- Email: [email protected]
The Japanese Red Data book marine mollusk Japonacteon nipponensis and a Japonacteon population from Russia belong to the same species: Molecular evidence and recommendations for conservation
Global Ecology and Conservation 9 (2017) 82–89
Contents lists available at ScienceDirect
Global Ecology and Conservation journal homepage: www.elsevier.com/locate/gecco
Original Research Article
The Japanese Red Data book marine mollusk Japonacteon nipponensis and a Japonacteon population from Russia belong to the same species: Molecular evidence and recommendations for conservation Alexander Martynov a, *, Kazunori Hasegawa b , Tatiana Korshunova a,c a b c
Zoological Museum of the Moscow State University, Bolshaya Nikitskaya Str. 6 125009 Moscow, Russia National Museum of Nature and Science, 4-1-1 Amakubo, Tsukuba, Ibaraki 305-0005, Japan Koltzov Institute of Developmental Biology RAS, Vavilova Str. 26, 119334 Moscow, Russia
article
info
Article history: Received 15 November 2016 Received in revised form 7 December 2016 Accepted 8 December 2016
Keywords: Endangered marine environments Molecular systematics Mollusks Pacific Red data list species Tidal flats
a b s t r a c t The marine gastropod Japonacteon nipponensis is a representative species of endangered tidal flat environments in northeastern Asia. It is rated near-threatened in Japanese Red Data Books. A population of a closely similar species had also been recognized in the Russian part of the Sea of Japan at a single locality in Sukhodol Bay and was recently distinguished taxonomically as a subspecies distinct from the Japanese populations. Here we present for the first time molecular evidence that confirms that both populations represent J. nipponensis with little genetic distance. The Russian population of this near-threatened species will be included in a forthcoming edition of the Red Data Book of Russia. Tidal flats in Japan and elsewhere in Asia have been seriously impacted in recent years by intensive coastal development. Although the sole known locality of this species in Russia in Sukhodol Bay is still intact, there are plans to construct a large coal terminal on the bay. The presence not only of this particular species but also of others specifically associated with this particular kind of biotope make it desirable to protect the whole habitat of Sukhodol Bay and surrounding localities in the Russian part of the Sea of Japan. © 2016 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
1. Introduction A census of global biodiversity is among the key tasks in modern biological science (Gaston, 2000; Tittensor et al., 2010; Wiens, 2015). Two decades of the routine application of molecular tools has revealed significant inconsistencies within traditional morphology-based systematics and phylogenetics (Scheffers et al., 2016). This is a serious challenge for biological conservation because accurate taxonomy is indispensable in evaluating conservation status (Bickford et al., 2006) and many invertebrate taxa are already facing extinction. Here a relevant case is presented concerning a marine mollusk of the genus Japonacteon. It is a member of the shell-bearing gastropod family Acteonidae, which is now shown to be a sister to the large clade containing most of taxa previously assigned to the opisthobranchs and pulmonates (Kano et al., 2016). Japonacteon nipponensis was first described as a fossil species from Pleistocene deposits in the Tokyo region (Yamakawa, 1911). Living specimens were then found in several localities around Japan and the Korean Peninsula (Fig. 1A), and the species has until now been regarded as endemic to that region.
*
Corresponding author. E-mail address: [email protected] (A. Martynov).
http://dx.doi.org/10.1016/j.gecco.2016.12.002 2351-9894/© 2016 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/ licenses/by-nc-nd/4.0/).
A. Martynov et al. / Global Ecology and Conservation 9 (2017) 82–89
83
Fig. 1. Study area. (A) Map of the northwestern part of the Pacific Ocean including Japan and Russia. Red dots indicate literature data on the occurrence of J. nipponensis (see text for detail), and blue dots indicate the data obtained in the present study based on the collection in the National Museum of Nature and Science (for Japan) and in the Zoological Museum Moscow State University (for Russia). (B) Photo of the tidal flat in the Russian part of the Sea of Japan (Sukhodol Bay) where J. nipponensis specimens were collected. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
It is endemic to the marine tidal flats (Fig. 1B) and has been assigned near-threatened status in Japanese red data books (Japanese Association of Benthology, 2012; Ministry of Environment, 2014) and least concern status in the Red Data Book of Endangered Mollusks in Korea (National Institute of Biological Resources, 2012). Marine tidal flats in Japan and elsewhere in Asia have been seriously impacted by intensive construction of coastal infrastructure and other industrial development (Wada et al., 1996; Sato and Koh, 2004; Mukai, 2010). A species similar to J. nipponensis has also been reported from the Russian part of the Sea of Japan (Martynov, 1998, 2001; Martynov and Korshunova, 2011), also from a marine tidal flat (Fig. 1B). Despite considerable search efforts it has been found only in a limited area within Sukhodol Bay. It was tentatively considered to be conspecific with J. nipponensis, and is to be included in the forthcoming new edition of the Red Data Book of the Russian Federation (RDBRF, in preparation; Ministry of Natural Resources and Environment of the Russian Federation, 2016). However, there is currently a plan to construct a large coal terminal in this bay (Darkin and Kvint, 2016). Japonacteon in both Japan and Russia is thus seriously endangered by the destruction of its natural habitat. It was suggested previously that Japonacteon from the Russian part of the Sea of Japan possibly represented a different, undescribed species based on slight differences in coloration and morphology (Martynov, 2005; Chaban and Martynov, 2006). Most recently the Russian population was distinguished as a distinct subspecies from the Japanese J. nipponensis (Chernyshev and Chaban, 2016). However, molecular data (including the barcoding COI gene) have not been available for Russian specimens until the present study, and this has prevented correct assessment of the conservation status of this otherwise threatened species. In this study we obtained and investigated in detail live-collected specimens of Japonacteon both from Japan and Russia. Herein we present molecular data of two gene markers for the Russian and Japanese populations. After integrating molecular and morphological data, we conclude that specimens of Japonacteon from Japan and Russia clearly belong to the same species. Appropriate recommendations for the conservation of this species are therefore proposed.
84
A. Martynov et al. / Global Ecology and Conservation 9 (2017) 82–89
Fig. 2. Morphological comparison of Russian (A–F) and Japanese (G–M) specimens of J. nipponensis. (A) Living specimen from Sukhodol Bay (Russia), shell length—5 mm. (B) Same, in the natural habitat (sand of the tidal flat). (C) Shell of specimen from Sukhodol Bay used for molecular analysis (ZMMU-Op-573), shell length—5.3 mm. (D) Shell of a specimen from Sukhodol Bay used for molecular analysis (ZMMU-Op-575), shell length—5 mm. (E) Radula of specimen from Sukhodol Bay (ZMMU-Op-575). (F) Close up of central part of the radula of specimen ZMMU-Op-575. (G) Shell of a specimen from Ise Bay (Japan) used for molecular analysis (NSMT-Mo 78972, specimen 1), shell length—4.5 mm. (H) Shell of a specimen from Ise Bay (Japan) used for molecular analysis (NSMT-Mo 78972, specimen 2), shell length—4.9 mm. (I) Shell of a specimen from Mutsu Bay (Japan) (NSMT-Mo 56129), shell length—3.6 mm. (J) Shell of a specimen from Tsuyazaki, Fukuoka Pref., Kyushu (Japan) (NSMT-Mo 78975), shell length—9 mm. (K) Shell of a specimen from Tokyo Bay (Japan) (NSMT-Mo 78974), shell length—7.3 mm. (L) Radula of specimen from Ise Bay (Japan) (NSMT-Mo 78972, specimen 1). (M) Close up of central part of the radula of specimen NSMT-Mo 78972, specimen 1. Scale bars—100 µm (E, L) and 30 µm (F, M). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
A. Martynov et al. / Global Ecology and Conservation 9 (2017) 82–89
85
2. Materials and methods 2.1. Study area For the comparative molecular and morphological study were used specimens collected on tidal flats in Sukhodol Bay (which lies within the larger Peter the Great Bay, in the Russian part of the Sea of Japan) and near the Ise Bay, Pacific coast of Honshu (Japan) (Fig. 1). 2.2. Data collection Three live-collected specimens of J. nipponensis were obtained in Onoura Cove (near the mouth of Ise Bay, Pacific coast of Honshu, Japan; Fig. 1A) through the courtesy of Mr. Shoichi Kimura (collected by Mr. Tatsuya Sato; preserved in the National Museum of Nature and Science, Tsukuba, Japan (NSMT) with the register number NSMT-78972). Seven living specimens of J. nipponensis were collected in Sukhodol Bay (Fig. 1 B) (preserved in the Zoological Museum of Moscow State University, Russia (ZMMU) with register numbers ZMMU Op-573 – Op-577). Specimens were collected using a sieve. Living examples were photographed in situ or in the laboratory using a Nikon D90 or Nikon D810, and fixed in 80% ethanol for morphological study or in 99% ethanol for molecular analysis. In addition, dry specimens (either empty shells or air-dried live-collected specimens) from various parts of Japan were studied in the National Museum of Nature and Science, Tsukuba, Japan. 2.3. Morphological methods Morphological studies of the soft parts and shells were performed using light stereomicroscope, digital cameras, and the special double digital and scanning microscope system Keyence VHX-D510 (Fig. 2A–D, G–K). The radulae of one specimen each from Russia (Fig. 2E, F) and Japan (Fig. 2L, M) were studied using Camscan Series II and JSM–6380 scanning electron microscopes. 2.4. Molecular methods DNA was extracted from tissue of specimens preserved in 70%–99% ethanol with DiatomTM DNA Prep 100 kit (Isogene Lab) according to the producer’s protocols. Partial sequences of COI and 16S were amplified by polymerase chain reaction (PCR) using the primers: LCO 1490 (GGTCAACAAATCATAAAGATATTGG; Folmer et al., 1994); HCO 2198 (TAAACTTCAGGGTGACCAAAAAATCA; Folmer et al., 1994); 16S arL (CGCCTGTTTAACAAAAACAT; Palumbi et al., 2002) and 16S R (CCGRTYTGAACTCAGCTCACG; Puslednik and Serb, 2008). PCR amplifications were carried out in a 20-µL reaction volume, which included 4 µL of 5x Screen Mix by Eurogen Lab, 0.5 µL of each primer (10 µM stock), 1 µL of genomic DNA, and 14 µL of sterile water. The amplification of COI was performed with an initial denaturation for 1 min at 95 ◦ C, followed by 35 cycles of 15 s at 95 ◦ C (denaturation), 15 s at 45 ◦ C (annealing temperature), and 30 s at 72 ◦ C, with a final extension of 7 min at 72 ◦ C. The 16S amplification began with an initial denaturation for 1 min at 95 ◦ C, followed by 40 cycles of 15 s at 95 ◦ C (denaturation), 15 s at 52 ◦ C (annealing temperature), and 30 s at 72 ◦ C, with a final extension of 7 min at 72 ◦ C. Sequencing R for both strands proceeded with the ABI PRISM⃝ BigDyeTM Terminator v. 3.1. Sequencing reactions were analyzed using a 3730 DNA Analyzer (Applied Biosystems). Protein-coding sequences were translated into amino acids for confirmation of the alignment. All sequences were deposited in GenBank. The sequences were aligned with the MUSCLE (Edgar, 2004) algorithm. For species delimitation studies uncorrected p-distances between all species were calculated for the COI and 16S genes in MEGA7. Uncorrected COI p-distances within and between the J. nipponensis populations from Russia and Japan were obtained in MEGA7 (Kumar et al., 2016). 3. Results 3.1. Molecular analysis In the molecular study, two J. nipponensis specimens from Japan and four from Russia were used. A total of 12 sequences were generated in the present study and one further sequence of J. nipponensis was extracted from GenBank (Table 1). The molecular-based species delineation was used for differently evolving mitochondrial COI and 16S rRNA genes. In the 16S gene, there are no differences (0%) between any specimen sequenced in this study. Small divergence (0.25% ± 0.25%) is found between the present data and publicly available sequence from GenBank (voucher number EED-Phy-746; Table 2). These minor differences can be explained by intraspecific genetic diversity or the differences in DNA sequencing techniques. Regarding the fast-evolving COI marker, the genetic distances amongst all the available data are 0%–0.46% ± 0.26% (Table 3). The same genetic distance (0.15% ± 0.15%) is found between two voucher specimens from Japan (NSMT-Mo 789721 and NSMT-Mo 78972-2), as well as between pairs of voucher specimens from Russia (ZMMU:Op-573 and ZMMU:Op-574; ZMMU:Op-574 and ZMMU:Op-575, ZMMU:Op-576). The same genetic distance (0.15% ± 0.15%) is also recognized between NSMT-Mo 78972-2 (Japan) and ZMMU:Op-573, ZMMU:Op-575 and ZMMU:Op-576 (Russia). Uncorrected COI p-distances within J. nipponensis population from Japan (0.15%) and from Russia (0.076%), as well as between the populations (0.26%) are very small for interspecific distances.
86
A. Martynov et al. / Global Ecology and Conservation 9 (2017) 82–89
Table 1 List of specimens of J. nipponensis used for the molecular analyses.
a
Registration
Locality
GenBank accession nos. CO1
16S
NSMT-Mo 78972.1 NSMT-Mo 78972.2 ZMMU:Op-573 ZMMU:Op-574 ZMMU:Op-575 ZMMU:Op-576 420 EED-Phy-746
Japan: Ise Bay Japan: Ise Bay Russia: Sukhodol Bay Russia: Sukhodol Bay Russia: Sukhodol Bay Russia: Sukhodol Bay Japan: Nagahama, Aio Bay, Yamaguchi Cityb
KX863690 KX863691 KX863688 KX863689 KX863686 KX863687 –
KX863684 KX863685 KX863680 KX863681 KX863682 KX863683 GQ845191a
Publicly available sequence from GenBank.
b
Chernyshev and Chaban (2016) erroneously recorded the locality of the voucher specimen EED-Phy-746 as Sukhodol Bay, Russia; actual locality is in Japan. Table 2 Uncorrected p-distances (%) amongst J. nipponensis specimens for 16S markers.
EED-Phy-746 Japan NSMT-Mo 78972.1 Japan NSMT-Mo 78972.2 Japan ZMMU:Op-573 Russia ZMMU:Op-574 Russia ZMMU:Op-575 Russia ZMMU:Op-576 Russia
EED-Phy746 Japan
NSMT-Mo 78972.1 Japan
NSMT-Mo 78972.2 Japan
ZMMU:Op573 Russia
ZMMU:Op574 Russia
ZMMU:Op575 Russia
ZMMU:Op576 Russia
– 0.25 ± 0.25 ± 0.25 ± 0.25 ± 0.25 ± 0.25 ±
0.25 ± 0.25 – 0 0 0 0 0
0.25 ± 0.25 0 – 0 0 0 0
0.25 ± 0.25 0 0 – 0 0 0
0.25 ± 0.25 0 0 0 – 0 0
0.25 ± 0.25 0 0 0 0 – 0
0.25 ± 0.25 0 0 0 0 0 –
0.25 0.25 0.25 0.25 0.25 0.25
Table 3 Uncorrected p-distances (%) amongst J. nipponensis specimens for COI markers.
NSMT-Mo 78972.1 Japan NSMT-Mo 78972.2 Japan ZMMU:Op-573 Russia ZMMU:Op-574 Russia ZMMU:Op-575 Russia ZMMU:Op-576 Russia
NSMT-Mo 78972.1 Japan
NSMT-Mo 78972.2 Japan
ZMMU:Op573 Russia
ZMMU:Op574 Russia
ZMMU:Op575 Russia
ZMMU:Op576 Russia
– 0.15 ± 0.30 ± 0.46 ± 0.30 ± 0.30 ±
0.15 ± – 0.15 ± 0.30 ± 0.15 ± 0.15 ±
0.30 ± 0.21 0.15 ± 0.15 – 0.15 ± 0.15 0 0
0.46 ± 0.30 ± 0.15 ± – 0.15 ± 0.15 ±
0.30 ± 0.21 0.15 ± 0.15 0 0.15 ± 0.15 – 0
0.30 ± 0.21 0.15 ± 0.15 0 0.15 ± 0.15 0 –
0.15 0.21 0.26 0.21 0.21
0.15 0.15 0.21 0.15 0.15
0.26 0.21 0.15 0.15 0.15
3.2. Morphological and taxonomic data Japonacteon nipponensis (Yamakawa, 1911) (Fig. 2) Actaeon tornatilis var. nipponensis Yamakawa, 1911: pp. 39-40, pl. 10, figs. 1–3. Acteon nipponensis; Habe, 1950: p. 40, pl. 8, fig. 6. Japonactaeon nipponensis Taki, 1956: p. 48, pl. 9, figs. 1–4, pl. 10, figs. 1–4; Martynov, 1997: p. 77; Hori, 2000: p. 365–366; Suzuki et al., 2013: p. 36 (fig. 133), 147–148. Japonacteon undescribed species Martynov, 2005: p. 168; Chaban and Martynov, 2006: p. 250. Japonactaeon nipponensis ussuriensis Chernyshev and Chaban, 2016: pp. 83–91, figs. 1–4, new synonym Morphological characters (Fig. 2): Shell oval to elongated, length = 3.5–11 mm, diameter = 2–4.5 mm, imperforate or with narrow umbilicus. Protoconch coaxial, rounded, smooth, one whorl; transition to teleoconch clearly demarcated. Teleoconch sculptured by 12–30 moderately spaced spiral grooves, each consisting of a row of densely placed square punctuations; distance between grooves 3–7 times width of groove, decreasing towards aperture. Upper part of last whorl occasionally devoid of spiral grooves. Spire whorls rounded to angulate, spire profile slightly to considerably stepped. Aperture rounded-trapezoid; columellar region thickened, bearing weak fold. Weak tooth-like axial thickening on palatal region of aperture. Parietal callus thin, well delimited. Shell color blackish to variegate with whitish spots. Operculum small, thin, with concentric lines. Radular formula 26–28 × 4.(1).4, up to four denticles on lateral teeth, up to seven denticles on central teeth. 3.3. Distribution According to the literature, Recent specimens of J. nipponensis have been recorded in various parts of Japan and South Korea: in the deepest part of Tokyo Bay (Taki, 1956); around the Miura Peninsula (Muraoka and Naito, 1991); in and around
A. Martynov et al. / Global Ecology and Conservation 9 (2017) 82–89
87
Ise Bay (Hayase et al., 2011; Japanese Association of Benthology, 2012; Suzuki et al., 2013); in several parts of the Seto Inland Sea (Wada et al., 1996; Hamada, 2008; Ishikawa, 2012); northern Kyushu (Takahashi and Okamoto, 1969; Habe and Kikuchi, 1960) and South Korea (Min, 2001) (Fig. 1A). Because of the recent recognition of a closely similar species to J. nipponensis (Ishikawa, 2012; Suzuki et al., 2013), only records accompanied by a figure or identifiable information in literature are acknowledged here. Accordingly records from Wakasa Bay (Ito, 1990), off Yamaguchi Prefecture (Kawamoto and Tanabe, 1956; Fukuda et al., 1992) in the Sea of Japan, and from Izu Peninsula (Nakano, 2004) were rejected. A record of J. nipponensis from the North Korean part of Yellow Sea (Mollusks of West Sea of Korea, 1985) is also a misidentification. Furthermore, examination of NSMT material for the present study has confirmed majority of the previous records and added a new locality at the northern extreme of Honshu (Fig. 1A). 4. Discussion 4.1. Molecular evidence that Japanese and Russian populations of Japonacteon belong to the same species and implications for taxonomic status The present study revealed extremely high genetic homogeneity between Japanese and Russian populations of J. nipponensis despite their considerably wide geographical separation, and therefore rejected the recent proposal of taxonomical separation of the Russian population as a subspecies based on minor differences in the shell color (Chernyshev and Chaban, 2016). Accordingly J. nipponensis ussuriensis is regarded herein as a junior synonym of J. nipponensis. Some morphological differences in color pattern and shell morphology recognized in various specimens (Fig. 2C, D, G–H) are thus interpreted as intraspecific variations. There are accumulative data showing that shell morphology and color patterns in mollusks are considerably influenced by the environmental conditions, e.g. water temperature, food, and UV light (Lemer et al., 2015; Lezin and Flyachinskaya, 2015; Williams, 2016). The melanistic specimens of J. nipponensis from Russia (Fig. 2C, D), which are genetically identical to the more variegated Japanese specimens (Fig. 2G, H), therefore are not separate taxonomically. Darker colored shells were also discovered in a Japanese population from northern Honshu (Fig. 2I) in the present study. Furthermore, the amount of black pigment is variable among specimens from the Russian locality, and some possess more obvious light bands (Fig. 2C) similar to typical Japanese specimens. There are no significant differences between Russian (Fig. 2E, F) and Japanese (Fig. 2L, M) specimens in the morphology of the radular teeth. Although the nominal taxon J. nipponensis was firstly described from Japan as a Pleistocene fossil and the type material is lost (The University Museum, The University of Tokyo, 2008-2016; T. Sasaki, personal communication), figures in the original description (Yamakawa, 1911: pl. 10, Figs. 1–3) clearly indicate the important distinguishing characters of this species, especially the detail of the spiral sculpture, and there is no taxonomical and nomenclatural problem in identifying the Recent specimens as this taxon. Furthermore, examination of Recent specimens from Kasai, Tokyo, which is located less than 15 km from the type locality of the fossil taxon at Oji, Tokyo, confirmed the identification (Fig. 2K). 4.2. Recommendations for conservation Despite a number of records of J. nipponensis in Japan, the majority of them are based on specimens collected before the 1960s. An extensive recent search for this species in the Tokyo area failed to find any live specimens. In recent years, live specimens have been confirmed only in several localities around the Ise Bay, the Pacific coast of Honshu, and in the Seto Inland Sea (Wada et al., 1996; Hayase et al., 2011; Japanese Association of Benthology, 2012; Ishikawa, 2012), and J. nipponensis was rated as near-threatened species by the Japanese Association of Benthology (2012). The species has also been recorded only from the southern parts of the Korean peninsula (Min, 2001), and there have been no reliable records from North Korea, suggesting an endemic distribution in temperate warm waters. Sukhodol Bay, the sole known Russian locality, possesses an unaltered tidal flat environment with no considerable artificial deconstructions (Fig. 1B). Apart from J. nipponensis, several other warm-water macroinvertebrate species, including the Japanese swimming crab Charybdis japonica, have been recorded in the bay (Kolpakov and Kolpakov, 2011). Thus this particular locality is one of the few remaining unaltered natural habitats of species that are otherwise greatly endangered in neighboring regions (e.g. in Japan). However, there are currently plans to construct a large coal terminal within this bay (Darkin and Kvint, 2016) and this precious environment could thereby be completely destroyed. We therefore suggest that special efforts for protection of the whole of Sukhodol Bay and neighboring localities should be made in order to preserve this unique warm-water tidal flat enclave in an otherwise cold-water part of the Sea of Japan. Acknowledgments Toshihiko Fujita (National Museum of Nature and Science, Tsukuba) is thanked for organizing of the research stay of AM and TK in the above mentioned museum. We are grateful to Vladimir Poluyaktov (Vladivostok) who greatly helped us with transportation to the collecting site in Sukhodol Bay. We are also very grateful to Shoichi Kimura (Mie University) who kindly provided us with the live-collected specimens of J. nipponensis from Mie Prefecture, and Paul Callomon (Academy of Natural Sciences of Drexel University, Philadelphia) who made detailed linguistic corrections. A.G. Bogdanov and G.N. Davidovich (Electron Microscopy Laboratory, Moscow State University) are thanked for support with electron microscopy. The study is supported by a research project of MSU Zoological Museum (AAAA-A16-116021660077-3) and by the Russian Science Foundation (grant 14-50-00029, morphological and molecular study).
88
A. Martynov et al. / Global Ecology and Conservation 9 (2017) 82–89
References
Bickford, D., Lohman, D.J., Sodhi, N.S., Ng, P.K.L., Meier, R., Winker, K., Ingram, K.K., Das, I., 2006. Cryptic species as a window on diversity and conservation. Trends Ecol. Evol. 22, 148–155. http://dx.doi.org/10.1016/j.tree.2006.11.004. Chaban, E.M., Martynov, A.V., 2006. In: Kantor, Yu.I., Sysoev, A.V. (Eds.), Marine and Brackish Water Gastropoda of Russia and Adjacent Countries: An Illustrated Catalogue, KMK, Moscow, pp. 250–262. Chernyshev, A.V., Chaban, E.M., 2016. Japonacteon nipponensis (Yamakawa, 1911) (Gastropoda: Heterobranchia)—single species of the family Acteonidae in the Russian seas with description of a new subspecies. Bull. Russ. Far East. Malac. Soc. 20, 83–91. Darkin, S., Kvint, V., 2016. The Russian Far East: Strategic Priorities for Sustainable Development. Apple Academic Press, 184 p. Edgar, R.C., 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucl. Acids Res. 32, 1792–1797. http://dx.doi.org/10. 1093/nar/gkh340. Folmer, O., Black, M., Hoeh, W., Lutz, R., Vrijenhoek, R., 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotech. 3, 294–299. Fukuda, H., Mashino, J., Sugiura, T., 1992. An Outline of the Shells of Yamaguchi Prefecture. Yamaguchi Prefectural Museum, Yamatuchi. 99+xxvi pp., 50 pls. (in Japanese: Title translated by the present authors). Gaston, K.J., 2000. Global patterns in biodiversity. Nature 405, 220–227. http://dx.doi.org/10.1038/35012228. Habe, T., 1950. Pupidae in Japan. In: Kuroda, T. (Ed.), In: Illustrated Catalogue of Japanese Shells, Vol. 6, pp. 39–44. Habe, T., Kikuchi, T., 1960. Fauna and Flora of the Sea Around the Amakusa Marine Biological Laboratory, Part I. Mollusca. The Amakusa Marine Biological Laboratory, Kyushu University, Kumamoto, 70 pp. Hamada, T., 2008. The Shells of Oita Prefecture. Published by the author, Oita, 136 pp. (in Japanese). Hayase, Y., Tanekura, T., Shakema, T., Matsunaga, Y., Yoshikawa, T., Matsuura, H., Ishikawa, S., 2011. The molluscan fauna of a tidal flat area and an intertidal rocky shore in Mikawa Bay, Hazu-cho, Aichi, Japan. Bull. Inst. Oceanic Res. and Develop. 32, Tokai Univ., 11–33. Hori, S., 2000. Family Acteonidae. In: Okutani, T. (Ed.), In: Marine Mollusks in Japan, Tokai University Press, Tokyo, Japan, pp. 365–366. Ishikawa, Y., 2012. A shell previously confused with Japonacteon nipponensis and Pupa strigosa (trans. auct.). Maigo, Reports of the Shikoku Shell Club, 19, pp. 6–7 (in Japanese: Title translated by the present authors). Ito, K., 1990. Distribution of molluscan shells in Wakasa Bay. Japan Sea. Bull. Japan Sea Nat. Fish. Res. Inst. 40, 79–211 (in Japanese). Japanese Association of Benthology (Ed.), 2012. Threatened Animals of Japanese Tidal Flats: Red Data Book of Seashore Benthos. Tokai University press, Tokyo. xvii+285 pp. (in Japanese). Kano, Y., Brenzinger, B., Nützel, A., Wilson, N.G., Schrödl, M., 2016. Ringiculid bubble snails recovered as the sister group to sea slugs (Nudipleura). Sci. Rep., 6, 30908, http://dx.doi.org/10.1038/srep30908. Kawamoto, T., Tanabe, S., 1956. Catalogue of Molluscan Shells of Yamaguti Prefecture. x+171 pp. Uamaguti Prefectural Yamaguti Museum, Yamaguchi. Kolpakov, N.V., Kolpakov, E.V., 2011. On the biology of the Japanese Swimming Crab Charybdis japonica (Portunidae) in waters of Primorye at the northern boundary of their range. Russ. J. Mar. Biol. 37, 570–578. Kumar, S., Stecher, G., Tamura, K., 2016. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33, 1870–1874. http://dx.doi.org/10.1093/molbev/msw054. Lemer, S., Saulnier, D., Gueguen, Y., Planes, S., 2015. Identification of genes associated with shell color in the black-lipped pearl oyster, Pinctada margaritifera. BMC Genomics 16, 568. http://dx.doi.org/10.1186/s12864-015-1776-x. Lezin, P., Flyachinskaya, L., 2015. Shell sculpture formation in bivalves of the genus Hiatella under different temperature conditions. J. Mar. Biol. Ass. UK. 95, 1621–1627. http://dx.doi.org/10.1017/S0025315415000259. Martynov, A.V., 1997. Subclass Opisthobranchia. In: Kussakin, O.G., Ivanova, M.B., Tsurpalo, A.P. (Eds.), In: List of the Animals, Plants and Fungi of the Intertidal of Far-Eastern Seas of Russia, Dalnauka, Vladivostok, Russia, pp. 77–80. Martynov, A.V., 1998. Subclass Opisthobranchia. In: Adrianov A.V. and Kussakin O.G (Eds.), Taxonomic Catalogue of Biota of Peter the Great Bay, Dalnauka, Vladivostok, Russia, pp. 204–209. Martynov, A.V., 2001. Japonacteon nipponensis from Russia. Message in Sea Slug Forum. Australian Museum, Sydney. Available from http://www. seaslugforum.net/find/4607. Martynov, A.V., 2005. Undescribed species of Japonacteon. In: Kantor, Yu.I., Sysoev, A.V. (Eds.), Catalogue of Molluscs of Russia and Adjacent Countries, KMK, Moscow, p. 168. Martynov, A.V., Korshunova, T.A., 2011. Opisthobranch Molluscs of the Seas of Russia. A Colour Guide to their Taxonomy and Biology. Fiton Press, Moscow, 230 pp. Min, D.-K., 2001. Korean Mollusks with Color Illustration. Shell House, Seoul, 333 pp. (in Korean). Ministry of Environment, 2014. Red Data Book 2014—Threatened Wildlife of Japan—Volume 6, Mollusks. Gyosei Corporation. xliii+455 pp. (in Japanese). Ministry of Natural Resources and Environment of the Russian Federation, 2016. Draft order ‘‘On approval of the list of objects of fauna listed in the Red Book of Russia and excluded from the Red Book of the Russian Federation’’, http://www.mnr.gov.ru/regulatory/detail.php?ID=145272. Mollusks of West Sea of Korea, 1985. Kim Il-Sung University, Pyongyang. 276 p. (in Korean). Mukai, H., 2010. Habitat diversity and its loss in Japanese coastal marine ecosystems. In: International Symposium on Integrated Coastal Management for Marine Biodiversity in Asia, January 14–15, 2010, Kyoto, Japan, pp. 25–27. Muraoka, K., Naito, T., 1991. Catalogue of the molluscan shells donated by Mr. Yhotaro Nomura to the Kanagawa Prefectural Museum. Catalogues of Specimens in the Kanagawa Prefectural Museum. Div. Nat. Stud. 5, 1–167. Nakano, R., 2004. Opisthobranchs of Japan Islands. Rutles, Inc., Tokyo, 304 pp. National Institute of Biological Resources, 2012. Red Data Book of Endangered Mollusks in Korea, Incheon. 207 pp. Palumbi, S.R., Martin, A.P., Romano, S., Mcmillan, W.O., Stice, L., Grabowski, G., 2002. The Simple Fool’S Guide To PCR. Department of Zoology Special Publication. University of Hawaii, Honolulu. Puslednik, L., Serb, J.M., 2008. Molecular phylogenetics of the Pectinidae (Mollusca: Bivalvia) and effect of increased taxon sampling and outgroup selection on tree topology. Mol. Phyl. Evol. 48, 1178–1188. http://dx.doi.org/10.1016/j.ympev.2008.05.006. RDBRF, in preparation. Red Data Book of the Russian Federation, new ed. Sato, M., Koh, C.-H., 2004. Biological richness of the Asian tidal flats and its crisis by human impacts. In: Hong, S.-E., et al. (Eds.), Ecological Issues in a Changing World, Springer and Kluwer Academic Publishers, Berlin, Amsterdam, pp. 135–155. Scheffers, B.R, Joppa, L.N., Pimm, S.L., Laurance, W.F., 2016. What we know and don’t know about Earth’s missing biodiversity. Trends Ecol. Evol. 27, 501–510. http://dx.doi.org/10.1016/j.tree.2012.05.008. Suzuki, T., Kimura, S., Kimura, T., Mori, K., Taru, M., 2013. Benthos of the Tidal Flat. Wetland International Japan, Tokyo, 257 pp. Takahashi, G., Okamoto, M., 1969. A Catalogue of Molluscan Shells of Fukuoka Prefecture. Published by the authors. iii + 154 pp. (in Japanese). Taki, I., 1956. Japonactaeon, a new genus of Pupidae (Opisthobranchia, Gastropoda). Bul. Nat. Sci. Mus. 3, 47–51.
A. Martynov et al. / Global Ecology and Conservation 9 (2017) 82–89
89
The University Museum, The University of Tokyo, 2008–2016. Acteon (Japanacteon) nipponensis (Yamakawa). Paleontology Collections Database. http:// umdb.um.u-tokyo.ac.jp/fmi/xsl/DKoseibu/jp/Collection/detail.xsl?umutNo=23599&-token.request=Keyword.op=cn|Keyword=nipponensis|-max=10|& -find. (Accessed 26 July 2016). Tittensor, D.P., Mora, C., Jetz, W., Lotze, H.K., Ricard, D., Berghe, E.V., Worm, B., 2010. Global patterns and predictors of marine biodiversity across taxa. Nature 466, 1098–1103. http://dx.doi.org/10.1038/nature09329. Wada, K., Nishihira, T., Furota, T., Nojima, S., Yamanishi, R., Nishikawa, T., Goshima, S., Suzuki, T., Kato, M., Shimamura, K., Fukuda, H., 1996. Present status of estuarine locales and benthic invertebrates occurring in estuarine environment in Japan. WWW Japan Sc. Rep., 3, 1–182. (in Japanese with English summary). Wiens, J.J., 2015. Faster diversification on land than sea helps explain global biodiversity patterns among habitats and animal phyla. Ecol. Lett . http: //dx.doi.org/10.1111/ele.12503. Williams, S.T., 2016. Molluscan shell colour. Biol. Rev . http://dx.doi.org/10.1111/brv.12268. Yamakawa, G., 1911. Description of some fossils opisthobranchiate from the diluvial deposits of Japan. J. Geol. Soc. Tokyo 18, 39–52.
Contents lists available at ScienceDirect
Global Ecology and Conservation journal homepage: www.elsevier.com/locate/gecco
Original Research Article
The Japanese Red Data book marine mollusk Japonacteon nipponensis and a Japonacteon population from Russia belong to the same species: Molecular evidence and recommendations for conservation Alexander Martynov a, *, Kazunori Hasegawa b , Tatiana Korshunova a,c a b c
Zoological Museum of the Moscow State University, Bolshaya Nikitskaya Str. 6 125009 Moscow, Russia National Museum of Nature and Science, 4-1-1 Amakubo, Tsukuba, Ibaraki 305-0005, Japan Koltzov Institute of Developmental Biology RAS, Vavilova Str. 26, 119334 Moscow, Russia
article
info
Article history: Received 15 November 2016 Received in revised form 7 December 2016 Accepted 8 December 2016
Keywords: Endangered marine environments Molecular systematics Mollusks Pacific Red data list species Tidal flats
a b s t r a c t The marine gastropod Japonacteon nipponensis is a representative species of endangered tidal flat environments in northeastern Asia. It is rated near-threatened in Japanese Red Data Books. A population of a closely similar species had also been recognized in the Russian part of the Sea of Japan at a single locality in Sukhodol Bay and was recently distinguished taxonomically as a subspecies distinct from the Japanese populations. Here we present for the first time molecular evidence that confirms that both populations represent J. nipponensis with little genetic distance. The Russian population of this near-threatened species will be included in a forthcoming edition of the Red Data Book of Russia. Tidal flats in Japan and elsewhere in Asia have been seriously impacted in recent years by intensive coastal development. Although the sole known locality of this species in Russia in Sukhodol Bay is still intact, there are plans to construct a large coal terminal on the bay. The presence not only of this particular species but also of others specifically associated with this particular kind of biotope make it desirable to protect the whole habitat of Sukhodol Bay and surrounding localities in the Russian part of the Sea of Japan. © 2016 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
1. Introduction A census of global biodiversity is among the key tasks in modern biological science (Gaston, 2000; Tittensor et al., 2010; Wiens, 2015). Two decades of the routine application of molecular tools has revealed significant inconsistencies within traditional morphology-based systematics and phylogenetics (Scheffers et al., 2016). This is a serious challenge for biological conservation because accurate taxonomy is indispensable in evaluating conservation status (Bickford et al., 2006) and many invertebrate taxa are already facing extinction. Here a relevant case is presented concerning a marine mollusk of the genus Japonacteon. It is a member of the shell-bearing gastropod family Acteonidae, which is now shown to be a sister to the large clade containing most of taxa previously assigned to the opisthobranchs and pulmonates (Kano et al., 2016). Japonacteon nipponensis was first described as a fossil species from Pleistocene deposits in the Tokyo region (Yamakawa, 1911). Living specimens were then found in several localities around Japan and the Korean Peninsula (Fig. 1A), and the species has until now been regarded as endemic to that region.
*
Corresponding author. E-mail address: [email protected] (A. Martynov).
http://dx.doi.org/10.1016/j.gecco.2016.12.002 2351-9894/© 2016 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/ licenses/by-nc-nd/4.0/).
A. Martynov et al. / Global Ecology and Conservation 9 (2017) 82–89
83
Fig. 1. Study area. (A) Map of the northwestern part of the Pacific Ocean including Japan and Russia. Red dots indicate literature data on the occurrence of J. nipponensis (see text for detail), and blue dots indicate the data obtained in the present study based on the collection in the National Museum of Nature and Science (for Japan) and in the Zoological Museum Moscow State University (for Russia). (B) Photo of the tidal flat in the Russian part of the Sea of Japan (Sukhodol Bay) where J. nipponensis specimens were collected. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
It is endemic to the marine tidal flats (Fig. 1B) and has been assigned near-threatened status in Japanese red data books (Japanese Association of Benthology, 2012; Ministry of Environment, 2014) and least concern status in the Red Data Book of Endangered Mollusks in Korea (National Institute of Biological Resources, 2012). Marine tidal flats in Japan and elsewhere in Asia have been seriously impacted by intensive construction of coastal infrastructure and other industrial development (Wada et al., 1996; Sato and Koh, 2004; Mukai, 2010). A species similar to J. nipponensis has also been reported from the Russian part of the Sea of Japan (Martynov, 1998, 2001; Martynov and Korshunova, 2011), also from a marine tidal flat (Fig. 1B). Despite considerable search efforts it has been found only in a limited area within Sukhodol Bay. It was tentatively considered to be conspecific with J. nipponensis, and is to be included in the forthcoming new edition of the Red Data Book of the Russian Federation (RDBRF, in preparation; Ministry of Natural Resources and Environment of the Russian Federation, 2016). However, there is currently a plan to construct a large coal terminal in this bay (Darkin and Kvint, 2016). Japonacteon in both Japan and Russia is thus seriously endangered by the destruction of its natural habitat. It was suggested previously that Japonacteon from the Russian part of the Sea of Japan possibly represented a different, undescribed species based on slight differences in coloration and morphology (Martynov, 2005; Chaban and Martynov, 2006). Most recently the Russian population was distinguished as a distinct subspecies from the Japanese J. nipponensis (Chernyshev and Chaban, 2016). However, molecular data (including the barcoding COI gene) have not been available for Russian specimens until the present study, and this has prevented correct assessment of the conservation status of this otherwise threatened species. In this study we obtained and investigated in detail live-collected specimens of Japonacteon both from Japan and Russia. Herein we present molecular data of two gene markers for the Russian and Japanese populations. After integrating molecular and morphological data, we conclude that specimens of Japonacteon from Japan and Russia clearly belong to the same species. Appropriate recommendations for the conservation of this species are therefore proposed.
84
A. Martynov et al. / Global Ecology and Conservation 9 (2017) 82–89
Fig. 2. Morphological comparison of Russian (A–F) and Japanese (G–M) specimens of J. nipponensis. (A) Living specimen from Sukhodol Bay (Russia), shell length—5 mm. (B) Same, in the natural habitat (sand of the tidal flat). (C) Shell of specimen from Sukhodol Bay used for molecular analysis (ZMMU-Op-573), shell length—5.3 mm. (D) Shell of a specimen from Sukhodol Bay used for molecular analysis (ZMMU-Op-575), shell length—5 mm. (E) Radula of specimen from Sukhodol Bay (ZMMU-Op-575). (F) Close up of central part of the radula of specimen ZMMU-Op-575. (G) Shell of a specimen from Ise Bay (Japan) used for molecular analysis (NSMT-Mo 78972, specimen 1), shell length—4.5 mm. (H) Shell of a specimen from Ise Bay (Japan) used for molecular analysis (NSMT-Mo 78972, specimen 2), shell length—4.9 mm. (I) Shell of a specimen from Mutsu Bay (Japan) (NSMT-Mo 56129), shell length—3.6 mm. (J) Shell of a specimen from Tsuyazaki, Fukuoka Pref., Kyushu (Japan) (NSMT-Mo 78975), shell length—9 mm. (K) Shell of a specimen from Tokyo Bay (Japan) (NSMT-Mo 78974), shell length—7.3 mm. (L) Radula of specimen from Ise Bay (Japan) (NSMT-Mo 78972, specimen 1). (M) Close up of central part of the radula of specimen NSMT-Mo 78972, specimen 1. Scale bars—100 µm (E, L) and 30 µm (F, M). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
A. Martynov et al. / Global Ecology and Conservation 9 (2017) 82–89
85
2. Materials and methods 2.1. Study area For the comparative molecular and morphological study were used specimens collected on tidal flats in Sukhodol Bay (which lies within the larger Peter the Great Bay, in the Russian part of the Sea of Japan) and near the Ise Bay, Pacific coast of Honshu (Japan) (Fig. 1). 2.2. Data collection Three live-collected specimens of J. nipponensis were obtained in Onoura Cove (near the mouth of Ise Bay, Pacific coast of Honshu, Japan; Fig. 1A) through the courtesy of Mr. Shoichi Kimura (collected by Mr. Tatsuya Sato; preserved in the National Museum of Nature and Science, Tsukuba, Japan (NSMT) with the register number NSMT-78972). Seven living specimens of J. nipponensis were collected in Sukhodol Bay (Fig. 1 B) (preserved in the Zoological Museum of Moscow State University, Russia (ZMMU) with register numbers ZMMU Op-573 – Op-577). Specimens were collected using a sieve. Living examples were photographed in situ or in the laboratory using a Nikon D90 or Nikon D810, and fixed in 80% ethanol for morphological study or in 99% ethanol for molecular analysis. In addition, dry specimens (either empty shells or air-dried live-collected specimens) from various parts of Japan were studied in the National Museum of Nature and Science, Tsukuba, Japan. 2.3. Morphological methods Morphological studies of the soft parts and shells were performed using light stereomicroscope, digital cameras, and the special double digital and scanning microscope system Keyence VHX-D510 (Fig. 2A–D, G–K). The radulae of one specimen each from Russia (Fig. 2E, F) and Japan (Fig. 2L, M) were studied using Camscan Series II and JSM–6380 scanning electron microscopes. 2.4. Molecular methods DNA was extracted from tissue of specimens preserved in 70%–99% ethanol with DiatomTM DNA Prep 100 kit (Isogene Lab) according to the producer’s protocols. Partial sequences of COI and 16S were amplified by polymerase chain reaction (PCR) using the primers: LCO 1490 (GGTCAACAAATCATAAAGATATTGG; Folmer et al., 1994); HCO 2198 (TAAACTTCAGGGTGACCAAAAAATCA; Folmer et al., 1994); 16S arL (CGCCTGTTTAACAAAAACAT; Palumbi et al., 2002) and 16S R (CCGRTYTGAACTCAGCTCACG; Puslednik and Serb, 2008). PCR amplifications were carried out in a 20-µL reaction volume, which included 4 µL of 5x Screen Mix by Eurogen Lab, 0.5 µL of each primer (10 µM stock), 1 µL of genomic DNA, and 14 µL of sterile water. The amplification of COI was performed with an initial denaturation for 1 min at 95 ◦ C, followed by 35 cycles of 15 s at 95 ◦ C (denaturation), 15 s at 45 ◦ C (annealing temperature), and 30 s at 72 ◦ C, with a final extension of 7 min at 72 ◦ C. The 16S amplification began with an initial denaturation for 1 min at 95 ◦ C, followed by 40 cycles of 15 s at 95 ◦ C (denaturation), 15 s at 52 ◦ C (annealing temperature), and 30 s at 72 ◦ C, with a final extension of 7 min at 72 ◦ C. Sequencing R for both strands proceeded with the ABI PRISM⃝ BigDyeTM Terminator v. 3.1. Sequencing reactions were analyzed using a 3730 DNA Analyzer (Applied Biosystems). Protein-coding sequences were translated into amino acids for confirmation of the alignment. All sequences were deposited in GenBank. The sequences were aligned with the MUSCLE (Edgar, 2004) algorithm. For species delimitation studies uncorrected p-distances between all species were calculated for the COI and 16S genes in MEGA7. Uncorrected COI p-distances within and between the J. nipponensis populations from Russia and Japan were obtained in MEGA7 (Kumar et al., 2016). 3. Results 3.1. Molecular analysis In the molecular study, two J. nipponensis specimens from Japan and four from Russia were used. A total of 12 sequences were generated in the present study and one further sequence of J. nipponensis was extracted from GenBank (Table 1). The molecular-based species delineation was used for differently evolving mitochondrial COI and 16S rRNA genes. In the 16S gene, there are no differences (0%) between any specimen sequenced in this study. Small divergence (0.25% ± 0.25%) is found between the present data and publicly available sequence from GenBank (voucher number EED-Phy-746; Table 2). These minor differences can be explained by intraspecific genetic diversity or the differences in DNA sequencing techniques. Regarding the fast-evolving COI marker, the genetic distances amongst all the available data are 0%–0.46% ± 0.26% (Table 3). The same genetic distance (0.15% ± 0.15%) is found between two voucher specimens from Japan (NSMT-Mo 789721 and NSMT-Mo 78972-2), as well as between pairs of voucher specimens from Russia (ZMMU:Op-573 and ZMMU:Op-574; ZMMU:Op-574 and ZMMU:Op-575, ZMMU:Op-576). The same genetic distance (0.15% ± 0.15%) is also recognized between NSMT-Mo 78972-2 (Japan) and ZMMU:Op-573, ZMMU:Op-575 and ZMMU:Op-576 (Russia). Uncorrected COI p-distances within J. nipponensis population from Japan (0.15%) and from Russia (0.076%), as well as between the populations (0.26%) are very small for interspecific distances.
86
A. Martynov et al. / Global Ecology and Conservation 9 (2017) 82–89
Table 1 List of specimens of J. nipponensis used for the molecular analyses.
a
Registration
Locality
GenBank accession nos. CO1
16S
NSMT-Mo 78972.1 NSMT-Mo 78972.2 ZMMU:Op-573 ZMMU:Op-574 ZMMU:Op-575 ZMMU:Op-576 420 EED-Phy-746
Japan: Ise Bay Japan: Ise Bay Russia: Sukhodol Bay Russia: Sukhodol Bay Russia: Sukhodol Bay Russia: Sukhodol Bay Japan: Nagahama, Aio Bay, Yamaguchi Cityb
KX863690 KX863691 KX863688 KX863689 KX863686 KX863687 –
KX863684 KX863685 KX863680 KX863681 KX863682 KX863683 GQ845191a
Publicly available sequence from GenBank.
b
Chernyshev and Chaban (2016) erroneously recorded the locality of the voucher specimen EED-Phy-746 as Sukhodol Bay, Russia; actual locality is in Japan. Table 2 Uncorrected p-distances (%) amongst J. nipponensis specimens for 16S markers.
EED-Phy-746 Japan NSMT-Mo 78972.1 Japan NSMT-Mo 78972.2 Japan ZMMU:Op-573 Russia ZMMU:Op-574 Russia ZMMU:Op-575 Russia ZMMU:Op-576 Russia
EED-Phy746 Japan
NSMT-Mo 78972.1 Japan
NSMT-Mo 78972.2 Japan
ZMMU:Op573 Russia
ZMMU:Op574 Russia
ZMMU:Op575 Russia
ZMMU:Op576 Russia
– 0.25 ± 0.25 ± 0.25 ± 0.25 ± 0.25 ± 0.25 ±
0.25 ± 0.25 – 0 0 0 0 0
0.25 ± 0.25 0 – 0 0 0 0
0.25 ± 0.25 0 0 – 0 0 0
0.25 ± 0.25 0 0 0 – 0 0
0.25 ± 0.25 0 0 0 0 – 0
0.25 ± 0.25 0 0 0 0 0 –
0.25 0.25 0.25 0.25 0.25 0.25
Table 3 Uncorrected p-distances (%) amongst J. nipponensis specimens for COI markers.
NSMT-Mo 78972.1 Japan NSMT-Mo 78972.2 Japan ZMMU:Op-573 Russia ZMMU:Op-574 Russia ZMMU:Op-575 Russia ZMMU:Op-576 Russia
NSMT-Mo 78972.1 Japan
NSMT-Mo 78972.2 Japan
ZMMU:Op573 Russia
ZMMU:Op574 Russia
ZMMU:Op575 Russia
ZMMU:Op576 Russia
– 0.15 ± 0.30 ± 0.46 ± 0.30 ± 0.30 ±
0.15 ± – 0.15 ± 0.30 ± 0.15 ± 0.15 ±
0.30 ± 0.21 0.15 ± 0.15 – 0.15 ± 0.15 0 0
0.46 ± 0.30 ± 0.15 ± – 0.15 ± 0.15 ±
0.30 ± 0.21 0.15 ± 0.15 0 0.15 ± 0.15 – 0
0.30 ± 0.21 0.15 ± 0.15 0 0.15 ± 0.15 0 –
0.15 0.21 0.26 0.21 0.21
0.15 0.15 0.21 0.15 0.15
0.26 0.21 0.15 0.15 0.15
3.2. Morphological and taxonomic data Japonacteon nipponensis (Yamakawa, 1911) (Fig. 2) Actaeon tornatilis var. nipponensis Yamakawa, 1911: pp. 39-40, pl. 10, figs. 1–3. Acteon nipponensis; Habe, 1950: p. 40, pl. 8, fig. 6. Japonactaeon nipponensis Taki, 1956: p. 48, pl. 9, figs. 1–4, pl. 10, figs. 1–4; Martynov, 1997: p. 77; Hori, 2000: p. 365–366; Suzuki et al., 2013: p. 36 (fig. 133), 147–148. Japonacteon undescribed species Martynov, 2005: p. 168; Chaban and Martynov, 2006: p. 250. Japonactaeon nipponensis ussuriensis Chernyshev and Chaban, 2016: pp. 83–91, figs. 1–4, new synonym Morphological characters (Fig. 2): Shell oval to elongated, length = 3.5–11 mm, diameter = 2–4.5 mm, imperforate or with narrow umbilicus. Protoconch coaxial, rounded, smooth, one whorl; transition to teleoconch clearly demarcated. Teleoconch sculptured by 12–30 moderately spaced spiral grooves, each consisting of a row of densely placed square punctuations; distance between grooves 3–7 times width of groove, decreasing towards aperture. Upper part of last whorl occasionally devoid of spiral grooves. Spire whorls rounded to angulate, spire profile slightly to considerably stepped. Aperture rounded-trapezoid; columellar region thickened, bearing weak fold. Weak tooth-like axial thickening on palatal region of aperture. Parietal callus thin, well delimited. Shell color blackish to variegate with whitish spots. Operculum small, thin, with concentric lines. Radular formula 26–28 × 4.(1).4, up to four denticles on lateral teeth, up to seven denticles on central teeth. 3.3. Distribution According to the literature, Recent specimens of J. nipponensis have been recorded in various parts of Japan and South Korea: in the deepest part of Tokyo Bay (Taki, 1956); around the Miura Peninsula (Muraoka and Naito, 1991); in and around
A. Martynov et al. / Global Ecology and Conservation 9 (2017) 82–89
87
Ise Bay (Hayase et al., 2011; Japanese Association of Benthology, 2012; Suzuki et al., 2013); in several parts of the Seto Inland Sea (Wada et al., 1996; Hamada, 2008; Ishikawa, 2012); northern Kyushu (Takahashi and Okamoto, 1969; Habe and Kikuchi, 1960) and South Korea (Min, 2001) (Fig. 1A). Because of the recent recognition of a closely similar species to J. nipponensis (Ishikawa, 2012; Suzuki et al., 2013), only records accompanied by a figure or identifiable information in literature are acknowledged here. Accordingly records from Wakasa Bay (Ito, 1990), off Yamaguchi Prefecture (Kawamoto and Tanabe, 1956; Fukuda et al., 1992) in the Sea of Japan, and from Izu Peninsula (Nakano, 2004) were rejected. A record of J. nipponensis from the North Korean part of Yellow Sea (Mollusks of West Sea of Korea, 1985) is also a misidentification. Furthermore, examination of NSMT material for the present study has confirmed majority of the previous records and added a new locality at the northern extreme of Honshu (Fig. 1A). 4. Discussion 4.1. Molecular evidence that Japanese and Russian populations of Japonacteon belong to the same species and implications for taxonomic status The present study revealed extremely high genetic homogeneity between Japanese and Russian populations of J. nipponensis despite their considerably wide geographical separation, and therefore rejected the recent proposal of taxonomical separation of the Russian population as a subspecies based on minor differences in the shell color (Chernyshev and Chaban, 2016). Accordingly J. nipponensis ussuriensis is regarded herein as a junior synonym of J. nipponensis. Some morphological differences in color pattern and shell morphology recognized in various specimens (Fig. 2C, D, G–H) are thus interpreted as intraspecific variations. There are accumulative data showing that shell morphology and color patterns in mollusks are considerably influenced by the environmental conditions, e.g. water temperature, food, and UV light (Lemer et al., 2015; Lezin and Flyachinskaya, 2015; Williams, 2016). The melanistic specimens of J. nipponensis from Russia (Fig. 2C, D), which are genetically identical to the more variegated Japanese specimens (Fig. 2G, H), therefore are not separate taxonomically. Darker colored shells were also discovered in a Japanese population from northern Honshu (Fig. 2I) in the present study. Furthermore, the amount of black pigment is variable among specimens from the Russian locality, and some possess more obvious light bands (Fig. 2C) similar to typical Japanese specimens. There are no significant differences between Russian (Fig. 2E, F) and Japanese (Fig. 2L, M) specimens in the morphology of the radular teeth. Although the nominal taxon J. nipponensis was firstly described from Japan as a Pleistocene fossil and the type material is lost (The University Museum, The University of Tokyo, 2008-2016; T. Sasaki, personal communication), figures in the original description (Yamakawa, 1911: pl. 10, Figs. 1–3) clearly indicate the important distinguishing characters of this species, especially the detail of the spiral sculpture, and there is no taxonomical and nomenclatural problem in identifying the Recent specimens as this taxon. Furthermore, examination of Recent specimens from Kasai, Tokyo, which is located less than 15 km from the type locality of the fossil taxon at Oji, Tokyo, confirmed the identification (Fig. 2K). 4.2. Recommendations for conservation Despite a number of records of J. nipponensis in Japan, the majority of them are based on specimens collected before the 1960s. An extensive recent search for this species in the Tokyo area failed to find any live specimens. In recent years, live specimens have been confirmed only in several localities around the Ise Bay, the Pacific coast of Honshu, and in the Seto Inland Sea (Wada et al., 1996; Hayase et al., 2011; Japanese Association of Benthology, 2012; Ishikawa, 2012), and J. nipponensis was rated as near-threatened species by the Japanese Association of Benthology (2012). The species has also been recorded only from the southern parts of the Korean peninsula (Min, 2001), and there have been no reliable records from North Korea, suggesting an endemic distribution in temperate warm waters. Sukhodol Bay, the sole known Russian locality, possesses an unaltered tidal flat environment with no considerable artificial deconstructions (Fig. 1B). Apart from J. nipponensis, several other warm-water macroinvertebrate species, including the Japanese swimming crab Charybdis japonica, have been recorded in the bay (Kolpakov and Kolpakov, 2011). Thus this particular locality is one of the few remaining unaltered natural habitats of species that are otherwise greatly endangered in neighboring regions (e.g. in Japan). However, there are currently plans to construct a large coal terminal within this bay (Darkin and Kvint, 2016) and this precious environment could thereby be completely destroyed. We therefore suggest that special efforts for protection of the whole of Sukhodol Bay and neighboring localities should be made in order to preserve this unique warm-water tidal flat enclave in an otherwise cold-water part of the Sea of Japan. Acknowledgments Toshihiko Fujita (National Museum of Nature and Science, Tsukuba) is thanked for organizing of the research stay of AM and TK in the above mentioned museum. We are grateful to Vladimir Poluyaktov (Vladivostok) who greatly helped us with transportation to the collecting site in Sukhodol Bay. We are also very grateful to Shoichi Kimura (Mie University) who kindly provided us with the live-collected specimens of J. nipponensis from Mie Prefecture, and Paul Callomon (Academy of Natural Sciences of Drexel University, Philadelphia) who made detailed linguistic corrections. A.G. Bogdanov and G.N. Davidovich (Electron Microscopy Laboratory, Moscow State University) are thanked for support with electron microscopy. The study is supported by a research project of MSU Zoological Museum (AAAA-A16-116021660077-3) and by the Russian Science Foundation (grant 14-50-00029, morphological and molecular study).
88
A. Martynov et al. / Global Ecology and Conservation 9 (2017) 82–89
References
Bickford, D., Lohman, D.J., Sodhi, N.S., Ng, P.K.L., Meier, R., Winker, K., Ingram, K.K., Das, I., 2006. Cryptic species as a window on diversity and conservation. Trends Ecol. Evol. 22, 148–155. http://dx.doi.org/10.1016/j.tree.2006.11.004. Chaban, E.M., Martynov, A.V., 2006. In: Kantor, Yu.I., Sysoev, A.V. (Eds.), Marine and Brackish Water Gastropoda of Russia and Adjacent Countries: An Illustrated Catalogue, KMK, Moscow, pp. 250–262. Chernyshev, A.V., Chaban, E.M., 2016. Japonacteon nipponensis (Yamakawa, 1911) (Gastropoda: Heterobranchia)—single species of the family Acteonidae in the Russian seas with description of a new subspecies. Bull. Russ. Far East. Malac. Soc. 20, 83–91. Darkin, S., Kvint, V., 2016. The Russian Far East: Strategic Priorities for Sustainable Development. Apple Academic Press, 184 p. Edgar, R.C., 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucl. Acids Res. 32, 1792–1797. http://dx.doi.org/10. 1093/nar/gkh340. Folmer, O., Black, M., Hoeh, W., Lutz, R., Vrijenhoek, R., 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotech. 3, 294–299. Fukuda, H., Mashino, J., Sugiura, T., 1992. An Outline of the Shells of Yamaguchi Prefecture. Yamaguchi Prefectural Museum, Yamatuchi. 99+xxvi pp., 50 pls. (in Japanese: Title translated by the present authors). Gaston, K.J., 2000. Global patterns in biodiversity. Nature 405, 220–227. http://dx.doi.org/10.1038/35012228. Habe, T., 1950. Pupidae in Japan. In: Kuroda, T. (Ed.), In: Illustrated Catalogue of Japanese Shells, Vol. 6, pp. 39–44. Habe, T., Kikuchi, T., 1960. Fauna and Flora of the Sea Around the Amakusa Marine Biological Laboratory, Part I. Mollusca. The Amakusa Marine Biological Laboratory, Kyushu University, Kumamoto, 70 pp. Hamada, T., 2008. The Shells of Oita Prefecture. Published by the author, Oita, 136 pp. (in Japanese). Hayase, Y., Tanekura, T., Shakema, T., Matsunaga, Y., Yoshikawa, T., Matsuura, H., Ishikawa, S., 2011. The molluscan fauna of a tidal flat area and an intertidal rocky shore in Mikawa Bay, Hazu-cho, Aichi, Japan. Bull. Inst. Oceanic Res. and Develop. 32, Tokai Univ., 11–33. Hori, S., 2000. Family Acteonidae. In: Okutani, T. (Ed.), In: Marine Mollusks in Japan, Tokai University Press, Tokyo, Japan, pp. 365–366. Ishikawa, Y., 2012. A shell previously confused with Japonacteon nipponensis and Pupa strigosa (trans. auct.). Maigo, Reports of the Shikoku Shell Club, 19, pp. 6–7 (in Japanese: Title translated by the present authors). Ito, K., 1990. Distribution of molluscan shells in Wakasa Bay. Japan Sea. Bull. Japan Sea Nat. Fish. Res. Inst. 40, 79–211 (in Japanese). Japanese Association of Benthology (Ed.), 2012. Threatened Animals of Japanese Tidal Flats: Red Data Book of Seashore Benthos. Tokai University press, Tokyo. xvii+285 pp. (in Japanese). Kano, Y., Brenzinger, B., Nützel, A., Wilson, N.G., Schrödl, M., 2016. Ringiculid bubble snails recovered as the sister group to sea slugs (Nudipleura). Sci. Rep., 6, 30908, http://dx.doi.org/10.1038/srep30908. Kawamoto, T., Tanabe, S., 1956. Catalogue of Molluscan Shells of Yamaguti Prefecture. x+171 pp. Uamaguti Prefectural Yamaguti Museum, Yamaguchi. Kolpakov, N.V., Kolpakov, E.V., 2011. On the biology of the Japanese Swimming Crab Charybdis japonica (Portunidae) in waters of Primorye at the northern boundary of their range. Russ. J. Mar. Biol. 37, 570–578. Kumar, S., Stecher, G., Tamura, K., 2016. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33, 1870–1874. http://dx.doi.org/10.1093/molbev/msw054. Lemer, S., Saulnier, D., Gueguen, Y., Planes, S., 2015. Identification of genes associated with shell color in the black-lipped pearl oyster, Pinctada margaritifera. BMC Genomics 16, 568. http://dx.doi.org/10.1186/s12864-015-1776-x. Lezin, P., Flyachinskaya, L., 2015. Shell sculpture formation in bivalves of the genus Hiatella under different temperature conditions. J. Mar. Biol. Ass. UK. 95, 1621–1627. http://dx.doi.org/10.1017/S0025315415000259. Martynov, A.V., 1997. Subclass Opisthobranchia. In: Kussakin, O.G., Ivanova, M.B., Tsurpalo, A.P. (Eds.), In: List of the Animals, Plants and Fungi of the Intertidal of Far-Eastern Seas of Russia, Dalnauka, Vladivostok, Russia, pp. 77–80. Martynov, A.V., 1998. Subclass Opisthobranchia. In: Adrianov A.V. and Kussakin O.G (Eds.), Taxonomic Catalogue of Biota of Peter the Great Bay, Dalnauka, Vladivostok, Russia, pp. 204–209. Martynov, A.V., 2001. Japonacteon nipponensis from Russia. Message in Sea Slug Forum. Australian Museum, Sydney. Available from http://www. seaslugforum.net/find/4607. Martynov, A.V., 2005. Undescribed species of Japonacteon. In: Kantor, Yu.I., Sysoev, A.V. (Eds.), Catalogue of Molluscs of Russia and Adjacent Countries, KMK, Moscow, p. 168. Martynov, A.V., Korshunova, T.A., 2011. Opisthobranch Molluscs of the Seas of Russia. A Colour Guide to their Taxonomy and Biology. Fiton Press, Moscow, 230 pp. Min, D.-K., 2001. Korean Mollusks with Color Illustration. Shell House, Seoul, 333 pp. (in Korean). Ministry of Environment, 2014. Red Data Book 2014—Threatened Wildlife of Japan—Volume 6, Mollusks. Gyosei Corporation. xliii+455 pp. (in Japanese). Ministry of Natural Resources and Environment of the Russian Federation, 2016. Draft order ‘‘On approval of the list of objects of fauna listed in the Red Book of Russia and excluded from the Red Book of the Russian Federation’’, http://www.mnr.gov.ru/regulatory/detail.php?ID=145272. Mollusks of West Sea of Korea, 1985. Kim Il-Sung University, Pyongyang. 276 p. (in Korean). Mukai, H., 2010. Habitat diversity and its loss in Japanese coastal marine ecosystems. In: International Symposium on Integrated Coastal Management for Marine Biodiversity in Asia, January 14–15, 2010, Kyoto, Japan, pp. 25–27. Muraoka, K., Naito, T., 1991. Catalogue of the molluscan shells donated by Mr. Yhotaro Nomura to the Kanagawa Prefectural Museum. Catalogues of Specimens in the Kanagawa Prefectural Museum. Div. Nat. Stud. 5, 1–167. Nakano, R., 2004. Opisthobranchs of Japan Islands. Rutles, Inc., Tokyo, 304 pp. National Institute of Biological Resources, 2012. Red Data Book of Endangered Mollusks in Korea, Incheon. 207 pp. Palumbi, S.R., Martin, A.P., Romano, S., Mcmillan, W.O., Stice, L., Grabowski, G., 2002. The Simple Fool’S Guide To PCR. Department of Zoology Special Publication. University of Hawaii, Honolulu. Puslednik, L., Serb, J.M., 2008. Molecular phylogenetics of the Pectinidae (Mollusca: Bivalvia) and effect of increased taxon sampling and outgroup selection on tree topology. Mol. Phyl. Evol. 48, 1178–1188. http://dx.doi.org/10.1016/j.ympev.2008.05.006. RDBRF, in preparation. Red Data Book of the Russian Federation, new ed. Sato, M., Koh, C.-H., 2004. Biological richness of the Asian tidal flats and its crisis by human impacts. In: Hong, S.-E., et al. (Eds.), Ecological Issues in a Changing World, Springer and Kluwer Academic Publishers, Berlin, Amsterdam, pp. 135–155. Scheffers, B.R, Joppa, L.N., Pimm, S.L., Laurance, W.F., 2016. What we know and don’t know about Earth’s missing biodiversity. Trends Ecol. Evol. 27, 501–510. http://dx.doi.org/10.1016/j.tree.2012.05.008. Suzuki, T., Kimura, S., Kimura, T., Mori, K., Taru, M., 2013. Benthos of the Tidal Flat. Wetland International Japan, Tokyo, 257 pp. Takahashi, G., Okamoto, M., 1969. A Catalogue of Molluscan Shells of Fukuoka Prefecture. Published by the authors. iii + 154 pp. (in Japanese). Taki, I., 1956. Japonactaeon, a new genus of Pupidae (Opisthobranchia, Gastropoda). Bul. Nat. Sci. Mus. 3, 47–51.
A. Martynov et al. / Global Ecology and Conservation 9 (2017) 82–89
89
The University Museum, The University of Tokyo, 2008–2016. Acteon (Japanacteon) nipponensis (Yamakawa). Paleontology Collections Database. http:// umdb.um.u-tokyo.ac.jp/fmi/xsl/DKoseibu/jp/Collection/detail.xsl?umutNo=23599&-token.request=Keyword.op=cn|Keyword=nipponensis|-max=10|& -find. (Accessed 26 July 2016). Tittensor, D.P., Mora, C., Jetz, W., Lotze, H.K., Ricard, D., Berghe, E.V., Worm, B., 2010. Global patterns and predictors of marine biodiversity across taxa. Nature 466, 1098–1103. http://dx.doi.org/10.1038/nature09329. Wada, K., Nishihira, T., Furota, T., Nojima, S., Yamanishi, R., Nishikawa, T., Goshima, S., Suzuki, T., Kato, M., Shimamura, K., Fukuda, H., 1996. Present status of estuarine locales and benthic invertebrates occurring in estuarine environment in Japan. WWW Japan Sc. Rep., 3, 1–182. (in Japanese with English summary). Wiens, J.J., 2015. Faster diversification on land than sea helps explain global biodiversity patterns among habitats and animal phyla. Ecol. Lett . http: //dx.doi.org/10.1111/ele.12503. Williams, S.T., 2016. Molluscan shell colour. Biol. Rev . http://dx.doi.org/10.1111/brv.12268. Yamakawa, G., 1911. Description of some fossils opisthobranchiate from the diluvial deposits of Japan. J. Geol. Soc. Tokyo 18, 39–52.