- Email: [email protected]
The level of midgut penetration of two begomoviruses affects their acquisition and transmission by two species of Bemisia tabaci
Virology 515 (2018) 66–73
Contents lists available at ScienceDirect
Virology journal homepage: www.elsevier.com/locate/virology
The level of midgut penetration of two begomoviruses affects their acquisition and transmission by two species of Bemisia tabaci Tao Guo, Jing Zhao, Li-Long Pan, Liang Geng, Teng Lei, Xiao-Wei Wang, Shu-Sheng Liu
T ⁎
Ministry of Agriculture Key Laboratory of Molecular Biology of Crop Pathogens and Insects, Institute of Insect Sciences, Zhejiang University, Hangzhou, China
A R T I C L E I N F O
A B S T R A C T
Keywords: Insect vector Midgut barrier Virus coat protein Virus-vector interaction Whitefly
Begomoviruses are transmitted by whiteflies in a persistent manner, but factors responsible for the variation of virus transmission by different species are poorly understood. We examined ingestion of papaya leaf curl China virus (PaLCuCNV) and tomato yellow leaf curl virus (TYLCV) by two species of the Bemisia tabaci complex, MEAM1 and MED, and then quantified the virion concentrations in different organs/tissues in each species. We found that PaLCuCNV penetrated the midgut wall of MED less efficiently than MEAM1, resulting in lower efficiency of PalCuCNV transmission by MED than that by MEAM1, while TYLCV penetrated the midgut wall of both species and was transmitted by them at similar levels of efficiency. Virus coat protein determined the virus capacity to cross the midgut wall of a given whitefly species. These data indicate that the level of midgut penetration determines virus acquisition and transmission by whiteflies in the first instance.
1. Introduction In nature over two thirds of plant viruses are transmitted by insect vectors (Hogenhout et al., 2008). According to the pattern of virus acquisition and retention by insects, the modes of transmission have been classified into four categories: non-persistent, semi-persistent, persistent circulative and persistent propagative (Nault, 1997; Hogenhout et al., 2008). In the former two categories, also called noncirculative transmission, the interactions between vector and virus are transient, with the virus only associated with the mouthparts or foregut of the insect vector. For example, cauliflower mosaic virus is transmitted by aphids in a non-circulative manner and this strategy relies on the association of virus coat protein with specific proteins localized in insect stylets (Ng and Falk, 2006). In contrast, in the other two categories, the virus develops intimate interactions with internal organs of the vector(s), such as the transmission of rice reoviruses by leafhopper and planthopper (Wei and Li, 2016). During the circulative transmission process, viruses have to overcome at least four barriers to infection: midgut invasion barrier, midgut penetrating barrier, salivary gland invasion barrier and salivary gland penetrating barrier (Gray et al., 2014). The genus Begomovirus (Geminiviridae) are a group of singlestranded circular DNA (ssDNA) viruses transmitted in a persistent-circulative manner by whiteflies in the Bemisia tabaci species complex (Harrison and Robinson, 1999; Ran et al., 2015). Different begomoviruses may be acquired and transmitted by the same whitefly species
⁎
with different efficiencies. For example, the species Middle East Asia Minor 1 (MEAM1) is able to transmit both tomato yellow leaf curl China virus (TYLCCNV) and tobacco curly shoot virus (TbCSV), but with higher efficiency when transmitting TYLCCNV (Jiu et al., 2006a). Different species of whiteflies may acquire and transmit the same begomovirus with various levels of efficiency. For example, the species MEAM1, Mediterranean (MED) and Asia II 1 differ in transmission efficiency of TYLCCNV (Liu et al., 2010). Many virus and whitefly related factors are probably involved in these differences, but so far these factors are poorly known (Ohnishi et al., 2009; Caciagli et al., 2009; Wei et al., 2014). Knowledge of the factors involved in begomovirus transmission is not only important to our general understanding of the virus-vector relationship, but also essential to the development of new strategies and techniques for the management of these virus diseases in plants. In this study we used two B. tabaci species, MEAM1 and MED, which differ in their acquisition and transmission efficiency of PaLCuCNV but are similar for TYLCV (Jiu et al., 2006b; Wei et al., 2014; Guo et al., 2015), to investigate factors associated with this difference. We focused on the following three questions: (1) does a begomovirus vary in its capacity to penetrate the midgut walls of different species of whiteflies; (2) does the midgut wall of the same species of whitefly differ in allowing virus penetration to reach the hemolymph when faced with different begomoviruses; and (3) does the coat protein of different begomoviruses permit varying levels of penetration into the hemolymph of the same vector? The results were expected to show the relative
Corresponding author. E-mail address: [email protected] (S.-S. Liu).
https://doi.org/10.1016/j.virol.2017.12.004 Received 21 October 2017; Received in revised form 8 December 2017; Accepted 9 December 2017 0042-6822/ © 2017 Elsevier Inc. All rights reserved.
Virology 515 (2018) 66–73
T. Guo et al.
importance of the midgut wall barrier to virus movement in whitefly vectors with different combinations of begomoviruses and whiteflies.
5′-TAGTCATTTCCACTCCCGC-3′; primer 2: 5′-TGATTGTCATACTTCGC AGC-3′) were used to determine virus infection.
2. Materials and methods
2.5. Viral quantity analysis in whiteflies
2.1. Insects, viruses and plants
Quantitative PCR (qPCR) was performed on a CFX96™ Real-Time PCR Detection System (Bio-Rad, USA) with SYBR Premix ExTaq II (Takara, Japan), and the relative abundance of viral DNA was calculated using the 2−ΔΔCT method. A partial sequence of AV2 gene of PaLCuCNV and AV1 gene of TYLCV was chosen as the amplified region and the β-actin gene was selected as the internal control. Primer sequences used were as follows: for both PaLCuCNV and mPaLCuCNV, forward primer (5′-GACCCGCCGATATAGTCATT-3′) and reverse primer (5′-GTTTGTGACGAGGACAGTGG-3′); for TYLCV and mTYLCV, forward primer (5′-GAAGCGACCAGGCGATATAA-3′) and reverse primer (5′-GGAACATCAGGGCTTCGATA-3′); for β-actin, forward primer (5′TCTTCCAGCCATCCTTCTTG-3′) and reverse primer (5′-CGGTGATTTC CTTCTGCATT-3′).
Species of the B. tabaci complex were reared in insect-proof cages on cotton plants (Gossypium hirsutum L. cv. Zhemian 1793) at 26 ± 1 °C, 60% relative humidity and 14 h light/10 h darkness. Cotton plants were cultivated to 6–7 true leaves for culture maintenance and experiments. Clones of tomato yellow leaf curl virus (TYLCV) isolate SH2 (GenBank accession number: AM282874.1) and PaLCuCNV isolate HeNZM1 (FN256260) were agroinoculated into tomato plants (Solanum lycopersicom L. cv. Hezuo903). The infected tomato plants that showed typical symptoms were used for experiments approximately four weeks post inoculation. 2.2. Construction of recombinant infectious clones of coat protein (CP) mutant viruses
2.6. Quantification of PaLCuCNV in honeydew The fifth or sixth leaves (from the bottom) of PaLCuCNV infected tomato plants with obvious symptoms were put into nutrient solution for 2 d. Later, MEAM1 or MED whitefly adults 2–7 d post emergence from cotton were collected in groups of 10 (5 females and 5 males) and were fed on leaves within leaf clip cages for 24 h and 48 h, respectively. The bottom of each clip cage was lined with aluminum foil. Honeydew of whiteflies on the aluminum foil was collected with phosphate-buffer saline (PBS) and viral DNA was purified with PureLink Viral RNA/DNA Mini Kit (Invitrogen, USA). Eight replicates of each treatment were performed for analysis of PaLCuCNV in the honeydew. For the standard curve, the full-length of PaLCuCNV was amplified (Primer 1: GGATCCTTTACTAAACGAGTT; Primer 2: CACATGTTTG ACGTGACTACT), and then cloned to pGEM-T Easy Vector and transferred into Escherichia coli DH5α for amplification. The concentration of purified plasmid was detected using NanoDrop 2000, and copy number was calculated using Avogadro number and then diluted in a tenfold series (101 to 108/μL) for quantification. Number of copies of PaLCuCNV DNA in honeydew was calculated according to the known standard curve. Number of viral copies = (DNA quantity × 6.022 × 1023) ×(length × 1 × 109 × 650)−1 (Gadiou et al., 2012).
Based on the amino acid sequence alignment of TYLCV and PaLCuCNV CP, a 141 aa fragment (aa 82-222) of TYLCV CP region was exchanged with a 140 aa fragment (aa 82-221) of the PaLCuCNV CP region through overlap extension PCR (Wei et al., 2017). The two regions selected for exchange show obvious differences, but the exchange would not cause sequence changes of domains of a given virus genome other than the coat protein. The sequences of mutant PaLCuCNV (mPaLCuCNV) and mutant TYLCV (mTYLCV) were confirmed by sequencing and transformed into Agrobacterium strain EHA105. Later, all four infectious clones, i.e. PaLCuCNV, TYLCV, mPaLCuCNV and mTYLCV were agroinoculated into tomato plants as described above. 2.3. Virus acquisition by MEAM1 and MED whiteflies At 24, 48 and 96 h acquisition access periods (AAP), quantities of PaLCuCNV, TYLCV, mPaLCuCNV and mTYLCV in the whole body of MEAM1 and MED whitefly adults 2–7 d post emergence from cotton were examined. For each of the four viruses, single-sex groups of 10 adult males and 10 adult females were used in each of four replicates. To compare the sustainability of PaLCuCNV acquisition between MEAM1 and MED, whitefly adults 2–7 d post emergence from cotton were transferred to PaLCuCNV-infected tomato for 1, 3, 6, 12 and 18 d. At each time point, 10 female or male adults were collected as a group for virus quantification, and four replicates were conducted for both females and males. To investigate the acquisition ability of MEAM1 and MED that had been reared on PaLCuCNV infected tomato for multiple generations, the two whitefly species were reared on PaLCuCNV infected tomato plants for four generations and whitefly adults 2–7 d post emergence of the last generation were used for experiments. Total DNA was extracted from individual female viruliferous whiteflies for quantitative PCR analyses and each treatment contained 20 replicates.
2.7. Analysis of viral DNA in specific whitefly tissues After a 48 AAP on virus-infected plants, female whiteflies were collected for dissection. Midgut was dissected from single whiteflies in 10 μL 1×PBS, rinsed with 1×PBS several times to remove hemolymph contamination, and then collected in 30 μL lysis buffer for quantification. The hemolymph droplet was collected using a 1–10 μL capillary pipette drawn to a fine point of ~0.5 µm in diameter and mixed with 20 μL lysis buffer for quantification. After removing the midgut, the head and thorax from single whiteflies were collected in 30 μL lysis buffer and rinsed with 1×PBS several times to prevent hemolymph contamination. For each of the treatments, 20–24 biological replicates were conducted.
2.4. Transmission of PaLCuCNV by MEAM1 and MED whiteflies MEAM1 and MED whiteflies reared on PaLCuCNV infected tomato plants for four generations and adults 2–7 d post emergence of the last generation were used for experiments. Adults were collected in groups of one male and one female, and each group was used to inoculate one uninfected tomato seedling (3 or 4 true-leaf stage, 3 weeks after sowing) for 7 d in leaf clip cages. Three replicates were conducted and each replicate used 10, 20 and 20 uninfected tomato seedlings, respectively. Seven days after virus inoculation, the whiteflies were removed by spraying 50 mg/liter imidacloprid thoroughly on each of the virus inoculated tomato plants. The plants were kept in insect-proof cages for 30 d. PaLCuCNV symptoms appearance and PCR (primer 1:
2.8. Immunofluorescence detection of virus in midgut After a 48 h AAP, midguts of MEAM1 and MED female whiteflies were dissected. The dissected midguts were fixed in 4% paraformaldehyde for 1 h at room temperature, and washed in TBS (1 M TisHCL, pH=8, with 1 M NaCl) three times, then 0.1% Triton X-100 was added. Thirty minutes later specimens were washed in TBST (1 M TisHCL, pH=8, with 1 M NaCl and 0.5% Tween-20) three times, then incubated in TBST with 1% BSA (MultiSciences Biotech, China) for 2 h at room temperature or 4 °C overnight, followed by incubation with 67
Virology 515 (2018) 66–73
T. Guo et al.
Fig. 1. Relative quantity of virus acquired by MEAM1 and MED whiteflies after various acquisition access periods on virus-infected plants. (A) Relative quantity of TYLCV in MEAM1 and MED; (B) Relative quantity of PaLCuCNV in MEAM1 and MED. At each acquisition access period, 10 females (MEAM1-F, MED-F) and 10 males (MEAM1-M, MED-M) of each species were collected as a group for DNA extraction respectively. Four biological replicates were conducted (Mann-Whitney test for A; Kruskal-Wallis test for B and C. Different letters above the bars indicate significant differences at P < 0.05).
Fig. 2. Viral quantity in MEAM1 and MED whiteflies that had been fed on PaLCuCNV infected tomato plants for various numbers of days. Quantitative PCR analysis of PaLCuCNV DNA in MEAM1 and MED whiteflies (Gender designations as in Fig. 1). Different letters above the bars indicate significant differences in virus quantity between the four types of insects at a given time interval (Kruskal-Wallis test, P < 0.05 for all five time intervals).
Fig. 4. Absolute quantification of PaLCuCNV DNA in the honeydew excreted by MEAM1 or MED whiteflies that had fed on PaLCuCNV-infected tomato plants for 24 h or 48 h. Statistical analysis was done with the Mann-Whitney test. The horizontal lines depict medians of the data.
Fig. 3. Differences in PaLCuCNV acquisition between viruliferous MEAM1 and MED whiteflies that had been reared on PaLCuCNV infected tomato plants for many generations. (A) Relative quantity of PaLCuCNV in MEAM1 and MED whiteflies. (B) Transmission efficiency of MEAM1 and MED whiteflies. Data are presented as mean ± standard error. * indicates a significant difference (Mann-Whitney test, P < 0.05 for A; independent t-test, P < 0.01 for B).
68
Virology 515 (2018) 66–73
T. Guo et al.
Fig. 5. Relative quantity of PaLCuCNV and TYLCV DNA in different parts of MEAM1 and MED after 48 h AAP on virus infected tomato plants. (A-C) The relative quantity of PaLCuCNV DNA; (D-F) The relative quantity of TYLCV DNA. Each dot represents the viral DNA level in the organ of an individual whitefly. The horizontal lines depict the medians. MG, midgut; HL, hemolymph; HT, head and thorax. Statistical analysis was done with the Mann-Whitney test (P < 0.05 indicate a significant difference).
anti-TYLCV CP monoclonal antibody (1:500) at 4 °C overnight or for 2 h at room temperature and then labeled with goat anti-mouse secondary antibody Dylight 549 (1:500) (MultiSciences Biotech, China) for 2 h at room temperature. The nucleus was stained with 100 nM 4′, 6-diamidino-2-phenylindole (DAPI) (Abcam, UK) in TBST for 2 min at room temperature. The samples were viewed with a laser scanning confocal microscope (Zeiss LSM780, Germany).
MEAM1 and MED. The quantity of virus was in general significantly higher in MEAM1 than in MED, and in both species the quantity of virus was higher in females than in males (Fig. 2). Similarly, for whiteflies that had been reared on PaLCuCNV infected tomato plants for multiple generations, the quantity of virus was significantly higher in MEAM1 than in MED, and a similar difference in virus transmission between the two species of whiteflies was observed (Fig. 3).
3. Results
3.3. Quantity of PaLCuCNV in honeydew excreted by MEAM1 and MED whiteflies
3.1. Acquisition of two begomoviruses by MED and MEAM1 whiteflies After a 24 h AAP, the quantity of PaLCuCNV DNA in the honeydew of MED did not differ to that of MEAM1 (Fig. 4). However, after a 48 h AAP, the quantity of PaLCuCNV DNA in the honeydew of MED was significantly higher than that of MEAM1 (P < 0.05) (Fig. 4).
The relative concentrations of TYLCV did not differ between MEAM1 and MED. However, at each of the three AAPs, the relative concentrations of PaLCuCNV acquired by MEAM1 was significantly higher than that of MED, in both females and males (24 h, P < 0.01; 48 h, P < 0.01; 96 h, P < 0.01)(Fig. 1).
3.4. Distribution of virus in different organs between MEAM1 and M`ED whiteflies
3.2. PaLCuCNV acquisition and transmission by MEAM1 and MED whiteflies
After a 48 h AAP on PaLCuCNV-infected tomato plants, the relative quantity of PaLCuCNV in midgut, hemolymph, and head and thorax of MEAM1 was significantly higher than that of MED (midgut, P < 0.002; hemolymph, P < 0.0001; head and thorax, P < 0.0001)(Fig. 5). Similarly, the relative quantity of TYLCV in hemolymph and head and
For whiteflies that had been reared on PaLCuCNV infected tomato only for the current generation, the relative quantity of the virus generally increased with acquisition access period from 1 to 18 days in both 69
Virology 515 (2018) 66–73
T. Guo et al.
Fig. 6. Immunofluorescent localization of PaLCuCNV and TYLCV in the midgut of MEAM1 and MED. The PaLCuCNV and TYLCV virions were detected by use of a mouse anti-TYLCV monoclonal antibody and a goat anti-mouse secondary antibody conjugated to 549 (red). Nuclei were stained with DAPI (blue) and then examined with a laser scanning confocal microscope (Zeiss LSM780, Germany). The white arrow in a diagram indicates the filter chamber and gastric cecum of midgut (magnified area).
Fig. 7. Relative quantity of mPaLCuCNV and mTYLCV in MEAM1 and MED determined by qPCR. (A) Relative quantity of mPaLCuCNV in MEAM1 and MED. (B) Relative quantity of mTYLCV in MEAM1 and MED. At each acquisition access periods, 10 female and 10 male of a given species were collected for DNA extraction respectively. Four biological replicates were conducted (Gender designations as in Fig. 1). Different letters above the bars indicate significant difference (Kruskal-Wallis test, P < 0.05 indicate a significant difference).
MEAM1 and MED whiteflies. At each of the three AAPs, no significant differences were found in relative quantity of mPaLCuCNV between MEAM1 and MED, in either females or males (Fig. 7). However, the relative quantity of mTYLCV in MEAM1 females and males was higher than that in MED (24 h, P < 0.01; 48 h, P < 0.01; 96 h, P < 0.01) (Fig. 7). Based on virus quantity in individual whitefly tissues, mPaLCuCNV in midgut of MEAM1 was similar to that of MED (P > 0.05) (Fig. 8). However, the relative quantity of mPaLCuCNV in hemolymph and head and thorax of MEAM1 was higher than that of MED (hemolymph, P < 0.01; head and thorax, P < 0.0001)(Fig. 8). The relative quantity of mTYLCV in midgut, hemolymph, and head and thorax of MEAM1 was significantly higher than that of MED (midgut, P < 0.0001; hemolymph, P < 0.0001; head and thorax, P = 0.033) (Fig. 8D-F). After fragment exchange of partial coat protein between TYLCV and PaLCuCNV, the virus signals of mPaLCuCNV in the midgut
thorax was higher in MEAM1 than MED (hemolymph, P = 0.033; head and thorax, P < 0.01) (Fig. 5). However, the relative TYLCV quantity in midgut of MEAM1 was similar to that of MED (P > 0.05). Immunofluorescence indicated that, after a 48 h AAP on virus-infected plants, the virus signal of both PaLCuCNV and TYLCV could be detected in the midgut of MEAM1 and MED, with the strongest signals in the filter chamber and gastric cecum (Fig. 6). The PaLCuCNV signal in MEAM1 was stronger than that in MED, while the TYLCV signals were similar in MEAM1 and MED (Fig. 6). 3.5. Acquisition and distribution of mutant virus in MEAM1 and MED whiteflies We exchanged a fragment of PaLCuCNV CP with that of TYLCV CP and examined the acquisition of the two mutant begomoviruses by 70
Virology 515 (2018) 66–73
T. Guo et al.
Fig. 8. The relative quantity of mPaLCuCNV and mTYLCV DNA in different parts of MEAM1 and MED after 48 h AAP on virus infected tomato. (A-C) The relative quantity of mPaLCuCNV DNA; (D-F) The relative quantity of mTYLCV DNA. Each dot represents the viral DNA level in the organ of an individual whitefly. The horizontal lines depict the medians. MG, midgut; HL, hemolymph; HT, head and thorax. Statistical analysis was done with the Mann-Whitney test (P < 0.05 indicates a significant difference).
MED, compared to those in the same organs of MEAM1, appeared even lower than the difference in relative PaLCuCNV quantities in the midgut between the two species of whiteflies (Fig. 5A-C). In the case of TYLCV, the quantities of virus in both midgut and hemolymph did not differ significantly between MEAM1 and MED, only the quantity in head and thorax of MED was significantly lower than that of MEAM1 (Fig. 5D-F). Taken together, these data indicate that in the process of PaLCuCNV movement within its vector the midgut wall of MED represents a stronger barrier to cross than that of MEAM1, and this barrier appears to be associated with a lower efficiency in acquiring and transmitting the virus (Fig. 3). With TYLCV the midgut walls in both species of whiteflies show similar permeability. As coat protein (CP) is the only begomovirus structural protein and has been shown to influence viral acquisition and transmission efficiency (Harrison et al., 2002), we exchanged TYLCV CP with PaLCuCNV CP, experimentations with the CP mutant viruses supported the difference in midgut permeability hypothesis (Figs. 7–9). Midgut is an important barrier that affects the efficiency and specificity of plant virus acquisition and transmission (Ohnishi et al., 2009; Nagata et al., 2002). However, little is known about the mechanisms of how begomoviruses cross the midgut barrier. For TYLCV, clathrin mediated endocytosis has been shown to be involved in its transport across midgut to vector hemolymph (Pan et al., 2017). As clathrin
of MEAM1 and MED whiteflies were similar, while the signals of mTYLCV in the midgut of MEAM1 was stronger than that of MED (Fig. 9). 4. Discussion Variation in virus acquisition and transmission efficiency is the rule rather than exception in different tripartite combinations of whiteflies, begomoviruses and plants (Polston et al., 2014). Our previous data (Jiu et al., 2006b; Li et al., 2010; Guo et al., 2015) and the current study (Figs. 1–3) indicate that the two invasive species of whiteflies, MEAM1 and MED, acquire and transmit TYLCV at similar levels of efficiency, but MEAM1 acquires and transmits PaLCuCNV at substantially higher efficiency that MED. The higher efficiency of MEAM1 in transmitting PaLCuCNV appears to be associated with the higher quantity of the virus acquired (Figs. 2 and 3). The quantity of PaLCuCNV virions excreted by MED in its honeydew was significantly higher than that excreted by MEAM1 (Fig. 4), suggesting that the lower quantity of PaLCuCNV in the body of MED is due, at least in part, to a high excretion rate of PaLCuCNV virions. Thus the difference in the quantity of PaLCuCNV virions ingested by the two species of whiteflies may be much smaller than indicated by the data (Fig. 5A). Interestingly, the relative PaLCuCNV quantities in both the hemolymph and head and thorax of 71
Virology 515 (2018) 66–73
T. Guo et al.
Fig. 9. Immunofluorescent localization of mPaLCuCNV and mTYLCV in the midgut of MEAM1 and MED. The white arrow in a diagram indicates the location of filter chamber in the midgut and magnified in the following diagram. The mPaLCuCNV and mTYLCV virions were detected by use of a mouse anti-TYLCV monoclonal antibody and a goat anti-mouse secondary antibody conjugated to 549 (red). Nuclei were stained with DAPI (blue) and then examined with a laser scanning confocal microscope (Zeiss LSM780, Germany). The white arrow in a diagram indicates the filter chamber and gastric cecum of midgut (magnified area).
Australia) for comments on the manuscript and Professor Jian-Xiang Wu (Institute of Bio-technology, Zhejiang University, China) for providing monoclonal antibodies against TYLCV. Financial support for this study was provided by the National Natural Science Foundation of China (31390421). The authors declare no competing interests.
mediated endocytosis is triggered by the specific recognition between virus and its receptors, the involvement of endocytosis in virus transport strongly suggests the existence of virus specific receptors in the midgut. The current study suggests that the binding capacity and numbers of TYLCV receptors on the midgut wall may be similar between MEAM1 and MED, while those of PaLCuCNV receptors on the midgut wall may differ between the two species of whiteflies. In an earlier study, we showed that the disparity in transmitting tomato yellow leaf curl China virus between MEAM1 and MED was due to difference in virus binding and escape from the salivary glands, which was likely determined by the different virus receptors in the two species of whiteflies (Wei et al., 2014). These few examples seem to indicate the existence of a range of potential receptors of begomoviruses, and the same receptor(s) may have different binding capacities to different viruses. For example, the receptors of a begomovirus may differ not only between species of whiteflies but also between different organs/ tissues of the same insect; the features and types of receptors in an vector may be simple or complex, or even changeable depending on particular circumstances. Much of these similarity and differences in receptors between species of whiteflies, or between organs/tissues of the same whitefly, remains to be investigated. Cai et al. (2007) reported that PaLCuCNV caused serious virus disease in papaya orchards in Nanning, Guangxi during 2002–2004. Field sampling in Nanning of whiteflies in the B. tabaci complex showed that MEAM1 was a predominant species at that time (Qiu et al., 2003). Thus, the outbreak of PaLCuCNV diseases in Nanning was likely associated with the abundance of MEAM1. Comparative studies between various whitefly and virus species, as reported here, may provide new knowledge to help elucidate the virus acquisition and transmission specificity and efficiency in various tripartite combinations of begomovirus, whitefly and plant, and thus promote the development and implementation of well-targeted and more effective measures for the management of virus diseases and vector outbreaks.
References Caciagli, P., Medina, P.V., Marian, D., Vecchiati, M., Masenga, V., Mason, G., Falcioni, T., Noris, E., 2009. Virion stability is important for the circulative transmission of Tomato yellow leaf curl Sardinia virus by Bemisia tabaci, but virion access to salivary glands does not guarantee transmissibility. J. Virol. 83, 5784–5795. http://dx.doi. org/10.1128/JVI.02267-08. Cai, J.H., Qin, B.X., Xie, Y., Chen, Y.H., 2007. The occurrence of Papaya leaf curl China virus in Nanning and the preliminary study of its midst hosts and transmission by Bemisia tabaci. Plant Prot. 33, 57–59. http://dx.doi.org/10.3969/j.issn.0529-1542. 2007.01.016. Gadiou, S., Ripl, J., Jaňourová, B., Jarošová, J., Kundu, J.K., 2012. Real-time PCR assay for the discrimination and quantification of wheat and barley strains of Wheat dwarf virus. Virus Genes 44, 349–355. http://dx.doi.org/10.1007/s11262-012-0841-7. Gray, S., Cilia, M., Ghanim, M., 2014. Circulative, "nonpropagative" virus transmission: an orchestra of virus-, insect-, and plant-derived instruments. Adv. Virus Res. 89, 141–199. http://dx.doi.org/10.1016/B978-0-12-800172-1.00004-5. Guo, T., Guo, Q., Cui, X.Y., Liu, Y.Q., Hu, J., Liu, S.S., 2015. Comparison of transmission of Papaya leaf curl China virus among four cryptic species of the whitefly Bemisia tabaci complex. Sci. Rep. 5, 15432. http://dx.doi.org/10.1038/srep15432. Harrison, B., Robinson, D., 1999. Natural genomic and antigenic variation in whiteflytransmitted geminiviruses (begomoviruses). Annu. Rev. Phytophathol. 37, 369–398. http://dx.doi.org/10.1146/annurev.phyto.37.1.369. Harrison, B.D., Swanson, M.M., Fargette, D., 2002. Begomovirus coat protein: serology, variation and functions. Physiol. Mol. Plant Pathol. 60, 257–271. http://dx.doi.org/ 10.1006/pmpp.2002.0404. Hogenhout, S.A., Ammar, E.D., Whitfield, A.E., Redinbaugh, M.G., 2008. Insect vector interactions with persistently transmitted viruses. Annu. Rev. Phytopathol. 46, 327–359. http://dx.doi.org/10.1146/annurev.phyto.022508.092135. Jiu, M., Zhou, X.P., Liu, S.S., 2006a. Acquisition and transmission of two begomoviruses by the B and a non-B biotype of Bemisia tabaci from Zhejiang, China. J. Phytopathol. 154, 587–591. http://dx.doi.org/10.1111/j.1439-0434.2006.01151.x. Jiu, M., Zhou, X.P., Liu, S.S., 2006b. Transmission of geminiviruses by whitefly. Acta Èntomol. Sin. 49, 513–520. http://dx.doi.org/10.3321/j.issn:0454-6296.2006.03. 025. Li, M., Hu, J., Xu, F., Liu, S.S., 2010. Transmission of Tomato yellow leaf curl virus by two invasive biotypes and a Chinese indigenous biotype of the whitefly Bemisia tabaci. Int. J. Pest Manag. 56, 275–280. http://dx.doi.org/10.1080/09670871003743428. Liu, J., Li, M., Li, J.M., Huang, C.J., Zhou, X.P., Xu, F.C., Liu, S.S., 2010. Viral infection of
Acknowledgements We thank Professor Myron Zalucki (The University of Queensland, 72
Virology 515 (2018) 66–73
T. Guo et al.
Polston, J.E., De Barro, P., Boykin, L.M., 2014. Transmission specificities of plant viruses with the newly identified species of the Bemisia tabaci species complex. Pest Manag. Sci. 70, 1547–1552. http://dx.doi.org/10.1002/ps.3738. Qiu, B.L., Ren, S.X., Xiao, Y., Wen, S.Y., Mandour, N.S., 2003. Distribution and control of B biotype of Bemisia tabaci (Homoptera: Aleyrodidae) in China. Entomol. J. East. China 12, 27–31. Ran, R., Kanakala, S., Kliot, A., Pakkianathan, B.C., Farich, B.A., Santana-Magal, N., Elimelech, M., Kontsedalov, S., Lebedev, G., 2015. Persistent, circulative transmission of begomoviruses by whitefly vectors. Curr. Opin. Virol. 15, 1–8. http://dx.doi.org/ 10.1016/j.coviro.2015.06.008. Wei, J., He, Y.Z., Guo, Q., Guo, T., Liu, S.S., Wang, X.W., 2017. Vector development and vitellogenin determine the transovarial transmission of begomoviruses. Proc. Natl. Acad. Sci. USA. http://dx.doi.org/10.1073/pnas.1701720114. Wei, J., Zhao, J.J., Zhang, T., Li, F.F., Ghanim, M., Zhou, X.P., Ye, G.Y., Liu, S.S., Wang, X.W., 2014. Specific cells in the primary salivary glands of the whitefly Bemisia tabaci control retention and transmission of begomoviruses. J. Virol. 88, 13460–13468. http://dx.doi.org/10.1128/JVI.02179-14. Wei, T.Y., Li, Y., 2016. Rice reoviruses in insect vectors. Annu. Rev. Phytopathol. 54, 99–120. http://dx.doi.org/10.1146/annurev-phyto-080615-095900.
tobacco plants improves performance of Bemisia tabaci but more so for an invasive than for an indigenous biotype of the whitefly. Zhejiang Univ.- Sci. B (Biomed. Biotechnol.). 11, 30–40. http://dx.doi.org/10.1631/jzus.B0900213. Nagata, T., Inouenagata, A.K., Van, L.J., Goldbach, R., Peters, D., 2002. Factors determining vector competence and specificity for transmission of Tomato spotted wilt virus. J. Gen. Virol. 83, 663–671. http://dx.doi.org/10.1099/0022-1317-83-3-663. Nault, L.R., 1997. Arthropod transmission of plant viruses: a new synthesis. Ann. Entomol. Soc. Am. 90, 521–541. http://dx.doi.org/10.1093/aesa/90.5.521. Ng, J.C., Falk, B.W., 2006. Virus-vector interactions mediating nonpersistent and semipersistent transmission of plant viruses. Annu. Rev. Phytopathol. 44, 183–212. http://dx.doi.org/10.1146/annurev.phyto.44.070505.143325. Ohnishi, J., Kitamura, T., Terami, F., Honda, K.I., 2009. A selective barrier in the midgut epithelial cell membrane of the nonvector whitefly Trialeurodes vaporariorum to Tomato yellow leaf curl virus uptake. J. Gen. Plant Pathol. 75, 131–139. http://dx.doi. org/10.1007/s10327-009-0147-3. Pan, L.L., Chen, Q.F., Zhao, J.J., Guo, T., Wang, X.W., Hariton-Shalev, A., Czosnek, H., Liu, S.S., 2017. Clathrin-mediated endocytosis is involved in Tomato yellow leaf curl virus transport across the midgut barrier of its whitefly vector. Virology 502, 152–159. http://dx.doi.org/10.1016/j.virol.2016.12.029.
73
Contents lists available at ScienceDirect
Virology journal homepage: www.elsevier.com/locate/virology
The level of midgut penetration of two begomoviruses affects their acquisition and transmission by two species of Bemisia tabaci Tao Guo, Jing Zhao, Li-Long Pan, Liang Geng, Teng Lei, Xiao-Wei Wang, Shu-Sheng Liu
T ⁎
Ministry of Agriculture Key Laboratory of Molecular Biology of Crop Pathogens and Insects, Institute of Insect Sciences, Zhejiang University, Hangzhou, China
A R T I C L E I N F O
A B S T R A C T
Keywords: Insect vector Midgut barrier Virus coat protein Virus-vector interaction Whitefly
Begomoviruses are transmitted by whiteflies in a persistent manner, but factors responsible for the variation of virus transmission by different species are poorly understood. We examined ingestion of papaya leaf curl China virus (PaLCuCNV) and tomato yellow leaf curl virus (TYLCV) by two species of the Bemisia tabaci complex, MEAM1 and MED, and then quantified the virion concentrations in different organs/tissues in each species. We found that PaLCuCNV penetrated the midgut wall of MED less efficiently than MEAM1, resulting in lower efficiency of PalCuCNV transmission by MED than that by MEAM1, while TYLCV penetrated the midgut wall of both species and was transmitted by them at similar levels of efficiency. Virus coat protein determined the virus capacity to cross the midgut wall of a given whitefly species. These data indicate that the level of midgut penetration determines virus acquisition and transmission by whiteflies in the first instance.
1. Introduction In nature over two thirds of plant viruses are transmitted by insect vectors (Hogenhout et al., 2008). According to the pattern of virus acquisition and retention by insects, the modes of transmission have been classified into four categories: non-persistent, semi-persistent, persistent circulative and persistent propagative (Nault, 1997; Hogenhout et al., 2008). In the former two categories, also called noncirculative transmission, the interactions between vector and virus are transient, with the virus only associated with the mouthparts or foregut of the insect vector. For example, cauliflower mosaic virus is transmitted by aphids in a non-circulative manner and this strategy relies on the association of virus coat protein with specific proteins localized in insect stylets (Ng and Falk, 2006). In contrast, in the other two categories, the virus develops intimate interactions with internal organs of the vector(s), such as the transmission of rice reoviruses by leafhopper and planthopper (Wei and Li, 2016). During the circulative transmission process, viruses have to overcome at least four barriers to infection: midgut invasion barrier, midgut penetrating barrier, salivary gland invasion barrier and salivary gland penetrating barrier (Gray et al., 2014). The genus Begomovirus (Geminiviridae) are a group of singlestranded circular DNA (ssDNA) viruses transmitted in a persistent-circulative manner by whiteflies in the Bemisia tabaci species complex (Harrison and Robinson, 1999; Ran et al., 2015). Different begomoviruses may be acquired and transmitted by the same whitefly species
⁎
with different efficiencies. For example, the species Middle East Asia Minor 1 (MEAM1) is able to transmit both tomato yellow leaf curl China virus (TYLCCNV) and tobacco curly shoot virus (TbCSV), but with higher efficiency when transmitting TYLCCNV (Jiu et al., 2006a). Different species of whiteflies may acquire and transmit the same begomovirus with various levels of efficiency. For example, the species MEAM1, Mediterranean (MED) and Asia II 1 differ in transmission efficiency of TYLCCNV (Liu et al., 2010). Many virus and whitefly related factors are probably involved in these differences, but so far these factors are poorly known (Ohnishi et al., 2009; Caciagli et al., 2009; Wei et al., 2014). Knowledge of the factors involved in begomovirus transmission is not only important to our general understanding of the virus-vector relationship, but also essential to the development of new strategies and techniques for the management of these virus diseases in plants. In this study we used two B. tabaci species, MEAM1 and MED, which differ in their acquisition and transmission efficiency of PaLCuCNV but are similar for TYLCV (Jiu et al., 2006b; Wei et al., 2014; Guo et al., 2015), to investigate factors associated with this difference. We focused on the following three questions: (1) does a begomovirus vary in its capacity to penetrate the midgut walls of different species of whiteflies; (2) does the midgut wall of the same species of whitefly differ in allowing virus penetration to reach the hemolymph when faced with different begomoviruses; and (3) does the coat protein of different begomoviruses permit varying levels of penetration into the hemolymph of the same vector? The results were expected to show the relative
Corresponding author. E-mail address: [email protected] (S.-S. Liu).
https://doi.org/10.1016/j.virol.2017.12.004 Received 21 October 2017; Received in revised form 8 December 2017; Accepted 9 December 2017 0042-6822/ © 2017 Elsevier Inc. All rights reserved.
Virology 515 (2018) 66–73
T. Guo et al.
importance of the midgut wall barrier to virus movement in whitefly vectors with different combinations of begomoviruses and whiteflies.
5′-TAGTCATTTCCACTCCCGC-3′; primer 2: 5′-TGATTGTCATACTTCGC AGC-3′) were used to determine virus infection.
2. Materials and methods
2.5. Viral quantity analysis in whiteflies
2.1. Insects, viruses and plants
Quantitative PCR (qPCR) was performed on a CFX96™ Real-Time PCR Detection System (Bio-Rad, USA) with SYBR Premix ExTaq II (Takara, Japan), and the relative abundance of viral DNA was calculated using the 2−ΔΔCT method. A partial sequence of AV2 gene of PaLCuCNV and AV1 gene of TYLCV was chosen as the amplified region and the β-actin gene was selected as the internal control. Primer sequences used were as follows: for both PaLCuCNV and mPaLCuCNV, forward primer (5′-GACCCGCCGATATAGTCATT-3′) and reverse primer (5′-GTTTGTGACGAGGACAGTGG-3′); for TYLCV and mTYLCV, forward primer (5′-GAAGCGACCAGGCGATATAA-3′) and reverse primer (5′-GGAACATCAGGGCTTCGATA-3′); for β-actin, forward primer (5′TCTTCCAGCCATCCTTCTTG-3′) and reverse primer (5′-CGGTGATTTC CTTCTGCATT-3′).
Species of the B. tabaci complex were reared in insect-proof cages on cotton plants (Gossypium hirsutum L. cv. Zhemian 1793) at 26 ± 1 °C, 60% relative humidity and 14 h light/10 h darkness. Cotton plants were cultivated to 6–7 true leaves for culture maintenance and experiments. Clones of tomato yellow leaf curl virus (TYLCV) isolate SH2 (GenBank accession number: AM282874.1) and PaLCuCNV isolate HeNZM1 (FN256260) were agroinoculated into tomato plants (Solanum lycopersicom L. cv. Hezuo903). The infected tomato plants that showed typical symptoms were used for experiments approximately four weeks post inoculation. 2.2. Construction of recombinant infectious clones of coat protein (CP) mutant viruses
2.6. Quantification of PaLCuCNV in honeydew The fifth or sixth leaves (from the bottom) of PaLCuCNV infected tomato plants with obvious symptoms were put into nutrient solution for 2 d. Later, MEAM1 or MED whitefly adults 2–7 d post emergence from cotton were collected in groups of 10 (5 females and 5 males) and were fed on leaves within leaf clip cages for 24 h and 48 h, respectively. The bottom of each clip cage was lined with aluminum foil. Honeydew of whiteflies on the aluminum foil was collected with phosphate-buffer saline (PBS) and viral DNA was purified with PureLink Viral RNA/DNA Mini Kit (Invitrogen, USA). Eight replicates of each treatment were performed for analysis of PaLCuCNV in the honeydew. For the standard curve, the full-length of PaLCuCNV was amplified (Primer 1: GGATCCTTTACTAAACGAGTT; Primer 2: CACATGTTTG ACGTGACTACT), and then cloned to pGEM-T Easy Vector and transferred into Escherichia coli DH5α for amplification. The concentration of purified plasmid was detected using NanoDrop 2000, and copy number was calculated using Avogadro number and then diluted in a tenfold series (101 to 108/μL) for quantification. Number of copies of PaLCuCNV DNA in honeydew was calculated according to the known standard curve. Number of viral copies = (DNA quantity × 6.022 × 1023) ×(length × 1 × 109 × 650)−1 (Gadiou et al., 2012).
Based on the amino acid sequence alignment of TYLCV and PaLCuCNV CP, a 141 aa fragment (aa 82-222) of TYLCV CP region was exchanged with a 140 aa fragment (aa 82-221) of the PaLCuCNV CP region through overlap extension PCR (Wei et al., 2017). The two regions selected for exchange show obvious differences, but the exchange would not cause sequence changes of domains of a given virus genome other than the coat protein. The sequences of mutant PaLCuCNV (mPaLCuCNV) and mutant TYLCV (mTYLCV) were confirmed by sequencing and transformed into Agrobacterium strain EHA105. Later, all four infectious clones, i.e. PaLCuCNV, TYLCV, mPaLCuCNV and mTYLCV were agroinoculated into tomato plants as described above. 2.3. Virus acquisition by MEAM1 and MED whiteflies At 24, 48 and 96 h acquisition access periods (AAP), quantities of PaLCuCNV, TYLCV, mPaLCuCNV and mTYLCV in the whole body of MEAM1 and MED whitefly adults 2–7 d post emergence from cotton were examined. For each of the four viruses, single-sex groups of 10 adult males and 10 adult females were used in each of four replicates. To compare the sustainability of PaLCuCNV acquisition between MEAM1 and MED, whitefly adults 2–7 d post emergence from cotton were transferred to PaLCuCNV-infected tomato for 1, 3, 6, 12 and 18 d. At each time point, 10 female or male adults were collected as a group for virus quantification, and four replicates were conducted for both females and males. To investigate the acquisition ability of MEAM1 and MED that had been reared on PaLCuCNV infected tomato for multiple generations, the two whitefly species were reared on PaLCuCNV infected tomato plants for four generations and whitefly adults 2–7 d post emergence of the last generation were used for experiments. Total DNA was extracted from individual female viruliferous whiteflies for quantitative PCR analyses and each treatment contained 20 replicates.
2.7. Analysis of viral DNA in specific whitefly tissues After a 48 AAP on virus-infected plants, female whiteflies were collected for dissection. Midgut was dissected from single whiteflies in 10 μL 1×PBS, rinsed with 1×PBS several times to remove hemolymph contamination, and then collected in 30 μL lysis buffer for quantification. The hemolymph droplet was collected using a 1–10 μL capillary pipette drawn to a fine point of ~0.5 µm in diameter and mixed with 20 μL lysis buffer for quantification. After removing the midgut, the head and thorax from single whiteflies were collected in 30 μL lysis buffer and rinsed with 1×PBS several times to prevent hemolymph contamination. For each of the treatments, 20–24 biological replicates were conducted.
2.4. Transmission of PaLCuCNV by MEAM1 and MED whiteflies MEAM1 and MED whiteflies reared on PaLCuCNV infected tomato plants for four generations and adults 2–7 d post emergence of the last generation were used for experiments. Adults were collected in groups of one male and one female, and each group was used to inoculate one uninfected tomato seedling (3 or 4 true-leaf stage, 3 weeks after sowing) for 7 d in leaf clip cages. Three replicates were conducted and each replicate used 10, 20 and 20 uninfected tomato seedlings, respectively. Seven days after virus inoculation, the whiteflies were removed by spraying 50 mg/liter imidacloprid thoroughly on each of the virus inoculated tomato plants. The plants were kept in insect-proof cages for 30 d. PaLCuCNV symptoms appearance and PCR (primer 1:
2.8. Immunofluorescence detection of virus in midgut After a 48 h AAP, midguts of MEAM1 and MED female whiteflies were dissected. The dissected midguts were fixed in 4% paraformaldehyde for 1 h at room temperature, and washed in TBS (1 M TisHCL, pH=8, with 1 M NaCl) three times, then 0.1% Triton X-100 was added. Thirty minutes later specimens were washed in TBST (1 M TisHCL, pH=8, with 1 M NaCl and 0.5% Tween-20) three times, then incubated in TBST with 1% BSA (MultiSciences Biotech, China) for 2 h at room temperature or 4 °C overnight, followed by incubation with 67
Virology 515 (2018) 66–73
T. Guo et al.
Fig. 1. Relative quantity of virus acquired by MEAM1 and MED whiteflies after various acquisition access periods on virus-infected plants. (A) Relative quantity of TYLCV in MEAM1 and MED; (B) Relative quantity of PaLCuCNV in MEAM1 and MED. At each acquisition access period, 10 females (MEAM1-F, MED-F) and 10 males (MEAM1-M, MED-M) of each species were collected as a group for DNA extraction respectively. Four biological replicates were conducted (Mann-Whitney test for A; Kruskal-Wallis test for B and C. Different letters above the bars indicate significant differences at P < 0.05).
Fig. 2. Viral quantity in MEAM1 and MED whiteflies that had been fed on PaLCuCNV infected tomato plants for various numbers of days. Quantitative PCR analysis of PaLCuCNV DNA in MEAM1 and MED whiteflies (Gender designations as in Fig. 1). Different letters above the bars indicate significant differences in virus quantity between the four types of insects at a given time interval (Kruskal-Wallis test, P < 0.05 for all five time intervals).
Fig. 4. Absolute quantification of PaLCuCNV DNA in the honeydew excreted by MEAM1 or MED whiteflies that had fed on PaLCuCNV-infected tomato plants for 24 h or 48 h. Statistical analysis was done with the Mann-Whitney test. The horizontal lines depict medians of the data.
Fig. 3. Differences in PaLCuCNV acquisition between viruliferous MEAM1 and MED whiteflies that had been reared on PaLCuCNV infected tomato plants for many generations. (A) Relative quantity of PaLCuCNV in MEAM1 and MED whiteflies. (B) Transmission efficiency of MEAM1 and MED whiteflies. Data are presented as mean ± standard error. * indicates a significant difference (Mann-Whitney test, P < 0.05 for A; independent t-test, P < 0.01 for B).
68
Virology 515 (2018) 66–73
T. Guo et al.
Fig. 5. Relative quantity of PaLCuCNV and TYLCV DNA in different parts of MEAM1 and MED after 48 h AAP on virus infected tomato plants. (A-C) The relative quantity of PaLCuCNV DNA; (D-F) The relative quantity of TYLCV DNA. Each dot represents the viral DNA level in the organ of an individual whitefly. The horizontal lines depict the medians. MG, midgut; HL, hemolymph; HT, head and thorax. Statistical analysis was done with the Mann-Whitney test (P < 0.05 indicate a significant difference).
anti-TYLCV CP monoclonal antibody (1:500) at 4 °C overnight or for 2 h at room temperature and then labeled with goat anti-mouse secondary antibody Dylight 549 (1:500) (MultiSciences Biotech, China) for 2 h at room temperature. The nucleus was stained with 100 nM 4′, 6-diamidino-2-phenylindole (DAPI) (Abcam, UK) in TBST for 2 min at room temperature. The samples were viewed with a laser scanning confocal microscope (Zeiss LSM780, Germany).
MEAM1 and MED. The quantity of virus was in general significantly higher in MEAM1 than in MED, and in both species the quantity of virus was higher in females than in males (Fig. 2). Similarly, for whiteflies that had been reared on PaLCuCNV infected tomato plants for multiple generations, the quantity of virus was significantly higher in MEAM1 than in MED, and a similar difference in virus transmission between the two species of whiteflies was observed (Fig. 3).
3. Results
3.3. Quantity of PaLCuCNV in honeydew excreted by MEAM1 and MED whiteflies
3.1. Acquisition of two begomoviruses by MED and MEAM1 whiteflies After a 24 h AAP, the quantity of PaLCuCNV DNA in the honeydew of MED did not differ to that of MEAM1 (Fig. 4). However, after a 48 h AAP, the quantity of PaLCuCNV DNA in the honeydew of MED was significantly higher than that of MEAM1 (P < 0.05) (Fig. 4).
The relative concentrations of TYLCV did not differ between MEAM1 and MED. However, at each of the three AAPs, the relative concentrations of PaLCuCNV acquired by MEAM1 was significantly higher than that of MED, in both females and males (24 h, P < 0.01; 48 h, P < 0.01; 96 h, P < 0.01)(Fig. 1).
3.4. Distribution of virus in different organs between MEAM1 and M`ED whiteflies
3.2. PaLCuCNV acquisition and transmission by MEAM1 and MED whiteflies
After a 48 h AAP on PaLCuCNV-infected tomato plants, the relative quantity of PaLCuCNV in midgut, hemolymph, and head and thorax of MEAM1 was significantly higher than that of MED (midgut, P < 0.002; hemolymph, P < 0.0001; head and thorax, P < 0.0001)(Fig. 5). Similarly, the relative quantity of TYLCV in hemolymph and head and
For whiteflies that had been reared on PaLCuCNV infected tomato only for the current generation, the relative quantity of the virus generally increased with acquisition access period from 1 to 18 days in both 69
Virology 515 (2018) 66–73
T. Guo et al.
Fig. 6. Immunofluorescent localization of PaLCuCNV and TYLCV in the midgut of MEAM1 and MED. The PaLCuCNV and TYLCV virions were detected by use of a mouse anti-TYLCV monoclonal antibody and a goat anti-mouse secondary antibody conjugated to 549 (red). Nuclei were stained with DAPI (blue) and then examined with a laser scanning confocal microscope (Zeiss LSM780, Germany). The white arrow in a diagram indicates the filter chamber and gastric cecum of midgut (magnified area).
Fig. 7. Relative quantity of mPaLCuCNV and mTYLCV in MEAM1 and MED determined by qPCR. (A) Relative quantity of mPaLCuCNV in MEAM1 and MED. (B) Relative quantity of mTYLCV in MEAM1 and MED. At each acquisition access periods, 10 female and 10 male of a given species were collected for DNA extraction respectively. Four biological replicates were conducted (Gender designations as in Fig. 1). Different letters above the bars indicate significant difference (Kruskal-Wallis test, P < 0.05 indicate a significant difference).
MEAM1 and MED whiteflies. At each of the three AAPs, no significant differences were found in relative quantity of mPaLCuCNV between MEAM1 and MED, in either females or males (Fig. 7). However, the relative quantity of mTYLCV in MEAM1 females and males was higher than that in MED (24 h, P < 0.01; 48 h, P < 0.01; 96 h, P < 0.01) (Fig. 7). Based on virus quantity in individual whitefly tissues, mPaLCuCNV in midgut of MEAM1 was similar to that of MED (P > 0.05) (Fig. 8). However, the relative quantity of mPaLCuCNV in hemolymph and head and thorax of MEAM1 was higher than that of MED (hemolymph, P < 0.01; head and thorax, P < 0.0001)(Fig. 8). The relative quantity of mTYLCV in midgut, hemolymph, and head and thorax of MEAM1 was significantly higher than that of MED (midgut, P < 0.0001; hemolymph, P < 0.0001; head and thorax, P = 0.033) (Fig. 8D-F). After fragment exchange of partial coat protein between TYLCV and PaLCuCNV, the virus signals of mPaLCuCNV in the midgut
thorax was higher in MEAM1 than MED (hemolymph, P = 0.033; head and thorax, P < 0.01) (Fig. 5). However, the relative TYLCV quantity in midgut of MEAM1 was similar to that of MED (P > 0.05). Immunofluorescence indicated that, after a 48 h AAP on virus-infected plants, the virus signal of both PaLCuCNV and TYLCV could be detected in the midgut of MEAM1 and MED, with the strongest signals in the filter chamber and gastric cecum (Fig. 6). The PaLCuCNV signal in MEAM1 was stronger than that in MED, while the TYLCV signals were similar in MEAM1 and MED (Fig. 6). 3.5. Acquisition and distribution of mutant virus in MEAM1 and MED whiteflies We exchanged a fragment of PaLCuCNV CP with that of TYLCV CP and examined the acquisition of the two mutant begomoviruses by 70
Virology 515 (2018) 66–73
T. Guo et al.
Fig. 8. The relative quantity of mPaLCuCNV and mTYLCV DNA in different parts of MEAM1 and MED after 48 h AAP on virus infected tomato. (A-C) The relative quantity of mPaLCuCNV DNA; (D-F) The relative quantity of mTYLCV DNA. Each dot represents the viral DNA level in the organ of an individual whitefly. The horizontal lines depict the medians. MG, midgut; HL, hemolymph; HT, head and thorax. Statistical analysis was done with the Mann-Whitney test (P < 0.05 indicates a significant difference).
MED, compared to those in the same organs of MEAM1, appeared even lower than the difference in relative PaLCuCNV quantities in the midgut between the two species of whiteflies (Fig. 5A-C). In the case of TYLCV, the quantities of virus in both midgut and hemolymph did not differ significantly between MEAM1 and MED, only the quantity in head and thorax of MED was significantly lower than that of MEAM1 (Fig. 5D-F). Taken together, these data indicate that in the process of PaLCuCNV movement within its vector the midgut wall of MED represents a stronger barrier to cross than that of MEAM1, and this barrier appears to be associated with a lower efficiency in acquiring and transmitting the virus (Fig. 3). With TYLCV the midgut walls in both species of whiteflies show similar permeability. As coat protein (CP) is the only begomovirus structural protein and has been shown to influence viral acquisition and transmission efficiency (Harrison et al., 2002), we exchanged TYLCV CP with PaLCuCNV CP, experimentations with the CP mutant viruses supported the difference in midgut permeability hypothesis (Figs. 7–9). Midgut is an important barrier that affects the efficiency and specificity of plant virus acquisition and transmission (Ohnishi et al., 2009; Nagata et al., 2002). However, little is known about the mechanisms of how begomoviruses cross the midgut barrier. For TYLCV, clathrin mediated endocytosis has been shown to be involved in its transport across midgut to vector hemolymph (Pan et al., 2017). As clathrin
of MEAM1 and MED whiteflies were similar, while the signals of mTYLCV in the midgut of MEAM1 was stronger than that of MED (Fig. 9). 4. Discussion Variation in virus acquisition and transmission efficiency is the rule rather than exception in different tripartite combinations of whiteflies, begomoviruses and plants (Polston et al., 2014). Our previous data (Jiu et al., 2006b; Li et al., 2010; Guo et al., 2015) and the current study (Figs. 1–3) indicate that the two invasive species of whiteflies, MEAM1 and MED, acquire and transmit TYLCV at similar levels of efficiency, but MEAM1 acquires and transmits PaLCuCNV at substantially higher efficiency that MED. The higher efficiency of MEAM1 in transmitting PaLCuCNV appears to be associated with the higher quantity of the virus acquired (Figs. 2 and 3). The quantity of PaLCuCNV virions excreted by MED in its honeydew was significantly higher than that excreted by MEAM1 (Fig. 4), suggesting that the lower quantity of PaLCuCNV in the body of MED is due, at least in part, to a high excretion rate of PaLCuCNV virions. Thus the difference in the quantity of PaLCuCNV virions ingested by the two species of whiteflies may be much smaller than indicated by the data (Fig. 5A). Interestingly, the relative PaLCuCNV quantities in both the hemolymph and head and thorax of 71
Virology 515 (2018) 66–73
T. Guo et al.
Fig. 9. Immunofluorescent localization of mPaLCuCNV and mTYLCV in the midgut of MEAM1 and MED. The white arrow in a diagram indicates the location of filter chamber in the midgut and magnified in the following diagram. The mPaLCuCNV and mTYLCV virions were detected by use of a mouse anti-TYLCV monoclonal antibody and a goat anti-mouse secondary antibody conjugated to 549 (red). Nuclei were stained with DAPI (blue) and then examined with a laser scanning confocal microscope (Zeiss LSM780, Germany). The white arrow in a diagram indicates the filter chamber and gastric cecum of midgut (magnified area).
Australia) for comments on the manuscript and Professor Jian-Xiang Wu (Institute of Bio-technology, Zhejiang University, China) for providing monoclonal antibodies against TYLCV. Financial support for this study was provided by the National Natural Science Foundation of China (31390421). The authors declare no competing interests.
mediated endocytosis is triggered by the specific recognition between virus and its receptors, the involvement of endocytosis in virus transport strongly suggests the existence of virus specific receptors in the midgut. The current study suggests that the binding capacity and numbers of TYLCV receptors on the midgut wall may be similar between MEAM1 and MED, while those of PaLCuCNV receptors on the midgut wall may differ between the two species of whiteflies. In an earlier study, we showed that the disparity in transmitting tomato yellow leaf curl China virus between MEAM1 and MED was due to difference in virus binding and escape from the salivary glands, which was likely determined by the different virus receptors in the two species of whiteflies (Wei et al., 2014). These few examples seem to indicate the existence of a range of potential receptors of begomoviruses, and the same receptor(s) may have different binding capacities to different viruses. For example, the receptors of a begomovirus may differ not only between species of whiteflies but also between different organs/ tissues of the same insect; the features and types of receptors in an vector may be simple or complex, or even changeable depending on particular circumstances. Much of these similarity and differences in receptors between species of whiteflies, or between organs/tissues of the same whitefly, remains to be investigated. Cai et al. (2007) reported that PaLCuCNV caused serious virus disease in papaya orchards in Nanning, Guangxi during 2002–2004. Field sampling in Nanning of whiteflies in the B. tabaci complex showed that MEAM1 was a predominant species at that time (Qiu et al., 2003). Thus, the outbreak of PaLCuCNV diseases in Nanning was likely associated with the abundance of MEAM1. Comparative studies between various whitefly and virus species, as reported here, may provide new knowledge to help elucidate the virus acquisition and transmission specificity and efficiency in various tripartite combinations of begomovirus, whitefly and plant, and thus promote the development and implementation of well-targeted and more effective measures for the management of virus diseases and vector outbreaks.
References Caciagli, P., Medina, P.V., Marian, D., Vecchiati, M., Masenga, V., Mason, G., Falcioni, T., Noris, E., 2009. Virion stability is important for the circulative transmission of Tomato yellow leaf curl Sardinia virus by Bemisia tabaci, but virion access to salivary glands does not guarantee transmissibility. J. Virol. 83, 5784–5795. http://dx.doi. org/10.1128/JVI.02267-08. Cai, J.H., Qin, B.X., Xie, Y., Chen, Y.H., 2007. The occurrence of Papaya leaf curl China virus in Nanning and the preliminary study of its midst hosts and transmission by Bemisia tabaci. Plant Prot. 33, 57–59. http://dx.doi.org/10.3969/j.issn.0529-1542. 2007.01.016. Gadiou, S., Ripl, J., Jaňourová, B., Jarošová, J., Kundu, J.K., 2012. Real-time PCR assay for the discrimination and quantification of wheat and barley strains of Wheat dwarf virus. Virus Genes 44, 349–355. http://dx.doi.org/10.1007/s11262-012-0841-7. Gray, S., Cilia, M., Ghanim, M., 2014. Circulative, "nonpropagative" virus transmission: an orchestra of virus-, insect-, and plant-derived instruments. Adv. Virus Res. 89, 141–199. http://dx.doi.org/10.1016/B978-0-12-800172-1.00004-5. Guo, T., Guo, Q., Cui, X.Y., Liu, Y.Q., Hu, J., Liu, S.S., 2015. Comparison of transmission of Papaya leaf curl China virus among four cryptic species of the whitefly Bemisia tabaci complex. Sci. Rep. 5, 15432. http://dx.doi.org/10.1038/srep15432. Harrison, B., Robinson, D., 1999. Natural genomic and antigenic variation in whiteflytransmitted geminiviruses (begomoviruses). Annu. Rev. Phytophathol. 37, 369–398. http://dx.doi.org/10.1146/annurev.phyto.37.1.369. Harrison, B.D., Swanson, M.M., Fargette, D., 2002. Begomovirus coat protein: serology, variation and functions. Physiol. Mol. Plant Pathol. 60, 257–271. http://dx.doi.org/ 10.1006/pmpp.2002.0404. Hogenhout, S.A., Ammar, E.D., Whitfield, A.E., Redinbaugh, M.G., 2008. Insect vector interactions with persistently transmitted viruses. Annu. Rev. Phytopathol. 46, 327–359. http://dx.doi.org/10.1146/annurev.phyto.022508.092135. Jiu, M., Zhou, X.P., Liu, S.S., 2006a. Acquisition and transmission of two begomoviruses by the B and a non-B biotype of Bemisia tabaci from Zhejiang, China. J. Phytopathol. 154, 587–591. http://dx.doi.org/10.1111/j.1439-0434.2006.01151.x. Jiu, M., Zhou, X.P., Liu, S.S., 2006b. Transmission of geminiviruses by whitefly. Acta Èntomol. Sin. 49, 513–520. http://dx.doi.org/10.3321/j.issn:0454-6296.2006.03. 025. Li, M., Hu, J., Xu, F., Liu, S.S., 2010. Transmission of Tomato yellow leaf curl virus by two invasive biotypes and a Chinese indigenous biotype of the whitefly Bemisia tabaci. Int. J. Pest Manag. 56, 275–280. http://dx.doi.org/10.1080/09670871003743428. Liu, J., Li, M., Li, J.M., Huang, C.J., Zhou, X.P., Xu, F.C., Liu, S.S., 2010. Viral infection of
Acknowledgements We thank Professor Myron Zalucki (The University of Queensland, 72
Virology 515 (2018) 66–73
T. Guo et al.
Polston, J.E., De Barro, P., Boykin, L.M., 2014. Transmission specificities of plant viruses with the newly identified species of the Bemisia tabaci species complex. Pest Manag. Sci. 70, 1547–1552. http://dx.doi.org/10.1002/ps.3738. Qiu, B.L., Ren, S.X., Xiao, Y., Wen, S.Y., Mandour, N.S., 2003. Distribution and control of B biotype of Bemisia tabaci (Homoptera: Aleyrodidae) in China. Entomol. J. East. China 12, 27–31. Ran, R., Kanakala, S., Kliot, A., Pakkianathan, B.C., Farich, B.A., Santana-Magal, N., Elimelech, M., Kontsedalov, S., Lebedev, G., 2015. Persistent, circulative transmission of begomoviruses by whitefly vectors. Curr. Opin. Virol. 15, 1–8. http://dx.doi.org/ 10.1016/j.coviro.2015.06.008. Wei, J., He, Y.Z., Guo, Q., Guo, T., Liu, S.S., Wang, X.W., 2017. Vector development and vitellogenin determine the transovarial transmission of begomoviruses. Proc. Natl. Acad. Sci. USA. http://dx.doi.org/10.1073/pnas.1701720114. Wei, J., Zhao, J.J., Zhang, T., Li, F.F., Ghanim, M., Zhou, X.P., Ye, G.Y., Liu, S.S., Wang, X.W., 2014. Specific cells in the primary salivary glands of the whitefly Bemisia tabaci control retention and transmission of begomoviruses. J. Virol. 88, 13460–13468. http://dx.doi.org/10.1128/JVI.02179-14. Wei, T.Y., Li, Y., 2016. Rice reoviruses in insect vectors. Annu. Rev. Phytopathol. 54, 99–120. http://dx.doi.org/10.1146/annurev-phyto-080615-095900.
tobacco plants improves performance of Bemisia tabaci but more so for an invasive than for an indigenous biotype of the whitefly. Zhejiang Univ.- Sci. B (Biomed. Biotechnol.). 11, 30–40. http://dx.doi.org/10.1631/jzus.B0900213. Nagata, T., Inouenagata, A.K., Van, L.J., Goldbach, R., Peters, D., 2002. Factors determining vector competence and specificity for transmission of Tomato spotted wilt virus. J. Gen. Virol. 83, 663–671. http://dx.doi.org/10.1099/0022-1317-83-3-663. Nault, L.R., 1997. Arthropod transmission of plant viruses: a new synthesis. Ann. Entomol. Soc. Am. 90, 521–541. http://dx.doi.org/10.1093/aesa/90.5.521. Ng, J.C., Falk, B.W., 2006. Virus-vector interactions mediating nonpersistent and semipersistent transmission of plant viruses. Annu. Rev. Phytopathol. 44, 183–212. http://dx.doi.org/10.1146/annurev.phyto.44.070505.143325. Ohnishi, J., Kitamura, T., Terami, F., Honda, K.I., 2009. A selective barrier in the midgut epithelial cell membrane of the nonvector whitefly Trialeurodes vaporariorum to Tomato yellow leaf curl virus uptake. J. Gen. Plant Pathol. 75, 131–139. http://dx.doi. org/10.1007/s10327-009-0147-3. Pan, L.L., Chen, Q.F., Zhao, J.J., Guo, T., Wang, X.W., Hariton-Shalev, A., Czosnek, H., Liu, S.S., 2017. Clathrin-mediated endocytosis is involved in Tomato yellow leaf curl virus transport across the midgut barrier of its whitefly vector. Virology 502, 152–159. http://dx.doi.org/10.1016/j.virol.2016.12.029.
73