- Email: [email protected]
The invasive MenC cc103 lineage with penicillin reduced susceptibility persisting in Brazil
International Journal of Medical Microbiology xxx (xxxx) xxx–xxx
Contents lists available at ScienceDirect
International Journal of Medical Microbiology journal homepage: www.elsevier.com/locate/ijmm
Short communication
The invasive MenC cc103 lineage with penicillin reduced susceptibility persisting in Brazil ⁎
Érica L. Fonsecaa, , Michel A. Marina, Fernanda S. Freitasa, Bruna S.A. Vitóriob, Flávio M.G. de Araújoc, Dhian R.A. Camargod, Roney S. Coimbrae, Ivano R. De Filippisb, Ana Carolina P. Vicentea a
Instituto Oswaldo Cruz, FIOCRUZ, Rio de Janeiro, RJ, Brazil Instituto Nacional de Controle de Qualidade em Saúde − INCQS, FIOCRUZ, Rio de Janeiro, RJ, Brazil c Fundação Ezequiel Dias (FUNED), Belo Horizonte, MG, Brazil d Informática de Biossistemas, Centro de Pesquisas René Rachou, FIOCRUZ, Belo Horizonte, MG, Brazil e Neuromgenômica, Centro de Pesquisa René Rachou, FIOCRUZ, Belo Horizonte, MG, Brazil b
A R T I C L E I N F O
A B S T R A C T
Keywords: Altered penA Penicillin reduced susceptibility ST-103 clonal complex Fitness Neisseria meningitidis
Penicillin is the antibiotic of choice for the treatment of meningococcal infections, and mutations in penA gene are involved with reduced susceptibility (penI) emergence to this antibiotic. This study aimed to characterize the penA allelic diversity, their association with penI phenotype and distribution among prevalent meningococci serogroups in Brazil. The entire penA from 49 invasive strains of distinct serogroups circulating in Brazil for more than two decades were obtained by PCR and sequencing. Additionally, the penA from 22 publicly available complete Neisseria meningitidis genomes from Brazil were included in the study. The allelic diversity was determined and a genetic tree was built using the penA sequence alignment. The penicillin MIC was obtained by the E-Test method. In general, the identified penA alleles correlated with the observed penI phenotype. The canonical penA1 was the most prevalent allele, however, several altered penA were also identified in strains presenting increased penicillin MICs. It was identified a new penA amino acid position (residue 480) that possibly influence the penicillin MIC in some strains. Interestingly, the altered penA14 was found in penI invasive MenC cc103 strains spread in Brazil and persisting since 2011, indicating that the biological cost imposed by penI phenotype can be ameliorated by particular features present in this lineage, which represents an additional public health threat.
1. Introduction Neisseria meningitidis may asymptomatically colonize the upper human respiratory tract, and occasionally cause meningitis and septicaemia (Rosenstein et al., 2001), which are associated with significant morbidity and mortality worldwide. The most invasive meningococci belong to the serogroups A, B, C, W and Y (Harrison et al., 2013). The serogroup C (MenC) from clonal complex 103 (cc103) is currently the most prevalent serogroup in Brazil, accounting for ∼40% of invasive disease (Bastos et al., 2015; Ibarz-Pavón et al., 2012; Sáfadi et al., 2013). Penicillin is the first-line drug for treating meningococcal infection (Nadel and Kroll, 2007), and it targets the penicillin-binding protein 2 (PBP2), encoded by penA, that participates in peptidoglycan biosynthesis during cell wall formation. However, the growing worldwide emergence of strains presenting penicillin reduced susceptibility (penI) ⁎
has been reported. Such phenotype is associated with five specific amino acid polymorphisms in the transpeptidase region of PBP2 Ctermini (Antignac et al., 2001; Taha et al., 2007; Thulin et al., 2006). In Brazil, the meningococcal disease is endemic and ∼1600 confirmed cases had been reported in 2014. As found worldwide, strains with reduced susceptibility to penicillin have also increased in Brazil, and recent studies showed that ∼14% of invasive N. meningitidis presented penicillin MICs ranging from 0.064–0.5 mg/L, which is associated with the penI phenotype (Gorla et al., 2011; Ibarz-Pavón et al., 2012). However, the diversity of penA circulating in the country and its association with penI phenotype was not assessed yet. Here, we aimed to determine the scenario of penA diversity, their association with resistance and distribution among prevalent invasive meningococci serogroups in Brazil.
Corresponding author at: Laboratório de Genética Molecular de Microrganismos, Instituto Oswaldo Cruz, Avenida Brasil 4365, Manguinhos, Rio de Janeiro, CEP 21040-360, Brazil. E-mail address: ericafon@ioc.fiocruz.br (É.L. Fonseca).
http://dx.doi.org/10.1016/j.ijmm.2017.05.004 Received 31 January 2017; Received in revised form 24 April 2017; Accepted 21 May 2017 1438-4221/ © 2017 Elsevier GmbH. All rights reserved.
Please cite this article as: Fonseca, É.L., International Journal of Medical Microbiology (2017), http://dx.doi.org/10.1016/j.ijmm.2017.05.004
International Journal of Medical Microbiology xxx (xxxx) xxx–xxx
É.L. Fonseca et al.
Table 1 The penA allele diversity of meningococci strains/genomes and resistance phenotype of meningococci strains from Brazil. Strains/ genomes
Serogroup
Location/date of isolation
ST/clonal complex
Penicillin MIC (mg/L)
penA allele
Invasive meningococci strains from Brazil Nm6641 C P3478 C Nm322 C Nm94 C P3558 C P3965 C P3966 C P4005 C P4077 C P4144 C P4417 B P4480 C P2676 B Nm6655 Y Nm6676 W Nm6653 W Nm6622 W P121 W P345 W Nm6633 W Nm6612 W Nm6689 W Nm6680 W Nm6651 W Nm6673 W Nm6662 W Nm6600 W Nm6671 W Nm6644 W P4461 B P4911 B Nm6642 B P4246 B P4404 B P3994 B Nm56 C Nm292 C Nm638 C Nm287 C Nm288 C Nm612 C P3978 C P4431 C P4950 C P4464 C C P4531 P4534 C P4615 C P4995 C
Rio de janeiro/2012 Pernambuco/2009 Minas Gerais/2011 Minas Gerais/2011 Pernambuco/2010 Pernambuco/2011 Pernambuco/2011 Pernambuco/2012 Rio de janeiro/2012 Pernambuco/2012 Brazil/2014 Brazil/2015 Brazil/2003 Brazil/2008 Brazil/1991 Brazil/1997 Brazil/2000 Brazil/1990 Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil/2014 Brazil/2015 Brazil/2001 Pernambuco/2013 Brazil/2014 Rio de janeiro/2012 Minas Gerais/2011 Minas Gerais/2011 Minas Gerais/2011 Minas Gerais/2011 Minas Gerais/2011 Minas Gerais/2011 Pernambuco/2011 Brazil/2014 Brazil/2015 Brazil/2014 Brazil/2015 Brazil/2015 Brazil/2015 Brazil/2015
ST3779/cc103 ST8436/cc103 ST3780/cc103 ST3780/cc103 ST103/cc103 NT ST3780/cc103 ST3780/cc103 ST5122/cc103 ST3780/cc103 ST639/cc32 ST3780/cc103 Cc32 Cc175 Cc174 Cc11 Cc11 Cc174 Cc174 Cc11 Cc11 NT NT NT NT NT NT NT NT ST34/cc32 ST34/cc32 ST639/cc32 ST461/cc461 ST33/cc32 ST461/cc461 ST3780/cc103 ST3780/cc103 ST3780/cc103 ST3780/cc103 ST3780/cc103 ST3780/cc103 ST3780/cc103 ST3780/cc103 ST3779/cc103 ST8730 ST3779/cc103 ST3779/cc103 ST3327/cc865 ST3780/cc103
0.032 0.047 0.032 0.047 0.016 0.004 0.012 0.008 0.012 0.012 0.023 0.032 0.016 0.023 0.012 0.008 0.032 0.032 0.032 0.032 0.047 0.016 0.012 0.023 0.032 0.023 0.023 0.047 0.012 0.032 0.032 0.032 0.064 0.032 0.094 0.19 0.25 0.125 0.125 0.19 0.19 0.064 0.25 0.064 0.023 0.25 0.032 0.25 0.19
penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA3 penA3 penA3 penA420 penA22 penA600 (new) penA14 penA14 penA14 penA14 penA14 penA14 penA14 penA14 penA14 penA14 penA14 penA14 penA9 penA9
Available BIGSDb Genomes from Brazil 31320 NI 31328 NI 34571 C 31317 NI 34570 C 38177 NI 468 C 34547 B 26034 B 26037 B 26038 B 34548 C 34549 B 34550 C 34573 A 84 IAL2229 A 34572 A 38176 NI 38179 NI
Brazil Brazil Brazil/1973 Brazil Brazil/1973 Brazil/2014 Brazil/1976 Brazil/1989 Brazil/1986 Brazil/1987 Brazil/1989 Brazil/2004 Brazil/1988 Brazil/2004 Brazil/1975 Brazil/1976 Brazil/1975 Brazil/2014 Brazil/2014
ST11/ET-37 NI ST11/ET-37 ST11/ET-37 ST8813 ST1136 ST11/ET-37 ST32/ET-5 ST32/ET-5 ST32/ET-5 ST32/ET-5 ST32/ET-5 ST32/ET-5 ST32/ET-5 ST5 ST5 ST5 ST11458 ST23
NI NI NI NI NI NI NI NI NI NI NI NI NI NI NI NI NI NI NI
2
penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA3 penA3 penA3 penA3 penA3 penA3 penA3 penA4 penA4 penA4 penA14 penA102 (continued on next page)
International Journal of Medical Microbiology xxx (xxxx) xxx–xxx
É.L. Fonseca et al.
Table 1 (continued) Strains/ genomes
Serogroup
Location/date of isolation
ST/clonal complex
Penicillin MIC (mg/L)
penA allele
38178 38175 38180
NI NI NI
Brazil/2014 Brazil/2014 Brazil/2014
ST1136 ST613 ST198
NI NI NI
New altered penA* New altered allele New altered penA
NT, not tested. NI, not informed on BIGSdb. *altered only at PBP2 amino acid positions 504 and 510. The penA14 with A480 amino acid residue is highlighted in bold. penI: 0.094–1 mg/L (Taha et al., 2007; Thulin et al., 2006).
2. Material and methods
demonstrated the importance of analyzing the entire penA sequences longer than those previously stipulated (402 bp), in order to identify additional polymorphisms contributing to penI phenotype (Thulin et al., 2006). Thus, we compared the deduced amino acid sequence of the entire penA14 (581 amino acids) recovered from twelve meningococci strains to verify the occurrence of any additional substitution that could be contributing to the observed phenotype. The analysis showed the presence of a polymorphism at amino acid position 480, in which either a proline (P) or an alanine (A) were observed. Interestingly, strains with the P480 amino acid residue (P4431, P4531, Nm292, Nm56, Nm638, Nm612, Nm288, Nm287) presented the penI phenotype (0.125–0.25 mg/L) while those carrying the A480 (P4534, P3978, P4950, P4464) were susceptible to penicillin (MICs 0.023–0.064 mg/L) in spite of harboring the altered penA14 allele (Table 1). This finding suggests that the position 480 could influence the PBP2 folding and conformation with a secondary role in penicillin MIC. Therefore, it seems that the altered PBP2 with the alanine at position 480 could have higher affinity for penicillin than that with proline, resulting in the penS phenotype. The spatio-temporal and serogroup distribution of the most prevalent penA alleles in Brazil, penA1 (n = 36) and penA14 (n = 13) (Table 1), showed that penA1 occurred among serogroups B, C, W and Y dispersed throughout Brazil from 1973 to 2015. Conversely, penI-associated penA14, independently of the polymorphism at position 480, was restricted only to the serogroup C strains belonging to cc103, which is the most prevalent clonal complex responsible for recent meningitis cases in Brazil (Bastos et al., 2015; Ibarz-Pavón et al., 2012; Sáfadi et al., 2013), and were recovered from 2011 onwards. A previous study observed the lack of clonal expansion among strains harboring altered penA alleles, suggesting that such alterations in PBP2 would interfere with meningococci fitness (Taha et al., 2007). In fact, another study demonstrated that the penI phenotype resulted from the presence of altered PBP2 would represent a biological burden to meningococci, since it would affect the colonization and the establishment of the invasive disease, and consequently, the clonal expansion of penI-associated strains (Zarantonelli et al., 2013). However, contrasting with these aforementioned studies, we characterized here a lineage (MenC cc103) with penicillin reduced susceptibility causing meningitis in distinct Brazilian geographic regions from 2011 to 2015, which shows its persistence and spread by clonal expansion in spite of harboring the altered penA14.
Forty-nine strains recovered from meningococcal disease cases in Brazil were included in this study. Their entire penA coding region was amplified with the primers PENAF 5′ AGGATTATGCGCAAATGAGG 3′ and PENAR 5′ GGCACGGTGTTTCAAATCTT 3′(2200 bp). Sequencing was performed with primers described previously (Karch et al., 2015). The penA allele definition was determined at the Neisseria typing scheme (http://pubmlst.org/neisseria/). A new penA sequence identified here was submitted to Neisseria typing scheme for allele number assignment. A specific penA segment of 402 bp, which is the target region for penicillin susceptibility definition and for allele assignment (Taha et al., 2007), was aligned with ClustalW, and a Neighbour-joining tree was constructed in MEGA6. The susceptibility testing to penicillin was performed on MuellerHinton agar plates using E-test (OXOID). The MIC breakpoint of 0.094–1 mg/L was considered for defining the penI phenotype (Taha et al., 2007; Thulin et al., 2006). The penA of 22 genomes from Brazil, publicly available in the Bacterial Isolate Genome Sequence Database − BIGSdb (http:// pubmlst.org/software/database/bigsdb/), was also analyzed in order to assess the penA diversity circulating in the country. The 49 strains and 22 genomes, accounting for 71 analyzed penA sequences, belonged to serogroups A, B, C, W and Y, and were recovered from 1973 to 2015 in Brazil. 3. Results and discussion The analyses of the penA sequences revealed the presence of 12 alleles among 71 strains/genomes (Table 1) of N. meningitidis from several serogroups isolated in Brazil throughout the last 42 years. Five of the 12 penA, accounting for 51 strains/genomes, were related to the penicillin susceptibility (penS) phenotype (canonical alleles): penA1 (n = 36), penA3 (n = 10), penA4 (n = 3), penA22 (n = 1) and penA420 (n = 1). Seven of the 12 penA alleles, found among 20 strains/genomes, presented the five polymorphisms F504L, A510V, I515V, H541N, I566V associated with penI phenotype (altered alleles) (Taha et al., 2007). Among these alleles, it was found the penA9 (n = 2), penA14 (n = 13), penA102 (n = 1) and the new one assigned in this study as penA600 (n = 1). In addition, three new altered penA alleles were verified among the genomes retrieved from PubMLST BIGSDb (Table 1 and Fig. 1). We determined the penicillin MICs for the 49 meningococci strains. In general, the MICs correlated with the penA alleles, in which strains harboring altered penA alleles presented the penI phenotype, while those carrying canonical penA were susceptible to penicillin (Table 1). The exceptions were the strains P4534, P3978, P4950 and P4464, which were susceptible to penicillin (MICs ranging from 0.023 to 0.064 mg/L) in spite of carrying the altered penA14 (Table 1). We hypothesized that such inconsistences could be associated to other polymorphisms along the entire penA genes. A previous study had
4. Conclusion The characterization of a persistent invasive lineage in Brazil (MenC cc103) presenting reduced susceptibility to penicillin and carrying the altered penA14 allele represents a new concern to public health. Therefore, we call attention for the importance of investigating particular genomic features that would compensate the biological cost imposed by the presence of an altered PBP2, which is supposed to compromise the meningococci virulence, spread and persistence. 3
International Journal of Medical Microbiology xxx (xxxx) xxx–xxx
É.L. Fonseca et al.
Funding This study was partially supported by the FNS/SVS project (25030001256201331) and Oswaldo Cruz Institute grants, CNPq and PNPD/CAPES Fellowships. Declaration of interest None to declare References Antignac, A., Kriz, P., Tzanakaki, G., Alonso, J.M., Taha, M.K., 2001. Polymorphism of Neisseria meningitidis penA gene associated with reduced susceptibility to penicillin. J. Antimicrob. Chemother. 47, 285–296. Bastos, R.C., de Souza, I.M., da Silva, M.N., Silva, F.de P., Figueira, E.S., Leal, M. de L., Jessouroun, E., da Silva Jr., J.G., Medronho, R. de A., da Silveira, I.A., 2015. Brazilian meningococcal C conjugate vaccine: scaling up studies. Vaccine 33, 2287–4281. Gorla, M.C., de Paiva, M.V., Salgueiro, V.C., Lemos, A.P., Brandão, A.P., Vázquez, J.A., Brandileone, M.C., 2011. Antimicrobial susceptibility of Neisseria meningitidis strains isolated from meningitis cases in Brazil from 2006 to 2008. Enferm. Infecc. Microbiol. Clin. 29, 85–89. Harrison, O.B., Claus, H., Jiang, Y., Bennett, J.S., Bratcher, H.B., Jolley, K.A., Corton, C., Care, R., Poolman, J.T., Zollinger, W.D., Frasch, C.E., Stephens, D.S., Feavers, I., Frosch, M., Parkhill, J., Vogel, U., Quail, M.A., Bentley, S.D., Maiden, M.C., 2013. Description and nomenclature of Neisseria meningitidis capsule locus. Emerg. Infect. Dis. 19, 566–573. Ibarz-Pavón, A.B., Lemos, A.P., Gorla, M.C., Regueira, M., SIREVA Working Group II, Gabastou, J.M., 2012. Laboratory-based surveillance of Neisseria meningitidis isolates from disease cases in Latin American and Caribbean countries, SIREVA II 2006–2010. PLoS One 7, e44102. Karch, A., Vogel, U., Claus, H., 2015. Role of penA polymorphisms for penicillin susceptibility in Neisseria lactamica and Neisseria meningitidis. Int. J. Med. Microbiol. 305, 729–735. Nadel, S., Kroll, J.S., 2007. Diagnosis and management of meningococcal disease: the need for centralized care. FEMS Microbiol. Rev. 31, 71–83. Rosenstein, N.E., Perkins, B.A., Stephens, D.S., Popovic, T., Hughes, J.M., 2001. Meningococcal disease. N. Engl. J. Med. 344, 1378–1388. Sáfadi, M.A., González-Ayala, S., Jäkel, A., Wieffer, H., Moreno, C., Vyse, A., 2013. The epidemiology of meningococcal disease in Latin America 1945–2010: an unpredictable and changing landscape. Epidemiol. Infect. 141, 447–458. Taha, M.K., Vázquez, J.A., Hong, E., Bennett, D.E., Bertrand, S., Bukovski, S., Cafferkey, M.T., Carion, F., Christensen, J.J., Diggle, M., Edwards, G., Enríquez, R., Fazio, C., Frosch, M., Heuberger, S., Hoffmann, S., Jolley, K.A., Kadlubowski, M., Kechrid, A., Kesanopoulos, K., Kriz, P., Lambertsen, L., Levenet, I., Musilek, M., Paragi, M., Saguer, A., Skoczynska, A., Stefanelli, P., Thulin, S., Tzanakaki, G., Unemo, M., Vogel, U., Zarantonelli, M.L., 2007. Target gene sequencing to characterize the penicillin G susceptibility of Neisseria meningitidis. Antimicrob. Agents Chemother. 51, 2784–2792. Thulin, S., Olcén, P., Fredlund, H., Unemo, M., 2006. Total variation in the penA gene of Neisseria meningitidis: correlation between susceptibility to beta-lactam antibiotics and penA gene heterogeneity. Antimicrob. Agents Chemother. 50, 3317–3324. Zarantonelli, M.L., Skoczynska, A., Antignac, A., El Ghachi, M., Deghmane, A.E., Szatanik, M., Mulet, C., Werts, C., Peduto, L., d'Andon, M.F., Thouron, F., Nato, F., Lebourhis, L., Philpott, D.J., Girardin, S.E., Vives, F.L., Sansonetti, P., Eberl, G., Pedron, T., Taha, M.K., Boneca, I.G., 2013. Penicillin resistance compromises Nod1-dependent proinflammatory activity and virulence fitness of Neisseria meningitidis. Cell Host Microbe 13, 735–745.
Fig. 1. Neighbour-joining genetic tree showing the diversity of penA alleles of 71 meningococci strains/genomes from Brazil. Sequence of 402 bp of penA were considered.
4
Contents lists available at ScienceDirect
International Journal of Medical Microbiology journal homepage: www.elsevier.com/locate/ijmm
Short communication
The invasive MenC cc103 lineage with penicillin reduced susceptibility persisting in Brazil ⁎
Érica L. Fonsecaa, , Michel A. Marina, Fernanda S. Freitasa, Bruna S.A. Vitóriob, Flávio M.G. de Araújoc, Dhian R.A. Camargod, Roney S. Coimbrae, Ivano R. De Filippisb, Ana Carolina P. Vicentea a
Instituto Oswaldo Cruz, FIOCRUZ, Rio de Janeiro, RJ, Brazil Instituto Nacional de Controle de Qualidade em Saúde − INCQS, FIOCRUZ, Rio de Janeiro, RJ, Brazil c Fundação Ezequiel Dias (FUNED), Belo Horizonte, MG, Brazil d Informática de Biossistemas, Centro de Pesquisas René Rachou, FIOCRUZ, Belo Horizonte, MG, Brazil e Neuromgenômica, Centro de Pesquisa René Rachou, FIOCRUZ, Belo Horizonte, MG, Brazil b
A R T I C L E I N F O
A B S T R A C T
Keywords: Altered penA Penicillin reduced susceptibility ST-103 clonal complex Fitness Neisseria meningitidis
Penicillin is the antibiotic of choice for the treatment of meningococcal infections, and mutations in penA gene are involved with reduced susceptibility (penI) emergence to this antibiotic. This study aimed to characterize the penA allelic diversity, their association with penI phenotype and distribution among prevalent meningococci serogroups in Brazil. The entire penA from 49 invasive strains of distinct serogroups circulating in Brazil for more than two decades were obtained by PCR and sequencing. Additionally, the penA from 22 publicly available complete Neisseria meningitidis genomes from Brazil were included in the study. The allelic diversity was determined and a genetic tree was built using the penA sequence alignment. The penicillin MIC was obtained by the E-Test method. In general, the identified penA alleles correlated with the observed penI phenotype. The canonical penA1 was the most prevalent allele, however, several altered penA were also identified in strains presenting increased penicillin MICs. It was identified a new penA amino acid position (residue 480) that possibly influence the penicillin MIC in some strains. Interestingly, the altered penA14 was found in penI invasive MenC cc103 strains spread in Brazil and persisting since 2011, indicating that the biological cost imposed by penI phenotype can be ameliorated by particular features present in this lineage, which represents an additional public health threat.
1. Introduction Neisseria meningitidis may asymptomatically colonize the upper human respiratory tract, and occasionally cause meningitis and septicaemia (Rosenstein et al., 2001), which are associated with significant morbidity and mortality worldwide. The most invasive meningococci belong to the serogroups A, B, C, W and Y (Harrison et al., 2013). The serogroup C (MenC) from clonal complex 103 (cc103) is currently the most prevalent serogroup in Brazil, accounting for ∼40% of invasive disease (Bastos et al., 2015; Ibarz-Pavón et al., 2012; Sáfadi et al., 2013). Penicillin is the first-line drug for treating meningococcal infection (Nadel and Kroll, 2007), and it targets the penicillin-binding protein 2 (PBP2), encoded by penA, that participates in peptidoglycan biosynthesis during cell wall formation. However, the growing worldwide emergence of strains presenting penicillin reduced susceptibility (penI) ⁎
has been reported. Such phenotype is associated with five specific amino acid polymorphisms in the transpeptidase region of PBP2 Ctermini (Antignac et al., 2001; Taha et al., 2007; Thulin et al., 2006). In Brazil, the meningococcal disease is endemic and ∼1600 confirmed cases had been reported in 2014. As found worldwide, strains with reduced susceptibility to penicillin have also increased in Brazil, and recent studies showed that ∼14% of invasive N. meningitidis presented penicillin MICs ranging from 0.064–0.5 mg/L, which is associated with the penI phenotype (Gorla et al., 2011; Ibarz-Pavón et al., 2012). However, the diversity of penA circulating in the country and its association with penI phenotype was not assessed yet. Here, we aimed to determine the scenario of penA diversity, their association with resistance and distribution among prevalent invasive meningococci serogroups in Brazil.
Corresponding author at: Laboratório de Genética Molecular de Microrganismos, Instituto Oswaldo Cruz, Avenida Brasil 4365, Manguinhos, Rio de Janeiro, CEP 21040-360, Brazil. E-mail address: ericafon@ioc.fiocruz.br (É.L. Fonseca).
http://dx.doi.org/10.1016/j.ijmm.2017.05.004 Received 31 January 2017; Received in revised form 24 April 2017; Accepted 21 May 2017 1438-4221/ © 2017 Elsevier GmbH. All rights reserved.
Please cite this article as: Fonseca, É.L., International Journal of Medical Microbiology (2017), http://dx.doi.org/10.1016/j.ijmm.2017.05.004
International Journal of Medical Microbiology xxx (xxxx) xxx–xxx
É.L. Fonseca et al.
Table 1 The penA allele diversity of meningococci strains/genomes and resistance phenotype of meningococci strains from Brazil. Strains/ genomes
Serogroup
Location/date of isolation
ST/clonal complex
Penicillin MIC (mg/L)
penA allele
Invasive meningococci strains from Brazil Nm6641 C P3478 C Nm322 C Nm94 C P3558 C P3965 C P3966 C P4005 C P4077 C P4144 C P4417 B P4480 C P2676 B Nm6655 Y Nm6676 W Nm6653 W Nm6622 W P121 W P345 W Nm6633 W Nm6612 W Nm6689 W Nm6680 W Nm6651 W Nm6673 W Nm6662 W Nm6600 W Nm6671 W Nm6644 W P4461 B P4911 B Nm6642 B P4246 B P4404 B P3994 B Nm56 C Nm292 C Nm638 C Nm287 C Nm288 C Nm612 C P3978 C P4431 C P4950 C P4464 C C P4531 P4534 C P4615 C P4995 C
Rio de janeiro/2012 Pernambuco/2009 Minas Gerais/2011 Minas Gerais/2011 Pernambuco/2010 Pernambuco/2011 Pernambuco/2011 Pernambuco/2012 Rio de janeiro/2012 Pernambuco/2012 Brazil/2014 Brazil/2015 Brazil/2003 Brazil/2008 Brazil/1991 Brazil/1997 Brazil/2000 Brazil/1990 Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil/2014 Brazil/2015 Brazil/2001 Pernambuco/2013 Brazil/2014 Rio de janeiro/2012 Minas Gerais/2011 Minas Gerais/2011 Minas Gerais/2011 Minas Gerais/2011 Minas Gerais/2011 Minas Gerais/2011 Pernambuco/2011 Brazil/2014 Brazil/2015 Brazil/2014 Brazil/2015 Brazil/2015 Brazil/2015 Brazil/2015
ST3779/cc103 ST8436/cc103 ST3780/cc103 ST3780/cc103 ST103/cc103 NT ST3780/cc103 ST3780/cc103 ST5122/cc103 ST3780/cc103 ST639/cc32 ST3780/cc103 Cc32 Cc175 Cc174 Cc11 Cc11 Cc174 Cc174 Cc11 Cc11 NT NT NT NT NT NT NT NT ST34/cc32 ST34/cc32 ST639/cc32 ST461/cc461 ST33/cc32 ST461/cc461 ST3780/cc103 ST3780/cc103 ST3780/cc103 ST3780/cc103 ST3780/cc103 ST3780/cc103 ST3780/cc103 ST3780/cc103 ST3779/cc103 ST8730 ST3779/cc103 ST3779/cc103 ST3327/cc865 ST3780/cc103
0.032 0.047 0.032 0.047 0.016 0.004 0.012 0.008 0.012 0.012 0.023 0.032 0.016 0.023 0.012 0.008 0.032 0.032 0.032 0.032 0.047 0.016 0.012 0.023 0.032 0.023 0.023 0.047 0.012 0.032 0.032 0.032 0.064 0.032 0.094 0.19 0.25 0.125 0.125 0.19 0.19 0.064 0.25 0.064 0.023 0.25 0.032 0.25 0.19
penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA3 penA3 penA3 penA420 penA22 penA600 (new) penA14 penA14 penA14 penA14 penA14 penA14 penA14 penA14 penA14 penA14 penA14 penA14 penA9 penA9
Available BIGSDb Genomes from Brazil 31320 NI 31328 NI 34571 C 31317 NI 34570 C 38177 NI 468 C 34547 B 26034 B 26037 B 26038 B 34548 C 34549 B 34550 C 34573 A 84 IAL2229 A 34572 A 38176 NI 38179 NI
Brazil Brazil Brazil/1973 Brazil Brazil/1973 Brazil/2014 Brazil/1976 Brazil/1989 Brazil/1986 Brazil/1987 Brazil/1989 Brazil/2004 Brazil/1988 Brazil/2004 Brazil/1975 Brazil/1976 Brazil/1975 Brazil/2014 Brazil/2014
ST11/ET-37 NI ST11/ET-37 ST11/ET-37 ST8813 ST1136 ST11/ET-37 ST32/ET-5 ST32/ET-5 ST32/ET-5 ST32/ET-5 ST32/ET-5 ST32/ET-5 ST32/ET-5 ST5 ST5 ST5 ST11458 ST23
NI NI NI NI NI NI NI NI NI NI NI NI NI NI NI NI NI NI NI
2
penA1 penA1 penA1 penA1 penA1 penA1 penA1 penA3 penA3 penA3 penA3 penA3 penA3 penA3 penA4 penA4 penA4 penA14 penA102 (continued on next page)
International Journal of Medical Microbiology xxx (xxxx) xxx–xxx
É.L. Fonseca et al.
Table 1 (continued) Strains/ genomes
Serogroup
Location/date of isolation
ST/clonal complex
Penicillin MIC (mg/L)
penA allele
38178 38175 38180
NI NI NI
Brazil/2014 Brazil/2014 Brazil/2014
ST1136 ST613 ST198
NI NI NI
New altered penA* New altered allele New altered penA
NT, not tested. NI, not informed on BIGSdb. *altered only at PBP2 amino acid positions 504 and 510. The penA14 with A480 amino acid residue is highlighted in bold. penI: 0.094–1 mg/L (Taha et al., 2007; Thulin et al., 2006).
2. Material and methods
demonstrated the importance of analyzing the entire penA sequences longer than those previously stipulated (402 bp), in order to identify additional polymorphisms contributing to penI phenotype (Thulin et al., 2006). Thus, we compared the deduced amino acid sequence of the entire penA14 (581 amino acids) recovered from twelve meningococci strains to verify the occurrence of any additional substitution that could be contributing to the observed phenotype. The analysis showed the presence of a polymorphism at amino acid position 480, in which either a proline (P) or an alanine (A) were observed. Interestingly, strains with the P480 amino acid residue (P4431, P4531, Nm292, Nm56, Nm638, Nm612, Nm288, Nm287) presented the penI phenotype (0.125–0.25 mg/L) while those carrying the A480 (P4534, P3978, P4950, P4464) were susceptible to penicillin (MICs 0.023–0.064 mg/L) in spite of harboring the altered penA14 allele (Table 1). This finding suggests that the position 480 could influence the PBP2 folding and conformation with a secondary role in penicillin MIC. Therefore, it seems that the altered PBP2 with the alanine at position 480 could have higher affinity for penicillin than that with proline, resulting in the penS phenotype. The spatio-temporal and serogroup distribution of the most prevalent penA alleles in Brazil, penA1 (n = 36) and penA14 (n = 13) (Table 1), showed that penA1 occurred among serogroups B, C, W and Y dispersed throughout Brazil from 1973 to 2015. Conversely, penI-associated penA14, independently of the polymorphism at position 480, was restricted only to the serogroup C strains belonging to cc103, which is the most prevalent clonal complex responsible for recent meningitis cases in Brazil (Bastos et al., 2015; Ibarz-Pavón et al., 2012; Sáfadi et al., 2013), and were recovered from 2011 onwards. A previous study observed the lack of clonal expansion among strains harboring altered penA alleles, suggesting that such alterations in PBP2 would interfere with meningococci fitness (Taha et al., 2007). In fact, another study demonstrated that the penI phenotype resulted from the presence of altered PBP2 would represent a biological burden to meningococci, since it would affect the colonization and the establishment of the invasive disease, and consequently, the clonal expansion of penI-associated strains (Zarantonelli et al., 2013). However, contrasting with these aforementioned studies, we characterized here a lineage (MenC cc103) with penicillin reduced susceptibility causing meningitis in distinct Brazilian geographic regions from 2011 to 2015, which shows its persistence and spread by clonal expansion in spite of harboring the altered penA14.
Forty-nine strains recovered from meningococcal disease cases in Brazil were included in this study. Their entire penA coding region was amplified with the primers PENAF 5′ AGGATTATGCGCAAATGAGG 3′ and PENAR 5′ GGCACGGTGTTTCAAATCTT 3′(2200 bp). Sequencing was performed with primers described previously (Karch et al., 2015). The penA allele definition was determined at the Neisseria typing scheme (http://pubmlst.org/neisseria/). A new penA sequence identified here was submitted to Neisseria typing scheme for allele number assignment. A specific penA segment of 402 bp, which is the target region for penicillin susceptibility definition and for allele assignment (Taha et al., 2007), was aligned with ClustalW, and a Neighbour-joining tree was constructed in MEGA6. The susceptibility testing to penicillin was performed on MuellerHinton agar plates using E-test (OXOID). The MIC breakpoint of 0.094–1 mg/L was considered for defining the penI phenotype (Taha et al., 2007; Thulin et al., 2006). The penA of 22 genomes from Brazil, publicly available in the Bacterial Isolate Genome Sequence Database − BIGSdb (http:// pubmlst.org/software/database/bigsdb/), was also analyzed in order to assess the penA diversity circulating in the country. The 49 strains and 22 genomes, accounting for 71 analyzed penA sequences, belonged to serogroups A, B, C, W and Y, and were recovered from 1973 to 2015 in Brazil. 3. Results and discussion The analyses of the penA sequences revealed the presence of 12 alleles among 71 strains/genomes (Table 1) of N. meningitidis from several serogroups isolated in Brazil throughout the last 42 years. Five of the 12 penA, accounting for 51 strains/genomes, were related to the penicillin susceptibility (penS) phenotype (canonical alleles): penA1 (n = 36), penA3 (n = 10), penA4 (n = 3), penA22 (n = 1) and penA420 (n = 1). Seven of the 12 penA alleles, found among 20 strains/genomes, presented the five polymorphisms F504L, A510V, I515V, H541N, I566V associated with penI phenotype (altered alleles) (Taha et al., 2007). Among these alleles, it was found the penA9 (n = 2), penA14 (n = 13), penA102 (n = 1) and the new one assigned in this study as penA600 (n = 1). In addition, three new altered penA alleles were verified among the genomes retrieved from PubMLST BIGSDb (Table 1 and Fig. 1). We determined the penicillin MICs for the 49 meningococci strains. In general, the MICs correlated with the penA alleles, in which strains harboring altered penA alleles presented the penI phenotype, while those carrying canonical penA were susceptible to penicillin (Table 1). The exceptions were the strains P4534, P3978, P4950 and P4464, which were susceptible to penicillin (MICs ranging from 0.023 to 0.064 mg/L) in spite of carrying the altered penA14 (Table 1). We hypothesized that such inconsistences could be associated to other polymorphisms along the entire penA genes. A previous study had
4. Conclusion The characterization of a persistent invasive lineage in Brazil (MenC cc103) presenting reduced susceptibility to penicillin and carrying the altered penA14 allele represents a new concern to public health. Therefore, we call attention for the importance of investigating particular genomic features that would compensate the biological cost imposed by the presence of an altered PBP2, which is supposed to compromise the meningococci virulence, spread and persistence. 3
International Journal of Medical Microbiology xxx (xxxx) xxx–xxx
É.L. Fonseca et al.
Funding This study was partially supported by the FNS/SVS project (25030001256201331) and Oswaldo Cruz Institute grants, CNPq and PNPD/CAPES Fellowships. Declaration of interest None to declare References Antignac, A., Kriz, P., Tzanakaki, G., Alonso, J.M., Taha, M.K., 2001. Polymorphism of Neisseria meningitidis penA gene associated with reduced susceptibility to penicillin. J. Antimicrob. Chemother. 47, 285–296. Bastos, R.C., de Souza, I.M., da Silva, M.N., Silva, F.de P., Figueira, E.S., Leal, M. de L., Jessouroun, E., da Silva Jr., J.G., Medronho, R. de A., da Silveira, I.A., 2015. Brazilian meningococcal C conjugate vaccine: scaling up studies. Vaccine 33, 2287–4281. Gorla, M.C., de Paiva, M.V., Salgueiro, V.C., Lemos, A.P., Brandão, A.P., Vázquez, J.A., Brandileone, M.C., 2011. Antimicrobial susceptibility of Neisseria meningitidis strains isolated from meningitis cases in Brazil from 2006 to 2008. Enferm. Infecc. Microbiol. Clin. 29, 85–89. Harrison, O.B., Claus, H., Jiang, Y., Bennett, J.S., Bratcher, H.B., Jolley, K.A., Corton, C., Care, R., Poolman, J.T., Zollinger, W.D., Frasch, C.E., Stephens, D.S., Feavers, I., Frosch, M., Parkhill, J., Vogel, U., Quail, M.A., Bentley, S.D., Maiden, M.C., 2013. Description and nomenclature of Neisseria meningitidis capsule locus. Emerg. Infect. Dis. 19, 566–573. Ibarz-Pavón, A.B., Lemos, A.P., Gorla, M.C., Regueira, M., SIREVA Working Group II, Gabastou, J.M., 2012. Laboratory-based surveillance of Neisseria meningitidis isolates from disease cases in Latin American and Caribbean countries, SIREVA II 2006–2010. PLoS One 7, e44102. Karch, A., Vogel, U., Claus, H., 2015. Role of penA polymorphisms for penicillin susceptibility in Neisseria lactamica and Neisseria meningitidis. Int. J. Med. Microbiol. 305, 729–735. Nadel, S., Kroll, J.S., 2007. Diagnosis and management of meningococcal disease: the need for centralized care. FEMS Microbiol. Rev. 31, 71–83. Rosenstein, N.E., Perkins, B.A., Stephens, D.S., Popovic, T., Hughes, J.M., 2001. Meningococcal disease. N. Engl. J. Med. 344, 1378–1388. Sáfadi, M.A., González-Ayala, S., Jäkel, A., Wieffer, H., Moreno, C., Vyse, A., 2013. The epidemiology of meningococcal disease in Latin America 1945–2010: an unpredictable and changing landscape. Epidemiol. Infect. 141, 447–458. Taha, M.K., Vázquez, J.A., Hong, E., Bennett, D.E., Bertrand, S., Bukovski, S., Cafferkey, M.T., Carion, F., Christensen, J.J., Diggle, M., Edwards, G., Enríquez, R., Fazio, C., Frosch, M., Heuberger, S., Hoffmann, S., Jolley, K.A., Kadlubowski, M., Kechrid, A., Kesanopoulos, K., Kriz, P., Lambertsen, L., Levenet, I., Musilek, M., Paragi, M., Saguer, A., Skoczynska, A., Stefanelli, P., Thulin, S., Tzanakaki, G., Unemo, M., Vogel, U., Zarantonelli, M.L., 2007. Target gene sequencing to characterize the penicillin G susceptibility of Neisseria meningitidis. Antimicrob. Agents Chemother. 51, 2784–2792. Thulin, S., Olcén, P., Fredlund, H., Unemo, M., 2006. Total variation in the penA gene of Neisseria meningitidis: correlation between susceptibility to beta-lactam antibiotics and penA gene heterogeneity. Antimicrob. Agents Chemother. 50, 3317–3324. Zarantonelli, M.L., Skoczynska, A., Antignac, A., El Ghachi, M., Deghmane, A.E., Szatanik, M., Mulet, C., Werts, C., Peduto, L., d'Andon, M.F., Thouron, F., Nato, F., Lebourhis, L., Philpott, D.J., Girardin, S.E., Vives, F.L., Sansonetti, P., Eberl, G., Pedron, T., Taha, M.K., Boneca, I.G., 2013. Penicillin resistance compromises Nod1-dependent proinflammatory activity and virulence fitness of Neisseria meningitidis. Cell Host Microbe 13, 735–745.
Fig. 1. Neighbour-joining genetic tree showing the diversity of penA alleles of 71 meningococci strains/genomes from Brazil. Sequence of 402 bp of penA were considered.
4