- Email: [email protected]
The investigation of Staphylococcus aureus and coagulase-negative staphylococci nasal carriage among patients undergoing haemodialysis
ARTICLE IN PRESS Microbiological Research 161 (2006) 281—287
www.elsevier.de/micres
The investigation of Staphylococcus aureus and coagulase-negative staphylococci nasal carriage among patients undergoing haemodialysis Maria Kozio$-Montewkaa,, Agnieszka Szczepanika, Iwona Baranowiczb, zekb, Danuta Kaczorc Lucyna Jo ´´ zwiakb, Andrzej Ksia˛˙ a
Department of Clinical Microbiology, Medical University of Lublin, Chodzki 1 Street, 20-093, Lublin, Poland Nephrology Department, University Hospital, Lublin, Poland c Hospital Laboratory, University Hospital, Lublin, Poland b
Accepted 7 October 2005
KEYWORDS Methicillin-resistant Staphylococcus aureus (MRSA); Coagulase-negative staphylococci (CNS); Haemodialysis; Colonization
Summary The frequency of nasal staphylococcal colonization among haemodialysed patients was investigated. The swabs were collected in 1998 and 2004 from 28 and 43 patients, respectively. Staphylococcus aureus colonization rates were 57.1% and 27.9% in 1998 and 2004, respectively. Twenty-six coagulase-negative staphylococci (CNS) isolates were cultured: S. epidermidis (21), S. lugdunensis (2), single S. haemolyticus, S. warneri, and S. capitits isolates. One S. aureus and 10 CNS isolates were methicillin resistant. The methicillin-resistant S. aureus (MRSA) was resistant to b-lactams, tetracycline, and harbored the pvl gene encoding the Panton-Valentine leukocidin. The decrease in S. aureus colonization at 6-year interval was observed. The presence of the pvl gene and a favorable antibiotic susceptibility pattern of the MRSA suggest that the isolate was a member of community-acquired MRSA (CA-MRSA). Concluding, screening of haemodialysed patients for staphylococcal colonization accompanied by characterization of cultured isolates is important to understand its epidemiology and to develop infection prevention measures and treatment strategies. & 2005 Elsevier GmbH. All rights reserved.
Introduction Corresponding author. Tel./fax: +48 81 740 58 33.
E-mail address: [email protected] (M. Kozio"-Montewka).
Patients receiving haemodialysis are at particular risk for the development of invasive infections caused by staphylococci. Carriage of these
0944-5013/$ - see front matter & 2005 Elsevier GmbH. All rights reserved. doi:10.1016/j.micres.2005.10.002
ARTICLE IN PRESS 282 microorganisms in the anterior nares appears to play a key role in the epidemiology and pathogenesis of infection (Kluytmans et al., 1997). Afflictions caused by Staphylococcus aureus and coagulase-negative staphylococci (CNS) are mainly considered to arise from the patient’s skin (Costa et al., 2004) as a result of bacterial spread from the anterior nares, since haemodialysed patients have areas of impaired skin associated with venepuncture (von Eiff et al., 2001; Peacock et al., 2002). In addition, staphylococcal translocation from colonized mucosal sites including nasal mucosa to the bloodstream has been considered as the potential source of bacterial invasion in certain patient populations such as those suffering from cancer (Costa et al., 2004). Haemodialysis patients might also be prone to this mode of acquisition of staphylococcal infections because of their defective mucocutaneous barriers and immunodeficiency (Goldblum and Reed, 1980; Peacock et al., 2002). Compounding the problem is striking ability of these microorganisms to develop resistance against a wide spectrum of antibiotics exemplified by the emergence and the worldwide spread of methicillin resistance (Hiramatsu et al., 2002; de Mattos et al., 2003) and the increasing incidence of afflictions caused by CNS other than S. epidermidis including S. haemolyticus, S. lugdunensis, S. warneri, and S. capitis (Huebner and Goldmann, 1999; Lee and Park, 2001; Marsou et al., 2001; Costa et al., 2004; Shittu et al., 2004). Moreover, recent evidence indicates that the epidemiology of methicillinresistant S. aureus (MRSA) may be undergoing a change through the appearance of communityacquired MRSA (CA-MRSA). CA-MRSA represents a group of staphylococci of rising clinical significance due to their significant pathogenic potential and the ability to cause life-threatening infections in otherwise healthy people (Anonymous, 1999; Ala’Aldeen, 2002; Vandenesch et al., 2003; Faria et al., 2005). Hence, adequate establishment of staphylococcal nasal carrier status accompanied by full and accurate characterization of cultured isolates along with antibiotic susceptibility testing is crucial in patients particularly prone to infections caused by these bacteria such as those receiving haemodialysis treatment. The aim of the study was to compare the frequency of nasal colonization with S. aureus among patients treated by haemodialysis at 6-year intervals (in 1998 and 2004). Additionally, screening of patients for staphylococcal nasal carriage conducted in 2004 involved CNS carriage investigation with characterization of cultured isolates to the species level.
M. Kozio!-Montewka et al.
Materials and methods Patients The study was conducted at Nephrology Department of the University Hospital in Lublin, Poland, at 6-year intervals, namely in 1998 and 2004. The nasal swabs were collected from 28 and 43 haemodialysed patients, respectively. The mean age of patients during investigation in 1998 was 44711 years and the mean treatment period with haemodialysis was over 124784 months. The mean age of patients who underwent the study in 2004 was 53.3711.82 years whereas the mean duration of dialysis treatment at the time of swab collection was 136.767104.99 months.
Methods Nasal swabs: Cotton swabs were moistened with sterile saline and rubbed over the anterior nares of both nostrils. The swabs specimens were immediately streaked on blood agar and mannitol/salt agar (MSA) and incubated at 37 1C for 24 and 48 h, respectively. Preliminary identification of staphylococcal isolates was performed on the basis of colonial morphology, cultural characteristics on agar media, Gram-reaction, catalase and coagulase tests. The isolates cultured in 2004 investigation were further identified to the species level using API STAPH test according to manufacturer’s instructions (BioMe´rieux). Antibiotic sensitivity testing in 2004 investigation was performed on the isolates using the agar disc diffusion method and the Vitek system according to recommendations given by the National Reference Centre for Antimicrobial Susceptibility Testing in Poland. The antibiotics used in the disc diffusion method included oxacillin (1 mg), penicillin (10 U), tetracycline (30 mg); erythromycin (15 mg); lincomycin (15 mg), ciprofloxacin (5 mg); trimethoprim/sulfamethoxazole (1.25/23.75 mg); mupirocin (200 mg), mupirocin (5 mg), fusidic acid (10 mg), vancomycin (30 mg), and teicoplanin (30 mg). The Vitek system tested staphylococcal sensitivity to the following antibiotics: ampicillin, ampicillin/sulbactam, cefazolin, penicillin G, oxacillin, ciprofloxacin, clindamycin, erythromycin, gentamycin, rifampin, tetracycline, trimethoprim/sulfamethoxazole, and vancomycin. Nuc and pvl genes detection: The PCR assay for the detection of the nuc (encoding for the S. aureus specific thermonuclease) and pvl (encoding for the Panton-Valentine leukocidin toxin) genes was
ARTICLE IN PRESS The investigation of Staphylococcus aureus and coagulase-negative staphylococci nasal carriage performed in order to confirm the assumption that the MRSA strain was a member of CA-MRSA. The employed method was based on published primers and methods: Brakstad et al. (1992) and Lina et al. (Clin. Infect. Dis. 1999, 29, 1128–32), respectively. The DNA template for the PCR assay was obtained by the suspension of several staphylococcal colonies in NET buffer (10 mM Tris, 1 mM EDTA, 10 mM NaCl) containing 10 U achromopeptidase (Kobayashi et al., 1994 and Leonard et al., 1995) and incubation of the suspension at 50 1C for 10–15 min. Two microliters of the DNA template was subsequently added to Ready-To-Go PCR beads (0.2 mM of each dNTPs, 1.5 mM MgCl2, 0.625 units of Taq polymerase and Taq buffer (20 mM Trizma base, 50 mM KCl) [Amersham Pharmacia, UK] containing 50pmol/ml of each primer. Tissue culture grade water [Sigma, UK] was added to give a final volume of 25 ml. The primer sequences were: ATCATTAGGTAAAATGTCTGGACATGATCCA (pvl-1) and GCATCAASTGTATTGGATAGCAAAAGC (pvl-2) with the product size of 433 bp and GCGATTGATGGTGATACGGTT (nuc-1) and AGCCAAGCCTTGACGAACTAAAGC (nuc-2) with the product size of 280 bp. Cycling conditions for nuc/pvl detection were as follows: 1 cycle of 95 1C (5 min.), 30 cycles of 95 1C (30 s), 55 1C (30 s), 72 1C (1 min), and 1 final cycle of 72 1C for 5 min. Six microliters of the PCR products were loaded into 1.5% Phorecus agarose [Biogene, UK] and electrophoresis was performed in 0.5 TBE buffer (44.5 mM Trizma base, 44.5 mM boric acid, 1 mM EDTA) at 180 V for 3 h. The gels were subsequently stained with 1 mg/ ml ethidium bromide [Sigma, UK] for 30 min, visualized under UV, and photographed.
283
treatment among S. aureus carriers at the time of swab collection was 100787.03 months, whereas 5 (41.6%) carriers were on haemodialysis for more than 10 years (mean 189.6749.03 months). Twenty-six isolates of CNS were cultured from nasal swabs obtained from 24 (55.8%) patients: S. epidermidis (21 isolates), S. lugdunensis (2 isolates), S. haemolyticus (1 isolate), S. warneri (1 isolate), and S. capitis (1 isolate). The mean duration of heamodialysis treatment among CNS carriers was 1457103.27 months, whereas 15 patients (62.5%) were on haemodialysis for at least 10 years with the mean of 206.40776.32 months by the time of staphylococcal carrier status investigation. Antibiotic susceptibility testing identified 1 (8.3%) S. aureus strain and 10 (38.4%) CNS isolates (9 S. epidermidis isolates and 1 S. haemolyticus isolate) demonstrating resistance to methicillin. The MRSA strain identified in the study was resistant only to b-lactam antibiotics (oxacillin MICX8; ampicillin MICX16; ampicillin/sulbactam MICX32; cefazolin MICX32) and tetracycline (MICX16). Moreover, the isolate was positive for the plv gene by the PCR assay (Fig. 1). The strain was cultured from a 56-year-old male suffering from both chronic renal failure, malignancy (true polycythaemia), and hepatitis C virus infection. The patient had a history of previous (a year before the MRSA recovery) 2-month hospitalization due to peritonitis associated with continuous ambulatory peritoneal dialysis (CAPD), which he had received before his admission to the haemodialysis ward. Among MRCNS, high rates of resistance to tetracycline (70%) and trimethoprim/sulfamethoxazole (40%) were observed. In total 50% of the
Data analysis Data were described as mean value7standard deviation (SD). The values were calculated using statistical software (SigmaStat, version 2. 03).
Results The study conducted in 1998 revealed that 16 of 28 (57.1%) patients on haemodialysis were colonized with S. aureus in their anterior nares. The S. aureus isolates were cultured from specimens obtained from patients, who underwent haemodialysis treatment for the mean of 113775 months. Thirty-five (81.3%) out of 43 patients examined in 2004 were positive for staphylococci in their anterior nares. S. aureus was cultured from 12 (27.9%) patients. The mean time on dialysis
Figure 1. The PCR detection of the nuc and pvl genes among selected S. aureus isolates colonizing nasal mucosa of haemodialysed patients. Lanes: 1. nuc (+), pvl (+) control; 2. nuc (+), pvl () control; 3–6. S. aureus isolates – nuc (+), pvl (); 7. MRSA isolate – nuc (+), pvl (+), M – marker.
ARTICLE IN PRESS 284 isolates demonstrated constitutive macrolides-lincosamides-streptogramins B (MLSB) resistance mechanism by the disc diffusion method. One isolate (10%) was resistant to ciprofloxacin and demonstrated low-level resistance to mupirocin. Methicillin-susceptible S. aureus (MSSA) isolates demonstrated high rates of resistance to penicillin (81.8%) and tetracycline (63.6%). Among methcillin-susceptible CNS (MSCNS), the following resistance rates were observed: penicillin (68.7%), tetracycline (31.2%), trimethoprim/sulfamethoxazole (25%), and erythromycin (18.7%). Among erythromycin-resistant isolates, two inducible MLSB resistance phenotypes were detected. It is noteworthy that non-S. epidermidis-CNS isolates (except for one methicillin-resistant S. haemolyticus isolate), namely 2 S. lugdunensis isolates and single isolates of S. warneri and S. capitis were fully sensitive to all antibiotics used in the susceptibility testing.
Discussion Infection is a major cause of morbidity and the second most common cause of death in patients treated by haemodialysis. S. aureus is the most frequently isolated pathogen and the anterior nares are the major reservoir for this microorganism. This important ecological niche has been considered to play a key role in the pathogenesis of infections in haemodialysis patients who are particularly prone to the development of staphylococcal life-threatening infections (Kluytmans et al., 1997; Nouwen et al., 2001). Haemodialysed patients have an increased S. aureus nasal carriage rate varying between 32% and 82% (Herwaldt, 2003) and the probable predisposing factors include immunodeficiency, the presence of prosthetic material and frequent breaches of the skin associated with venepuncture (Kluytmans et al., 1997; KoziolMontewka et al., 2001; Peacock et al., 2002). Furthermore, patients treated by haemodialysis have frequent and direct contacts with hospital environment, another factor contributing to S. aureus acquisition (Chow and Yu, 1989). Many literature data indicate that most S. aureus isolates responsible for infections are of endogenous origin (Ena et al., 1994; Kluytmans et al., 1997; Wanten et al., 1998; Toshkova et al., 2001; von Eiff et al., 2001; Peacock et al., 2002). Afflictions caused by this microorganism are also complicated by the problem of increasing resistance of S. aureus to antimicrobial agents including the worldwide emergence and spread of MRSA strains, which often
M. Kozio!-Montewka et al. demonstrate multi-drug resistance (von Eiff et al., 2001). This adverse phenomenon leads to limitation of therapeutic options (Kluytmans et al., 1997). Several authors have suggested that MRSA carriage poses an increased risk for the development of invasive infection over the risk of carriage of MSSA (Kluytmans et al., 1997). Nevertheless, recent data emphasize that particular attention should be paid not only to colonization with MRSA isolates but also to MSSA colonization since both groups of microorganisms may precede the development of invasive infections such as bacteremia (Archer and Climo, 2001). The results of our study indicate that the S. aureus carriage rate among examined patients differed substantially between 1998 and 2004. Namely, 57.1% of patients on haemodialysis were nasal carriers of the bacterium in 1998 whereas its carriage declined to the rate of 27.9% in 2004. The decrease of S. aureus colonization in 2004 could be largely ascribed to a better awareness of the hospital staff about the threat of transmission of the microorganism through hands of personnel. This has led to routine wearing of protective gloves during contacts with haemodialysed patients and reduction of the risk. Unexpectedly, only 1 (8.3%) MRSA isolate was identified during the investigation. Its resistance to oxacillin was detected by the disc diffusion method and confirmed by the automated Vitek system (MICZ8). Furthermore, the susceptibility testing revealed its unusual resistance pattern, which involved only b-lactams and tetracycline. The lack of multi-drug resistance, which has been considered a characteristic feature of nosocomial MRSA (Okuma et al., 2002; Fey et al., 2003; An Diep et al., 2004), suggested that the strain might be a member of CA-MRSA since this group of staphylococci is commonly susceptible to the majority of other non-b-lactam antibiotics (Fey et al., 2003). The hypothesis was subsequently corroborated by the fact that the MRSA strain was positive for the PVL leukocidin gene by PCR. This highly potent toxin targets mononuclear and polymorphonuclear cells (Holmes et al., 2005) and is considered a stable and unique molecular marker of the CAMRSA. The significant virulence potential reported for this group of microorganisms has been ascribed to production of the PVL implicated in the pathogenesis of skin and soft-tissue infections, as well as necrotizing pneumonia – two most commonly encountered afflictions caused by CA-MRSA (Lina et al., 1999; Vandenesch et al., 2003; An Diep et al., 2004; Dietrich et al., 2004; Liassine et al., 2004; Holmes et al., 2005; Faria et al., 2005). Interestingly, in spite of the ability of CA-MRSA to
ARTICLE IN PRESS The investigation of Staphylococcus aureus and coagulase-negative staphylococci nasal carriage affect otherwise healthy and immunocompetent people (Anonymous, 1999), many literature data indicate that the CA-MRSA are still of rare occurrence in this group of patients as most infected individuals have risk factors predisposing to MRSA acquisition (Salgado et al., 2003). The typical risk factors include recent hospitalization, severe underlying illness, indwelling devices, dialysis, a close proximity to a patient who is infected or colonized with MRSA, and prolonged or recurrent exposure to antibiotics (Salgado et al., 2003; Vandenesch et al., 2003; Dietrich et al., 2004). Our results support these observations since the carrier of CA-MRSA in the present study had predisposing factors in addition to the end-stage renal disease including malignancy, hepatitis C, and a history of previous hospitalization (Akram and Glatt, 1998; Vandenesch et al., 2003). Nevertheless, the elucidation of the origin of the MRSA was not possible with certainty. The association of the MRSA with the health-care setting seems to be plausible taking into account the history of 2-month hospitalization experienced by the patient a year before the strain recovery. Nevertheless, since the patient was not screened for MRSA at the time of hospital admission and had no known history of acquiring the microorganism during the hospital stay, the possibility of colonization in the community before or after hospitalization cannot be ruled out. Another aspect of the study considered characterization of CNS colonizing anterior nares of the patients. CNS have long been regarded as harmless skin and mucous membranes commensals and often dismissed as clinically nonrelevant culture contaminants (Huebner and Goldmann, 1999; Marsou et al., 2001; Couto et al., 2001; Shittu et al., 2004). Their role as important opportunistic pathogens has been recognized only recently. The increasing incidence of infections caused by these microorganisms can be attributed to their particular affinity for the foreign materials that have become integral part of modern medicine (Huebner and Goldmann, 1999). The importance of CNS reported as causative agents of serious nosocomial infections has been associated with the increasing use of prosthetic, indwelling devices and immunocompromised patients including those receiving haemodialysis (Huebner and Goldmann, 1999; Couto et al., 2001; Spare et al., 2003; Shittu et al., 2004). Furthermore, the CNS have become increasingly resistant against many antimicrobial agents leading to serious limitation of therapeutic options (Huebner and Goldmann, 1999). The mechanism of methicillin resistance, which represents one of the major problems associated with antimicrobial
285
therapy of afflictions caused by these bacteria, is considered essentially the same with CNS and S. aureus and associated with the chromosomal mecA gene, encoding for a novel penicillin-binding protein (PBP20 ) demonstrating low binding affinities to b-lactam antibiotics (Hiramatsu et al., 2002). It has been reported that more than 80% of clinical CNS strains and 30–40% of CNS obtained from healthy carriers or patients from the community currently demonstrate resistance to methicillin, which is usually connected with resistance to multiple antimicrobial agents (Huebner and Goldmann, 1999; de Mattos et al., 2003). Therefore, full and accurate characterization of CNS isolates cultured in clinical samples along with their identification to the species level (Couto et al., 2001; Shittu et al., 2004) would be very helpful for an early prediction of the potential pathogenicity or antibiotic susceptibility of each clinically significant isolate (Couto et al., 2001). The results of our study indicate the higher rate of methicillin resistance among CNS isolates (38.4%) than among S. aureus isolates (8.3%) colonizing anterior nares of patients on haemodialysis. Methicillin resistance among CNS was also accompanied by the lack of susceptibility to other classes of antibiotics including tetracycline (70% of isolates), trimethoprim/sulfamethoxazole (40%), and ciprofloxacin (10%). Additionally, 50% of the MRCNS demonstrated constitutive MLSB resistance type. The predominant CNS species isolated from patients’ nasal swabs in our study was S. epidermidis. Although this microorganism still accounts for the majority of CNS infections and appears to possess the greatest pathogenic potential and diversity, other species have also been associated with a variety of human diseases (Couto et al., 2001; Marsou et al., 2001; Shittu et al., 2004). Among non-S. epidermidis species responsible for invasive infections at least several should be mentioned. S. haemolyticus is the second most commonly encountered species in clinical infections (Lee and Park, 2001; Marsou et al., 2001) and it has been reported to cause myocarditis, sepsis, peritonitis, and urinary tract infections (Lee and Park, 2001). S. saprophyticus is believed to be the causative agent of opportunistic infections of the female urinary tract (Lee and Park, 2001) by its capacity to adhere specifically to uroepithelial cells and to elaborate urease, which is responsible for tissue damage and invasion (Huebner and Goldmann, 1999; von Eiff et al., 2002). The relatively newly described CNS species, namely S. lugdunensis and S. schleiferi also appear to be significant opportunistic pathogens (Lee and Park, 2001;
ARTICLE IN PRESS 286 Marsou et al., 2001). They have been reported as etiologic agents in a range of nosocomial infections including endocarditis, polymer-associated infections, osteomyelitis, septic arthritis, urinary tract infections, and wound infections. S. lugdunensis has been regarded as more pathogenic than most members of the genus Staphylococcus because of the aggressive nature of infections observed in many cases. The two mentioned species seem to share ability to express a clumping factor and/or produce a thermostable DNAse and to produce virulence determinants with the most pathogenic species among staphylococci – S. aureus (Poutanen, 2001; von Eiff et al., 2002). S. lugdunensis has also been much less commonly than other CNS species considered to be a contaminant or colonizing microorganism and is much more likely to be considered a significant isolate (Poutanen, 2001). Moreover, some authors suggest that any isolate of this species should be considered a pathogen until proven otherwise (Poutanen, 2001). We found two isolates of S. lugdunensis among 26 CNS isolates colonizing patients’ anterior nares. Both S. lugdunensis isolates analyzed in our study had unusually favorable antibiotic susceptibility patterns – they were fully sensitive to all antibiotics used in the susceptibility testing. This finding is in accordance with literature data (Poutanen, 2001), which report that S. lugdunensis has nearly uniform in vitro susceptibility to most antimicrobials, including penicillins and cephalosporins. The antimicrobial susceptibility testing of other non-S. epidermidis species cultured from nasal swabs obtained from patients on haemodialysis revealed that S. warneri and S. capitis isolates also demonstrated sensitivity to all antimicrobials, whereas the S. haemolyticus isolate showed resistance to methicillin accompanied by multi-drug resistance to tetracycline, erythromycin, and lincomycin (cMLSB mechanism). Our study met several limitations. First of all, the patients included in the study were screened for staphylococcal colonization of the nasal mucosa only once. Therefore, we were not able to state whether the positive results represented intermittent or persistent nasal carriage. Second, the study was focused primarily on investigation of colonization frequency and no invasive infections of staphylococcal etiology were recorded and observed during the study period. Summing up, the results of our study demonstrated the decrease in S. aureus nasal carriage rate among haemodialysed patients at 6-year interval and the lower rate of methicillin resistance among S. aureus isolates in comparison with CNS. We also infer that the MRSA strain identified in the study was a member of CA-MRSA, as evidenced by
M. Kozio!-Montewka et al. the presence of the pvl gene and a favorable antibiotic susceptible pattern. Furthermore, CNS characterization enabled identification of species characterized by a significant virulence potential and the ability to develop resistance against a wide spectrum of antimicrobial agents. The abovementioned findings indicate the usefulness of investigation of staphylococcal colonization of the nasal mucosa – the primary ecological niche for these microorganisms – in order to better understand the epidemiology of this phenomenon, but also to develop prevention measures and treatment strategies in case of established infections among predisposed patients such as those suffering form end-stage renal disease and undergoing haemodialysis treatment.
References Akram, J., Glatt, A.E., 1998. True community-acquired methicillin-resistant Staphylococcus aureus bacteremia. Infect. Control Hosp. Epidemiol. 19, 106–107. Ala’Aldeen, D., 2002. A non-multiresistant community MRSA exposes its genome. Lancet 359, 1791–1792. An Diep, B., et al., 2004. Widespread skin and soft-tissue infections due to two methicillin-resistant Staphylococcus aureus strains harboring the genes for PantonValentine Leukocidin. J. Clin. Microbiol. 42, 2080–2084. Anonymous, 1999. Four pediatric deaths from community-acquired methicillin-resistant Staphylococcus aureus – Minnesota and North Dakota, 1997–1999. Morb. Mortal. Wkly. Rep. 48, 707–710. Archer, G.L., Climo, M.W., 2001. Staphylococcus aureus bacteremia – consider the source. N. Engl. J. Med. 344, 55–56. Brakstad, O.G., Aasbakk, K., Maeland, J.A., 1992. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene. J. Clin. Microbiol. 30, 1654–1660. Chow, J.W., Yu, V.L., 1989. Staphylococcus aureus nasal carriage in hemodialysis patients. Its role in infection and approaches to prophylaxis. Arch. Intern. Med. 149, 1258–1262. Costa, S.F., et al., 2004. Mucosa or skin as source of coagulase-negative staphylococcal bacteraemia? Lancet Infect. Dis. 4, 278–286. Couto, I., et al., 2001. Identification of clinical staphylococcal isolates from humans by Internal Transcribed Spacer PCR. J. Clin. Microbiol. 39, 3099–3103. de Mattos, E.M., et al., 2003. Isolation of methicillinresistant coagulase-negative staphylococci from patients undergoing continuous ambulatory peritoneal dialysis (CAPD) and comparison of different molecular techniques for discriminating isolates of Staphylococcus epidermidis. Diagn. Microbiol. Infect. Dis. 45, 13–22.
ARTICLE IN PRESS The investigation of Staphylococcus aureus and coagulase-negative staphylococci nasal carriage Dietrich, D.W., et al., 2004. Community-acquired methicillin-resistant Staphylococcus aureus in Southern New England children. Pediatrics 113, e347–e352. Ena, J., et al., 1994. Epidemiology of Staphylococcus aureus infections in patients on haemodialysis. Infect. Control Hosp. Epidemiol. 15, 78–81. Faria, N.A., et al., 2005. Epidemiology of emerging methicillin-resistant Staphylococcus aureus (MRSA) in Denmark: a nationwide study in a country with low prevalence of MRSA infection. J. Clin. Microbiol. 43, 1836–1842. Fey, P.D., et al., 2003. Comparative molecular analysis of community- or hospital-acquired methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 47, 196–203. Goldblum, S.E., Reed, W.P., 1980. Host defenses and immunologic alterations associated with chronic hemodialysis. Ann. Intern. Med. 93, 597–613. Herwaldt, L.A., 2003. Staphylococcus aureus nasal carriage and surgical-site infections. Surgery 134, S2–S9. Hiramatsu, K., et al., 2002. Molecular genetics of methicillin-resistant Staphylococcus aureus. Int. J. Med. Microbiol. 292, 67–74. Holmes, A., et al., 2005. Staphylococcus aureus isolates carrying Panton-Valentine leukocidin genes in England and Wales: frequency, characterization, and association with clinical disease. J. Clin. Microbiol. 43, 2384–2390. Huebner, J., Goldmann, D.A., 1999. Coagulase-negative staphylococci: role as pathogens. Annu. Rev. Med. 50, 223–236. Kluytmans, J., et al., 1997. Nasal carriage of Staphylococcus aureus: epidemiology, underlying mechanisms. Clin. Microbiol. Rev. 10, 505–520. Kobayashi, N., Wu, H., Kojima, K., Taniguchi, K., Urasawa, S., Uehara, N., et al., 1994. Detection of mecA, femA, and femB genes in clinical strains of staphylococci using polymerase chain reaction. Epid. Infect. 113, 259–266. Koziol-Montewka, M., et al., 2001. Rate of Staphylococcus aureus nasal carriage in immunocompromised patients receiving haemodialysis treatment. Int. J. Antimicrob. Agents 18, 193–196. Lee, M.K., Park, A.J., 2001. Rapid species identification of coagulase-negative staphylococci by rRNA spacer length polymorphism analysis. J. Infect. 42, 189–194. Leonard, R.B., Mayer, J., Sasser, M., Woods, M.L., Mooney, B.R., Brinton, B.G., Newcomb-Gayman, P.L., Carroll, K.C., 1995. Comparison of MIDI Sherlock system and pulsed-field gel electrophoresis in characterizing strains of methicillin-resistant Staphylococcus aureus from a recent hospital outbreak. J. Clin. Microbiol. 33, 2723–2727.
287
Liassine, N., et al., 2004. Community-acquired methicillin-resistant Staphylococcus aureus isolated in Switzerland contains the Panton-Valentine Leukocidin or exfoliative genes toxin genes. J. Clin. Microbiol. 42, 825–828. Lina, G., et al., 1999. Involvement of Panton-Valentine Leukocidin-producing Staphylococcus aureus in primary skin infections and pneumonia. Clin. Infect. Dis. 29, 1128–1132. Marsou, R., et al., 2001. Molecular techniques open up new vistas for typing of coagulase-negative staphylococci. Pathol. Biol. 49, 205–215. Nouwen, J.L., et al., 2001. Determinants of Staphylococcus aureus nasal carriage. Neth. J. Med. 59, 126–133. Okuma, K., et al., 2002. Dissemination of new methicillin-resistant Staphylococcus aureus clones in the community. J. Clin. Microbiol. 40, 4289–4294. Peacock, S.J., et al., 2002. Preventing Staphylococcus aureus infection in the renal unit. Q. J. Med. 95, 405–410. Poutanen, S.M., 2001. Staphylococcus lugdunensis: a notably distinct coagulase-negative Staphylococcus. Clin. Microbiol. Newsletter 23, 147–150. Salgado, C.D., et al., 2003. Community-acquired methicillin-resistant Staphylococcus aureus: a meta-analysis of prevalence and risk factors. Clin. Infect. Dis. 36, 131–139. Shittu, A., et al., 2004. Isolation and molecular characterization of multiresistant Staphylococcus sciuri and Staphylococcus haemolyticus associated with skin and soft-tissue infections. J. Med. Microbiol. 53, 1–5. Spare, M.K., et al., 2003. Genotypic and phenotypic properties of coagulase-negative staphylococci causing catheter-related sepsis. J. Hosp. Infect. 54, 272–278. Toshkova, K., et al., 2001. The significance of nasal carriage of Staphylococcus aureus as risk factor for human skin infections. FEMS Microbiol. Lett. 202, 17–24. Vandenesch, F., et al., 2003. Community-acquired methicillin-resistant Staphylococcus aureus carrying PantonValentine Leukocidin genes: worldwide emergence. Emerg. Infect. Dis. 9, 978–984. von Eiff, Ch., et al., 2001. Nasal carriage as a source of Staphylococcus aureus bacteremia. N. Engl. J. Med. 344, 11–16. von Eiff, Ch., et al., 2002. Pathogenesis of infections due to coagulase-negative staphylococci. Lancet Infect. Dis. 2, 677–685. Wanten, G.J.A., et al., 1998. Optimizing screening procedures for Staphylococcus aureus nasal carriage in patients on haemodialysis. Nephrol. Dial. Transplant. 13, 1256–1258.
www.elsevier.de/micres
The investigation of Staphylococcus aureus and coagulase-negative staphylococci nasal carriage among patients undergoing haemodialysis Maria Kozio$-Montewkaa,, Agnieszka Szczepanika, Iwona Baranowiczb, zekb, Danuta Kaczorc Lucyna Jo ´´ zwiakb, Andrzej Ksia˛˙ a
Department of Clinical Microbiology, Medical University of Lublin, Chodzki 1 Street, 20-093, Lublin, Poland Nephrology Department, University Hospital, Lublin, Poland c Hospital Laboratory, University Hospital, Lublin, Poland b
Accepted 7 October 2005
KEYWORDS Methicillin-resistant Staphylococcus aureus (MRSA); Coagulase-negative staphylococci (CNS); Haemodialysis; Colonization
Summary The frequency of nasal staphylococcal colonization among haemodialysed patients was investigated. The swabs were collected in 1998 and 2004 from 28 and 43 patients, respectively. Staphylococcus aureus colonization rates were 57.1% and 27.9% in 1998 and 2004, respectively. Twenty-six coagulase-negative staphylococci (CNS) isolates were cultured: S. epidermidis (21), S. lugdunensis (2), single S. haemolyticus, S. warneri, and S. capitits isolates. One S. aureus and 10 CNS isolates were methicillin resistant. The methicillin-resistant S. aureus (MRSA) was resistant to b-lactams, tetracycline, and harbored the pvl gene encoding the Panton-Valentine leukocidin. The decrease in S. aureus colonization at 6-year interval was observed. The presence of the pvl gene and a favorable antibiotic susceptibility pattern of the MRSA suggest that the isolate was a member of community-acquired MRSA (CA-MRSA). Concluding, screening of haemodialysed patients for staphylococcal colonization accompanied by characterization of cultured isolates is important to understand its epidemiology and to develop infection prevention measures and treatment strategies. & 2005 Elsevier GmbH. All rights reserved.
Introduction Corresponding author. Tel./fax: +48 81 740 58 33.
E-mail address: [email protected] (M. Kozio"-Montewka).
Patients receiving haemodialysis are at particular risk for the development of invasive infections caused by staphylococci. Carriage of these
0944-5013/$ - see front matter & 2005 Elsevier GmbH. All rights reserved. doi:10.1016/j.micres.2005.10.002
ARTICLE IN PRESS 282 microorganisms in the anterior nares appears to play a key role in the epidemiology and pathogenesis of infection (Kluytmans et al., 1997). Afflictions caused by Staphylococcus aureus and coagulase-negative staphylococci (CNS) are mainly considered to arise from the patient’s skin (Costa et al., 2004) as a result of bacterial spread from the anterior nares, since haemodialysed patients have areas of impaired skin associated with venepuncture (von Eiff et al., 2001; Peacock et al., 2002). In addition, staphylococcal translocation from colonized mucosal sites including nasal mucosa to the bloodstream has been considered as the potential source of bacterial invasion in certain patient populations such as those suffering from cancer (Costa et al., 2004). Haemodialysis patients might also be prone to this mode of acquisition of staphylococcal infections because of their defective mucocutaneous barriers and immunodeficiency (Goldblum and Reed, 1980; Peacock et al., 2002). Compounding the problem is striking ability of these microorganisms to develop resistance against a wide spectrum of antibiotics exemplified by the emergence and the worldwide spread of methicillin resistance (Hiramatsu et al., 2002; de Mattos et al., 2003) and the increasing incidence of afflictions caused by CNS other than S. epidermidis including S. haemolyticus, S. lugdunensis, S. warneri, and S. capitis (Huebner and Goldmann, 1999; Lee and Park, 2001; Marsou et al., 2001; Costa et al., 2004; Shittu et al., 2004). Moreover, recent evidence indicates that the epidemiology of methicillinresistant S. aureus (MRSA) may be undergoing a change through the appearance of communityacquired MRSA (CA-MRSA). CA-MRSA represents a group of staphylococci of rising clinical significance due to their significant pathogenic potential and the ability to cause life-threatening infections in otherwise healthy people (Anonymous, 1999; Ala’Aldeen, 2002; Vandenesch et al., 2003; Faria et al., 2005). Hence, adequate establishment of staphylococcal nasal carrier status accompanied by full and accurate characterization of cultured isolates along with antibiotic susceptibility testing is crucial in patients particularly prone to infections caused by these bacteria such as those receiving haemodialysis treatment. The aim of the study was to compare the frequency of nasal colonization with S. aureus among patients treated by haemodialysis at 6-year intervals (in 1998 and 2004). Additionally, screening of patients for staphylococcal nasal carriage conducted in 2004 involved CNS carriage investigation with characterization of cultured isolates to the species level.
M. Kozio!-Montewka et al.
Materials and methods Patients The study was conducted at Nephrology Department of the University Hospital in Lublin, Poland, at 6-year intervals, namely in 1998 and 2004. The nasal swabs were collected from 28 and 43 haemodialysed patients, respectively. The mean age of patients during investigation in 1998 was 44711 years and the mean treatment period with haemodialysis was over 124784 months. The mean age of patients who underwent the study in 2004 was 53.3711.82 years whereas the mean duration of dialysis treatment at the time of swab collection was 136.767104.99 months.
Methods Nasal swabs: Cotton swabs were moistened with sterile saline and rubbed over the anterior nares of both nostrils. The swabs specimens were immediately streaked on blood agar and mannitol/salt agar (MSA) and incubated at 37 1C for 24 and 48 h, respectively. Preliminary identification of staphylococcal isolates was performed on the basis of colonial morphology, cultural characteristics on agar media, Gram-reaction, catalase and coagulase tests. The isolates cultured in 2004 investigation were further identified to the species level using API STAPH test according to manufacturer’s instructions (BioMe´rieux). Antibiotic sensitivity testing in 2004 investigation was performed on the isolates using the agar disc diffusion method and the Vitek system according to recommendations given by the National Reference Centre for Antimicrobial Susceptibility Testing in Poland. The antibiotics used in the disc diffusion method included oxacillin (1 mg), penicillin (10 U), tetracycline (30 mg); erythromycin (15 mg); lincomycin (15 mg), ciprofloxacin (5 mg); trimethoprim/sulfamethoxazole (1.25/23.75 mg); mupirocin (200 mg), mupirocin (5 mg), fusidic acid (10 mg), vancomycin (30 mg), and teicoplanin (30 mg). The Vitek system tested staphylococcal sensitivity to the following antibiotics: ampicillin, ampicillin/sulbactam, cefazolin, penicillin G, oxacillin, ciprofloxacin, clindamycin, erythromycin, gentamycin, rifampin, tetracycline, trimethoprim/sulfamethoxazole, and vancomycin. Nuc and pvl genes detection: The PCR assay for the detection of the nuc (encoding for the S. aureus specific thermonuclease) and pvl (encoding for the Panton-Valentine leukocidin toxin) genes was
ARTICLE IN PRESS The investigation of Staphylococcus aureus and coagulase-negative staphylococci nasal carriage performed in order to confirm the assumption that the MRSA strain was a member of CA-MRSA. The employed method was based on published primers and methods: Brakstad et al. (1992) and Lina et al. (Clin. Infect. Dis. 1999, 29, 1128–32), respectively. The DNA template for the PCR assay was obtained by the suspension of several staphylococcal colonies in NET buffer (10 mM Tris, 1 mM EDTA, 10 mM NaCl) containing 10 U achromopeptidase (Kobayashi et al., 1994 and Leonard et al., 1995) and incubation of the suspension at 50 1C for 10–15 min. Two microliters of the DNA template was subsequently added to Ready-To-Go PCR beads (0.2 mM of each dNTPs, 1.5 mM MgCl2, 0.625 units of Taq polymerase and Taq buffer (20 mM Trizma base, 50 mM KCl) [Amersham Pharmacia, UK] containing 50pmol/ml of each primer. Tissue culture grade water [Sigma, UK] was added to give a final volume of 25 ml. The primer sequences were: ATCATTAGGTAAAATGTCTGGACATGATCCA (pvl-1) and GCATCAASTGTATTGGATAGCAAAAGC (pvl-2) with the product size of 433 bp and GCGATTGATGGTGATACGGTT (nuc-1) and AGCCAAGCCTTGACGAACTAAAGC (nuc-2) with the product size of 280 bp. Cycling conditions for nuc/pvl detection were as follows: 1 cycle of 95 1C (5 min.), 30 cycles of 95 1C (30 s), 55 1C (30 s), 72 1C (1 min), and 1 final cycle of 72 1C for 5 min. Six microliters of the PCR products were loaded into 1.5% Phorecus agarose [Biogene, UK] and electrophoresis was performed in 0.5 TBE buffer (44.5 mM Trizma base, 44.5 mM boric acid, 1 mM EDTA) at 180 V for 3 h. The gels were subsequently stained with 1 mg/ ml ethidium bromide [Sigma, UK] for 30 min, visualized under UV, and photographed.
283
treatment among S. aureus carriers at the time of swab collection was 100787.03 months, whereas 5 (41.6%) carriers were on haemodialysis for more than 10 years (mean 189.6749.03 months). Twenty-six isolates of CNS were cultured from nasal swabs obtained from 24 (55.8%) patients: S. epidermidis (21 isolates), S. lugdunensis (2 isolates), S. haemolyticus (1 isolate), S. warneri (1 isolate), and S. capitis (1 isolate). The mean duration of heamodialysis treatment among CNS carriers was 1457103.27 months, whereas 15 patients (62.5%) were on haemodialysis for at least 10 years with the mean of 206.40776.32 months by the time of staphylococcal carrier status investigation. Antibiotic susceptibility testing identified 1 (8.3%) S. aureus strain and 10 (38.4%) CNS isolates (9 S. epidermidis isolates and 1 S. haemolyticus isolate) demonstrating resistance to methicillin. The MRSA strain identified in the study was resistant only to b-lactam antibiotics (oxacillin MICX8; ampicillin MICX16; ampicillin/sulbactam MICX32; cefazolin MICX32) and tetracycline (MICX16). Moreover, the isolate was positive for the plv gene by the PCR assay (Fig. 1). The strain was cultured from a 56-year-old male suffering from both chronic renal failure, malignancy (true polycythaemia), and hepatitis C virus infection. The patient had a history of previous (a year before the MRSA recovery) 2-month hospitalization due to peritonitis associated with continuous ambulatory peritoneal dialysis (CAPD), which he had received before his admission to the haemodialysis ward. Among MRCNS, high rates of resistance to tetracycline (70%) and trimethoprim/sulfamethoxazole (40%) were observed. In total 50% of the
Data analysis Data were described as mean value7standard deviation (SD). The values were calculated using statistical software (SigmaStat, version 2. 03).
Results The study conducted in 1998 revealed that 16 of 28 (57.1%) patients on haemodialysis were colonized with S. aureus in their anterior nares. The S. aureus isolates were cultured from specimens obtained from patients, who underwent haemodialysis treatment for the mean of 113775 months. Thirty-five (81.3%) out of 43 patients examined in 2004 were positive for staphylococci in their anterior nares. S. aureus was cultured from 12 (27.9%) patients. The mean time on dialysis
Figure 1. The PCR detection of the nuc and pvl genes among selected S. aureus isolates colonizing nasal mucosa of haemodialysed patients. Lanes: 1. nuc (+), pvl (+) control; 2. nuc (+), pvl () control; 3–6. S. aureus isolates – nuc (+), pvl (); 7. MRSA isolate – nuc (+), pvl (+), M – marker.
ARTICLE IN PRESS 284 isolates demonstrated constitutive macrolides-lincosamides-streptogramins B (MLSB) resistance mechanism by the disc diffusion method. One isolate (10%) was resistant to ciprofloxacin and demonstrated low-level resistance to mupirocin. Methicillin-susceptible S. aureus (MSSA) isolates demonstrated high rates of resistance to penicillin (81.8%) and tetracycline (63.6%). Among methcillin-susceptible CNS (MSCNS), the following resistance rates were observed: penicillin (68.7%), tetracycline (31.2%), trimethoprim/sulfamethoxazole (25%), and erythromycin (18.7%). Among erythromycin-resistant isolates, two inducible MLSB resistance phenotypes were detected. It is noteworthy that non-S. epidermidis-CNS isolates (except for one methicillin-resistant S. haemolyticus isolate), namely 2 S. lugdunensis isolates and single isolates of S. warneri and S. capitis were fully sensitive to all antibiotics used in the susceptibility testing.
Discussion Infection is a major cause of morbidity and the second most common cause of death in patients treated by haemodialysis. S. aureus is the most frequently isolated pathogen and the anterior nares are the major reservoir for this microorganism. This important ecological niche has been considered to play a key role in the pathogenesis of infections in haemodialysis patients who are particularly prone to the development of staphylococcal life-threatening infections (Kluytmans et al., 1997; Nouwen et al., 2001). Haemodialysed patients have an increased S. aureus nasal carriage rate varying between 32% and 82% (Herwaldt, 2003) and the probable predisposing factors include immunodeficiency, the presence of prosthetic material and frequent breaches of the skin associated with venepuncture (Kluytmans et al., 1997; KoziolMontewka et al., 2001; Peacock et al., 2002). Furthermore, patients treated by haemodialysis have frequent and direct contacts with hospital environment, another factor contributing to S. aureus acquisition (Chow and Yu, 1989). Many literature data indicate that most S. aureus isolates responsible for infections are of endogenous origin (Ena et al., 1994; Kluytmans et al., 1997; Wanten et al., 1998; Toshkova et al., 2001; von Eiff et al., 2001; Peacock et al., 2002). Afflictions caused by this microorganism are also complicated by the problem of increasing resistance of S. aureus to antimicrobial agents including the worldwide emergence and spread of MRSA strains, which often
M. Kozio!-Montewka et al. demonstrate multi-drug resistance (von Eiff et al., 2001). This adverse phenomenon leads to limitation of therapeutic options (Kluytmans et al., 1997). Several authors have suggested that MRSA carriage poses an increased risk for the development of invasive infection over the risk of carriage of MSSA (Kluytmans et al., 1997). Nevertheless, recent data emphasize that particular attention should be paid not only to colonization with MRSA isolates but also to MSSA colonization since both groups of microorganisms may precede the development of invasive infections such as bacteremia (Archer and Climo, 2001). The results of our study indicate that the S. aureus carriage rate among examined patients differed substantially between 1998 and 2004. Namely, 57.1% of patients on haemodialysis were nasal carriers of the bacterium in 1998 whereas its carriage declined to the rate of 27.9% in 2004. The decrease of S. aureus colonization in 2004 could be largely ascribed to a better awareness of the hospital staff about the threat of transmission of the microorganism through hands of personnel. This has led to routine wearing of protective gloves during contacts with haemodialysed patients and reduction of the risk. Unexpectedly, only 1 (8.3%) MRSA isolate was identified during the investigation. Its resistance to oxacillin was detected by the disc diffusion method and confirmed by the automated Vitek system (MICZ8). Furthermore, the susceptibility testing revealed its unusual resistance pattern, which involved only b-lactams and tetracycline. The lack of multi-drug resistance, which has been considered a characteristic feature of nosocomial MRSA (Okuma et al., 2002; Fey et al., 2003; An Diep et al., 2004), suggested that the strain might be a member of CA-MRSA since this group of staphylococci is commonly susceptible to the majority of other non-b-lactam antibiotics (Fey et al., 2003). The hypothesis was subsequently corroborated by the fact that the MRSA strain was positive for the PVL leukocidin gene by PCR. This highly potent toxin targets mononuclear and polymorphonuclear cells (Holmes et al., 2005) and is considered a stable and unique molecular marker of the CAMRSA. The significant virulence potential reported for this group of microorganisms has been ascribed to production of the PVL implicated in the pathogenesis of skin and soft-tissue infections, as well as necrotizing pneumonia – two most commonly encountered afflictions caused by CA-MRSA (Lina et al., 1999; Vandenesch et al., 2003; An Diep et al., 2004; Dietrich et al., 2004; Liassine et al., 2004; Holmes et al., 2005; Faria et al., 2005). Interestingly, in spite of the ability of CA-MRSA to
ARTICLE IN PRESS The investigation of Staphylococcus aureus and coagulase-negative staphylococci nasal carriage affect otherwise healthy and immunocompetent people (Anonymous, 1999), many literature data indicate that the CA-MRSA are still of rare occurrence in this group of patients as most infected individuals have risk factors predisposing to MRSA acquisition (Salgado et al., 2003). The typical risk factors include recent hospitalization, severe underlying illness, indwelling devices, dialysis, a close proximity to a patient who is infected or colonized with MRSA, and prolonged or recurrent exposure to antibiotics (Salgado et al., 2003; Vandenesch et al., 2003; Dietrich et al., 2004). Our results support these observations since the carrier of CA-MRSA in the present study had predisposing factors in addition to the end-stage renal disease including malignancy, hepatitis C, and a history of previous hospitalization (Akram and Glatt, 1998; Vandenesch et al., 2003). Nevertheless, the elucidation of the origin of the MRSA was not possible with certainty. The association of the MRSA with the health-care setting seems to be plausible taking into account the history of 2-month hospitalization experienced by the patient a year before the strain recovery. Nevertheless, since the patient was not screened for MRSA at the time of hospital admission and had no known history of acquiring the microorganism during the hospital stay, the possibility of colonization in the community before or after hospitalization cannot be ruled out. Another aspect of the study considered characterization of CNS colonizing anterior nares of the patients. CNS have long been regarded as harmless skin and mucous membranes commensals and often dismissed as clinically nonrelevant culture contaminants (Huebner and Goldmann, 1999; Marsou et al., 2001; Couto et al., 2001; Shittu et al., 2004). Their role as important opportunistic pathogens has been recognized only recently. The increasing incidence of infections caused by these microorganisms can be attributed to their particular affinity for the foreign materials that have become integral part of modern medicine (Huebner and Goldmann, 1999). The importance of CNS reported as causative agents of serious nosocomial infections has been associated with the increasing use of prosthetic, indwelling devices and immunocompromised patients including those receiving haemodialysis (Huebner and Goldmann, 1999; Couto et al., 2001; Spare et al., 2003; Shittu et al., 2004). Furthermore, the CNS have become increasingly resistant against many antimicrobial agents leading to serious limitation of therapeutic options (Huebner and Goldmann, 1999). The mechanism of methicillin resistance, which represents one of the major problems associated with antimicrobial
285
therapy of afflictions caused by these bacteria, is considered essentially the same with CNS and S. aureus and associated with the chromosomal mecA gene, encoding for a novel penicillin-binding protein (PBP20 ) demonstrating low binding affinities to b-lactam antibiotics (Hiramatsu et al., 2002). It has been reported that more than 80% of clinical CNS strains and 30–40% of CNS obtained from healthy carriers or patients from the community currently demonstrate resistance to methicillin, which is usually connected with resistance to multiple antimicrobial agents (Huebner and Goldmann, 1999; de Mattos et al., 2003). Therefore, full and accurate characterization of CNS isolates cultured in clinical samples along with their identification to the species level (Couto et al., 2001; Shittu et al., 2004) would be very helpful for an early prediction of the potential pathogenicity or antibiotic susceptibility of each clinically significant isolate (Couto et al., 2001). The results of our study indicate the higher rate of methicillin resistance among CNS isolates (38.4%) than among S. aureus isolates (8.3%) colonizing anterior nares of patients on haemodialysis. Methicillin resistance among CNS was also accompanied by the lack of susceptibility to other classes of antibiotics including tetracycline (70% of isolates), trimethoprim/sulfamethoxazole (40%), and ciprofloxacin (10%). Additionally, 50% of the MRCNS demonstrated constitutive MLSB resistance type. The predominant CNS species isolated from patients’ nasal swabs in our study was S. epidermidis. Although this microorganism still accounts for the majority of CNS infections and appears to possess the greatest pathogenic potential and diversity, other species have also been associated with a variety of human diseases (Couto et al., 2001; Marsou et al., 2001; Shittu et al., 2004). Among non-S. epidermidis species responsible for invasive infections at least several should be mentioned. S. haemolyticus is the second most commonly encountered species in clinical infections (Lee and Park, 2001; Marsou et al., 2001) and it has been reported to cause myocarditis, sepsis, peritonitis, and urinary tract infections (Lee and Park, 2001). S. saprophyticus is believed to be the causative agent of opportunistic infections of the female urinary tract (Lee and Park, 2001) by its capacity to adhere specifically to uroepithelial cells and to elaborate urease, which is responsible for tissue damage and invasion (Huebner and Goldmann, 1999; von Eiff et al., 2002). The relatively newly described CNS species, namely S. lugdunensis and S. schleiferi also appear to be significant opportunistic pathogens (Lee and Park, 2001;
ARTICLE IN PRESS 286 Marsou et al., 2001). They have been reported as etiologic agents in a range of nosocomial infections including endocarditis, polymer-associated infections, osteomyelitis, septic arthritis, urinary tract infections, and wound infections. S. lugdunensis has been regarded as more pathogenic than most members of the genus Staphylococcus because of the aggressive nature of infections observed in many cases. The two mentioned species seem to share ability to express a clumping factor and/or produce a thermostable DNAse and to produce virulence determinants with the most pathogenic species among staphylococci – S. aureus (Poutanen, 2001; von Eiff et al., 2002). S. lugdunensis has also been much less commonly than other CNS species considered to be a contaminant or colonizing microorganism and is much more likely to be considered a significant isolate (Poutanen, 2001). Moreover, some authors suggest that any isolate of this species should be considered a pathogen until proven otherwise (Poutanen, 2001). We found two isolates of S. lugdunensis among 26 CNS isolates colonizing patients’ anterior nares. Both S. lugdunensis isolates analyzed in our study had unusually favorable antibiotic susceptibility patterns – they were fully sensitive to all antibiotics used in the susceptibility testing. This finding is in accordance with literature data (Poutanen, 2001), which report that S. lugdunensis has nearly uniform in vitro susceptibility to most antimicrobials, including penicillins and cephalosporins. The antimicrobial susceptibility testing of other non-S. epidermidis species cultured from nasal swabs obtained from patients on haemodialysis revealed that S. warneri and S. capitis isolates also demonstrated sensitivity to all antimicrobials, whereas the S. haemolyticus isolate showed resistance to methicillin accompanied by multi-drug resistance to tetracycline, erythromycin, and lincomycin (cMLSB mechanism). Our study met several limitations. First of all, the patients included in the study were screened for staphylococcal colonization of the nasal mucosa only once. Therefore, we were not able to state whether the positive results represented intermittent or persistent nasal carriage. Second, the study was focused primarily on investigation of colonization frequency and no invasive infections of staphylococcal etiology were recorded and observed during the study period. Summing up, the results of our study demonstrated the decrease in S. aureus nasal carriage rate among haemodialysed patients at 6-year interval and the lower rate of methicillin resistance among S. aureus isolates in comparison with CNS. We also infer that the MRSA strain identified in the study was a member of CA-MRSA, as evidenced by
M. Kozio!-Montewka et al. the presence of the pvl gene and a favorable antibiotic susceptible pattern. Furthermore, CNS characterization enabled identification of species characterized by a significant virulence potential and the ability to develop resistance against a wide spectrum of antimicrobial agents. The abovementioned findings indicate the usefulness of investigation of staphylococcal colonization of the nasal mucosa – the primary ecological niche for these microorganisms – in order to better understand the epidemiology of this phenomenon, but also to develop prevention measures and treatment strategies in case of established infections among predisposed patients such as those suffering form end-stage renal disease and undergoing haemodialysis treatment.
References Akram, J., Glatt, A.E., 1998. True community-acquired methicillin-resistant Staphylococcus aureus bacteremia. Infect. Control Hosp. Epidemiol. 19, 106–107. Ala’Aldeen, D., 2002. A non-multiresistant community MRSA exposes its genome. Lancet 359, 1791–1792. An Diep, B., et al., 2004. Widespread skin and soft-tissue infections due to two methicillin-resistant Staphylococcus aureus strains harboring the genes for PantonValentine Leukocidin. J. Clin. Microbiol. 42, 2080–2084. Anonymous, 1999. Four pediatric deaths from community-acquired methicillin-resistant Staphylococcus aureus – Minnesota and North Dakota, 1997–1999. Morb. Mortal. Wkly. Rep. 48, 707–710. Archer, G.L., Climo, M.W., 2001. Staphylococcus aureus bacteremia – consider the source. N. Engl. J. Med. 344, 55–56. Brakstad, O.G., Aasbakk, K., Maeland, J.A., 1992. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene. J. Clin. Microbiol. 30, 1654–1660. Chow, J.W., Yu, V.L., 1989. Staphylococcus aureus nasal carriage in hemodialysis patients. Its role in infection and approaches to prophylaxis. Arch. Intern. Med. 149, 1258–1262. Costa, S.F., et al., 2004. Mucosa or skin as source of coagulase-negative staphylococcal bacteraemia? Lancet Infect. Dis. 4, 278–286. Couto, I., et al., 2001. Identification of clinical staphylococcal isolates from humans by Internal Transcribed Spacer PCR. J. Clin. Microbiol. 39, 3099–3103. de Mattos, E.M., et al., 2003. Isolation of methicillinresistant coagulase-negative staphylococci from patients undergoing continuous ambulatory peritoneal dialysis (CAPD) and comparison of different molecular techniques for discriminating isolates of Staphylococcus epidermidis. Diagn. Microbiol. Infect. Dis. 45, 13–22.
ARTICLE IN PRESS The investigation of Staphylococcus aureus and coagulase-negative staphylococci nasal carriage Dietrich, D.W., et al., 2004. Community-acquired methicillin-resistant Staphylococcus aureus in Southern New England children. Pediatrics 113, e347–e352. Ena, J., et al., 1994. Epidemiology of Staphylococcus aureus infections in patients on haemodialysis. Infect. Control Hosp. Epidemiol. 15, 78–81. Faria, N.A., et al., 2005. Epidemiology of emerging methicillin-resistant Staphylococcus aureus (MRSA) in Denmark: a nationwide study in a country with low prevalence of MRSA infection. J. Clin. Microbiol. 43, 1836–1842. Fey, P.D., et al., 2003. Comparative molecular analysis of community- or hospital-acquired methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 47, 196–203. Goldblum, S.E., Reed, W.P., 1980. Host defenses and immunologic alterations associated with chronic hemodialysis. Ann. Intern. Med. 93, 597–613. Herwaldt, L.A., 2003. Staphylococcus aureus nasal carriage and surgical-site infections. Surgery 134, S2–S9. Hiramatsu, K., et al., 2002. Molecular genetics of methicillin-resistant Staphylococcus aureus. Int. J. Med. Microbiol. 292, 67–74. Holmes, A., et al., 2005. Staphylococcus aureus isolates carrying Panton-Valentine leukocidin genes in England and Wales: frequency, characterization, and association with clinical disease. J. Clin. Microbiol. 43, 2384–2390. Huebner, J., Goldmann, D.A., 1999. Coagulase-negative staphylococci: role as pathogens. Annu. Rev. Med. 50, 223–236. Kluytmans, J., et al., 1997. Nasal carriage of Staphylococcus aureus: epidemiology, underlying mechanisms. Clin. Microbiol. Rev. 10, 505–520. Kobayashi, N., Wu, H., Kojima, K., Taniguchi, K., Urasawa, S., Uehara, N., et al., 1994. Detection of mecA, femA, and femB genes in clinical strains of staphylococci using polymerase chain reaction. Epid. Infect. 113, 259–266. Koziol-Montewka, M., et al., 2001. Rate of Staphylococcus aureus nasal carriage in immunocompromised patients receiving haemodialysis treatment. Int. J. Antimicrob. Agents 18, 193–196. Lee, M.K., Park, A.J., 2001. Rapid species identification of coagulase-negative staphylococci by rRNA spacer length polymorphism analysis. J. Infect. 42, 189–194. Leonard, R.B., Mayer, J., Sasser, M., Woods, M.L., Mooney, B.R., Brinton, B.G., Newcomb-Gayman, P.L., Carroll, K.C., 1995. Comparison of MIDI Sherlock system and pulsed-field gel electrophoresis in characterizing strains of methicillin-resistant Staphylococcus aureus from a recent hospital outbreak. J. Clin. Microbiol. 33, 2723–2727.
287
Liassine, N., et al., 2004. Community-acquired methicillin-resistant Staphylococcus aureus isolated in Switzerland contains the Panton-Valentine Leukocidin or exfoliative genes toxin genes. J. Clin. Microbiol. 42, 825–828. Lina, G., et al., 1999. Involvement of Panton-Valentine Leukocidin-producing Staphylococcus aureus in primary skin infections and pneumonia. Clin. Infect. Dis. 29, 1128–1132. Marsou, R., et al., 2001. Molecular techniques open up new vistas for typing of coagulase-negative staphylococci. Pathol. Biol. 49, 205–215. Nouwen, J.L., et al., 2001. Determinants of Staphylococcus aureus nasal carriage. Neth. J. Med. 59, 126–133. Okuma, K., et al., 2002. Dissemination of new methicillin-resistant Staphylococcus aureus clones in the community. J. Clin. Microbiol. 40, 4289–4294. Peacock, S.J., et al., 2002. Preventing Staphylococcus aureus infection in the renal unit. Q. J. Med. 95, 405–410. Poutanen, S.M., 2001. Staphylococcus lugdunensis: a notably distinct coagulase-negative Staphylococcus. Clin. Microbiol. Newsletter 23, 147–150. Salgado, C.D., et al., 2003. Community-acquired methicillin-resistant Staphylococcus aureus: a meta-analysis of prevalence and risk factors. Clin. Infect. Dis. 36, 131–139. Shittu, A., et al., 2004. Isolation and molecular characterization of multiresistant Staphylococcus sciuri and Staphylococcus haemolyticus associated with skin and soft-tissue infections. J. Med. Microbiol. 53, 1–5. Spare, M.K., et al., 2003. Genotypic and phenotypic properties of coagulase-negative staphylococci causing catheter-related sepsis. J. Hosp. Infect. 54, 272–278. Toshkova, K., et al., 2001. The significance of nasal carriage of Staphylococcus aureus as risk factor for human skin infections. FEMS Microbiol. Lett. 202, 17–24. Vandenesch, F., et al., 2003. Community-acquired methicillin-resistant Staphylococcus aureus carrying PantonValentine Leukocidin genes: worldwide emergence. Emerg. Infect. Dis. 9, 978–984. von Eiff, Ch., et al., 2001. Nasal carriage as a source of Staphylococcus aureus bacteremia. N. Engl. J. Med. 344, 11–16. von Eiff, Ch., et al., 2002. Pathogenesis of infections due to coagulase-negative staphylococci. Lancet Infect. Dis. 2, 677–685. Wanten, G.J.A., et al., 1998. Optimizing screening procedures for Staphylococcus aureus nasal carriage in patients on haemodialysis. Nephrol. Dial. Transplant. 13, 1256–1258.