 ribonuclease activity is robust and nonspecific, until it is regulated by the addition of its binding partner TbPNO1 to the reaction. The interplay between TbNOB1 and TbPNO1 in the enzymatic assay is most intriguing. Predictably, there are several ways to interpret this result in the context of Nob1 activity in other organisms. Nob1 structure and function have been most extensively studied in archaea, where its role in cytosolic-localized pre-ribosomal small subunit rRNA processing is conserved [27]. Purified recombinant archaeal Nob1 alone performed the expected cleavage activity analogous to that of the TbNOB1-TbPNO1 complex on a substrate similar to ours. However, several archaeal Nob1 mutants exhibited general degradation rather than specific cleavage activity. One of these was a site mutation in a region thought to be required for RNA interactions to stabilize positioning of the catalytic site. Interestingly, this site is neither conserved in TbNOB1 nor yeast Nob1. At face value, yeast in vitro ribonuclease assays would suggest that Nob1 is capable of appropriate cleavage on its own [24]. However, these experiments utilized an RNA with the expected cleavage site presented on a loop embedded in a stem loop “to prevent 3 –5 and 5 –3 exonuclease degradation of the substrate”. Therefore, we speculate that a nonspecific Nob1 decay activity with a substrate such as ours with unprotected ends could potentially be observed. Furthermore, the study utilized tagged Nob1 purified from yeast itself that resolved as multiple bands with SDS-PAGE. It is possible that some endogenous yeast Pno1 was present in the purified fraction, and in fact is essential for the specificity of the cleavage in yeast as well. However, another study reported that interactions of Nob1 and Pno1 may have no impact of Pno1 on Nob1 rRNA cleavage [34]. In summary, we show that, unexpectedly, TbNOB1 catalytic activity resulting in a product of expected size only occurs upon addition of TbPNO1. However, it is possible that we would also have observed this result using the recombinant homologues from other eukaryotes in our experimental system, and that such a result is not unique to trypanosomes. We determined both nuclear and cytosolic localization of TbPNO1. For technical reasons, we were unable to do the same for TbNOB1. However, Nob1 in yeast, like TbPNO1, is both nuclear and cytosolic. Since TbNOB1 silencing results in reduced cleavage activity at site 3 which occurs in the nucleus as well as cytosolic site 2 cleavage reduction, we expect that its subcellular localization mirrors that of the yeast orthologue. For Nob1 to be present in the nucleus, it is hypothesized that other factors are necessary

Please cite this article in press as: S. Kala, et al., The interaction of a Trypanosoma brucei KH-domain protein with a ribonuclease is implicated in ribosome processing, Mol Biochem Parasitol (2016), http://dx.doi.org/10.1016/j.molbiopara.2016.12.003

G Model MOLBIO-11033; No. of Pages 10

ARTICLE IN PRESS S. Kala et al. / Molecular & Biochemical Parasitology xxx (2016) xxx–xxx

9

Fig. 5. Silencing of TbPNO1 or TbNOB1 by RNAi reduces cleavage activity at sites 2, 3 and A1. (A) Representation of the forward (F) and reverse (R) primer binding sites, flanking the indicated cleavage sites on the RNA (cDNA) substrate. Reduced cleavage activity in RNAi cells would result in a more intact RNA (cDNA), and hence greater amplification. Image is not to scale. (B) The relative amplification across the cleavage sites in cells in which TbPNO1 or TbNOB1 was either expressed (light grey bar, normalized to 1) or repressed for 2 and 4 days (darker grey bars). The relative change in the target amplicon was determined by quantitative real-time RT-PCR analysis of total RNA and normalized to ␤-tubulin. The error bars indicate the standard deviation of three biological replicates.

to prevent it from acting prior to transfer of the pre-rRNA to the cytosol. Indeed, available evidence does suggest that Nob1 is in general highly regulated by AFs [24,27]. If TbNOB1 indeed plays a role in nucleolar site-3 cleavage, we may discover trypanosomespecific AFs by studying TbNOB1 nuclear function. Furthermore, the impact of TbNOB1 silencing on site 3 cleavage raises the possibility of its involvement in other cleavages such as those required for LSU maturation, an avenue for future exploration. Yeast and archaea have proven their worth as model systems for the study of 18S 3 maturation. However, it is still unknown whether differences between the yeast system and archaea are conserved among all eukaryotes or are specific to yeast, warranting the exploration of this process in another eukaryotic model organism. Furthermore, while in vitro assays can elucidate the effects of other AFs on TbNOB1/Nob1 RNA binding [34] or catalytic activity (this study), it is more difficult to assess other roles of AFs in 18S 3 maturation, such as inhibition of cleavage until the proper time in ribosome assembly. Turowski et al. [27] developed methodology to comprehensively study this using cytosolic pre-40S subunits co-purified with each tagged AF in yeast. The pre-cleaved 40S preribosome upon addition of manganese (required for Nob1 activity) could be tested for site 2 cleavage of 20S, and factors present in the pull-down can be determined, thereby allowing correlation of the accuracy and degree of cleavage with factors present in the purification. Transfer of these techniques to multicellular organisms or mammalian cell culture may be complex. However, T. brucei as a model organism is well suited for these assays.

Acknowledgements Mass spectrometric analysis was performed by the OHSU Proteomics Shared Resource with partial support from NIH grants P30EY010572, P30CA069533, &. R01DC002368-15S1. Access to a confocal laser scanning microscope and assistance was provided by Dr. Petra Rohrbach at the Institute of Parasitology, McGill University. This work was supported by the Natural Sciences and Engineering Research Council of Canada (NSERC) grant 328186 to R.S. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.molbiopara.2016. 12.003. References [1] J. Venema, D. Tollervey, Ribosome synthesis in Saccharomyces cerevisiae, Annu. Rev. Genet. 33 (1999) 261–311. [2] A. Fatica, D. Tollervey, Making ribosomes, Curr. Opin. Cell. Biol. 14 (2002) 313–318. [3] H. Tschochner, E. Hurt, Pre-ribosomes on the road from the nucleolus to the cytoplasm, Trends. Cell. Biol. 13 (2003) 255–263. [4] S.T. Mullineux, D.L. Lafontaine, Mapping the cleavage sites on mammalian pre-rRNAs: where do we stand? Biochimie 94 (2012) 1521–1532. [5] S. Granneman, S.J. Baserga, Ribosome biogenesis: of knobs and RNA processing, Exp. Cell. Res. 296 (2004) 43–50. [6] M. Fromont-Racine, B. Senger, C. Saveanu, F. Fasiolo, Ribosome assembly in eukaryotes, Gene 313 (2003) 17–42.

Please cite this article in press as: S. Kala, et al., The interaction of a Trypanosoma brucei KH-domain protein with a ribonuclease is implicated in ribosome processing, Mol Biochem Parasitol (2016), http://dx.doi.org/10.1016/j.molbiopara.2016.12.003

G Model MOLBIO-11033; No. of Pages 10 10

ARTICLE IN PRESS S. Kala et al. / Molecular & Biochemical Parasitology xxx (2016) xxx–xxx

[7] T. Kiss, Small nucleolar RNA-guided post-transcriptional modification of cellular RNAs, EMBO J. 20 (2001) 3617–3622. [8] A.K. Henras, J. Soudet, M. Gerus, S. Lebaron, M. Caizergues-Ferrer, A. Mougin, Y. Henry, The post-transcriptional steps of eukaryotic ribosome biogenesis, Cell. Mol. Life. Sci. 65 (2008) 2334–2359. [9] B.S. Strunk, K. Karbstein, Powering through ribosome assembly, RNA 15 (2009) 2083–2104. [10] S.M. Adl, A.G. Simpson, C.E. Lane, J. Lukes, D. Bass, S.S. Bowser, M.W. Brown, F. Burki, M. Dunthorn, V. Hampl, et al., The revised classification of eukaryotes, J. Eukaryot. Microbiol. 59 (2012) 429–493. [11] R. Derelle, G. Torruella, V. Klimes, H. Brinkmann, E. Kim, C. Vlcek, B.F. Lang, M. Elias, Bacterial proteins pinpoint a single eukaryotic root, Proc. Natl Acad. Sci. U. S. A. 112 (2015) E693–699. [12] K.D. Stuart, A. Schnaufer, N.L. Ernst, A.K. Panigrahi, Complex management: RNA editing in trypanosomes, Trends. Biochem. Sci. 30 (2005) 97–105. [13] X.H. Liang, A. Haritan, S. Uliel, S. Michaeli, trans and cis splicing in trypanosomatids: mechanism, factors, and regulation, Eukaryot. Cell 2 (2003) 830–840. [14] T.C. White, G. Rudenko, P. Borst, Three small RNAs within the 10 kb trypanosome rRNA transcription unit are analogous to domain VII of other eukaryotic 28S rRNAs, Nucleic. Acids. Res. 14 (1986) 9471–9489. [15] D.A. Campbell, K. Kubo, C.G. Clark, J.C. Boothroyd, Precise identification of cleavage sites involved in the unusual processing of trypanosome ribosomal RNA, J. Mol. Biol. 196 (1987) 113–124. [16] J. Sakyiama, S.L. Zimmer, M. Ciganda, N. Williams, L.K. Read, Ribosome biogenesis requires a highly diverged XRN family 5’- > 3’ exoribonuclease for rRNA processing in Trypanosoma brucei, RNA 19 (2013) 1419–1431. [17] M.N. Schnare, J.C. Collings, M.W. Gray, Structure and evolution of the small subunit ribosomal RNA gene of Crithidia fasciculata, Curr. Genet. 10 (1986) 405–410. [18] T. Hartshorne, W. Toyofuku, Two 5’-ETS regions implicated in interactions with U3 snoRNA are required for small subunit rRNA maturation in Trypanosoma brucei, Nucleic Acids. Res. 27 (1999) 3300–3309. [19] T. Hartshorne, N. Agabian, RNA B is the major nucleolar trimethylguanosine-capped small nuclear RNA associated with fibrillarin and pre-rRNAs in Trypanosoma brucei, Mol. Cell. Biol. 13 (1993) 144–154. [20] A. Fatica, M. Oeffinger, M. Dlakic, D. Tollervey, Nob1p is required for cleavage of the 3’ end of 18S rRNA, Mol. Cell. Biol. 23 (2003) 1798–1807. [21] A. Fatica, D. Tollervey, M. Dlakic, PIN domain of Nob1p is required for D-site cleavage in 20S pre-rRNA, RNA 10 (2004) 1698–1701. [22] A.C. Lamanna, K. Karbstein, Nob1 binds the single-stranded cleavage site D at the 3’-end of 18S rRNA with its PIN domain, Proc. Natl. Acad. Sci. U. S. A. 106 (2009) 14259–14264. [23] T. Veith, R. Martin, J.P. Wurm, B.L. Weis, E. Duchardt-Ferner, C. Safferthal, R. Hennig, O. Mirus, M.T. Bohnsack, J. Wohnert, et al., Structural and functional analysis of the archaeal endonuclease Nob1, Nucleic. Acids. Res. 40 (2012) 3259–3274. [24] B. Pertschy, C. Schneider, M. Gnadig, T. Schafer, D. Tollervey, E. Hurt, RNA helicase Prp43 and its co-factor Pfa1 promote 20 to 18S rRNA processing catalyzed by the endonuclease Nob1, J. Biol. Chem. 284 (2009) 35079–35091. [25] T. Wild, P. Horvath, E. Wyler, B. Widmann, L. Badertscher, I. Zemp, K. Kozak, G. Csucs, E. Lund, U. Kutay, A protein inventory of human ribosome biogenesis reveals an essential function of exportin 5 in 60S subunit export, PLoS Biol. 8 (2010) e1000522. [26] M.G. Campbell, K. Karbstein, Protein-protein interactions within late pre-40S ribosomes, PLoS One 6 (2011) e16194. [27] T.W. Turowski, S. Lebaron, E. Zhang, L. Peil, T. Dudnakova, E. Petfalski, S. Granneman, J. Rappsilber, D. Tollervey, Rio1 mediates ATP-dependent final maturation of 40S ribosomal subunits, Nucleic Acids. Res. 42 (2014) 12189–12199.

[28] W. Chen, J. Bucaria, D.A. Band, A. Sutton, R. Sternglanz, Enp1 a yeast protein associated with U3 and U14 snoRNAs, is required for pre-rRNA processing and 40S subunit synthesis, Nucleic Acids. Res. 31 (2003) 690–699. [29] D. Gelperin, L. Horton, J. Beckman, J. Hensold, S.K. Lemmon, Bms1p, a novel GTP-binding protein, and the related Tsr1p are required for distinct steps of 40S ribosome biogenesis in yeast, RNA 7 (2001) 1268–1283. [30] T.H. Geerlings, A.W. Faber, M.D. Bister, J.C. Vos, H.A. Raue, Rio2p an evolutionarily conserved, low abundant protein kinase essential for processing of 20S Pre-rRNA in Saccharomyces cerevisiae, J. Biol. Chem. 278 (2003) 22537–22545. [31] E. Vanrobays, J.P. Gelugne, P.E. Gleizes, M. Caizergues-Ferrer, Late cytoplasmic maturation of the small ribosomal subunit requires RIO proteins in Saccharomyces cerevisiae, Mol. Cell. Biol. 23 (2003) 2083–2095. [32] C.A. Fassio, B.J. Schofield, R.M. Seiser, A.W. Johnson, D.E. Lycan, Dominant mutations in the late 40S biogenesis factor Ltv1 affect cytoplasmic maturation of the small ribosomal subunit in Saccharomyces cerevisiae, Genetics 185 (2010) 199–209. [33] R.M. Seiser, A.E. Sundberg, B.J. Wollam, P. Zobel-Thropp, K. Baldwin, M.D. Spector, D.E. Lycan, Ltv1 is required for efficient nuclear export of the ribosomal small subunit in Saccharomyces cerevisiae, Genetics 174 (2006) 679–691. [34] H.A. Woolls, A.C. Lamanna, K. Karbstein, Roles of Dim2 in ribosome assembly, J. Biol. Chem. 286 (2011) 2578–2586. [35] E. Wirtz, S. Leal, C. Ochatt, G.A. Cross, A tightly regulated inducible expression system for conditional gene knock-outs and dominant-negative genetics in Trypanosoma brucei, Mol. Biochem. Parasitol. 99 (1999) 89–101. [36] A.K. Panigrahi, A. Schnaufer, N.L. Ernst, B. Wang, N. Carmean, R. Salavati, K. Stuart, Identification of novel components of Trypanosoma brucei editosomes, RNA 9 (2003) 484–492. [37] J. Carnes, J.R. Trotter, N.L. Ernst, A. Steinberg, K. Stuart, An essential RNase III insertion editing endonuclease in Trypanosoma brucei, Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 16614–16619. [38] M.W. Pfaffl, A new mathematical model for relative quantification in real-time RT-PCR, Nucleic. Acids. Res. 29 (2001) e45. [39] C. Ramakers, J.M. Ruijter, R.H. Deprez, A.F. Moorman, Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data, Neurosci. Lett. 339 (2003) 62–66. [40] E. Vanrobays, J.P. Gelugne, M. Caizergues-Ferrer, D.L. Lafontaine, Dim2p, a KH-domain protein required for small ribosomal subunit synthesis, RNA 10 (2004) 645–656. [41] E. Vanrobays, A. Leplus, Y.N. Osheim, A.L. Beyer, L. Wacheul, D.L. Lafontaine, TOR regulates the subcellular distribution of DIM2, a KH domain protein required for cotranscriptional ribosome assembly and pre-40S ribosome export, RNA 14 (2008) 2061–2073. [42] S. Senapin, G.D. Clark-Walker, X.J. Chen, B. Seraphin, M.C. Daugeron, RRP20 a component of the 90S preribosome, is required for pre-18S rRNA processing in Saccharomyces cerevisiae, Nucleic Acids. Res. 31 (2003) 2524–2533. [43] V.H. Gazestani, N. Nikpour, V. Mehta, H.S. Najafabadi, H. Moshiri, A. Jardim, R. Salavati, A protein complex map of Trypanosoma brucei, PLoS Negl. Trop. Dis. 10 (2016) e0004533. [44] T. Hartshorne, W. Toyofuku, J. Hollenbaugh, Trypanosoma brucei 5’ETS A’-cleavage is directed by 3’-adjacent sequences but not two U3 snoRNA-binding elements, which are all required for subsequent pre-small subunit rRNA processing events, J. Mol. Biol. 313 (2001) 733–749.

Please cite this article in press as: S. Kala, et al., The interaction of a Trypanosoma brucei KH-domain protein with a ribonuclease is implicated in ribosome processing, Mol Biochem Parasitol (2016), http://dx.doi.org/10.1016/j.molbiopara.2016.12.003