- Email: [email protected]
The key role of macrophage depolarization in the treatment of COPD with ergosterol both in vitro and in vivo
International Immunopharmacology 79 (2020) 106086
Contents lists available at ScienceDirect
International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp
The key role of macrophage depolarization in the treatment of COPD with ergosterol both in vitro and in vivo ⁎⁎
Xiao Suna, Yan Liua, Xiuli Fenga, Chunyan Lia, Siying Lib, , Zhongxi Zhaoa,c,d,
T
⁎
a
School of Pharmaceutical Sciences, Shandong University, 44 West Wenhua Road, Jinan, Shandong 250012, PR China School of Basic Medical Sciences, Shandong University, 44 West Wenhua Road, Jinan 250012, PR China c Shandong Engineering & Technology Research Center for Jujube Food and Drug, 44 West Wenhua Road, Jinan, Shandong 250012, PR China d Shandong Provincial Key Laboratory of Mucosal and Transdermal Drug Delivery Technologies, Shandong Academy of Pharmaceutical Sciences, 989 Xinluo Street, Jinan, Shandong 250101, PR China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Ergosterol COPD Macrophage depolarization Histone deacetylases Histone acetyltransferase
Macrophages are the most abundant immune cells in the lung, which play an important role in COPD. The antiinflammatory and anti-oxidation of ergosterol are well documented. However, the effect of ergosterol on macrophage polarization has not been studied. The objective of this work was to investigate the effect of ergosterol on macrophage polarization in CSE-induced RAW264.7 cells and Sprague-Dawley (SD) rats COPD model. Our results demonstrate that CSE-induced macrophages tend to the M1 polarization via increasing ROS, IL-6 and TNF-α, as well as increasing MMP-9 to destroy the lung construction in both RAW264.7 cells and SD rats. However, treatment of RAW264.7 cells and SD rats with ergosterol inhibited CSE-induced inflammatory by decreasing ROS, IL-6 and TNF-α, and increasing IL-10 and TGF-β, shuffling the dynamic polarization of macrophages from M1 to M2 both in vitro and in vivo. Ergosterol also decreased the expression of M1 marker CD40, while increased that of M2 marker CD163. Moreover, ergosterol improved the lung characters in rats by decreasing MMP-9. Furthermore, ergosterol elevated HDAC3 activation and suppressed P300/CBP and PCAF activation as well as acetyl NF-κB/p65 and IKKβ, demonstrating that HDAC3 deacetylation was involved in the effect of ergosterol on macrophage polarization. These results also provide a proof in immunoregulation of ergosterol for therapeutic effects of cultured C. sinensis on COPD patients.
1. Introduction Chronic obstructive pulmonary disease (COPD) is characterized by progressive airflow obstruction that is only partly reversible and an abnormal inflammatory response [1]. Cigarette smoke (CS) is the main etiologic factor in pathogenesis of COPD by increasing oxidant burden, consequently initiate inflammatory cells infiltration, which consists of neutrophils, macrophages, and T cell subsets, releasing inflammatory mediators [2–4]. This inflammatory response ultimately leads to the tissue destruction associated with pulmonary emphysema [5,6]. So, the relative contribution of these specific immune cell subsets towards diseases pathogenesis provides a good horizon for the treatment of
COPD. Macrophages are the most abundant immune cells in the lung, which play a dual role of inflammatory and anti-inflammatory function [7]. The two extremes in the spectrum of macrophage function are represented by the mononuclear phenotype “M1 polarization” (referred to as “classical activation”) and “M2 polarization” (referred to as “alternative activation”) [7,8]. COPD likely reflects an altered lung microenvironment where CS induces inflammation on the one hand but, over time, impairs the ability of the alveolar macrophage to response subsequent microbial triggers. Xiao Fu et al demonstrated that macrophage M2 polarization induced by CSE treatment for 96 h promotes proliferation, migration, and invasion of alveolar basal epithelial cells
Abbreviations: AP-1, activator protein-1; Ac, acetylation; BALF, bronchoalveolar lavage fluid; CBP, CREB-binding protein; CSE, cigarette smoke extract; FBS, fetal bovine serum; HATs, histone acetyltransferase; HDACs, histone deacetylases; HE, hematoxylin and eosin; IL, interleukin; iNOS, inducible nitric oxide synthase; MMP, matrix metalloproteinase; MT, Masson’s Trichrome; NF-κB, nuclear factor-κB; PCAF, P300/CBP-associated factor; ROS, Reactive Oxygen Species; TNF-α, tumor necrosis factor-α; TGF-β, transforming growth factor-β ⁎ Corresponding author at: National Distinguished Professor, School of Pharmaceutical Sciences, Shandong University, 44 West Wenhua Road, Jinan 250012, PR China. ⁎⁎ Corresponding author. E-mail addresses: [email protected] (S. Li), [email protected] (Z. Zhao). https://doi.org/10.1016/j.intimp.2019.106086 Received 10 October 2019; Received in revised form 23 November 2019; Accepted 25 November 2019 1567-5769/ © 2019 Elsevier B.V. All rights reserved.
International Immunopharmacology 79 (2020) 106086
X. Sun, et al.
was got from Abbkin (shanghai, China). Horseradish peroxidase (HRP)conjugated antibodies were bought from Jackson Immuno Research Laboratories, Inc. (West Grove, PA, USA). Other reagents used in the experiment were all of analytical grade.
[9]. While alveolar macrophages in the face of CS can show a suppression of M1 phenotype, it is possible that a distinct subset of mononuclear phagocytes within the lungs can develop and sustain the inflammation response [10]. Besides, macrophages have been implicated as playing a central role in mediating the tissue destruction through the secretion of matrix metalloproteinases (MMPs) [4]. Therefore, a better understanding of the molecular mechanisms regulating macrophage polarization is essential to understand the causal relationship between drugs and its treatment of COPD. Histone acetylation is an active process whereby small changes in acetylases or deacetylases can markedly affect the overall histone acetyltransferase (HAT) activity associated with inflammatory genes [11,12]. The acetylation of core histones by coactivator proteins that possess intrinsic HAT activity leads to the unwinding of chromatin, which subsequently allows transcription factors and RNA polymerase Ⅱ to switch on gene transcription. Conversely, the deacetylation of core histones by HDACs is generally associated with transcriptional repression [13]. Report shows that HDAC activity was down-regulated in several types of cells in COPD, which is correlated with the increased inflammatory gene expression levels [12]. Besides, HDACs directly affect the nuclear binding of transcription factors such as nuclear factorκB (NF-κB), which is related to COPD, preventing gene transcription [12]. It is also demonstrated that HAT activity was reduced while HDAC activity was increased in the asthma subjects treated with inhaled steroids [11]. Moreover, HDAC3 is required for the activation of hundreds of inflammatory genes in M1 macrophages [14]. Macrophages lacking HDAC3 show an M2-line phenotype in the absence of external stimuli and are hyper-responsive to IL-4, suggesting that HDAC3 may promote M1 and inhibit M2 polarization [15]. HDAC3 can also deacetylate histone tails at regulatory regions, leading to repression of many IL-4-regulated genes, which are characteristic of M2 macrophages [7,16]. So, modulation of HAT and HDAC activity, following to intervene macrophage polarization and reduce NF-κB-mediated inflammatory gene expression, may have therapeutic potential in the treatment of COPD. Ergosterol, a principal sterol, has been used as a useful chemical marker for evaluating the quality of Cordyceps sinensis (C. sinensis), which is a traditional Chinese medicine [17]. It can be transported into the cell mediated by lipid transfer proteins (LTPs) via the lipid phosphatidylinositol 4-phosphate (PI4P) as a fuel [18]. Numerous studies have summarized that ergosterol has pharmacological activities (antitumor, anti-inflammation, anti-oxidation) [17,19,20]. Wang Huan et al also revealed that ergosterol effectively ameliorates the progression of CS-induced COPD in mice via JAK3/STAT3/NF-κB pathway [21]. However, the underline mechanism is not clear. The objective of this work was to explore the effect of ergosterol on macrophage polarization on CSE-induced COPD models in RAW264.7 cells and rats.
2.2. Preparation of aqueous cigarette smoke extract (CSE) CSE was prepared as previously reported [22]. Briefly, three cigarettes (Taishan brand, Jinan, China) were burned and the smoke was collected by a vessel containing the phosphate-buffered saline (PBS, 10 mL) using a vacuum pump. This 100% CSE was adjusted to pH 7.4 and was sterile filtered through a 0.22-µm filter. CSE was freshly prepared for each experiment and diluted with the culture medium containing 10% FBS immediately before use although the filtered CSE could be used within 24 h. The nicotine content in the range of 36–39 µg/mL in the CSE was determined by high performance liquid chromatography and used as a quality control. 2.3. Cells culture RAW264.7 cells, which were purchased from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences (Shanghai, China), were cultured in DMEM medium supplemented with 100 U/mL of penicillin G, 100 μg/mL of streptomycin, and 10% (v/v) inactivated fetal bovine serum. RAW264.7 cells were grown at 37 °C in a humidified 5% CO2 incubator. 2.4. Determination of IL-6, TNF-α, IL-10 and TGF-β secretion in RAW264.7 cells The cells were pre-incubated in 12-well plates for 24 h at 37 °C in a humidified incubator with 5% CO2. After cells were cultured with or without 10% CSE in the absence or presence of ergosterol (5, 10 and 20 μmol/L) for 24 h, levels of IL-6, TNF-α, IL-10 and TGF-β in the culture supernatants were then measured by a commercial essay kit or ELISA kit according to the manufacturer’s instructions. 2.5. Measurement of reactive oxygen species generation The generation of ROS was measured using 2′, 7′-Dichlorodi-hydrofluorescein diacetate (DCFH-DA, Sigma–Aldrich St. Louis, MO, USA) as described previously.[23] Briefly, cells were treated with or without ergosterol for 24 h after 1 h 10% CSE treatment. For measuring the ROS via microscopy, the cells were incubated with 10 µmol/L of DCFH-DA for 20 min at 37 °C. After washing with 1 × PBS for twice, fluorescence was measured using Olympus fluorescence microscope. 2.6. RNA extraction and relative quantification using real-time PCR
2. Materials and methods Total RNA was extracted using a RNAEasy kit according to the manufacturer’s instruction (Bioecon Biotec Co Ltd, China). RNA purity was checked by measuring the OD260/280 of RNA samples. cDNA was synthesized through reverse transcription using M-MLV reverse transcriptase and oligo(dT) primer. The gene expression levels of iNOS, TNF-α, IL-6, IL-10, TGF-β, HDAC3, P300, CBP and PCAF were detected by real-time PCR. PCR amplification was performed in a 96-well plate in triplicate. Each reaction well consisted of 10 μL of 2 × SYBR Green PCR Master mix, 0.5 μL forward and reverse primers, and 1 μL of template cDNA to obtain a final volume of 20 μL. The PCR analysis was performed using a Mastercycler ep realplex apparatus (Eppendorf, Germany). After an initial denaturation step for 3 min at 95 °C, the conditions for cycling were 39 cycles of 30 s at 95 °C, 30 s at 57 or 60 °C, and 30 s at 72 °C. The primer sets for iNOS, IL-6, TNF-α, IL-10, TGF-β, HDAC3, P300, CBP, PCAF and GAPDH were purchased from Dingguo Changsheng Biotechnology Co, Ltd (Beijing, China) and listed below (Table 1). The relative expression level of each target gene was
2.1. Reagents Ergosterol (Purity of 99%) was purchased from Aladdin Regents CO., Ltd. (Shanghai, China). Dulbecco’s modified Eagle’s medium (DMEM) and fetal bovine serum (FBS) were purchased from Biological Industries (Beit Haemek Ltd., Israel). Penicillin and streptomycin were purchased from Solarbio Biotechology (Beijing, China). TNF-α, IL-6, IL10 and TGF-β Enzyme-linked Immunosorbent Assay Kits were purchased from Shanghai Multi Sciences (Lianke) Biotech Co., Ltd. (Shanghai, China). Anti- P300 and HDAC3 antibodies were purchased from BOSTER (Wuhan, China). Anti-PCAF antibody was a gift from Abways technology (Shanghai, China). Anti-iNOS and MMP-9 antibodies were purchased from Cell Signaling Technology (Danvers, MA, USA). Anti- IKKα, IKKβ and IKKγ were got from ABclonal (Boston, USA). Anti-GAPDH antibody was provided by Proteintech Biotechnology (Rocky Hill, CT, USA). Anti-acetyl NF-κB/p65 antibody 2
International Immunopharmacology 79 (2020) 106086
X. Sun, et al.
morphological changes in the lungs.
Table 1 The primer sets for associated mRNA. Mouse
Forward primer
Reverse primer
TNF-α IL-6 IL-10 TGF-β, iNOS HDAC3 P300 CBP PCAF GAPDH
CAACGCCCTCCTGGCCAACG TGT GCAA TGGC AATT CTGA T GCTCTTACTGACTGGCATGAG CCACCTGCAAGACCATCGAC AGCAACTACTGCTGGTGGTG CACCCGCATCGAGAATCAGAAC AGCGGCCTAAACTCTCATCTC TGGAGTGAACCCCCAGTTAG AGCGGCCTAAACTCTCATCTC AATGTGTCCGTCGTGGATCT
TCGGGGCAGCCTTGTCCCTT CT CTGA AGGA CTCT GGC TTTG CGCAGCTCTAGGAGCATGTG CTGGCGAGCCTTAGTTTGGAC TCTTCAGAGTCTGCCCATTG CAGCGTCGGCCTCGTCAGTC GGCTGCATCTTGTACTATGCC TTGCTTGCTCTCGTCTCTGA GGCTGCATCTTGTACTATGCC CATCGAAGGTGGAAGAGTGG
2.10. Bronchoalveolar lavage fluid (BALF) collection The lungs were lavaged via a cannula inserted into the trachea and then instilled with 1 × 2 mL aliquots of saline. All aliquots were collected and centrifuged at 2000 rpm for 10 min at 4 °C. The supernatants were obtained and stored at −80 °C for the further analysis of IL-6, TNF-α and TGF-β using ELISA kits. The cells were resuspended in the PBS solution (100 μL) and counted using a hemocytometer. The cell differential was determined from an aliquot of the cell suspension by centrifugation on a slide and Wright-Giemsa stain (Solarbio Biotechnology, Beijing, China). Differential cell counts were calculated based on the morphological criteria.
normalized against the GAPDH control using the 2−△△Ct method and further compared with its own control. All samples were studied in independent triplicate experiments.
2.11. Western blot analysis The Raw264.7 cells and lung tissues were homogenized in the RIPA lysis buffer, and then total proteins were extracted and determined by a BCA kit (Beyotime Institute of Biotechnology, Beijing, China). Equal quantities of proteins were separated on 8–12% SDS-polyacrylamide gels and transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore Corp., Bedford, MA, USA). Membranes were incubated with primary antibodies (including iNOS, CD40, CD163, MMP-9, Acetyl NFκB/p65, HDAC3, P300, PCAF, IKKα, IKKβ and IKKγ) overnight at 4 °C, followed by the incubation with horseradish peroxidase (HRP)-conjugated anti-rabbit or anti-mouse antibodies for 1 h at room temperature. The signals were detected by enhanced chemiluminescence detection reagents. The relative optical densities of the bands were quantified using AlphaView SA software. All western blot analyses were carried out at least three times.
2.7. Flow cytometric analysis To assess M1 and M2-related genes at the protein level, the cells, treated with or without ergosterol for 24 h after 1 h treatment with 10% CSE, were washed three times in cold PBS supplemented with 2% fetal bovine serum (FBS). Then, cells were fixed and permeabilized for 30 min in cold 4% formaldehyde phosphate buffer and then washed with cold PBS supplemented with 2% FBS. After that, the fixed permeabilized cells were stained with PE-conjugated anti- CD40 and CD163 antibodies (eBioscience, Vienna, Austria) for 30 min in the dark. After the incubation, cells were washed twice and then were resuspended in PBS containing 2% FBS. Analysis was performed using a BD FACSArray cytometer (BD biosciences), and data were analyzed using FlwJo software (Tree Star). Mean fluorescence intensity was used to evaluate the expression of the different markers.
2.12. Immunohistochemistry for P300, HDAC3, acetyl NF-κB/p65, CD40 and CD163
2.8. Animal experiment
P300, HDAC3, Acetyl NF-κB/p65, CD40 and CD163 in the lung tissues of rats were determined by immunohistochemistry. Briefly, the lung tissue slices embedded with paraffin was deparaffinized and rehydrated. The antigen was retrieved using sodium citrate with heatinduced retrieval. After blocking with goat serum, P300, HDAC3, Acetyl NF-κB/p65, CD40 and CD163 antibodies were applied overnight at 4 °C. Then horseradish peroxidase-conjugated anti-rabbit antibody was applied, and P300, HDAC3, Acetyl NF-κB/p65, CD40 and CD163 were obtained and photographed under a microscope (Olympus Corporation, Tokyo, Japan).
Male SPF Sprague-Dawley rats weighing 160 g were purchased from Jinan Pengyue Experimental Animal Breeding Co. LTD (Shandong, China). Rats were housed in a temperature-controlled room (25 ± 2 °C) with the relative humidity of 40%-70%. All experimental procedures involving animals were performed in accordance with the institutional guidelines of the Animal Care and Use Committee of Shandong University (No. 2016020, Jinan, China) and conducted in the Center for Pharmaceutical Research and Drug Delivery System of Shandong University. After one-week acclimatization to the laboratory conditions, the rats were randomly divided into 6 groups (n = 6) as follows: control group (C), model group (M), positive control group (P, budesonide, 2 mg/kg), ergosterol low dosage (E-L, 2.5 mg/kg), ergosterol medium dosage (E-M, 5 mg/kg) and ergosterol high dosage (E-H, 10 mg/kg). Each rat in the model group was intraperitoneally injected with the 100% CSE (1 mL) on days 1, 8 and 15. Rats in the positive control and ergosterol groups were intraperitoneally injected with the 100% CSE (1 mL) on days 1, 8 and 15 along with the daily oral administration of budesonide or ergosterol, respectively. Budesonide and ergosterol were freshly prepared by suspending them in PBS containing 20% hydroxypropyl-β-cyclodextrin (w/v). On the 21st day after the experiment, all rats were sacrificed.
2.13. Statistical analysis Data are presented as mean ± SEM. The statistical significance of the difference was determined by one-way ANOVA followed by the Tukey’s post-hoc multiple comparison test using Prism version 5.0 (GraphPad Software, Inc.). Values of p < 0.05 were considered statistically significant. 3. Results 3.1. Ergosterol regulates immuno status of COPD rats
2.9. Histopathological analysis After treatment for 21 days, the body weight of rats in CSE-treated model group (p < 0.05) and budesonide group (p < 0.001) were significantly decreased compared to the control group, while the ergosterol treatment rats demonstrated a better situation (Fig. 1A). Spleen index is an immune parameter closely related to immune function [24]. It is calculated by dividing the body weight by spleen
The lung tissues were fixed with the 4% formaldehyde phosphate buffer overnight and then dehydrated and paraffin embedded and sliced into 4 µm sections and stained with hematoxylin and eosin (H&E) and Masson’s Trichrome. The slides were observed under a morphometric microscope (Nikon, Japan) at 100 magnification to evaluate the 3
International Immunopharmacology 79 (2020) 106086
X. Sun, et al.
Fig. 1. Ergosterol improved the rat life and lung features on the CSE-induced rat model. (A) Rat body weights were measured at the indicated time point. (B) The spleen index of rats in each group. (C) The liver index of rats in each group. Lung tissue histological assay was stained with HE (D) and MT (E) (100×). Rats (six per group) were treated as follows: C, control group (the vehicle); M, CSE group; P, budesonide group (2 mg/kg/day + CSE); E-L, ergosterol low group (2.5 mg/kg/ day + CSE); E-M, ergosterol medium group (5 mg/kg/day + CSE); E-H, ergosterol high group (10 mg/kg/day + CSE). *p < 0.05, **p < 0.01, the CSE group vs. the control group; #p < 0.05, ##p < 0.01, the ergosterol treatment groups vs. the CSE group. Data are presented as mean ± SEM.
manner by the co-treatment with ergosterol. Interestingly, the level of IL-10 and TGF-β (Fig. 2B) was slightly increased by CSE-treatment comparing to the control group, while further increased by the cotreatment with ergosterol. Besides, the expression of iNOS, IL-6, TNF-α, IL-10 and TGF-β mRNA were also detected by RT-PCR analysis. As shown in Fig. 2C, ergosterol significantly decreased iNOS, IL-6 and TNF-α mRNA expression while increased that of IL-10 and TGF-β in the CSE treatment groups. Furthermore, the CSE induced macrophages and neutrophil counts increased in the BALF compared to the control group (Fig. 2D). In contrast, the ergosterol-treatment led to a significant reduction in those inflammatory cells counts compared to the model group. And the ergosterol-treatment decreased the IL-6 and TNF-α level while increased the TGF-β level in BALF in CSE-induced rat model, as shown in Fig. 2D.
mass. As shown in Fig. 1B, the spleen index was significantly reduced both in the model group (M) (p < 0.05) and budesonide group (P) (p < 0.01) compared to the control group (C). However, the ergosterol treatment reversed the CSE-induced reduction of spleen index, which is markedly in E-H (10 mg/kg) group (p < 0.05). Moreover, as shown in Fig. 1C, liver index markedly decreased in the model group (M) compared with the control group (C) (p < 0.01), while the budesonide and ergosterol treatment reversed this change and, particularly in the ergosterol of high (E-H) group, showed a statistically significance (p < 0.01) compared with the model (M) group. 3.2. Morphological change of lung tissues in CSE-induced COPD rats The morphometric assay was performed to value the effect of ergosterol on the CSE-induced lung damage in rats. H&E (Fig. 1D) and Masson’s Staining (Fig. 1E) show the CSE treatment (M group) caused a marked destruction of the lung parenchyma including increased inflammatory cell infiltration, thickened small airways due to deposition of extracellular matrix, and alveolar space collapse. However, this destruction was alleviated by the treatment of ergosterol.
3.4. Ergosterol significantly decreases M1-marker iNOS and CD40 but increases M2-marker CD163 The effect of ergosterol on macrophage polarization was detected by quantifying the level of M1-associated marker of iNOS, CD40 and that of M2-associated marker of CD163. Results show that expression of CD40 was significantly increased in CSE-treated RAW264.7 cells as opposed to the control group, while the ergosterol treatment reversed this change (Fig. 3A). Interestingly, the CSE treatment also slightly increased the expression of M2-marker CD163 compared to the control group, and the ergosterol treatment further increased that of CD163 (Fig. 3B). Besides, immunohistochemistry results show that the ergosterol treatment decreased the expression of M1-marker CD40 (Fig. 3C) while increased that of M2-marker CD163 in the rat lungs (Fig. 3D), which was consisted with the results in vitro. Furthermore, as shown in
3.3. Ergosterol affects the dynamic polarization of macrophages from M1 to M2 both in vitro and in vivo In order to investigate the effect of ergosterol on macrophages polarization, the ROS and M1 characteristic cytokines (IL-6 and TNF-α) level as well as the M2 characteristic cytokines (IL-10 and TGF-β) level were measured. Results show that the level of ROS (Fig. 2A) and IL-6, TNF-α (Fig. 2B) was significantly increased by CSE-treatment as opposed to the control group, which were inhibited in a dose-dependent 4
International Immunopharmacology 79 (2020) 106086
X. Sun, et al.
Fig. 2. Ergosterol affect the dynamic polarization of macrophages from M1 to M2 both in vitro and in vivo. (A) ROS level. (B) M1 and M2 –associated cytokines secretion in RAW264.7 cells. (C) M1 and M2 –associated cytokines mRNA in RAW264.7 cells. (D) Number of the inflammatory cells and the level of M1 and M2 –associated cytokines in BALF. *p < 0.05, **p < 0.01, ***p < 0.001, the CSE-induced group (Model group) vs. the control group; #p < 0.05, ##p < 0.01, the ergosterol treatment groups vs. the CSE-induced group (Model group). All the experiments were repeated three times. Data shown are the mean ± SEM (n = 3).
deacetylation is involved in the effect of ergosterol protection in COPD diseases. So, mRNA levels of HDAC3, CBP, P300 and PCAF were examined by RT-PCR analysis on CSE-induced RAW264.7 cells (Fig. 6A). Besides, HDAC3, P300, PCAF and acetyl-NF-κB/p65 were analyzed via Western blot to evaluate the mechanistic pathway. As expected, acetylNF-κB/p65 both in vitro (Fig. 6B) and in vivo (Fig. 6C) was increased while HDAC3 showed a significant decrease in the CSE or model group compared to the control group. On the contrary, these changes were reversed by the treatment of ergosterol. In contrast, the ergosterol treatment decreased the up-regulation of P300 and PCAF induced by CSE both in vivo and in vitro. In addition, immunohistochemistry of P300, HDAC3 and acetyl NF-κB/p65 were consistent with that of Western blot (Fig. 6D).
Fig. 4, ergosterol decreased the expression of M1-marker iNOS and CD40, while increased that of M2-marker CD163 both in CSE-induced Raw264.7 cells and rat lungs via Western blot. 3.5. Ergosterol significantly decreases the expression of MMP-9 The matrix metalloproteinase (MMP) family members, which can be produced by macrophages, are associated with the degradation of elastin in the alveolar walls and other extracellular matrix components, resulting in the destruction of parenchyma and emphysematous changes [25]. Thereby, MMP-9 activity both in vitro and in vivo was determined using Western blot. As shown in Fig. 5A and 5B, the CSE treatment (CSE and model group) exhibited increased MMP-9 activity. As expected, ergosterol significantly reduced the activity of MMP-9 in the CSE-treated cells and rats. Moreover, immunohistochemistry of MMP-9 (Fig. 5C and 5D) was consistent with that of Western blot.
3.7. Effect of ergosterol on IKKα, IKKβ and IKKγ IKKs are important kinase in NF-κB-mediated immune and inflammatory response [29]. Therefore, the level of IKKα, IKKβ and IKKγ were measured by Western blot. Results show that the CSE treatment significantly increased the level of IKKβ while no effect on that of IKKα and IKKγ both in vitro (Fig. 7A) and in vivo (Fig. 7B). However, the ergosterol treatment reversed this change, demonstrating that it was IKKβ mainly involved in the protective effect of ergosterol on COPD.
3.6. Effect of ergosterol on HDAC3, P300, PCAF and acetyl-NF-κB/p65 It is reported that the transrepression and transactivation controlled by NF-κB is associated with the expression and activity of HDAC (such as HDAC1, HDAC2, HDAC3), which is reduced by cigarette smoking and lower expression in COPD patients [13,26]. Besides, the activated NF-κB can switch on HAT leading to histone deacetylation and subsequently activating transcription genes encoding for inflammatory proteins, which can be revised by steroids treatment [27]. Shannon E. Mullican et al reports that HDAC3 is an epigenomic brake in alternative activation whose release could be of benefit in the treatment of multiple inflammatory disease [15]. Ergosterol has been reported to have antiinflammatory and anti-oxidative effects via NF-κB pathway in CS-induced mice [28]. Therefore, we hypothesized that HDAC3
4. Discussion Previous reports indicated that ergosterol might effectively improve the progression of CS-induced COPD by anti-inflammation via JAK3/ STAT3/NF-κB pathway in mice [21]. In this study, we observed that 10% CSE administration significantly increased the ROS level compared with the control group, whereas this change was reversed by the 5
International Immunopharmacology 79 (2020) 106086
X. Sun, et al.
Fig. 3. Effect of ergosterol on the M1 marker CD40 and M2 marker CD163. Flow cytometry assay of CD40 (A) and CD163 (B) in Raw264.7 cells. Immunohistochemistry analysis of CD40 (C) and CD163 (D) in rats. The corresponding histogram was shown as (E). *p < 0.05, ***p < 0.001, the CSE group vs. the control group; #p < 0.05, ##p < 0.01, the ergosterol treatment groups vs. the CSE group. Data are presented as mean ± SEM.
MMP-9 activity, which was accompanied by the increase of cytokines induced by CSE such as TNF-α and IL-1β [25]. Cytokines production largely affects macrophage phenotypes in inflammatory associated diseases. And macrophage phenotype switch can cause the imbalance of cytokine production, thereby play a key role in COPD [30]. Zheng XF et al demonstrats that LPS may have caused M1 macrophages to produce high level of IL-12 which cause inflammatory T cell responses, in addition, there could have been a shifting of M2
treatment of ergosterol in Raw264.7 cells. ROS is an important component in the upregulation of various cytokines and chemokines [13]. Our results show that the ergosterol treatment significantly attenuated the secretion of IL-6 and TNF-α and increased IL-10 and TGF-β and their mRNA levels in RAW264.7 cells. Moreover, results of cytokines secretion in CSE-induced rats were consistent with that in vitro, demonstrating the protective effects of ergosterol in COPD patients, which are consistent with the previous study [21]. Ergosterol also decreased
6
International Immunopharmacology 79 (2020) 106086
X. Sun, et al.
Fig. 4. Effect of ergosterol on the M1 markers iNOS and CD40 and M2 marker CD163 determined by Western blot. Western blot analysis of iNOS, CD40 and CD163 in RAW264.7 cells (A) and in rats (B). The corresponding histogram was on the right. *p < 0.05, **p < 0.01, the CSE group vs. the control group; # p < 0.05, the ergosterol treatment groups vs. the CSE or model group. Data are presented as mean ± SEM.
deacetylation of specific NF-κB/p65 lysines has a closely connection with HDAC3 [32], which is a member of class Ⅰ HDAC family and play critical roles in regulating cell proliferation and inflammatory responses (such as in COPD and asthma) [11,13,32]. HDAC3 is also associated with the alternative macrophage activation, playing an important role in the treatment of multiple inflammatory disease [15]. Hence, we examined the expression of, HDAC3, P300, CBP and PCAF by using RTPCR and/or Western blot. Results show that the expression of acetylNF-κB/p65 and HATs were increased, while that of HDAC3 was decreased in the CSE-induced RAW264.7 cells and rats. However, the ergosterol treatment reversed these changes. Besides, results of P300 and HDAC3 in lung detected by the immunohistochemical assay were consistent with in vitro data above. These results indicate that ergosterol
macrophages to M1 macrophages to promote inflammation [31]. In the work, the M1 and M2 polarization were identified using specific markers by flow cytometry, Western blot and/or immunohistochemical assay. Our data indicate that CSE induced a remarkable increase in the percentage of M1 cells with a slight increase in the M2 cells. However, the ergosterol treatment down-regulated the expression of iNOS and CD40 while up-regulated CD163 both in CSE-induced RAW264.7 cells and rats, demonstrating that ergosterol drive a shuffling of M1 polarization to M2 polarization to show the protective effect on COPD disease. The activated HATs (includes CBP, P300 and PCAF) acetylate the core histones to allow transcription factors and RNA polymerase binding to DNA, thus, initiating gene transcription [11]. Moreover, the
Fig. 5. Effect of ergosterol on MMP-9 activity. MMP-9 activity determined via Western blot in RAW264.7 cells (A) and in rats (B). (C) MMP-9 activity determined via Immunohistochemistry. The corresponding histogram was shown as (D). **p < 0.01, ***p < 0.001, the CSE group vs. the control group; #p < 0.05, ##p < 0.01, the ergosterol treatment groups vs. the CSE or model group. Data are presented as mean ± SEM.
7
International Immunopharmacology 79 (2020) 106086
X. Sun, et al.
Fig. 6. Effect of ergosterol on the mRNA or/and protein expression of HDAC3, P300, CBP, PCAF and acetyl NF-κB/p65. (A) RT-PCR analysis of HDAC3, P300, CBP and PCAF mRNA in CSE-induced RAW264.7 cells. Western blot analysis of acetyl NF-κB/p65, HDAC3, P300 and PCAF proteins in CSE-induced RAW264.7 cells (B) and in rats (C). (D) The immunohistochemistry analysis of P300, HDAC3 and Acetyl NF-κB/p65 expression in the CSE-stimulated rats (400×). Their quantitative densitometric analysis normalized against GAPDH were shown on the right, respectively. Each value represents the mean ± SEM of three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001, the CSE-induced group vs. the control group; #p < 0.05, ##p < 0.01, the ergosterol treatment group vs. the CSE or model group. Study groups: C: control group; M: model group, intraperitoneal injection of CSE; P: positive control group (budesonide 2 mg/kg/day + CSE); E–L, ergosterol low group (2.5 mg/kg/day + CSE); EM, ergosterol medium group (5 mg/kg/ day + CSE); E-H, ergosterol high group (10 mg/ kg/day + CSE).
Based upon our study results, we proposed the preliminary mechanism of the treatment effect of ergosterol on COPD (Fig. 8). Ergoserol attenuated the oxidative stress (ROS) and inflammation by inhibiting the NF-κB activation. In response to stimulation, activated IκB
might increase the HDAC3 protein expression and decrease the HAT protein expressions. The increased HAT activity subsequently influences NF-κB/p65 acetylation, therefore regulating inflammatory gene expressions to cause macrophage phenotype switch.
Fig. 7. Effect of ergosterol on IKKs both in vitro and in vivo Western blot analysis of IKKα, IKKβ and IKKγ proteins in CSE-induced RAW264.7 cells (A) and in rats (B). Their quantitative densitometric analysis normalized against GAPDH were shown on the right, respectively. ** p < 0.01, the CSE-induced group vs. the control group; #p < 0.05, ##p < 0.01, the ergosterol treatment group vs. the CSE or model group. Study groups: C: control group; M: model group, intraperitoneal injection of CSE; P: positive control group (budesonide 2 mg/kg/ day + CSE); E–L, ergosterol low group (2.5 mg/ kg/day + CSE); E-M, ergosterol medium group (5 mg/kg/day + CSE); E-H, ergosterol high group (10 mg/kg/day + CSE).
8
International Immunopharmacology 79 (2020) 106086
X. Sun, et al.
Fig. 8. The proposed mechanism of ergosterol on the protection of COPD.
kinases (IKKs) will phosphorylate two specific serine residues (Ser32 and Ser36) on IκBs leading to its degradation, resulting in the free NFκB in cytoplasm will translocate into nucleus and binds to the target genes [29]. The binding transcription factors such as NF-κB activated the transcriptional coactivators HATs such as CBP and PCAF and enhanced intrinsic histone acetylation activity [11]. The acetylation of core histones by coactivator proteins and RNA polymerase Ⅱ led to the unwinding of chromatin, and subsequently promoted the transcription factors to switch on gene transcriptions. Conversely, the deacetylation of core histones by elevated HDAC3 that was associated with transcriptional repressions further attenuated the proinflammatory cytokines (i.e. IL-6, TNF-α and IL-1β) and upregulated anti-inflammatory cytokines (i.e. IL-10 and TGF-β) in the M1 polarization. In conclusion, our study confirmed the key role of the macrophages polarization shifting from M1 to M2 in the treatment of COPD with ergosterol. This therapeutic effect of ergosterol on COPD was partially related to the attenuation of NF-κB and activation of IκB kinases (IKKβ), transcriptional coactivators HATs (CBP and PCAF) and HDACs (HDAC3). These findings show that ergosterol had a potential pharmacological effect on macrophage polarization and expected to be a special drug target in COPD diseases.
Xiuli Feng: Data curation, Formal analysis, Writing - original draft, Writing - review & editing. Chunyan Li: Writing - original draft, Writing - review & editing. Siying Li: Conceptualization, Writing original draft, Writing - review & editing. Zhongxi Zhao: Conceptualization, Writing - original draft, Writing - review & editing.
CRediT authorship contribution statement
Declaration of Competing Interest
Xiao Sun: Conceptualization, Data curation, Formal analysis, Investigation, Writing - original draft, Writing - review & editing. Yan Liu: Investigation, Writing - original draft, Writing - review & editing.
We wish to confirm that there are no known conflicts of interest associated with this publication and there has been no significant financial support for this work that could have influenced its outcome.
Acknowledgments This work was supported by the funds from the National Major Science and Technology Project–Prevention and Treatment of AIDS, Viral Hepatitis, and Other Major Infectious Diseases (Grant #2013ZX10005004), Ministry of Science and Technology, China; Major Project of Science and Technology of Shandong Province (Grants #2015ZDJS04001 and 2018CXGC1411), Department of Science and Technology, Shandong Province, China; Science & Technology Enterprise Technology Innovation Fund of Jiangsu Province (Grant #BC2014172), Department of Science and Technology, Jiangsu Province, China; Small & Medium Enterprise Technology Innovation Project of Lianyungang City (Grant #CK1333), Department of Science and Technology, Lianyungang City, China.
9
International Immunopharmacology 79 (2020) 106086
X. Sun, et al.
References
105 (4) (2007) 1755–1759. [18] B. Mesmin, B. Antonny, The counterflow transport of sterols and PI4P, Biochim. Biophys. Acta 1861 (8 Pt B) (2016) 940–951. [19] T.B. Ng, H.X. Wang, Pharmacological actions of Cordyceps, a prized folk medicine, J. Pharm. Pharmacol. 57 (12) (2005) 1509–1519. [20] S.-Y. Zhang, L.-T. Xu, A.-X. Li, S.-M. Wang, Effects of ergosterol, isolated from scleroderma polyrhizum pers., on lipopolysaccharide-induced inflammatory responses in acute lung injury, Inflammation 38 (5) (2015) 1979–1985. [21] W. Huan, Z. Tianzhu, L. Yu, W. Shumin, Effects of Ergosterol on COPD in Mice via JAK3/STAT3/NF-κB Pathway, Inflammation 40 (3) (2017) 1–10. [22] R. Dong, L. Xie, K.S. Zhao, Q.R. Zhang, M. Zhou, P. He, Cigarette smoke-induced lung inflammation in COPD mediated via LTB4/BLT1/SOCS1 pathway, Int. J. Chro. Obstr. 11 (2016) 31–41. [23] N.J. Dar, N.K. Satti, P. Dutt, A. Hamid, M. Ahmad, Attenuation of GlutamateInduced Excitotoxicity by Withanolide-A in Neuron-Like Cells: Role for PI3K/Akt/ MAPK Signaling Pathway, Mol. Neurobiol. 55 (4) (2018) 2725–2739. [24] Y. Liu, A. Li, X.L. Feng, X. Sun, X.S. Zhu, Z.X. Zhao, Pharmacological Investigation of the Anti-Inflammation and Anti-Oxidation Activities of Diallyl Disulfide in a Rat Emphysema Model Induced by Cigarette Smoke Extract, Nutrients 10 (1) (2018). [25] Y. Chen, M. Hanaoka, Y. Droma, P. Chen, N.F. Voelkel, K. Kubo, Endothelin-1 receptor antagonists prevent the development of pulmonary emphysema in rats, Eur. Respir. J. 35 (4) (2010) 904–912. [26] T. Koopmans, R. Eilers, M. Menzen, A. Halayko, R. Gosens, β-Catenin Directs Nuclear Factor-κB p65 Output via CREB-Binding Protein/p300 in Human Airway Smooth Muscle, Front. Immunol. 8 (1086) (2017). [27] F.J. Van Overveld, U. Demkow, D. Górecka, W.A. De Backer, J. Zieliński, Differences in responses upon corticosteroid therapy between smoking and nonsmoking patients with COPD, J. Physiol. Pharmacol. 57 (Suppl 4 57 Suppl 4) (2006) 273–282. [28] X. Sun, X. Feng, D. Zheng, A. Li, C. Li, S. Li, Z. Zhao, Ergosterol attenuates cigarette smoke extract-induced COPD by modulating inflammation, oxidative stress and apoptosis in vitro and in vivo, Clin. Sci. (Lond) 133 (13) (2019) 1523–1536. [29] H. Harikrishnan, I. Jantan, M.A. Haque, E. Kumolosasi, Anti-inflammatory effects of Phyllanthus amarus Schum. & Thonn. through inhibition of NF-kappaB, MAPK, and PI3K-Akt signaling pathways in LPS-induced human macrophages, BMC Complement Altern. Med. 18(1) (2018) 224. [30] A. Al Faraj, A. Sultana Shaik, M.A. Pureza, M. Alnafea, R. Halwani, Preferential macrophage recruitment and polarization in LPS-induced animal model for COPD: noninvasive tracking using MRI, PLoS One 9 (3) (2014) e90829. [31] X.-F. Zheng, Y.-X. Hong, G.-J. Feng, G.-F. Zhang, H. Rogers, M.A.O. Lewis, D.W. Williams, Z.-F. Xia, B. Song, X.-Q. Wei, Lipopolysaccharide-induced M2 to M1 macrophage transformation for IL-12p70 production is blocked by Candida albicans mediated up-regulation of EBI3 expression, PLoS One 8 (5) (2013) e63967. [32] N.G. Leus, T. van den Bosch, P.E. van der Wouden, K. Krist, M.E. Ourailidou, N. Eleftheriadis, L.E. Kistemaker, S. Bos, R.A. Gjaltema, S.A. Mekonnen, R. Bischoff, R. Gosens, H.J. Haisma, F.J. Dekker, HDAC1-3 inhibitor MS-275 enhances IL10 expression in RAW264.7 macrophages and reduces cigarette smoke-induced airway inflammation in mice, Sci. Rep. 7 (2017) 45047.
[1] M. Decramer, W. Janssens, M. Miravitlles, Chronic obstructive pulmonary disease, Lancet 379 (9823) (2012) 1341–1351. [2] P.J. Barnes, New anti-inflammatory targets for chronic obstructive pulmonary disease, Nature Rev. Drug Discov. 12 (7) (2013) 543–559. [3] G.G. Brusselle, G.F. Joos, K.R. Bracke, New insights into the immunology of chronic obstructive pulmonary disease, Lancet 378 (9795) (2011) 1015–1026. [4] O.J. Harrison, J. Foley, B.J. Bolognese, E. Long 3rd, P.L. Podolin, P.T. Walsh, Airway infiltration of CD4+ CCR6+ Th17 type cells associated with chronic cigarette smoke induced airspace enlargement, Immunol. Lett. 121 (1) (2008) 13–21. [5] W. MacNee, Pulmonary and systemic oxidant/antioxidant imbalance in chronic obstructive pulmonary disease, Proc. Am. Thorac. Soc. 2 (1) (2005) 50–60. [6] I. Rahman, W. MacNee, Antioxidant pharmacological therapies for COPD, Curr. Opin. Pharmacol. 12 (3) (2012) 256–265. [7] A. Saradna, D.C. Do, S. Kumar, Q.L. Fu, P. Gao, Macrophage polarization and allergic asthma, Transl. Res. 191 (2018) 1–14. [8] R. Shaykhiev, A. Krause, J. Salit, Y. Strulovici-Barel, B.G. Harvey, T.P. O'Connor, R.G. Crystal, Smoking-dependent reprogramming of alveolar macrophage polarization: implication for pathogenesis of chronic obstructive pulmonary disease, J. Immunol. 183 (4) (2009) 2867–2883. [9] X. Fu, H. Shi, Y. Qi, W. Zhang, P. Dong, M2 polarized macrophages induced by CSE promote proliferation, migration, and invasion of alveolar basal epithelial cells, Int. Immunopharmacol. 28 (1) (2015) 666–674. [10] J.S. Lee, Heterogeneity of lung mononuclear phagocytes in chronic obstructive pulmonary disease, J. Innate Immun. 4 (5–6) (2012) 489–497. [11] K. Ito, G. Caramori, S. Lim, T. Oates, K.F. Chung, P.J. Barnes, I.M. Adcock, Expression and activity of histone deacetylases in human asthmatic airways, Am. J. Respir. Crit. Care Med. 166 (3) (2002) 392–396. [12] J. Milara, A. Navarro, P. Almudéver, J. Lluch, E.J. Morcillo, J. Cortijo, Oxidative stress-induced glucocorticoid resistance is prevented by dual PDE3/PDE4 inhibition in human alveolar macrophages, Clin. Exp. Allergy 41 (4) (2011) 535–546. [13] M. Li, X. Zhong, Z. He, M. Wen, J. Li, X. Peng, G. Liu, J. Deng, J. Zhang, J. Bai, Effect of erythromycin on cigarette-induced histone deacetylase protein expression and nuclear factor-κB activity in human macrophages in vitro, Int. Immunopharmacol. 12 (4) (2012) 643–650. [14] X. Chen, I. Barozzi, A. Termanini, E. Prosperini, A. Recchiuti, J. Dalli, F. Mietton, G. Matteoli, S. Hiebert, G. Natoli, Requirement for the histone deacetylase Hdac3 for the inflammatory gene expression program in macrophages, Proc. Natl. Acad. Sci. USA 109 (42) (2012) E2865–E2874. [15] S.E. Mullican, C.A. Gaddis, T. Alenghat, M.G. Nair, P.R. Giacomin, L.J. Everett, D. Feng, D.J. Steger, J. Schug, D. Artis, M.A. Lazar, Histone deacetylase 3 is an epigenomic brake in macrophage alternative activation, Genes Dev. 25 (23) (2011) 2480–2488. [16] J. Yang, S. Yin, F. Bi, L. Liu, T. Qin, H. Wang, W. Cao, TIMAP repression by TGFbeta and HDAC3-associated Smad signaling regulates macrophage M2 phenotypic phagocytosis, J. Mol. Med. (Berl) 95 (3) (2017) 273–285. [17] J.-P. Yuan, J.-H. Wang, X. Liu, H.-C. Kuang, S.-Y. Zhao, Simultaneous determination of free ergosterol and ergosteryl esters in Cordyceps sinensis by HPLC, Food Chem.
10
Contents lists available at ScienceDirect
International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp
The key role of macrophage depolarization in the treatment of COPD with ergosterol both in vitro and in vivo ⁎⁎
Xiao Suna, Yan Liua, Xiuli Fenga, Chunyan Lia, Siying Lib, , Zhongxi Zhaoa,c,d,
T
⁎
a
School of Pharmaceutical Sciences, Shandong University, 44 West Wenhua Road, Jinan, Shandong 250012, PR China School of Basic Medical Sciences, Shandong University, 44 West Wenhua Road, Jinan 250012, PR China c Shandong Engineering & Technology Research Center for Jujube Food and Drug, 44 West Wenhua Road, Jinan, Shandong 250012, PR China d Shandong Provincial Key Laboratory of Mucosal and Transdermal Drug Delivery Technologies, Shandong Academy of Pharmaceutical Sciences, 989 Xinluo Street, Jinan, Shandong 250101, PR China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Ergosterol COPD Macrophage depolarization Histone deacetylases Histone acetyltransferase
Macrophages are the most abundant immune cells in the lung, which play an important role in COPD. The antiinflammatory and anti-oxidation of ergosterol are well documented. However, the effect of ergosterol on macrophage polarization has not been studied. The objective of this work was to investigate the effect of ergosterol on macrophage polarization in CSE-induced RAW264.7 cells and Sprague-Dawley (SD) rats COPD model. Our results demonstrate that CSE-induced macrophages tend to the M1 polarization via increasing ROS, IL-6 and TNF-α, as well as increasing MMP-9 to destroy the lung construction in both RAW264.7 cells and SD rats. However, treatment of RAW264.7 cells and SD rats with ergosterol inhibited CSE-induced inflammatory by decreasing ROS, IL-6 and TNF-α, and increasing IL-10 and TGF-β, shuffling the dynamic polarization of macrophages from M1 to M2 both in vitro and in vivo. Ergosterol also decreased the expression of M1 marker CD40, while increased that of M2 marker CD163. Moreover, ergosterol improved the lung characters in rats by decreasing MMP-9. Furthermore, ergosterol elevated HDAC3 activation and suppressed P300/CBP and PCAF activation as well as acetyl NF-κB/p65 and IKKβ, demonstrating that HDAC3 deacetylation was involved in the effect of ergosterol on macrophage polarization. These results also provide a proof in immunoregulation of ergosterol for therapeutic effects of cultured C. sinensis on COPD patients.
1. Introduction Chronic obstructive pulmonary disease (COPD) is characterized by progressive airflow obstruction that is only partly reversible and an abnormal inflammatory response [1]. Cigarette smoke (CS) is the main etiologic factor in pathogenesis of COPD by increasing oxidant burden, consequently initiate inflammatory cells infiltration, which consists of neutrophils, macrophages, and T cell subsets, releasing inflammatory mediators [2–4]. This inflammatory response ultimately leads to the tissue destruction associated with pulmonary emphysema [5,6]. So, the relative contribution of these specific immune cell subsets towards diseases pathogenesis provides a good horizon for the treatment of
COPD. Macrophages are the most abundant immune cells in the lung, which play a dual role of inflammatory and anti-inflammatory function [7]. The two extremes in the spectrum of macrophage function are represented by the mononuclear phenotype “M1 polarization” (referred to as “classical activation”) and “M2 polarization” (referred to as “alternative activation”) [7,8]. COPD likely reflects an altered lung microenvironment where CS induces inflammation on the one hand but, over time, impairs the ability of the alveolar macrophage to response subsequent microbial triggers. Xiao Fu et al demonstrated that macrophage M2 polarization induced by CSE treatment for 96 h promotes proliferation, migration, and invasion of alveolar basal epithelial cells
Abbreviations: AP-1, activator protein-1; Ac, acetylation; BALF, bronchoalveolar lavage fluid; CBP, CREB-binding protein; CSE, cigarette smoke extract; FBS, fetal bovine serum; HATs, histone acetyltransferase; HDACs, histone deacetylases; HE, hematoxylin and eosin; IL, interleukin; iNOS, inducible nitric oxide synthase; MMP, matrix metalloproteinase; MT, Masson’s Trichrome; NF-κB, nuclear factor-κB; PCAF, P300/CBP-associated factor; ROS, Reactive Oxygen Species; TNF-α, tumor necrosis factor-α; TGF-β, transforming growth factor-β ⁎ Corresponding author at: National Distinguished Professor, School of Pharmaceutical Sciences, Shandong University, 44 West Wenhua Road, Jinan 250012, PR China. ⁎⁎ Corresponding author. E-mail addresses: [email protected] (S. Li), [email protected] (Z. Zhao). https://doi.org/10.1016/j.intimp.2019.106086 Received 10 October 2019; Received in revised form 23 November 2019; Accepted 25 November 2019 1567-5769/ © 2019 Elsevier B.V. All rights reserved.
International Immunopharmacology 79 (2020) 106086
X. Sun, et al.
was got from Abbkin (shanghai, China). Horseradish peroxidase (HRP)conjugated antibodies were bought from Jackson Immuno Research Laboratories, Inc. (West Grove, PA, USA). Other reagents used in the experiment were all of analytical grade.
[9]. While alveolar macrophages in the face of CS can show a suppression of M1 phenotype, it is possible that a distinct subset of mononuclear phagocytes within the lungs can develop and sustain the inflammation response [10]. Besides, macrophages have been implicated as playing a central role in mediating the tissue destruction through the secretion of matrix metalloproteinases (MMPs) [4]. Therefore, a better understanding of the molecular mechanisms regulating macrophage polarization is essential to understand the causal relationship between drugs and its treatment of COPD. Histone acetylation is an active process whereby small changes in acetylases or deacetylases can markedly affect the overall histone acetyltransferase (HAT) activity associated with inflammatory genes [11,12]. The acetylation of core histones by coactivator proteins that possess intrinsic HAT activity leads to the unwinding of chromatin, which subsequently allows transcription factors and RNA polymerase Ⅱ to switch on gene transcription. Conversely, the deacetylation of core histones by HDACs is generally associated with transcriptional repression [13]. Report shows that HDAC activity was down-regulated in several types of cells in COPD, which is correlated with the increased inflammatory gene expression levels [12]. Besides, HDACs directly affect the nuclear binding of transcription factors such as nuclear factorκB (NF-κB), which is related to COPD, preventing gene transcription [12]. It is also demonstrated that HAT activity was reduced while HDAC activity was increased in the asthma subjects treated with inhaled steroids [11]. Moreover, HDAC3 is required for the activation of hundreds of inflammatory genes in M1 macrophages [14]. Macrophages lacking HDAC3 show an M2-line phenotype in the absence of external stimuli and are hyper-responsive to IL-4, suggesting that HDAC3 may promote M1 and inhibit M2 polarization [15]. HDAC3 can also deacetylate histone tails at regulatory regions, leading to repression of many IL-4-regulated genes, which are characteristic of M2 macrophages [7,16]. So, modulation of HAT and HDAC activity, following to intervene macrophage polarization and reduce NF-κB-mediated inflammatory gene expression, may have therapeutic potential in the treatment of COPD. Ergosterol, a principal sterol, has been used as a useful chemical marker for evaluating the quality of Cordyceps sinensis (C. sinensis), which is a traditional Chinese medicine [17]. It can be transported into the cell mediated by lipid transfer proteins (LTPs) via the lipid phosphatidylinositol 4-phosphate (PI4P) as a fuel [18]. Numerous studies have summarized that ergosterol has pharmacological activities (antitumor, anti-inflammation, anti-oxidation) [17,19,20]. Wang Huan et al also revealed that ergosterol effectively ameliorates the progression of CS-induced COPD in mice via JAK3/STAT3/NF-κB pathway [21]. However, the underline mechanism is not clear. The objective of this work was to explore the effect of ergosterol on macrophage polarization on CSE-induced COPD models in RAW264.7 cells and rats.
2.2. Preparation of aqueous cigarette smoke extract (CSE) CSE was prepared as previously reported [22]. Briefly, three cigarettes (Taishan brand, Jinan, China) were burned and the smoke was collected by a vessel containing the phosphate-buffered saline (PBS, 10 mL) using a vacuum pump. This 100% CSE was adjusted to pH 7.4 and was sterile filtered through a 0.22-µm filter. CSE was freshly prepared for each experiment and diluted with the culture medium containing 10% FBS immediately before use although the filtered CSE could be used within 24 h. The nicotine content in the range of 36–39 µg/mL in the CSE was determined by high performance liquid chromatography and used as a quality control. 2.3. Cells culture RAW264.7 cells, which were purchased from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences (Shanghai, China), were cultured in DMEM medium supplemented with 100 U/mL of penicillin G, 100 μg/mL of streptomycin, and 10% (v/v) inactivated fetal bovine serum. RAW264.7 cells were grown at 37 °C in a humidified 5% CO2 incubator. 2.4. Determination of IL-6, TNF-α, IL-10 and TGF-β secretion in RAW264.7 cells The cells were pre-incubated in 12-well plates for 24 h at 37 °C in a humidified incubator with 5% CO2. After cells were cultured with or without 10% CSE in the absence or presence of ergosterol (5, 10 and 20 μmol/L) for 24 h, levels of IL-6, TNF-α, IL-10 and TGF-β in the culture supernatants were then measured by a commercial essay kit or ELISA kit according to the manufacturer’s instructions. 2.5. Measurement of reactive oxygen species generation The generation of ROS was measured using 2′, 7′-Dichlorodi-hydrofluorescein diacetate (DCFH-DA, Sigma–Aldrich St. Louis, MO, USA) as described previously.[23] Briefly, cells were treated with or without ergosterol for 24 h after 1 h 10% CSE treatment. For measuring the ROS via microscopy, the cells were incubated with 10 µmol/L of DCFH-DA for 20 min at 37 °C. After washing with 1 × PBS for twice, fluorescence was measured using Olympus fluorescence microscope. 2.6. RNA extraction and relative quantification using real-time PCR
2. Materials and methods Total RNA was extracted using a RNAEasy kit according to the manufacturer’s instruction (Bioecon Biotec Co Ltd, China). RNA purity was checked by measuring the OD260/280 of RNA samples. cDNA was synthesized through reverse transcription using M-MLV reverse transcriptase and oligo(dT) primer. The gene expression levels of iNOS, TNF-α, IL-6, IL-10, TGF-β, HDAC3, P300, CBP and PCAF were detected by real-time PCR. PCR amplification was performed in a 96-well plate in triplicate. Each reaction well consisted of 10 μL of 2 × SYBR Green PCR Master mix, 0.5 μL forward and reverse primers, and 1 μL of template cDNA to obtain a final volume of 20 μL. The PCR analysis was performed using a Mastercycler ep realplex apparatus (Eppendorf, Germany). After an initial denaturation step for 3 min at 95 °C, the conditions for cycling were 39 cycles of 30 s at 95 °C, 30 s at 57 or 60 °C, and 30 s at 72 °C. The primer sets for iNOS, IL-6, TNF-α, IL-10, TGF-β, HDAC3, P300, CBP, PCAF and GAPDH were purchased from Dingguo Changsheng Biotechnology Co, Ltd (Beijing, China) and listed below (Table 1). The relative expression level of each target gene was
2.1. Reagents Ergosterol (Purity of 99%) was purchased from Aladdin Regents CO., Ltd. (Shanghai, China). Dulbecco’s modified Eagle’s medium (DMEM) and fetal bovine serum (FBS) were purchased from Biological Industries (Beit Haemek Ltd., Israel). Penicillin and streptomycin were purchased from Solarbio Biotechology (Beijing, China). TNF-α, IL-6, IL10 and TGF-β Enzyme-linked Immunosorbent Assay Kits were purchased from Shanghai Multi Sciences (Lianke) Biotech Co., Ltd. (Shanghai, China). Anti- P300 and HDAC3 antibodies were purchased from BOSTER (Wuhan, China). Anti-PCAF antibody was a gift from Abways technology (Shanghai, China). Anti-iNOS and MMP-9 antibodies were purchased from Cell Signaling Technology (Danvers, MA, USA). Anti- IKKα, IKKβ and IKKγ were got from ABclonal (Boston, USA). Anti-GAPDH antibody was provided by Proteintech Biotechnology (Rocky Hill, CT, USA). Anti-acetyl NF-κB/p65 antibody 2
International Immunopharmacology 79 (2020) 106086
X. Sun, et al.
morphological changes in the lungs.
Table 1 The primer sets for associated mRNA. Mouse
Forward primer
Reverse primer
TNF-α IL-6 IL-10 TGF-β, iNOS HDAC3 P300 CBP PCAF GAPDH
CAACGCCCTCCTGGCCAACG TGT GCAA TGGC AATT CTGA T GCTCTTACTGACTGGCATGAG CCACCTGCAAGACCATCGAC AGCAACTACTGCTGGTGGTG CACCCGCATCGAGAATCAGAAC AGCGGCCTAAACTCTCATCTC TGGAGTGAACCCCCAGTTAG AGCGGCCTAAACTCTCATCTC AATGTGTCCGTCGTGGATCT
TCGGGGCAGCCTTGTCCCTT CT CTGA AGGA CTCT GGC TTTG CGCAGCTCTAGGAGCATGTG CTGGCGAGCCTTAGTTTGGAC TCTTCAGAGTCTGCCCATTG CAGCGTCGGCCTCGTCAGTC GGCTGCATCTTGTACTATGCC TTGCTTGCTCTCGTCTCTGA GGCTGCATCTTGTACTATGCC CATCGAAGGTGGAAGAGTGG
2.10. Bronchoalveolar lavage fluid (BALF) collection The lungs were lavaged via a cannula inserted into the trachea and then instilled with 1 × 2 mL aliquots of saline. All aliquots were collected and centrifuged at 2000 rpm for 10 min at 4 °C. The supernatants were obtained and stored at −80 °C for the further analysis of IL-6, TNF-α and TGF-β using ELISA kits. The cells were resuspended in the PBS solution (100 μL) and counted using a hemocytometer. The cell differential was determined from an aliquot of the cell suspension by centrifugation on a slide and Wright-Giemsa stain (Solarbio Biotechnology, Beijing, China). Differential cell counts were calculated based on the morphological criteria.
normalized against the GAPDH control using the 2−△△Ct method and further compared with its own control. All samples were studied in independent triplicate experiments.
2.11. Western blot analysis The Raw264.7 cells and lung tissues were homogenized in the RIPA lysis buffer, and then total proteins were extracted and determined by a BCA kit (Beyotime Institute of Biotechnology, Beijing, China). Equal quantities of proteins were separated on 8–12% SDS-polyacrylamide gels and transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore Corp., Bedford, MA, USA). Membranes were incubated with primary antibodies (including iNOS, CD40, CD163, MMP-9, Acetyl NFκB/p65, HDAC3, P300, PCAF, IKKα, IKKβ and IKKγ) overnight at 4 °C, followed by the incubation with horseradish peroxidase (HRP)-conjugated anti-rabbit or anti-mouse antibodies for 1 h at room temperature. The signals were detected by enhanced chemiluminescence detection reagents. The relative optical densities of the bands were quantified using AlphaView SA software. All western blot analyses were carried out at least three times.
2.7. Flow cytometric analysis To assess M1 and M2-related genes at the protein level, the cells, treated with or without ergosterol for 24 h after 1 h treatment with 10% CSE, were washed three times in cold PBS supplemented with 2% fetal bovine serum (FBS). Then, cells were fixed and permeabilized for 30 min in cold 4% formaldehyde phosphate buffer and then washed with cold PBS supplemented with 2% FBS. After that, the fixed permeabilized cells were stained with PE-conjugated anti- CD40 and CD163 antibodies (eBioscience, Vienna, Austria) for 30 min in the dark. After the incubation, cells were washed twice and then were resuspended in PBS containing 2% FBS. Analysis was performed using a BD FACSArray cytometer (BD biosciences), and data were analyzed using FlwJo software (Tree Star). Mean fluorescence intensity was used to evaluate the expression of the different markers.
2.12. Immunohistochemistry for P300, HDAC3, acetyl NF-κB/p65, CD40 and CD163
2.8. Animal experiment
P300, HDAC3, Acetyl NF-κB/p65, CD40 and CD163 in the lung tissues of rats were determined by immunohistochemistry. Briefly, the lung tissue slices embedded with paraffin was deparaffinized and rehydrated. The antigen was retrieved using sodium citrate with heatinduced retrieval. After blocking with goat serum, P300, HDAC3, Acetyl NF-κB/p65, CD40 and CD163 antibodies were applied overnight at 4 °C. Then horseradish peroxidase-conjugated anti-rabbit antibody was applied, and P300, HDAC3, Acetyl NF-κB/p65, CD40 and CD163 were obtained and photographed under a microscope (Olympus Corporation, Tokyo, Japan).
Male SPF Sprague-Dawley rats weighing 160 g were purchased from Jinan Pengyue Experimental Animal Breeding Co. LTD (Shandong, China). Rats were housed in a temperature-controlled room (25 ± 2 °C) with the relative humidity of 40%-70%. All experimental procedures involving animals were performed in accordance with the institutional guidelines of the Animal Care and Use Committee of Shandong University (No. 2016020, Jinan, China) and conducted in the Center for Pharmaceutical Research and Drug Delivery System of Shandong University. After one-week acclimatization to the laboratory conditions, the rats were randomly divided into 6 groups (n = 6) as follows: control group (C), model group (M), positive control group (P, budesonide, 2 mg/kg), ergosterol low dosage (E-L, 2.5 mg/kg), ergosterol medium dosage (E-M, 5 mg/kg) and ergosterol high dosage (E-H, 10 mg/kg). Each rat in the model group was intraperitoneally injected with the 100% CSE (1 mL) on days 1, 8 and 15. Rats in the positive control and ergosterol groups were intraperitoneally injected with the 100% CSE (1 mL) on days 1, 8 and 15 along with the daily oral administration of budesonide or ergosterol, respectively. Budesonide and ergosterol were freshly prepared by suspending them in PBS containing 20% hydroxypropyl-β-cyclodextrin (w/v). On the 21st day after the experiment, all rats were sacrificed.
2.13. Statistical analysis Data are presented as mean ± SEM. The statistical significance of the difference was determined by one-way ANOVA followed by the Tukey’s post-hoc multiple comparison test using Prism version 5.0 (GraphPad Software, Inc.). Values of p < 0.05 were considered statistically significant. 3. Results 3.1. Ergosterol regulates immuno status of COPD rats
2.9. Histopathological analysis After treatment for 21 days, the body weight of rats in CSE-treated model group (p < 0.05) and budesonide group (p < 0.001) were significantly decreased compared to the control group, while the ergosterol treatment rats demonstrated a better situation (Fig. 1A). Spleen index is an immune parameter closely related to immune function [24]. It is calculated by dividing the body weight by spleen
The lung tissues were fixed with the 4% formaldehyde phosphate buffer overnight and then dehydrated and paraffin embedded and sliced into 4 µm sections and stained with hematoxylin and eosin (H&E) and Masson’s Trichrome. The slides were observed under a morphometric microscope (Nikon, Japan) at 100 magnification to evaluate the 3
International Immunopharmacology 79 (2020) 106086
X. Sun, et al.
Fig. 1. Ergosterol improved the rat life and lung features on the CSE-induced rat model. (A) Rat body weights were measured at the indicated time point. (B) The spleen index of rats in each group. (C) The liver index of rats in each group. Lung tissue histological assay was stained with HE (D) and MT (E) (100×). Rats (six per group) were treated as follows: C, control group (the vehicle); M, CSE group; P, budesonide group (2 mg/kg/day + CSE); E-L, ergosterol low group (2.5 mg/kg/ day + CSE); E-M, ergosterol medium group (5 mg/kg/day + CSE); E-H, ergosterol high group (10 mg/kg/day + CSE). *p < 0.05, **p < 0.01, the CSE group vs. the control group; #p < 0.05, ##p < 0.01, the ergosterol treatment groups vs. the CSE group. Data are presented as mean ± SEM.
manner by the co-treatment with ergosterol. Interestingly, the level of IL-10 and TGF-β (Fig. 2B) was slightly increased by CSE-treatment comparing to the control group, while further increased by the cotreatment with ergosterol. Besides, the expression of iNOS, IL-6, TNF-α, IL-10 and TGF-β mRNA were also detected by RT-PCR analysis. As shown in Fig. 2C, ergosterol significantly decreased iNOS, IL-6 and TNF-α mRNA expression while increased that of IL-10 and TGF-β in the CSE treatment groups. Furthermore, the CSE induced macrophages and neutrophil counts increased in the BALF compared to the control group (Fig. 2D). In contrast, the ergosterol-treatment led to a significant reduction in those inflammatory cells counts compared to the model group. And the ergosterol-treatment decreased the IL-6 and TNF-α level while increased the TGF-β level in BALF in CSE-induced rat model, as shown in Fig. 2D.
mass. As shown in Fig. 1B, the spleen index was significantly reduced both in the model group (M) (p < 0.05) and budesonide group (P) (p < 0.01) compared to the control group (C). However, the ergosterol treatment reversed the CSE-induced reduction of spleen index, which is markedly in E-H (10 mg/kg) group (p < 0.05). Moreover, as shown in Fig. 1C, liver index markedly decreased in the model group (M) compared with the control group (C) (p < 0.01), while the budesonide and ergosterol treatment reversed this change and, particularly in the ergosterol of high (E-H) group, showed a statistically significance (p < 0.01) compared with the model (M) group. 3.2. Morphological change of lung tissues in CSE-induced COPD rats The morphometric assay was performed to value the effect of ergosterol on the CSE-induced lung damage in rats. H&E (Fig. 1D) and Masson’s Staining (Fig. 1E) show the CSE treatment (M group) caused a marked destruction of the lung parenchyma including increased inflammatory cell infiltration, thickened small airways due to deposition of extracellular matrix, and alveolar space collapse. However, this destruction was alleviated by the treatment of ergosterol.
3.4. Ergosterol significantly decreases M1-marker iNOS and CD40 but increases M2-marker CD163 The effect of ergosterol on macrophage polarization was detected by quantifying the level of M1-associated marker of iNOS, CD40 and that of M2-associated marker of CD163. Results show that expression of CD40 was significantly increased in CSE-treated RAW264.7 cells as opposed to the control group, while the ergosterol treatment reversed this change (Fig. 3A). Interestingly, the CSE treatment also slightly increased the expression of M2-marker CD163 compared to the control group, and the ergosterol treatment further increased that of CD163 (Fig. 3B). Besides, immunohistochemistry results show that the ergosterol treatment decreased the expression of M1-marker CD40 (Fig. 3C) while increased that of M2-marker CD163 in the rat lungs (Fig. 3D), which was consisted with the results in vitro. Furthermore, as shown in
3.3. Ergosterol affects the dynamic polarization of macrophages from M1 to M2 both in vitro and in vivo In order to investigate the effect of ergosterol on macrophages polarization, the ROS and M1 characteristic cytokines (IL-6 and TNF-α) level as well as the M2 characteristic cytokines (IL-10 and TGF-β) level were measured. Results show that the level of ROS (Fig. 2A) and IL-6, TNF-α (Fig. 2B) was significantly increased by CSE-treatment as opposed to the control group, which were inhibited in a dose-dependent 4
International Immunopharmacology 79 (2020) 106086
X. Sun, et al.
Fig. 2. Ergosterol affect the dynamic polarization of macrophages from M1 to M2 both in vitro and in vivo. (A) ROS level. (B) M1 and M2 –associated cytokines secretion in RAW264.7 cells. (C) M1 and M2 –associated cytokines mRNA in RAW264.7 cells. (D) Number of the inflammatory cells and the level of M1 and M2 –associated cytokines in BALF. *p < 0.05, **p < 0.01, ***p < 0.001, the CSE-induced group (Model group) vs. the control group; #p < 0.05, ##p < 0.01, the ergosterol treatment groups vs. the CSE-induced group (Model group). All the experiments were repeated three times. Data shown are the mean ± SEM (n = 3).
deacetylation is involved in the effect of ergosterol protection in COPD diseases. So, mRNA levels of HDAC3, CBP, P300 and PCAF were examined by RT-PCR analysis on CSE-induced RAW264.7 cells (Fig. 6A). Besides, HDAC3, P300, PCAF and acetyl-NF-κB/p65 were analyzed via Western blot to evaluate the mechanistic pathway. As expected, acetylNF-κB/p65 both in vitro (Fig. 6B) and in vivo (Fig. 6C) was increased while HDAC3 showed a significant decrease in the CSE or model group compared to the control group. On the contrary, these changes were reversed by the treatment of ergosterol. In contrast, the ergosterol treatment decreased the up-regulation of P300 and PCAF induced by CSE both in vivo and in vitro. In addition, immunohistochemistry of P300, HDAC3 and acetyl NF-κB/p65 were consistent with that of Western blot (Fig. 6D).
Fig. 4, ergosterol decreased the expression of M1-marker iNOS and CD40, while increased that of M2-marker CD163 both in CSE-induced Raw264.7 cells and rat lungs via Western blot. 3.5. Ergosterol significantly decreases the expression of MMP-9 The matrix metalloproteinase (MMP) family members, which can be produced by macrophages, are associated with the degradation of elastin in the alveolar walls and other extracellular matrix components, resulting in the destruction of parenchyma and emphysematous changes [25]. Thereby, MMP-9 activity both in vitro and in vivo was determined using Western blot. As shown in Fig. 5A and 5B, the CSE treatment (CSE and model group) exhibited increased MMP-9 activity. As expected, ergosterol significantly reduced the activity of MMP-9 in the CSE-treated cells and rats. Moreover, immunohistochemistry of MMP-9 (Fig. 5C and 5D) was consistent with that of Western blot.
3.7. Effect of ergosterol on IKKα, IKKβ and IKKγ IKKs are important kinase in NF-κB-mediated immune and inflammatory response [29]. Therefore, the level of IKKα, IKKβ and IKKγ were measured by Western blot. Results show that the CSE treatment significantly increased the level of IKKβ while no effect on that of IKKα and IKKγ both in vitro (Fig. 7A) and in vivo (Fig. 7B). However, the ergosterol treatment reversed this change, demonstrating that it was IKKβ mainly involved in the protective effect of ergosterol on COPD.
3.6. Effect of ergosterol on HDAC3, P300, PCAF and acetyl-NF-κB/p65 It is reported that the transrepression and transactivation controlled by NF-κB is associated with the expression and activity of HDAC (such as HDAC1, HDAC2, HDAC3), which is reduced by cigarette smoking and lower expression in COPD patients [13,26]. Besides, the activated NF-κB can switch on HAT leading to histone deacetylation and subsequently activating transcription genes encoding for inflammatory proteins, which can be revised by steroids treatment [27]. Shannon E. Mullican et al reports that HDAC3 is an epigenomic brake in alternative activation whose release could be of benefit in the treatment of multiple inflammatory disease [15]. Ergosterol has been reported to have antiinflammatory and anti-oxidative effects via NF-κB pathway in CS-induced mice [28]. Therefore, we hypothesized that HDAC3
4. Discussion Previous reports indicated that ergosterol might effectively improve the progression of CS-induced COPD by anti-inflammation via JAK3/ STAT3/NF-κB pathway in mice [21]. In this study, we observed that 10% CSE administration significantly increased the ROS level compared with the control group, whereas this change was reversed by the 5
International Immunopharmacology 79 (2020) 106086
X. Sun, et al.
Fig. 3. Effect of ergosterol on the M1 marker CD40 and M2 marker CD163. Flow cytometry assay of CD40 (A) and CD163 (B) in Raw264.7 cells. Immunohistochemistry analysis of CD40 (C) and CD163 (D) in rats. The corresponding histogram was shown as (E). *p < 0.05, ***p < 0.001, the CSE group vs. the control group; #p < 0.05, ##p < 0.01, the ergosterol treatment groups vs. the CSE group. Data are presented as mean ± SEM.
MMP-9 activity, which was accompanied by the increase of cytokines induced by CSE such as TNF-α and IL-1β [25]. Cytokines production largely affects macrophage phenotypes in inflammatory associated diseases. And macrophage phenotype switch can cause the imbalance of cytokine production, thereby play a key role in COPD [30]. Zheng XF et al demonstrats that LPS may have caused M1 macrophages to produce high level of IL-12 which cause inflammatory T cell responses, in addition, there could have been a shifting of M2
treatment of ergosterol in Raw264.7 cells. ROS is an important component in the upregulation of various cytokines and chemokines [13]. Our results show that the ergosterol treatment significantly attenuated the secretion of IL-6 and TNF-α and increased IL-10 and TGF-β and their mRNA levels in RAW264.7 cells. Moreover, results of cytokines secretion in CSE-induced rats were consistent with that in vitro, demonstrating the protective effects of ergosterol in COPD patients, which are consistent with the previous study [21]. Ergosterol also decreased
6
International Immunopharmacology 79 (2020) 106086
X. Sun, et al.
Fig. 4. Effect of ergosterol on the M1 markers iNOS and CD40 and M2 marker CD163 determined by Western blot. Western blot analysis of iNOS, CD40 and CD163 in RAW264.7 cells (A) and in rats (B). The corresponding histogram was on the right. *p < 0.05, **p < 0.01, the CSE group vs. the control group; # p < 0.05, the ergosterol treatment groups vs. the CSE or model group. Data are presented as mean ± SEM.
deacetylation of specific NF-κB/p65 lysines has a closely connection with HDAC3 [32], which is a member of class Ⅰ HDAC family and play critical roles in regulating cell proliferation and inflammatory responses (such as in COPD and asthma) [11,13,32]. HDAC3 is also associated with the alternative macrophage activation, playing an important role in the treatment of multiple inflammatory disease [15]. Hence, we examined the expression of, HDAC3, P300, CBP and PCAF by using RTPCR and/or Western blot. Results show that the expression of acetylNF-κB/p65 and HATs were increased, while that of HDAC3 was decreased in the CSE-induced RAW264.7 cells and rats. However, the ergosterol treatment reversed these changes. Besides, results of P300 and HDAC3 in lung detected by the immunohistochemical assay were consistent with in vitro data above. These results indicate that ergosterol
macrophages to M1 macrophages to promote inflammation [31]. In the work, the M1 and M2 polarization were identified using specific markers by flow cytometry, Western blot and/or immunohistochemical assay. Our data indicate that CSE induced a remarkable increase in the percentage of M1 cells with a slight increase in the M2 cells. However, the ergosterol treatment down-regulated the expression of iNOS and CD40 while up-regulated CD163 both in CSE-induced RAW264.7 cells and rats, demonstrating that ergosterol drive a shuffling of M1 polarization to M2 polarization to show the protective effect on COPD disease. The activated HATs (includes CBP, P300 and PCAF) acetylate the core histones to allow transcription factors and RNA polymerase binding to DNA, thus, initiating gene transcription [11]. Moreover, the
Fig. 5. Effect of ergosterol on MMP-9 activity. MMP-9 activity determined via Western blot in RAW264.7 cells (A) and in rats (B). (C) MMP-9 activity determined via Immunohistochemistry. The corresponding histogram was shown as (D). **p < 0.01, ***p < 0.001, the CSE group vs. the control group; #p < 0.05, ##p < 0.01, the ergosterol treatment groups vs. the CSE or model group. Data are presented as mean ± SEM.
7
International Immunopharmacology 79 (2020) 106086
X. Sun, et al.
Fig. 6. Effect of ergosterol on the mRNA or/and protein expression of HDAC3, P300, CBP, PCAF and acetyl NF-κB/p65. (A) RT-PCR analysis of HDAC3, P300, CBP and PCAF mRNA in CSE-induced RAW264.7 cells. Western blot analysis of acetyl NF-κB/p65, HDAC3, P300 and PCAF proteins in CSE-induced RAW264.7 cells (B) and in rats (C). (D) The immunohistochemistry analysis of P300, HDAC3 and Acetyl NF-κB/p65 expression in the CSE-stimulated rats (400×). Their quantitative densitometric analysis normalized against GAPDH were shown on the right, respectively. Each value represents the mean ± SEM of three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001, the CSE-induced group vs. the control group; #p < 0.05, ##p < 0.01, the ergosterol treatment group vs. the CSE or model group. Study groups: C: control group; M: model group, intraperitoneal injection of CSE; P: positive control group (budesonide 2 mg/kg/day + CSE); E–L, ergosterol low group (2.5 mg/kg/day + CSE); EM, ergosterol medium group (5 mg/kg/ day + CSE); E-H, ergosterol high group (10 mg/ kg/day + CSE).
Based upon our study results, we proposed the preliminary mechanism of the treatment effect of ergosterol on COPD (Fig. 8). Ergoserol attenuated the oxidative stress (ROS) and inflammation by inhibiting the NF-κB activation. In response to stimulation, activated IκB
might increase the HDAC3 protein expression and decrease the HAT protein expressions. The increased HAT activity subsequently influences NF-κB/p65 acetylation, therefore regulating inflammatory gene expressions to cause macrophage phenotype switch.
Fig. 7. Effect of ergosterol on IKKs both in vitro and in vivo Western blot analysis of IKKα, IKKβ and IKKγ proteins in CSE-induced RAW264.7 cells (A) and in rats (B). Their quantitative densitometric analysis normalized against GAPDH were shown on the right, respectively. ** p < 0.01, the CSE-induced group vs. the control group; #p < 0.05, ##p < 0.01, the ergosterol treatment group vs. the CSE or model group. Study groups: C: control group; M: model group, intraperitoneal injection of CSE; P: positive control group (budesonide 2 mg/kg/ day + CSE); E–L, ergosterol low group (2.5 mg/ kg/day + CSE); E-M, ergosterol medium group (5 mg/kg/day + CSE); E-H, ergosterol high group (10 mg/kg/day + CSE).
8
International Immunopharmacology 79 (2020) 106086
X. Sun, et al.
Fig. 8. The proposed mechanism of ergosterol on the protection of COPD.
kinases (IKKs) will phosphorylate two specific serine residues (Ser32 and Ser36) on IκBs leading to its degradation, resulting in the free NFκB in cytoplasm will translocate into nucleus and binds to the target genes [29]. The binding transcription factors such as NF-κB activated the transcriptional coactivators HATs such as CBP and PCAF and enhanced intrinsic histone acetylation activity [11]. The acetylation of core histones by coactivator proteins and RNA polymerase Ⅱ led to the unwinding of chromatin, and subsequently promoted the transcription factors to switch on gene transcriptions. Conversely, the deacetylation of core histones by elevated HDAC3 that was associated with transcriptional repressions further attenuated the proinflammatory cytokines (i.e. IL-6, TNF-α and IL-1β) and upregulated anti-inflammatory cytokines (i.e. IL-10 and TGF-β) in the M1 polarization. In conclusion, our study confirmed the key role of the macrophages polarization shifting from M1 to M2 in the treatment of COPD with ergosterol. This therapeutic effect of ergosterol on COPD was partially related to the attenuation of NF-κB and activation of IκB kinases (IKKβ), transcriptional coactivators HATs (CBP and PCAF) and HDACs (HDAC3). These findings show that ergosterol had a potential pharmacological effect on macrophage polarization and expected to be a special drug target in COPD diseases.
Xiuli Feng: Data curation, Formal analysis, Writing - original draft, Writing - review & editing. Chunyan Li: Writing - original draft, Writing - review & editing. Siying Li: Conceptualization, Writing original draft, Writing - review & editing. Zhongxi Zhao: Conceptualization, Writing - original draft, Writing - review & editing.
CRediT authorship contribution statement
Declaration of Competing Interest
Xiao Sun: Conceptualization, Data curation, Formal analysis, Investigation, Writing - original draft, Writing - review & editing. Yan Liu: Investigation, Writing - original draft, Writing - review & editing.
We wish to confirm that there are no known conflicts of interest associated with this publication and there has been no significant financial support for this work that could have influenced its outcome.
Acknowledgments This work was supported by the funds from the National Major Science and Technology Project–Prevention and Treatment of AIDS, Viral Hepatitis, and Other Major Infectious Diseases (Grant #2013ZX10005004), Ministry of Science and Technology, China; Major Project of Science and Technology of Shandong Province (Grants #2015ZDJS04001 and 2018CXGC1411), Department of Science and Technology, Shandong Province, China; Science & Technology Enterprise Technology Innovation Fund of Jiangsu Province (Grant #BC2014172), Department of Science and Technology, Jiangsu Province, China; Small & Medium Enterprise Technology Innovation Project of Lianyungang City (Grant #CK1333), Department of Science and Technology, Lianyungang City, China.
9
International Immunopharmacology 79 (2020) 106086
X. Sun, et al.
References
105 (4) (2007) 1755–1759. [18] B. Mesmin, B. Antonny, The counterflow transport of sterols and PI4P, Biochim. Biophys. Acta 1861 (8 Pt B) (2016) 940–951. [19] T.B. Ng, H.X. Wang, Pharmacological actions of Cordyceps, a prized folk medicine, J. Pharm. Pharmacol. 57 (12) (2005) 1509–1519. [20] S.-Y. Zhang, L.-T. Xu, A.-X. Li, S.-M. Wang, Effects of ergosterol, isolated from scleroderma polyrhizum pers., on lipopolysaccharide-induced inflammatory responses in acute lung injury, Inflammation 38 (5) (2015) 1979–1985. [21] W. Huan, Z. Tianzhu, L. Yu, W. Shumin, Effects of Ergosterol on COPD in Mice via JAK3/STAT3/NF-κB Pathway, Inflammation 40 (3) (2017) 1–10. [22] R. Dong, L. Xie, K.S. Zhao, Q.R. Zhang, M. Zhou, P. He, Cigarette smoke-induced lung inflammation in COPD mediated via LTB4/BLT1/SOCS1 pathway, Int. J. Chro. Obstr. 11 (2016) 31–41. [23] N.J. Dar, N.K. Satti, P. Dutt, A. Hamid, M. Ahmad, Attenuation of GlutamateInduced Excitotoxicity by Withanolide-A in Neuron-Like Cells: Role for PI3K/Akt/ MAPK Signaling Pathway, Mol. Neurobiol. 55 (4) (2018) 2725–2739. [24] Y. Liu, A. Li, X.L. Feng, X. Sun, X.S. Zhu, Z.X. Zhao, Pharmacological Investigation of the Anti-Inflammation and Anti-Oxidation Activities of Diallyl Disulfide in a Rat Emphysema Model Induced by Cigarette Smoke Extract, Nutrients 10 (1) (2018). [25] Y. Chen, M. Hanaoka, Y. Droma, P. Chen, N.F. Voelkel, K. Kubo, Endothelin-1 receptor antagonists prevent the development of pulmonary emphysema in rats, Eur. Respir. J. 35 (4) (2010) 904–912. [26] T. Koopmans, R. Eilers, M. Menzen, A. Halayko, R. Gosens, β-Catenin Directs Nuclear Factor-κB p65 Output via CREB-Binding Protein/p300 in Human Airway Smooth Muscle, Front. Immunol. 8 (1086) (2017). [27] F.J. Van Overveld, U. Demkow, D. Górecka, W.A. De Backer, J. Zieliński, Differences in responses upon corticosteroid therapy between smoking and nonsmoking patients with COPD, J. Physiol. Pharmacol. 57 (Suppl 4 57 Suppl 4) (2006) 273–282. [28] X. Sun, X. Feng, D. Zheng, A. Li, C. Li, S. Li, Z. Zhao, Ergosterol attenuates cigarette smoke extract-induced COPD by modulating inflammation, oxidative stress and apoptosis in vitro and in vivo, Clin. Sci. (Lond) 133 (13) (2019) 1523–1536. [29] H. Harikrishnan, I. Jantan, M.A. Haque, E. Kumolosasi, Anti-inflammatory effects of Phyllanthus amarus Schum. & Thonn. through inhibition of NF-kappaB, MAPK, and PI3K-Akt signaling pathways in LPS-induced human macrophages, BMC Complement Altern. Med. 18(1) (2018) 224. [30] A. Al Faraj, A. Sultana Shaik, M.A. Pureza, M. Alnafea, R. Halwani, Preferential macrophage recruitment and polarization in LPS-induced animal model for COPD: noninvasive tracking using MRI, PLoS One 9 (3) (2014) e90829. [31] X.-F. Zheng, Y.-X. Hong, G.-J. Feng, G.-F. Zhang, H. Rogers, M.A.O. Lewis, D.W. Williams, Z.-F. Xia, B. Song, X.-Q. Wei, Lipopolysaccharide-induced M2 to M1 macrophage transformation for IL-12p70 production is blocked by Candida albicans mediated up-regulation of EBI3 expression, PLoS One 8 (5) (2013) e63967. [32] N.G. Leus, T. van den Bosch, P.E. van der Wouden, K. Krist, M.E. Ourailidou, N. Eleftheriadis, L.E. Kistemaker, S. Bos, R.A. Gjaltema, S.A. Mekonnen, R. Bischoff, R. Gosens, H.J. Haisma, F.J. Dekker, HDAC1-3 inhibitor MS-275 enhances IL10 expression in RAW264.7 macrophages and reduces cigarette smoke-induced airway inflammation in mice, Sci. Rep. 7 (2017) 45047.
[1] M. Decramer, W. Janssens, M. Miravitlles, Chronic obstructive pulmonary disease, Lancet 379 (9823) (2012) 1341–1351. [2] P.J. Barnes, New anti-inflammatory targets for chronic obstructive pulmonary disease, Nature Rev. Drug Discov. 12 (7) (2013) 543–559. [3] G.G. Brusselle, G.F. Joos, K.R. Bracke, New insights into the immunology of chronic obstructive pulmonary disease, Lancet 378 (9795) (2011) 1015–1026. [4] O.J. Harrison, J. Foley, B.J. Bolognese, E. Long 3rd, P.L. Podolin, P.T. Walsh, Airway infiltration of CD4+ CCR6+ Th17 type cells associated with chronic cigarette smoke induced airspace enlargement, Immunol. Lett. 121 (1) (2008) 13–21. [5] W. MacNee, Pulmonary and systemic oxidant/antioxidant imbalance in chronic obstructive pulmonary disease, Proc. Am. Thorac. Soc. 2 (1) (2005) 50–60. [6] I. Rahman, W. MacNee, Antioxidant pharmacological therapies for COPD, Curr. Opin. Pharmacol. 12 (3) (2012) 256–265. [7] A. Saradna, D.C. Do, S. Kumar, Q.L. Fu, P. Gao, Macrophage polarization and allergic asthma, Transl. Res. 191 (2018) 1–14. [8] R. Shaykhiev, A. Krause, J. Salit, Y. Strulovici-Barel, B.G. Harvey, T.P. O'Connor, R.G. Crystal, Smoking-dependent reprogramming of alveolar macrophage polarization: implication for pathogenesis of chronic obstructive pulmonary disease, J. Immunol. 183 (4) (2009) 2867–2883. [9] X. Fu, H. Shi, Y. Qi, W. Zhang, P. Dong, M2 polarized macrophages induced by CSE promote proliferation, migration, and invasion of alveolar basal epithelial cells, Int. Immunopharmacol. 28 (1) (2015) 666–674. [10] J.S. Lee, Heterogeneity of lung mononuclear phagocytes in chronic obstructive pulmonary disease, J. Innate Immun. 4 (5–6) (2012) 489–497. [11] K. Ito, G. Caramori, S. Lim, T. Oates, K.F. Chung, P.J. Barnes, I.M. Adcock, Expression and activity of histone deacetylases in human asthmatic airways, Am. J. Respir. Crit. Care Med. 166 (3) (2002) 392–396. [12] J. Milara, A. Navarro, P. Almudéver, J. Lluch, E.J. Morcillo, J. Cortijo, Oxidative stress-induced glucocorticoid resistance is prevented by dual PDE3/PDE4 inhibition in human alveolar macrophages, Clin. Exp. Allergy 41 (4) (2011) 535–546. [13] M. Li, X. Zhong, Z. He, M. Wen, J. Li, X. Peng, G. Liu, J. Deng, J. Zhang, J. Bai, Effect of erythromycin on cigarette-induced histone deacetylase protein expression and nuclear factor-κB activity in human macrophages in vitro, Int. Immunopharmacol. 12 (4) (2012) 643–650. [14] X. Chen, I. Barozzi, A. Termanini, E. Prosperini, A. Recchiuti, J. Dalli, F. Mietton, G. Matteoli, S. Hiebert, G. Natoli, Requirement for the histone deacetylase Hdac3 for the inflammatory gene expression program in macrophages, Proc. Natl. Acad. Sci. USA 109 (42) (2012) E2865–E2874. [15] S.E. Mullican, C.A. Gaddis, T. Alenghat, M.G. Nair, P.R. Giacomin, L.J. Everett, D. Feng, D.J. Steger, J. Schug, D. Artis, M.A. Lazar, Histone deacetylase 3 is an epigenomic brake in macrophage alternative activation, Genes Dev. 25 (23) (2011) 2480–2488. [16] J. Yang, S. Yin, F. Bi, L. Liu, T. Qin, H. Wang, W. Cao, TIMAP repression by TGFbeta and HDAC3-associated Smad signaling regulates macrophage M2 phenotypic phagocytosis, J. Mol. Med. (Berl) 95 (3) (2017) 273–285. [17] J.-P. Yuan, J.-H. Wang, X. Liu, H.-C. Kuang, S.-Y. Zhao, Simultaneous determination of free ergosterol and ergosteryl esters in Cordyceps sinensis by HPLC, Food Chem.
10