β1 in endothelial cell focal adhesions

Experimental Cell Research 305 (2005) 110 – 121 www.elsevier.com/locate/yexcr

The intermediate filament protein vimentin binds specifically to a recombinant integrin a2/h1 cytoplasmic tail complex and co-localizes with native a2/h1 in endothelial cell focal adhesions Stephanie Kreisa, Hans-Joachim Schfnfeldb, Chantal Melchior a, Beat Steinerb,1, Nelly Kieffera,* a

LBPI: Laboratoire de Biologie et Physiologie Inte´gre´e (CNRS/GDRE-ITI), Universite´ du Luxembourg, 162A, avenue de la Faiencerie, L-1511 Luxembourg b F. Hoffmann-La Roche Ltd., Pharmaceuticals Division, Preclinical Research, Vascular and Metabolic Diseases, CH-4070 Basel, Switzerland Received 3 August 2004, revised version received 10 December 2004

Abstract Integrin receptors are crucial players in cell adhesion and migration. Identification and characterization of cellular proteins that interact with their short a and h cytoplasmic tails will help to elucidate the molecular mechanisms by which integrins mediate bi-directional signaling across the plasma membrane. Integrin a2h1 is a major collagen receptor but to date, only few proteins have been shown to interact with the a2 cytoplasmic tail or with the a2h1 complex. In order to identify novel binding partners of a a2h1cytoplasmic domain complex, we have generated recombinant GST-fusion proteins, incorporating the leucine zipper heterodimerization cassettes of Jun and Fos. To ascertain proper functionality of the recombinant proteins, interaction with natural binding partners was tested. GST-a2 and GST-Jun a2 bound His-tagged calreticulin while GST-h1 and GST-Fos h1 proteins bound talin. In screening assays for novel binding partners, the immobilized GST-Jun a2/GST-Fos h1 heterodimeric complex, but not the single subunits, interacted specifically with endothelial cell-derived vimentin. Vimentin, an abundant intermediate filament protein, has previously been shown to co-localize with avh3-positive focal contacts. Here, we provide evidence that this interaction also occurs with a2h1-enriched focal adhesions and we further show that this association is lost after prolonged adhesion of endothelial cells to collagen. D 2005 Elsevier Inc. All rights reserved. Keywords: Integrin a2h1; Recombinant complex; Cytoplasmic tail; Interaction; Vimentin; Intermediate filament

Introduction Integrins are ah heterodimeric cell adhesion receptors that interact with numerous proteins of the extracellular matrix and by doing so they play a pivotal role in the regulation of cell motility, hemostasis, proliferation, differentiation, and apoptosis [1,2]. Binding of integrins to their ligands and subsequent integrin-mediated cell

* Corresponding author. Fax: +352 466644442. E-mail address: [email protected] (N. Kieffer). 1 Current address: ACTELION Pharmaceuticals Ltd., Innovation Center, Gewerbestrasse 16, CH- 4123 Allschwil Switzerland. 0014-4827/$ - see front matter D 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.yexcr.2004.12.023

adhesion is a tightly regulated process, which involves changes in affinity and avidity of the receptor for its ligand [3]. Cell–cell and cell–substratum adhesions are mainly a result of integrin–ligand interactions, following a receptor switch from a low to a high affinity state. It has recently been shown that the final step leading to integrin activation involves talin binding to the h cytoplasmic tails, which results in conformational rearrangements of the extracellular domains, in turn increasing the affinity of the integrin for its ligand (inside-out signaling) [4,5]. Upon ligand binding, conformational changes in the ectodomain are transferred through the

S. Kreis et al. / Experimental Cell Research 305 (2005) 110–121

membrane rendering the short cytoplasmic tails capable of interacting with different intracellular proteins such as talin (outside-in signaling), filamin, paxillin, CIB, h3endonexin, and many others [6,7]. Integrin a and h cytoplasmic domains generally comprise only 13–70 residues with a remarkably conserved short membrane-proximal segment of 7–10 amino acids (aa) [6]. Mutation or deletion of the conserved membraneproximal GFFKR sequence within the a cytoplasmic tail or the respective part of the h tail constitutively activates integrins [8,9] and this indicates that integrins are kept in an inactive state through close interaction of the membraneproximal regions and most likely the transmembrane regions [10]. Once the cytoplasmic domains move apart, the receptor becomes activated [7,11]. Integrin a2h1 is expressed on a variety of cell types, serving as a collagen receptor on platelets and fibroblasts, and as both a collagen and laminin receptor on endothelial and epithelial cells [12,13]. The a2-cytoplasmic domain is 27 aa long with the highly conserved membrane proximal sequence KVGFFKR, while the h1cytoplasmic tail comprises 47 aa and carries two (more C-terminal) NXXY motifs, which are conserved amongst all integrin h tails [14]. It is of growing interest to identify cellular proteins that directly or indirectly interact with the cytoplasmic tails of integrins in order to gain a better understanding of how integrins regulate bi-directional signaling processes under varying biological conditions and in different cell types. So far, more than a dozen proteins have been shown to bind to h1 (talin, a-actinin, skelemin, ILK, FAK, ICAP-1, etc.) [15] while only two proteins (F-actin and calreticulin) are known to bind to the a2 cytoplasmic tail [16,17]. In the current study, we have generated recombinant fusion proteins of the integrin a2 and h1 cytoplasmic tails and the jun–fos heterodimerization units [18], which ensured correct orientation and stable contact between the two subunits. Using this complex, we were able to identify vimentin as a specifically interacting protein, which was not retained by either one of the two subunits. Vimentin, a type III intermediate filament, is present in cells of mesenchymal origin such as endothelial cells, fibroblasts, and leukocytes [19]. In endothelial cells, vimentin can interact with integrin a6h4 mediated through the cytolinker protein plectin [20], which has previously been shown to directly bind to a6h4 in hemidesmosomes of epithelial cells [21]. Furthermore, a close contact has recently been demonstrated between integrin avh3-enriched focal adhesions and vimentin and this association is believed to stabilize cell-matrix adhesions in endothelial cells and to further regulate size and shape of integrin-positive focal adhesions [22,23]. Here, we show that vimentin interacts with a recombinant complex of a2h1 cytoplasmic domains in vitro. Furthermore, we provide evidence that a2h1-positive focal adhesion structures come into close contact with the tips of intermediate filaments in endothelial cells and that vimentin

111

is specifically co-precipitated with an anti-a2 antibody from cellular lysates of endothelial cells grown on a collagen matrix.

Materials and methods Antibodies and reagents The following antibodies were used: goat anti humanvimentin AB 1620 (Chemicon), goat anti-plectin C-20 (Santa Cruz), mouse anti-plectin 10F6 and 5B3 were kindly provided by Dr. Wiche (Austria), goat anti-GST (AmershamBiosciences), rabbit anti-integrin a2 cytoplasmic tail AB1944 (Chemicon), mouse anti-integrin h1 cytoplasmic tail K20 (Immunotech), mouse anti-integrin a2 Gi9 was kindly provided by Dr. Santoso (Germany), mouse anti-His tag (Roche Pharmaceuticals), mouse-anti c-Fos (6-2H-2F) (Santa Cruz Biotechnology), mouse anti-talin TA205 (Chemicon). Phalloidin-TRITC, FITC-, and TRITC-labeled secondary antibodies were from Jackson ImmunoResearch Laboratories, USA. The bacterial expression vector pGEX4T2 and glutathione Sepharose 4B was purchased from AmershamBiosciences. Plasmid constructs The cytoplasmic tails of integrin a2 and h1A were amplified from plasmids containing the entire integrin sequence, which were kindly provided by Dr. M. Hemler (Boston, USA) and Dr. M. Block (Grenoble, France), respectively. The sense primers for PCR-amplification of the a2 and h1 cytoplasmic tails both included a BamHI and HindIII restriction site, the reverse primers carried a SalI site: a2-sense: 5V-GGATCCAAGCTTGGCTTCTTCAAAAGA3 V, a2 - r e v e r s e : 5 V- G T C G A C C C A G G T TA G T T TACCTACGAC-3V; h1-sense: 5V-GGATCCAAGCTT TTAATGATAATTCAT-3V, h1-reverse: 5V-GTCGACGCTACCTAACTGTGACTATGG-3V. Amplified fragments were cloned into the pGEX4T2 vector (AmershamBiosciences) using the BamHI and SalI restriction sites resulting in constructs GST-a2 and GST-h1. For inclusion of Jun–Fos heterodimerization units, the leucine zipper sequence of Jun and Fos was amplified from plasmids (a kind gift of Dr. Eble, Mqnster, Germany) using the following primers: sense primer JUN: CGTGGATCCTGTGGTAAGCTTCGC AT C G C C C G G C T C , r e v e r s e p r i m e r - J U N : G C A G G AT C C T C C A C C T C C G T G G T T C AT G A C T T T C T G T T C A A G ; s e n s e p r i m e r - F O S : CGTGGATCCTGTGGTAAGCTTTTAACTGATACACTC, r e v e r s e p r i m e r - F O S : A G T G G AT C C T C CACCTCCGTGGGCGGCCAGGATGAAC. Jun and Fos cassettes were cloned into GST-a2 and GST-h1 via the BamHI restriction site resulting in constructs GST-Jun a2 and GST-Fos h1. Correct orientation and fidelity of all clones was determined by automated sequencing (ABI310, Applied

112

S. Kreis et al. / Experimental Cell Research 305 (2005) 110–121

Biosystems). Control model proteins representing different integrin cytoplasmic domains (GST–Fos h3 and GST–Jun av) were constructed accordingly. Protein purification Expression of GST-fusion proteins in Escherichia coli BL21(DE3) was induced with 0.2 mM IPTG for 3 h at 378C. GST-Jun a2 or Fos h1-fusion proteins from the E. coli soluble fraction were lysed in PBS + 0.5% Triton X-100, 2 mM DTT, 1 mM PMSF, 1 tablet AEBSF (Roche Pharmaceuticals) in 50 ml of lysis buffer for 30 min on ice, and with 5–7 cycles of 6 s sonication pulses. Lysates were clarified for 30 min at 13000 rpm at 48C. GST-fusion proteins were applied to PBS-washed glutathione Sepharose 4B overnight (o/n) at 48C. The Sepharose was washed 4 in washing buffer (100 mM Tris, pH 8.0, 100 mM NaCl, 1 mM DTT, 0.5 mM PMSF) and captured proteins eluted 3 for 10 min at 48C with washing buffer containing 15 mM reduced GSH and were, for some applications, finally dialyzed against PBS. Protein dot blot Increasing amounts of recombinant proteins (GST-Jun av, -Jun a2, -a2, GST-talin A, -Fos h1, -h1, -h3, and Hiscalreticulin) were spotted on a Hybond C Extra nitrocellulose membrane (Amersham Biosciences) in 10 Al PBS, allowed to air-dry followed by a blocking step for 2 h at room temperature in TBS + 0.5% Tween 20, +5% dry milk powder. The membrane was then incubated in blocking buffer, which contained 20 Ag of a recombinant secondlayer protein o/n at 48C. Blots were washed for 30 min in blocking buffer, incubated with the appropriate antibodies, washed as above, followed by incubation with appropriate HRP-labeled secondary antibody. The recombinant GSTTalin A was as described by Tremuth et al. [24] and Hiscalreticulin was a kind gift of Dr. D. Pritchard, UK. Cell culture ECV are endothelial-like human cells derived from the umbilical cord vein and were kindly provided by Dr. B. Sch7fer, Zqrich, Switzerland. ECV cells were maintained in IMDM medium supplemented with 10% FCS, 2 mM glutamine, 100 U/ml penicillin, and 100 Ag/ml streptomycin at 378C in a 5% CO2-humidified incubator. The EAhy926 cell line, a hybrid between vascular endothelial and carcinoma cells (kindly provided by Dr. H. Deckmyn, Kortrijk, Belgium), was propagated in DMEM medium supplemented with 15% FCS, 25 mM HEPES, 50 Ag/ml endothelial cell growth supplement ECGS (Sigma-Aldrich), 100 Ag/ml heparine, and 50 U/ml penicillin/streptomycin. Cells were maintained in culture flasks pre-treated with 0.1% gelatin in PBS for 15 min at room temperature. EAhy926 cells were detached with trypsin–EDTA (Bio

Whittaker, Europe), all other cells were detached with EDTA buffer (50 mM Hepes, 126 mM NaCl, 5 mM KCl, 1 mM EDTA, pH 7.5). The endothelial phenotype of both cell lines was confirmed by control immunofluorescence labeling for PECAM and von Willebrand Factor (vWF) (data not shown). Pull-down assay and mass spectrometry Platelets were isolated from freshly drawn whole blood as described previously [25]. Platelets were lysed by sonication on ice in lysis buffer (50 mM NaCl, 150 mM sucrose, 10 mM Pipes, 1% Triton X-100, 0.5% DOC, 1 mM EDTA, 1 mM Na3VO4, 50 mM NaF, 5 Ag/ml aprotinin, 2.5 Ag/ml leupeptine, and 1 mM PMSF, pH 6.8). The endothelial cells EAhy926 and the endothelial-like cells ECV were lysed for 45 min on ice in the above lysis buffer. Lysates were clarified at 13000 rpm and 48C for 30 min. Total protein concentration of the lysates was determined with a BioRad Protein assay according to the manufacturer’s instructions (BioRad). For identification of interacting proteins, either the single subunit fusion proteins or the complex of both GST-Jun a2 + GST-Fos h1 were used. Recombinant and purified GST-Jun a2 protein (20 Ag) was immobilized on 20 Al PBS-washed glutathione Sepharose for 2 h at 48C. Remaining binding sites were blocked with PBS + 0.5% BSA for 1 h at 48C, followed by addition of 20 Ag of GST-Fos h1 for 1 h at 48C. Unbound proteins were washed off with PBS. 500 Ag to 1 mg of total platelet or ECV cell lysates was then incubated with the immobilized fusion protein complexes on Sepharose o/n at 48C on a rotating wheel. Unbound proteins were washed off twice with 1 ml wash buffer 1 (50 mM Tris–HCl, pH 7.5, 150 mM NaCl, 0.1% Nonidet P40) and twice with wash buffer 2 (10 mM Tris–HCl, pH 7.5). Protein complexes were extracted in 40 Al loading buffer (Invitrogen) and boiled for 5 min at 1008C, separated on a 4–12% NuPAGE Bis–Tris gradient gel (Invitrogen) and generally stained with Coomassie brilliant blue or the Novex colloidal blue stain kit (Invitrogen) prior to mass spectrometry analysis for identification of interacting proteins. For this, discrete bands were cut out of an SDS–polyacrylamide gel, in-gel digested with trypsin and peptides extracted according to standard protocols. Measurements were performed on a MALDI-mass spectrometer (Bruker Ultraflex) and recorded peptide maps were analyzed using the MASCOT fingerprinting algorithm against the human subset of the nrNCBI database. Immunoprecipitation and Western blot analysis For co-precipitation of a2 integrin and vimentin, 750 Ag of total cell lysates (ECV, EAhy926) were pre-cleared for 1 h at 48C with 30 Al of protein A agarose (Roche Biochemicals). Supernatants were then incubated with 20 Al of anti-a2 antibody Gi9 for 3 h at 48C followed by addition of 50 Al protein A agarose for 12–18 h. Protein complexes were

S. Kreis et al. / Experimental Cell Research 305 (2005) 110–121

washed 2 in buffer A (50 mM Tris–HCl, pH 7.5, 150 mM NaCl, 0.1% Nonidet P40), 1 in buffer B (50 mM Tris–HCl, pH 7.5, 500 mM NaCl, 0.1% Nonidet P40), and 2 in buffer C (10 mM Tris–HCl, pH 7.5) and subsequently extracted with 2 loading buffer (5 min, 1008C). Western blot analysis was performed by incubating transferred proteins with specific antibodies as indicated. Chemiluminescent detection of signals was performed using SuperSignal West Pico Stable Peroxide Solution (Pierce, USA). Where applicable, membranes were stripped for 30 min at 508C in 62.5 mM Tris– HCl, pH 6.7, 2% SDS, and 100 mM 2-mercaptoethanol followed by a 30-min washing step in TBS–Tween (100 mM Tris–HCl, pH 7.5, 0.9% NaCl, 1% Tween 20) and subsequent incubation in blocking buffer (TBS–Tween containing 5% dry milk) prior to addition of a new primary antibody. Immunofluorescence For indirect immunof luorescence analysis, glass coverslips were coated with monomeric collagen VIII (SigmaAldrich) (50 Ag/ml) in acetic acid, pH 3.0 for 1 h at 378C, washed 3 with PBS before cells were added. After different times of adhesion at 378C, cells were fixed for 15 min at 48C in fixation buffer (PBS, pH 7.4, 3% paraformaldehyde, 2% sucrose) and washed four times in washing buffer (PBS, pH 7.4, 0.5% Triton X-100, 0.5% BSA). For staining of integrin a2, h1, vimentin, and plectin, fixed cells were incubated for 40 min with the respective primary antibodies in washing buffer (0.5% bovine serum albumin BSA and 0.5% Triton X100 in PBS) followed by 30 min incubation with either rhodamine (TRITC)-conjugated or FITC-conjugated secondary Ig antibodies (7.5 Ag/ml) and a nuclear stain DAPI (4V,6 diamidino-2-phenylindole). After each incubation step, the coverslips were washed three times for 5 min in washing buffer. Finally, the coverslips were mounted on microscopy slides in Mowiol/DABCO (Sigma). Single images were collected under a conventional fluorescence microscope (LEICA Leitz DMRB) with a 100 oil immersion objective and a LEICA DC 300F camera using the LEICA IM1000 1.20 software. Images were processed digitally with Photoshop 6.0 (Adobe Systems).

Results Generation of a2b1 cytoplasmic domain model proteins The premier objective of this study was to generate a recombinant complex of the integrin a2 and h1 cytoplasmic domains suitable for identifying novel interacting intracellular proteins. In order to bring both subunits into close, stable, and correctly orientated contact, the Jun–Fos leucine zipper heterodimerization unit was included as depicted in Figs. 1A and B, which is known to form self-oriented ahelices [18]. Similar recombinant model proteins were also generated with a His-tag in a pET vector system; however,

113

bacterially expressed fusion proteins of GST-a2, GST-Jun a2, GST-h1, and GST-Fos h1 proved to be more soluble and thus resulted in higher protein yields (data not shown). To ensure sufficient flexibility of the integrin cytoplasmic domains, a spacer consisting of 4 glycine and 1 serine residue was incorporated (Fig. 1B). Expression products of Coomassie-stained purified recombinant proteins are shown in Fig. 1C with their sizes corresponding to the estimated molecular weights (MW): GST-a2 Y 29 kDa, GST-Jun a2 Y 34 kDa, GST-h1 Y 31 kDa, GST-Fos h1 Y 37 kDa. The fusion proteins were recognized specifically by antibodies directed against the a2 and h1 cytoplasmic domains (Fig. 1D). To prove functionality and correct folding properties of the recombinant proteins, natural binding partners were used to demonstrate that the model proteins retained their ability to interact with known cytoplasmic proteins. The talin head domain (GST-talin A) has previously been shown to interact with h integrin cytoplasmic tails [24,25]. Incorporation of the Fos cassette and the glycine spacer into the recombinant h1construct did not interfere with this binding as shown by protein dot blot assay (Fig. 2A, row 2). Similarly, GST-Jun a2 reacted readily with His-tagged calreticulin indicating correct general binding properties of the recombinant model protein (Fig. 2A, row 7). Although GST can potentially form dimers, this was not the case for the proteins described here as GST only controls remained negative for binding of GST-fused recombinant proteins (Fig. 2A, rows 1 and 6). The positive signals for the arbitrary pairs GST-Jun aIIb/GST-Fos h1 and GST-Jun a2/GST-Fos h3 indicate that the interaction between the two proteins was largely due to a strong Jun– Fos contact rather than a direct interaction between the integrin cytoplasmic tails themselves (Fig. 2A, rows 5 and 10). This was further supported by the failure of the model proteins to associate in the absence of the Jun–Fos heterodimerization units (Fig. 2A, rows 4 and 9). Identical results for the given protein pairs were also obtained in pull-down assays (data not shown). Complex formation of recombinant a2 and b1 cytoplasmic domains After having established the specific association of a2 and h1 cytoplasmic domain model proteins either immobilized on a membrane in a protein dot blot assay (Fig. 2A, rows 3 and 8) or immobilized on glutathione Sepharose (Fig. 2B), we next investigated the complex formation using recombinant proteins in solution. From a solution containing GST-Juna2 and GST-Fos h1 at equimolar quantities, either antibody (anti-a2 or anti-h1) pulled down both proteins indicating that the two recombinant proteins formed a complex. Coomassiestaining of the pull down (insert in Fig. 2B) suggested that the model proteins bound to each other in a 1:1 stoichiometry; however, a 2:2 or multimeric stoichiometry cannot be completely ruled out. This complex (in solution or coupled to glutathione Sepharose) was stable for at least 2 weeks at 48C. Both proteins were also pulled down when a commercial

114

S. Kreis et al. / Experimental Cell Research 305 (2005) 110–121

Fig. 1. Structure of recombinant model proteins. (A) Schematic representation of the recombinant fusion proteins consisting of integrin a2 and h1 cytoplasmic tails, the Jun and Fos leucine zipper cassettes, a glycine spacer, and a GST moiety. (B) Amino acid sequences of the recombinant GST-Jun a2 and GST-Fos h1 cytoplasmic tail model proteins. (C) Coomassie-stained SDS–PAGE of recombinant fusion proteins. Proteins were expressed in E. coli BL21DE3, lysed, and affinity-purified using glutathione Sepharose as described in experimental procedures. The apparent molecular weights (MW) corresponded to the deduced values of 29 kDa (GST-a2), 34 kDa (GST-Jun a2), 31 kDa (GST-h1), and 37 kDa (GST-Fos h1). (D) Western blot analysis of a2- and h1-containing model proteins stained with anti-a2 or anti-h1 polyclonal antibodies, both directed against the cytoplasmic domains. MW standard sizes are indicated on the left.

anti-Fos antibody was used, and additionally specific complex formation was confirmed by different techniques such as ELISA or Far Western blots (data not shown). Vimentin interacts with the a2b1 cytoplasmic domain complex in vitro The above model proteins provide an effective tool to identify novel binding partners from a variety of cellular backgrounds since lysates of different cells can readily be incubated with the Sepharose-immobilized complex. Furthermore, it is likely that different proteins bind to the complex (consisting of both the a2 and h1 cytoplasmic tails) than to the single model proteins. Using the recombinant a2h1 complex in pull-down experiments, a number of proteins were retained from crude platelet and ECV lysate. Distinct bands were selected, cut out of the gel, and analyzed by mass spectrometry. One of the bands from ECV lysate was identified to be vimentin. To confirm the specificity of the interaction between the identified proteins and the a2h1-model complex, vimentin was selected for further experiments. Crude lysate of ECV cells was incubated with GST only or the recombinant a2h1 complex immobilized on gluta-

thione Sepharose, unbound proteins were washed off, and the retained protein was stained with a specific anti-vimentin antibody as depicted in Fig. 3A (top panel). Vimentin associated with the immobilized model complex GST-Jun a2/GST-Fos h1 but not with GST alone. To rule out the possibility of unspecific entrapment of cytoskeletal proteins in pull down assays, the stripped membrane was incubated with an antibody directed against vinculin, an abundant cytoskeletal protein, which is present in focal adhesions but which normally does not interact with integrins. Vinculin was not precipitated using the recombinant GST-Jun a2/GST Fos h1 complex (Fig. 3A, middle panel). Plectin, a 500-kDa protein, has recently been shown to link the intermediate filament system with integrin-positive structures such as focal contacts and hemidesmosomes [19,20]. In order to test whether plectin could play a similar role in connecting a2h1 with the vimentin network, stripped membranes were re-probed with the anti-plectin antibody C-20. Plectin was not co-precipitated with the a2h1-vimentin complex (Fig. 3A, bottom panel). Crude lysate of ECV (far right lane) illustrates the presence of all three assayed proteins. In addition, to examine whether the vimentin–a2h1 interaction also occurs in native cells, crude lysate of ECV

S. Kreis et al. / Experimental Cell Research 305 (2005) 110–121

cells harvested after 3 h of growth on a collagen matrix was subjected to immunoprecipitation experiments (Fig. 3B). Both vimentin and a2h1 were co-precipitated with an antia2 antibody directed against the extracellular domain, whereas vinculin and talin were not (Fig. 3B), suggesting a specific interaction between vimentin and integrin a2h1. An anti-His tag irrelevant control antibody (Fig. 3B) did not precipitate a2, vinculin, or talin and only a minor amount of vimentin was unspecifically entrapped. The far right lanes in Fig. 3B show crude total ECV lysate and the presence of all four assayed proteins. Co-localization of vimentin intermediate filaments with integrin a2b1 in endothelial cells adherent to collagen ECV cells were used to identify binding proteins and to study the possible co-localization of vimentin and integrin

115

a2h1 in vivo. Another endothelial-derived cell line, EAhy926, was included in immunofluorescence analyses in order to confirm the staining and localization patterns obtained with the ECV cells. Single labeling of a2 integrin, vimentin, plectin, and stress fibers is shown in Fig. 4 with photographs A–D showing ECV cells and E-H representing EAhy926 cells. Although ECV and EAhy926 cells reacted slightly different regarding the staining intensity of endothelial markers (PECAM and vWF, data not shown), labeling patterns for the integrin subunit a2 (or h1), the intermediate filament vimentin and the cytoskeletal linker plectin were very similar for the 2 cell lines. Labeling of integrins resulted in well-defined focal adhesion staining (Figs. 4A and E). Vimentin displayed a perinuclear staining and an extensive labeling of the cytoplasmic intermediate filament network with individual filament bundles often stretching from the nucleus to the cell periphery, depending on the degree of spreading in the assayed cell (Figs. 4B and F). Similar to vimentin, the goat anti-plectin antibody C-20 labeled a fine cytoplasmic network and perinuclear structures (Figs. 4C and G). Very similar staining characteristics were obtained when using two additional mouse anti-plectin antibodies (10F6 and 5B3, kindly provided by Dr. Wiche, Austria) (data not shown). Actin filaments, when visualized with Phalloidin-TRITC, were clearly distinct from the intermediate filaments (Figs. 4D and H). To examine a potential co-localization of vimentin and a2h1 integrin, dual color-immunofluorescence analysis was performed on fixed ECV and EAhy926 cells grown for different time points on a collagen matrix. Almost

Fig. 2. Functionality and complex formation of the recombinant a2 and h1 model proteins. (A) Protein dot blot interaction of immobilized GST-Jun a2 and GST-Fos h1 model proteins with each other or with selected natural binding partners. Increasing amounts of recombinant proteins were spotted on a membrane. After blocking, the membrane was incubated with the recombinant second-layer proteins GST-Fos h1 (rows 1–5) or GST-Jun a2 (rows 6–10) and protein–protein interactions were visualized with the appropriate anti-a2 or anti-h1 antibodies. Rows 2 and 7 show that GST-Fos h1 and GST-Jun a2 interact with the human talin head domain and calreticulin, respectively. Neither one of the model proteins reacted with GST alone or with the corresponding recombinant proteins lacking the Jun or Fos heterodimerization units (rows 1.6 and 4.9). Rows 5 and 10 demonstrate that interaction between the model proteins is mainly due to a strong Jun–Fos contact as GST-Fos h1 and GST-Jun a2 associated with GST-Jun aIIb and GST-Fos h3, respectively. Both combinations represent arbitrarily selected integrin subunit pairings, which do not occur naturally. (B) Complex formation and co-immunoprecipitation of affinity-purified recombinant a2 and h1 fusion proteins in solution. GST-Jun a2 and GSTFos h1 proteins (20 Ag each) were combined for 90 min at 48C. Anti-a2 antibody (lanes 1 and 3) or anti-h1 antibody (lanes 2 and 4) were then added for 90 min at 48C followed by addition of protein A agarose for 1 h at 48C. The agarose pellet was washed extensively and protein complexes were extracted in sample buffer. After SDS–PAGE, proteins were immunoblotted with anti-a2 antibody (lanes 1 and 2) or anti-h1 antibody (lanes 3 and 4), demonstrating that both model proteins form a complex, which can be pulled down using either one of the antibodies. Insert (lanes 5 and 6): corresponding Coomassie-stained gel showing the individual model proteins in the complex at a 1:1 stoichiometry.

116

S. Kreis et al. / Experimental Cell Research 305 (2005) 110–121

Fig. 3. In vitro interaction of integrin a2h1 with the intermediate filament protein Vimentin. (A) The a2h1 cytoplasmic tail model complex precipitates Vimentin but not vinculin or plectin. Lane 1 shows that vimentin from crude ECV cell lysate was retained by the glutathione Sepharose-immobilized complex whereas GST alone did not pull down vimentin. As a positive control, total ECV cell lysate (50 Ag protein) was applied in the last lane, showing the presence of all three assayed proteins. The membrane was incubated with a specific anti-vimentin antibody (top), stripped, then re-probed with an anti-vinculin (middle), and subsequently with an anti-plectin antibody (bottom). (B) An antibody against the extracellular domain of a2 was used to pull down the integrin together with interacting proteins from ECV cell lysates. Cells were grown on collagen for 3 h before lysis. After pre-clearing with protein A agarose, lysates were incubated with an anti-a2 antibody (left lanes) or an irrelevant anti-His tag antibody (middle lanes) o/n and resulting protein complexes were precipitated with protein A agarose and separated by SDS–PAGE. Blots were consecutively stained for vimentin, a2, vinculin, and talin. Crude ECV lysate (right lane) was included to show the presence of assayed proteins. MW are indicated on the left.

identical results were obtained for both cell lines and representative results for ECV cells are illustrated in Fig. 5. At early time points of adhesion, attached, but not yet fully spread cells showed a meshwork-like staining of vimentin around the nucleus rather than individual filaments stretching out to the periphery of the cell where integrinpositive focal adhesions were concentrated and therefore no clear co-localization of both proteins was detected at this early stage (Fig. 5A). The co-localization of vimentin and a2h1 was most prominent in well spread cells (3 h attachment to collagen), where a2h1-positive focal adhesions were frequently

located at the end of vimentin intermediate filaments (Figs. 5A and B1). Interestingly, this interaction became less frequent and was almost lost when cells were grown to confluence o/n on a collagen matrix. Fully spread and partly contact-inhibited cells showed a distinct vimentin staining, which was characterized by a very fine perinuclear meshwork with few mature filament bundles stretching to the periphery of the cell (Fig. 5A), which is in agreement with previous reports on vimentin dynamics [26]. In such cells, a2-positive focal adhesions were also less prominent and hardly any co-localization of a2 integrins with the vimentin filaments was evident. In an attempt to quantify co-localization events, 500 a2positive focal adhesions in 7 cells from 3 different experiments were counted. After 3 h of cell attachment to collagen, presence of vimentin was observed in 87 of a2stained focal adhesions (17.4%). Quantification after 30 min or o/n cell attachment to collagen was not possible as hardly any vimentin/a2 co-localization was reliably detectable. Recently, Gonzales et al. [22] have described 3 different modes of interaction between vimentin and avh3-positive focal contacts in endothelial cells, where vimentin intermediate filaments (i) wrap around a focal contact, (ii) terminate at focal adhesions, or (iii) form bundles that stretch across several focal contacts. Here, we have seen similar types of interactions; however, the most frequent event was the termination of a vimentin filament at the site of a a2h1-positive focal adhesion and this was most frequently seen in well-spread cells, which were not contact inhibited (Figs. 5A and B). Magnifications of merged vimentin–a2h1 integrin contact areas are documented in Fig. 5B. After 3 h of spreading on collagen, ECV cells were stained for vimentin (green) and integrin a2 (red) with points of co-localization appearing in yellow. Vimentin filaments often extended to the cell periphery ending at a2-positive focal adhesions (Fig. 5B1) or terminated in the cytoplasm (Fig. 5B2). Less frequently, short vimentin filaments, termed squiggles [27], appeared to connect two independent focal adhesions (Fig. 5B3). Is plectin the link between vimentin and a2b1? Plectin is a very versatile cytolinker protein that is known to connect numerous cytoskeletal structures such as integrin a6h4 or microtubules with keratin in epithelial cells and actin or microtubules with vimentin in fibroblasts [28,29]. It was also speculated that plectin could link avh3 focal contacts to the intermediate filament network [22]. To analyze whether plectin could play a similar role in connecting a2h1-focal adhesions to vimentin, we colabeled endothelial cells with anti-a2 and anti-plectin antibodies. Fig. 6 shows the results obtained for the antia2 antibody Gi9, co-labeled with a goat anti-plectin antibody C-20 (top) or a mouse anti-plectin antibody 5B3 (bottom) after 3 h of spreading on collagen. Almost identical results were obtained with a third antibody, 10F6 (data not

S. Kreis et al. / Experimental Cell Research 305 (2005) 110–121

117

Fig. 4. Subcellular distribution of integrin a2h1, Vimentin, plectin, and actin filaments in endothelial cells. ECV cells are shown in photographs A–D, EAhy926 cells in E–H. Cells were grown for 3 h on a collagen VIII matrix, fixed, and stained with antibodies against the indicated proteins. Integrin a2 was located in focal adhesions. Both plectin and Vimentin show a characteristic and similar perinuclear distribution with labeling of long filaments generally extending from the nucleus to the cell periphery. Labeling of stress fibers with phalloidin-TRITC shows a clearly distinct staining when compared to intermediate filament labeling. Scale bar = 10 Am.

shown). Plectin showed a typical perinuclear staining but no co-localization with a2h1-containing structures was detected, in accordance with the pull down results, which did not suggest an association of vimentin/a2h1/plectin. Recently, Rezniczek et al. [29] have demonstrated that specifically the isoform 1F of plectin concentrates in focal adhesions of mouse fibroblasts. Although all 3 plectin antibodies showed typical staining characteristics for plectin, it cannot be entirely ruled out that the isoform of plectin, which concentrates in focal adhesions of endothelial cells, is not properly recognized by the antibodies used here. This could explain the lack of plectin in focal adhesions, which has previously been shown by others [29] and also the lack of co-localization with a2-vimentin-positive focal adhesions. Further studies are needed to clearly establish or rule out the involvement of plectin in linking vimentin to integrin a2-positive focal adhesions.

Discussion The activation state of integrin receptors is determined by the conformation of their cytoplasmic domains. The receptor is considered to be inactive when the membraneproximal regions of the short a and h subunits are in close contact whereas a spatial separation of the tails results in an active or open conformation [8,30], which renders the receptor capable of interacting with extracellular ligands. It appears that intracellular binding partners of integrin cytoplasmic domains can distinguish between the different

conformations, i.e., different proteins may bind when the tails are in close proximity to each other (inactive) opposed to the open or active state. Intracellular proteins that specifically interact with only one of the cytoplasmic domains have been identified using synthetic or recombinant single subunits. In order to dimerize proteins, several approaches have been described. Chang et al. [31] have used synthetic acidic and basic peptides to dimerize a and h T-cell receptors. The peptides heterodimerize through electrostatic forces to form a coiled coil leucine zipper. In another study, the four heptad repeats of tropomyosin were added to synthetically generated integrin aIIbh3 cytoplasmic tails but this approach required the difficult synthesis of molecules of more than 120 amino acids [32]. More recently, Ginsberg et al. [33] have successfully employed a fully recombinant model, which used the heterodimerization sequence of the GCN4 transcription factor together with an incorporated disulphide bond to bring and keep integrin cytoplasmic domains together. This complex was further characterized by generation of polyclonal antibodies recognizing a combinatorial epitope, which was not present in the single subunits. Another very elegant approach used acidic and basic peptides to bring the recombinant cytoplasmic domains of integrins a5 and h1 together. For increased stability, an additional cysteine bond was introduced as well as a protease cleavage site, which allowed for controlled release of the covalent link between the two cytoplasmic domains. Using this model complex, it was demonstrated that the linked complex represented the resting or binactiveQ integrin receptor [11].

118

S. Kreis et al. / Experimental Cell Research 305 (2005) 110–121

Fig. 5. Integrin a2h1-positive focal adhesion contacts co-localize with the tips of vimentin intermediate filaments (A). Characteristic cells are shown for each time point (30 min, 3 h, o/n attachment to collagen). Cells were co-stained for a2 (red) and vimentin (green); the overlay of both colors appears in yellow. Contacts between focal adhesions and the vimentin intermediate filament system were most prominent in well-spread cells and were mostly lost after o/n incubation of cells on collagen prior to dual-color immunofluorescence. Scale bar = 10 Am. (B) Merged images of magnified areas showing a2h1/vimentin colocalization in ECV cells after 3 h of growth on collagen. Vimentin filaments were labeled green (FITC), a2 is shown in red (TRITC), and areas of colocalization appear in yellow. Scale bar = 2.5 Am.

The 40 amino acid long leucine zipper sequence of the Jun and Fos transcription factors are well known to stably associate with each other and to form an anti-parallel vertical stagger, which ascertains the correct orientation and close proximity of the two added integrin subunits [18]. This approach has previously successfully been applied to express a functional a3h1 complex devoid of the transmembrane and cytoplasmic domains [34]. Here, we have used the Jun or Fos heterodimerization cassette that was added N-terminally to the a2 and h1 cytoplasmic tails together with a 5 amino acid spacer (Fig. 1) for increased flexibility. These fully recombinant a2- or h1-cytoplasmic tail fusion proteins allowed for the expression of functional single subunits and the formation of a complex without the need of additional disulphide bonding. The recombinant

model proteins showed fairly good solubility and could thus be purified by standard procedures for native protein purification. Although a minor degree of aggregation of the individually analyzed recombinant proteins, most likely caused by GST multimerization, was detectable in size exclusion chromatography (data not shown), this did not affect the basic biological properties of expressed proteins as was demonstrated by interaction studies with natural binding partners. We also showed that unnatural pairings of integrin cytoplasmic tails, which normally would not heterodimerize, became possible through the forced Jun– Fos dimerization. In this way, GST-Jun aIIb + GST-Fos h1 as well as GST-Jun a2 + GST-Fos h3 formed complexes (Fig. 2). Taken together, the model proteins produced here proved to be stable even at 48C, were sufficiently soluble in

S. Kreis et al. / Experimental Cell Research 305 (2005) 110–121

119

Fig. 6. Dual-color immunofluorescence analysis of integrin a2 and plectin on ECV cells grown on collagen. Plectin is labeled green (top panel: C-20 antibody, bottom panel: 5B3 antibody), a2 is shown in red. No clear co-localization of plectin with a2-positive focal adhesions was detectable at 3 h of cell attachment or at shorter or longer periods of cell growth on collagen (data not shown). Scale bar = 10 Am.

standard bacterial expression systems, retained their biological binding properties, and formed a complex that was subsequently used to mimic the a2h1 cytoplasmic domain heterodimer. Integrin a2h1 is a major collagen receptor on platelets, fibroblasts, epithelial, and endothelial cells [12] but so far only calreticulin and F-actin have been shown to interact with a2 [16,17] whereas at least 12 different actin binding, signaling, or other intracellular proteins can bind to h1 [6]. However, no interaction has so far been demonstrated using a complex of the two subunits, which could mimic the inactive conformation of the intracellular part of the receptor. In view of that, the model proteins described here represent useful tools to screen for new interacting partners either of the complex or of the individual domains. The approach of simply immobilizing single subunits versus the heterodimer and subsequent retention of interacting proteins from a complex mixture present in cell lysates is a feasible and rapid method to identify distinct intracellular binding partners from a variety of cellular backgrounds. In the current study we focused on finding intracellular proteins that would bind and interact with a a2h1 cytoplasmic tail complex. Using this recombinant model complex, we repeatedly retained vimentin from the endothelial-derived cell line ECV. Interestingly, vimentin exclusively interacted with the a2h1 complex but not with the individual subunits (data not shown) suggesting that the association, whether direct or indirect, between both proteins would require a resting integrin receptor. Vimentin is a type III intermediate filament (IF), which is normally expressed in mesenchymal cells and its overexpression is often connected to highly invasive tumor growth [35]. IFs undergo dynamic changes during cell growth and movement [26,36,37] similar to integrin-

positive focal adhesions or contacts, which also change their protein composition according to the different stages in which they interact with the surrounding matrix [38]. Vimentin and IFs in general have long been thought to be fairly static elements of the cytoskeleton responsible for maintaining cellular integrity and stability. In recent years, however, the motile and dynamic properties of this vast class of proteins have been documented, mainly facilitated by the imaging of GFP-vimentin in living cells [26,27, 36,39]. Furthermore, Maniotis et al. [40] have shown that upon integrin-mediated movements, IFs mechanically and dynamically anchor the nucleus in place and thus form a connection between integrins and the nuclear structure. Another type of cell contact structure is the hemidesmosome, which, in basal epithelial and endothelial cells, links the IF system with the extracellular matrix. Plectin serves as a cross linker in these structures through interaction of its NH2 terminus with the integrin h4 cytoplasmic tail or actin filaments and by binding of its COOH terminus to vimentin [20,28]. Also, vimentin has recently been shown to associate with avh3-enriched focal adhesions to form structures that were termed vimentin-associated matrix adhesions (VMA) [22]. Focal adhesions closely interact with microfilaments and microtubules; however, a possible association with the third cytoskeletal system, the intermediate filaments, is still less well investigated. Nevertheless, several groups have recently shown that in live endothelial cells and in fibroblasts, integrin-positive focal adhesions interact with vimentin as such that the IFs regulate the structure and function of focal adhesions, especially under conditions of shear stress [22,23,41]. Using YFP-labeled integrin h3 and CFP-labeled vimentin, Tsuruta and Jones have established that approximately 50% of h3positive focal adhesions associate with vimentin in live

120

S. Kreis et al. / Experimental Cell Research 305 (2005) 110–121

endothelial cells [23]. In our study, co-localization between vimentin and a2-positive focal adhesions after 3 h of attachment to collagen in fixed endothelial cells occurred in 17.4% of total counted focal adhesions. As IFs are dynamic structures, it can be assumed that the degree of interaction between vimentin and integrin-positive focal adhesions crucially depends on the dynamic state of the cell and it may change if the cell is attaching, spreading, migrating, or static. Nevertheless, most of previously published work demonstrate that, in living cells, vimentin comes into close contact with integrin-enriched focal adhesions without providing biochemical evidence for a direct interaction. To our knowledge, our data show for the first time that integrin a2h1 interacts with vimentin either directly or through a yet to be identified linker protein. Plectin, a member of the plakin/cytolinker protein family, is an important cytolinker that can bind to a variety of structural elements such as intermediate filaments, actin microfilaments, microtubules, fodrin, integrins, and to itself [42]. Because of the established role of plectin as a cytolinker, we investigated whether plectin could also connect vimentin IFs with the collagen receptor a2h1. However, neither the pulldown assays nor the immunofluorescence studies provided any evidence for an involvement of plectin. This can be explained by (i) the failure of available plectin antibodies to recognize the isoform, which preferentially resides in focal adhesions of endothelial cells; (ii) the presence of a still unidentified linker protein that connects vimentin and a2h1; or (iii) by a possible direct interaction between the two proteins independent of an intermediate linker. To further confirm our biochemical data, we performed dual-color immunofluorescence labeling of a2h1 and the intermediate filament in endothelial cells grown on collagen. Vimentin IF often terminated at sites of a2h1-positive focal contacts (Fig. 5) and this was most evident in cells attached to collagen for time periods between 1 and 3 h. At confluency, when cells became contact-inhibited, IFs developed into a very fine network of filaments with less well visible individual bundles. It has previously been speculated that VMAs, in contrast to the stable anchorage hemidesmosomes, could be involved in providing stability in migrating cells and thus be more closely related to focal adhesions [22]. Indeed, our results confirm that especially in stationary and contact-inhibited cells, the vimentin network was less pronounced and almost appeared to be disassembled as well as the connection to focal adhesions was no longer detectable at that stage. The co-localization between vimentin and integrin-positive focal adhesions could therefore provide an additional stabilizing element to migrating cells, which could play a role in the general architecture of the cell. As cell adhesion and migration are dynamic processes, in which the contact points constantly need to change in order to provide the cell with the structural means necessary for the different migratory stages, integrins, as major components of focal adhesions, may interact with the vimentin intermediate filament system to stabilize the cell

shape during the dynamic processes of cell migration. It can be speculated that this concerted interaction becomes obsolete in stationary (contact-inhibited) cells. Further studies will focus on a detailed characterization of this interaction, the identification of a possible linker protein between integrin a2h1 and vimentin, as well as an in vivo analysis of this association at different stages of cell adhesion and migration.

Acknowledgments We would like to thank Bernd Pfschl (Hoffmann-La Roche, Basel) for his excellent technical support in the characterization of recombinant proteins and Dr. Axel Ducret (Hoffmann-La Roche, Basel) for mass spectrometry analysis of interacting proteins. This work was supported by a research grant from Hoffmann-La Roche, Basel, Switzerland EC grant HPRN-CT-2002-00253, and the University of Luxembourg.

References [1] R.O. Hynes, Integrins: versatility, modulation and signaling in cell adhesion, Cell 69 (1992) 11 – 25. [2] E. Ruoslahti, A. Vaheri, Cell-to-cell contact and extracellular matrix, Curr. Opin. Cell Biol. 9 (5) (1997) 605 – 607. [3] E.F. Plow, T.A. Haas, L. Zhang, J. Lof tus, J.W. Smith, Ligand binding to integrins, J. Biol. Chem. 275 (29) (2000) 21785 – 21788. [4] D.A. Calderwood, Integrin activation, J. Cell Sci. 117 (2004) 657 – 666. [5] S. Tadokoro, S.J. Shattil, K. Eto, V. Tai, R.C. Liddington, J.M. de Pereda, M.H. Ginsberg, D.A. Calderwood, Talin binding to integrin h tails: a final common step in integrin activation, Science 302 (2003) 103 – 106. [6] S. Liu, D.A. Calderwood, M.H. Ginsberg, Integrin cytoplasmic domain-binding proteins, J. Cell Sci. 113 (2000) 3563 – 3571. [7] M. Kim, C.V. Carman, T.A. Springer, Bidirectional transmembrane signaling by cytoplasmic domain separation in integrins, Science 301 (2003) 1720 – 1725. [8] C. Lu, J. Takagi, T.A. Springer, Association of the membraneproximal regions of the alpha and beta subunit cytoplasmic domains constrains an integrin in the inactive state, J. Biol. Chem. 276 (2001) 14642 – 14648. [9] T.E. O’Toole, Y. Katagiri, R.J. Faull, K. Peter, R. Ramura, V. Quaranta, J.C. Lof tus, S.J. Shattil, M.H. Ginsberg, Integrin cytoplasmic domains mediate inside-out signal transduction, J. Cell Biol. 124 (1994) 1047 – 1059. [10] J. Takagi, T.A. Springer, Integrin activation and structural rearrangement, Immunol. Rev. 186 (2002) 141 – 163. [11] J. Takagi, H.P. Erickson, T.A. Springer, C-terminal opening mimics binside-outQ activation of integrin a5h1, Nat. Struct. Biol. 8 (5) (2001) 412 – 416. [12] L.R. Languino, K.R. Gehlsen, E. Wayner, W.G. Carter, I.E. Engvall, E. Ruoslahti, Endothelial cells use alpha 2 beta 1 integrin as a laminin receptor, J. Cell Biol. 109 (1989) 2455 – 2462. [13] M. Moroi, S.M. Jung, Platelet receptors for collagen, Thromb. Haemost. 78 (1) (1997) 439 – 444. [14] A.A. Reszka, Y. Hayashi, A.F. Horwitz, Identification of amino acid sequences in the integrin beta 1 cytoplasmic domain implicated in cytoskeletal association, J. Cell Biol. 117 (1992) 1321 – 1330.

S. Kreis et al. / Experimental Cell Research 305 (2005) 110–121 [15] A. van der Flier, A. Sonnenberg, Function and interactions of integrins, Cell Tissue Res. 305 (2001) 285 – 298. [16] C.M. Elton, P.A. Smethurst, P. Eggleton, R.W. Farndale, Physical and functional interaction between cell-surface calreticulin and the collagen receptors integrin alpha2beta1 and glycoprotein VI in human platelets, Thromb. Haemost. 88 (4) (2002) 648 – 654. [17] J.D. Kieffer, G. Plopper, D.E. Ingber, J.H. Hartwig, T.S. Kupper, Direct binding of F actin to the cytoplasmic domain of the alpha2 integrin chain in vitro, Biochem. Biophys. Res. Commun. 217 (2) (1995) 466 – 474. [18] T. Smeal, P. Angel, J. Meek, M. Karin, Different requirements for formation of Jun:Jun and Jun:Fos complexes, Genes Dev. 3 (1989) 2091 – 2100. [19] H. Hermann, U. Aebi, Intermediate filaments and their associates: multi-talented structural elements specifying cytoarchitecture and cytodynamics, Curr. Opin. Cell Biol. 12 (1) (2000) 79 – 90. [20] S.M. Homan, R. Martinez, A. Benware, S.E. LaFlamme, Regulation of the association of alpha6beta4 with vimentin intermediate filaments in endothelial cells, Exp. Cell Res. 281 (2002) 107 – 114. [21] J. Koster, D. Geerts, B. Favre, L. Borradori, A. Sonnenberg, Analysis of the interaction between BP180, BP230, plectin and the integrin alpha6beta4 important for hemidesmosome assembly, J. Cell Sci. 116 (2003) 387 – 399. [22] M. Gonzales, K. Haan, S.E. Baker, M. Fitchmun, I. Todorov, S. Weitzman, J.C.R. Jones, A cell signal pathway involving Laminin-5, a3h1 integrin, and mitogen-activated protein kinase can regulate epithelial cell proliferation, Mol. Biol. Cell 10 (1999) 259 – 270. [23] D. Tsuruta, J.C.R. Jones, The vimentin cytoskeleton regulates focal contact size and adhesion of endothelial cells subjected to shear stress, J. Cell Sci. 116 (2003) 4977 – 4984. [24] L. Tremuth, S. Kreis, C. Melchior, J. Hoebeke, P. Ronde, S. Plancon, K. Takeda, N. Kieffer, A fluorescence cell biology approach to map the second integrin-binding site of talin to a 130 amino acid sequence within the rod domain, J. Biol. Chem. 279 (2004) 22258 – 22266. [25] M. Pfaff, S. Liu, D.J. Erle, M.H. Ginsberg, Integrin beta cytoplasmic domains differentially bind to cytoskeletal proteins, J. Biol. Chem. 273 (1998) 6104 – 6109. [26] J.L. Martys, C.-L. Ho, R.K.H. Liem, G.G. Gundersen, Intermediate filaments in motion: observations of intermediate filaments in cells using green fluorescent protein. Vimentin, Mol. Biol. Cell 10 (1999) 1289 – 1295. [27] M. Yoon, R.D. Moir, V. Prahlad, R.D. Goldman, Motile properties of vimentin intermediate filament networks in living cells, J. Cell Biol. 143 (1998) 147 – 157. [28] D. Geerts, L. Fontao, M.G. Nievers, R.Q.J. Schaapveld, P.E. Purkis, G.N. Wheeler, E.B. Lane, I.M. Leigh, A. Sonnenberg, Binding of integrin a6h4 to plectin prevents plectin association with F-actin but does not interfere with intermediate filament binding, J. Cell Biol. 147 (1999) 417 – 434. [29] G.A. Rezniczek, J.M. de Pereda, S. Reipert, G. Wiche, Linking integrin a6h4-based cell adhesion to the intermediate filament cytoskeleton: direct interaction between the h4 subunit and plectin at multiple molecular sites, J. Cell Biol. 141 (1998) 209 – 225.

121

[30] O. Vinogradova, J. Vaynberg, X. Kong, T.A. Haas, TE.F. Plow, J. Qin, Membrane-mediated structural transitions at the cytoplasmic face during integrin activation, Proc. Natl. Acad. Sci. U. S. A. 1001 (12) (2004) 4094 – 4099. [31] H.-C. Chang, Z.-Z. Bao, Y. Yao, A.G.D. Tse, E.C. Goyarts, M. Madsen, E. Kawasaki, P.P. Brauer, J.C. Sacchettini, S.G. Nathenson, E.L. Reinherz, A general method for facilitating heterodimeric pairing between two proteins: application to expression of a and h T-cell receptor extracellular segments, Proc. Natl. Acad. Sci. U. S. A. 91 (1994) 11408 – 11412. [32] T.W. Muir, M.J. Williams, M.H. Ginsberg, S.B.H. Kent, Design and chemical synthesis of a neoprotein structural model for the cytoplasmic domain of multisubunit cell-surface receptor: integrin alpha IIb beta 3 (platelet GPIIb-IIIa), Biochemistry 33 (1994) 7701 – 7708. [33] M.H. Ginsberg, B. Yaspan, J. Forsyth, T.S. Ulmer, I.D. Campbell, M. Slepak, A membrane-distal segment of the integrin aIIb cytoplasmic domain regulates integrin activation, J. Biol. Chem. 276 (2001) 22514 – 22521. [34] J.A. Eble, K.W. Wucherpfennig, L. Gauthier, P. Dersch, E. Krukonis, R.R. Isberg, M.E. Hemler, Recombinant soluble human alpha 3 beta 1 integrin: purification, processing, regulation, and specific binding to laminin-5 and invasin in a mutually exclusive manner, Biochemistry 37 (1998) 10945 – 10955. [35] C. Gilles, M. Polette, J.-M. Zahm, J.-M. Tournier, L. Volders, J.-M. Foidart, P. Birembaut, Vimentin contributes to human mammary epithelial cell migration, J. Cell Sci. 112 (1999) 4615 – 4625. [36] B.T. Helfand, L. Chang, R.D. Goldman, Intermediate filaments are dynamic and motile elements of cellular architecture, J. Cell Sci. 117 (2004) 133 – 141. [37] S.H. Lang, C. Hyde, I.N. Reid, I.S. Hitchcock, C.A. Hart, A.A. Bryden, J.M. Villette, M.J. Stower, N.J. Maitland, Enhanced expression of vimentin in motile prostate cell lines and in poorly differentiated and metastatic prostate carcinoma, Prostate 52 (4) (2002) 253 – 263. [38] R. Zaidel-Bar, C. Ballestrem, Z. Kam, B. Geiger, Early molecular events in the assembly of matrix adhesions at the leading edge of migrating cells, J. Cell Sci. 116 (2003) 4605 – 4613. [39] R.D. Goldman, S. Khuon, Y.H. Chou, P. Opal, P.M. Steinert, The function of intermediate filaments in cell shape and cytoskeletal integrity, J. Cell Biol. 134 (1996) 971 – 983. [40] A.J. Maniotis, C.S. Chen, D.E. Ingber, Demonstration of mechanical connections between integrins, cytoskeletal filaments, and nucleoplasm that stabilize nuclear structure, Proc. Natl. Acad. Sci. U. S. A. 94 (1997) 849 – 854. [41] B. Eckes, D. Dogic, E. Colucci-Guyon, N. Wang, A. Maniotis, D. Ingber, A. Merckling, F. Langa, M. Aumailley, A. Delouvee, V. Koteliansky, C. Babinet, T. Krieg, Impaired mechanical stability, migration and contractile capacity in vimentin-deficient fibroblasts, J. Cell Sci. 111 (1998) 1897 – 1907. [42] M.J. Brown, J.A. Hallam, Y. Liu, K.M. Yamada, S. Shaw, Cutting edge: integration of human T lymphocyte cytoskeleton by the cytolinker plectin, J. Immunol. 167 (2) (2001) 641 – 645.