The lipid lowering drug lovastatin protects against doxorubicin-induced hepatotoxicity

Toxicology and Applied Pharmacology 261 (2012) 66–73

Contents lists available at SciVerse ScienceDirect

Toxicology and Applied Pharmacology journal homepage: www.elsevier.com/locate/ytaap

The lipid lowering drug lovastatin protects against doxorubicin-induced hepatotoxicity Christian Henninger a, e, 1, Johannes Huelsenbeck a, 1, Stefanie Huelsenbeck a, Sabine Grösch d, Arno Schad b, Karl J. Lackner c, Bernd Kaina a, Gerhard Fritz a, e,⁎ a

Institute of Toxicology, University Medical Center of the Johannes Gutenberg University Mainz, Obere Zahlbacher Str. 67, D-55131 Mainz, Germany Institute of Pathology, University Medical Center of the Johannes Gutenberg University Mainz, Obere Zahlbacher Str. 67, D-55131 Mainz, Germany Institute of Clinical Chemistry and Laboratory Medicine, University Medical Center of the Johannes Gutenberg University Mainz, Obere Zahlbacher Str. 67, D-55131 Mainz, Germany d Institute of Clinical Pharmacology, Johann Wolfgang Goethe University Frankfurt, Theodor Stern Kai 7, D-60590 Frankfurt/Main, Germany e Institute of Toxicology, University Duesseldorf, Medical Faculty, Universitätsstrasse 1, D-40225 Duesseldorf, Germany b c

a r t i c l e

i n f o

Article history: Received 30 November 2011 Revised 16 March 2012 Accepted 19 March 2012 Available online 27 March 2012 Keywords: Anthracyclines DNA damage Heptotoxicity HMG-CoA reductase inhibitors

a b s t r a c t Liver is the main detoxifying organ and therefore the target of high concentrations of genotoxic compounds, such as environmental carcinogens and anticancer drugs. Here, we investigated the usefulness of lovastatin, which is nowadays widely used for lipid lowering purpose, as a hepatoprotective drug following the administration of the anthracycline derivative doxorubicin in vivo. To this end, BALB/c mice were exposed to either a single high dose or three consecutive low doses of doxorubicin. Acute and subacute hepatotoxicities were analyzed with or without lovastatin co-treatment. Lovastatin protected the liver against doxorubicin-induced acute pro-inflammatory and pro-fibrotic stress responses as indicated by an attenuated mRNA expression of tumor necrosis factor alpha (TNFα) and connective tissue growth factor (CTGF), respectively. Hepatoprotection by lovastatin was due to a reduced induction of DNA damage following doxorubicin treatment. The statin also mitigated subacute anthracycline-provoked hepatotoxicity as shown on the level of doxorubicin- and epirubicin-stimulated CTGF mRNA expression as well as histopathologically detectable fibrosis and serum concentration of marker enzymes of hepatotoxicity (GPT/GLDH). Kidney damage following doxorubicin exposure was not detectable under our experimental conditions. Moreover, lovastatin showed multiple inhibitory effects on doxorubicin-triggered hepatic expression of genes involved in oxidative stress response, drug transport, DNA repair, cell cycle progression and cell death. Doxorubicin also stimulated the formation of ceramides. Ceramide production, however, was not blocked by lovastatin, indicating that hepatoprotection by lovastatin is independent of the sphingolipid metabolism. Overall, the data show that lovastatin is hepatoprotective following genotoxic stress induced by anthracyclines. Based on the data, we hypothesize that statins might be suitable to lower hepatic injury following anthracycline-based anticancer therapy. © 2012 Elsevier Inc. All rights reserved.

Introduction The liver is the main detoxifying organ and therefore often exposed to high concentrations of exogeneously encountered toxicants such as environmental carcinogens, resulting in hepatotoxicity.

Abbreviations: C, ceramide; CTGF, connective tissue growth factor; Doxo, doxorubicin; DHC, dihydro-ceramide; DHSph, dihydro-sphingosine; DSB, DNA double-strand break; GPT, glutamate pyruvate transaminase (= ALT); GLDH, glutamate dehydrogenase; gpx1, glutathione peroxidase 1; ho-1, heme oxygenase 1; γH2AX, Ser139 phosphorylated histone H2AX; keap1, kelch-like ECH-associated protein 1; mdr, multidrug resistance; mrp, multidrug resistance-related protein; nrf2, nuclear factorlike 2; Sph, sphingosine; Rho, Ras-homologous; TGFβ, transforming growth factor beta; TNFα, tumor necrosis factor alpha; topo, topoisomerase. ⁎ Corresponding author at: Institute of Toxicology, Heinrich Heine University Duesseldorf, Universitätsstrasse 1, D-40225 Duesseldorf, Germany. Fax: + 49 211 81 13013. E-mail address: [email protected] (G. Fritz). 1 Equal contribution. 0041-008X/$ – see front matter © 2012 Elsevier Inc. All rights reserved. doi:10.1016/j.taap.2012.03.012

Hepatic damage is also a relevant adverse effect of many anticancer drugs, which is of particular relevance under situation of preexisting liver dysfunction (King and Perry, 2001). Apart from hepatic damage (El-Sayyad et al., 2009; Kalender et al., 2005; Kimura et al., 2000) irreversible cardiotoxicity (Ferreira et al., 2008; Gianni et al., 2008) is the clinically most relevant side effect of the anthracycline derivative doxorubicin. The molecular mechanisms underlying the cytotoxicity of anthracyclines are manifold. Reactive oxygen species (ROS) and/or inhibition of topoisomerase II isoforms (topo II) are the most frequently discussed factors for both triggering tumor kill and normal tissue damage (Ferreira et al., 2008; Lyu et al., 2007). Identification and characterization of organ-protective compounds is of high clinical importance as they are anticipated to widen the therapeutic window of anticancer drugs. Moreover, they might be useful for chemoprevention of cancer, too. In search of hepatoprotective drugs we considered statins, which are nowadays widely used for lipid lowering purpose, as promising

C. Henninger et al. / Toxicology and Applied Pharmacology 261 (2012) 66–73

candidates. This is because low doses of statins reduce cell death of primary human endothelial cells (HUVEC) following exposure to doxorubicin and ionizing radiation in vitro (Damrot et al., 2006; Nuebel et al., 2006). Statins also protect against the cardiotoxicity of anthracyclines in vivo, presumably by interfering with Rac1 signaling that is related to topo II function (Huelsenbeck et al., 2011; Riad et al., 2009). Moreover, statins protect the intestine from the pro-fibrotic effects of radiotherapy in vivo (Haydont et al., 2007a; Ostrau et al., 2009). Besides, statins are well established to be cardioprotective (Ludman et al., 2009; Zhou and Liao, 2010), alleviate cardiac ischemia– reperfusion injury (Ludman et al., 2009) and protect the kidney from aminoglycoside-induced toxicity (Antoine et al., 2010). Bearing in mind these data, it is tempting to speculate that statins might have multiple organ-protective effects under situation of stress. The pleiotropic effects of statins are presumably due to their interference with the C-terminal prenylation of membrane-associated small GTPases of the family of Ras-homologous (Rho) GTPases. This modification of Rho proteins is required for their correct intracellular localization and function (Fritz, 2009; Rashid et al., 2009; Zhou and Liao, 2010). Regarding tumor cells, statins are described to provoke cytotoxicity by impairing G1-S transition (Rao et al., 1998) and triggering apoptosis (Dimitroulakos et al., 2001). Moreover, statins are reported to increase the antitumor activity of numerous anticancer drugs in vitro and in vivo (Agarwal et al., 1999; Cafforio et al., 2005; Fritz, 2009; Mistafa and Stenius, 2009). Human-based data regarding possible beneficial effects of statins on cancer risk and anticancer therapy are inconsistent (Bonovas et al., 2006; Dale et al., 2006). In the present study, we investigated the effect of lovastatin on hepatic and kidney injury in vivo using the anthracycline derivative doxorubicin as a prototypical genotoxic anticancer drug. The data show that lovastatin acts hepatoprotective and reduces hepatic DNA damage formation following doxorubicin exposure. Materials and methods Materials. γH2AX antibody (pSer139) was purchased from Millipore (Billerica, MA, USA), ERK2 antibody from Santa Cruz (Santa Cruz, CA, USA), hyperfilm ECL from GE Healthcare (München, Germany) and Vectashield from Vector Laboratories (Burlingame, CA, USA). The RNeasy Mini Kit and OmniScript Kit for cDNA synthesis were obtained from Qiagen (Hilden, Germany). DNA oligonucleotides for RT-PCR analysis originated from SIGMA-Aldrich (St. Louis, MO, USA), SYBR Green SensiMix from Bioline (Luckenwalde, Germany) and dNTPs from Perkin Elmer (Waltham, MA, USA). Doxorubicin, etoposide and lovastatin were provided by the pharmacy of the University Medical Center (Mainz, Germany). In vivo experiments. BALB/c mice were bred in our local specificpathogen free animal housing facility (University Medical Center Mainz, Germany). They were 3–4 months of age and weighed ~25 g at the start of the experiments. For analyzing the influence of lovastatin on doxorubicin-induced acute and subacute organ toxicity, in each case 24 animals were randomly divided into 4 groups (control, lovastatin, doxorubicin, doxorubicin + lovastatin) of 6 animals. To investigate the effect of lovastatin on acute doxorubicin-induced toxicity (acute model system), mice were pre-treated with a human relevant dose of lovastatin (10 mg/kg; p.o.) 48 h and 24 h before doxorubicin (10 mg/kg; i.p.) administration. Lovastatin pretreatment was performed in order to allow depletion of the pool of isoprene precursors required for the prenylation of Rho GTPases. Additional lovastatin treatment was performed 24 h after injection of doxorubicin. Two days after doxorubicin treatment, the animals were euthanized and liver and kidney were isolated for analyses. To determine subacute toxicity of doxorubicin (subacute model system), animals were pre-treated twice with lovastatin (10 mg/kg; p.o.) as

67

described before. Post-treatment with lovastatin started 24 h after the first doxorubicin administration and was performed three times per week. In order to reflect the clinical situation, the cumulative dose of 9 mg/kg doxorubicin, which is relevant in humans, was administered in three single doses of 3 mg/kg (i.p.) per week. Eight days after the last doxorubicin injection, mice were euthanized. One lobe of the liver and one kidney were immediately frozen in liquid nitrogen and stored at −80 °C for subsequent biochemical or mRNA analyses, the other lobe and kidney were fixed in formalin (Roti Fix) for 16–24 h and embedded in paraffin. HE-stained tissue sections were evaluated for signs of inflammation and cell death by the department of pathology (University Medical Center Mainz, Germany). Blood samples were collected from the tail vein. Serum GPT and GLDH levels, which are markers of hepatotoxicity, as well as serum creatinine concentration, which reflects severe kidney damage, were determined by routine analysis in the Institute of Clinical Chemistry and Laboratory Medicine (University Medical Center Mainz, Germany). If not stated otherwise, quantitative data shown are based on the analysis of five to six animals per group. All animals received humane care and the study protocols comply with institutional guidelines. Total RNA purification and real-time RT-PCR. Total RNA was isolated from the liver and kidney using the RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions, yielding in about 20 μg of total RNA. For reverse transcriptase (RT) reaction 500–2000 ng of mRNA were used. Real-time RT-PCR analysis was performed with pooled RNA samples from five to six mice and was done in duplicates or triplicates using MyIQ Thermal Cycler (BioRad). For each reaction, 200 ng cDNA and specific primers (0.45 μM each) were added. The real-time PCR reaction was conducted according to the following protocol: 1. 95 °C, 15 min; 2. 95 °C, 15 s ;55 °C, 15 s ; 72 °C, 1 min; 45 cycles. At the end of each run, the melting curve was recorded to ensure the specificity of the reaction. Amplicons with a cycle thresholds >35 were excluded from quantitative analysis. mRNA expression levels of GAPDH and β-actin were used for normalization and relative mRNA expression in untreated control animals was set to 1.0. Analysis of gene expression by PCR array. To this end, a semicustomized PCR array (Sigma Aldrich GmbH, Steinheim, Germany) was used. It allows the analysis of the expression of 94 genes involved in DNA repair, stress signaling, cell cycle regulation and cell death. Pooled samples from five to six mice were used. GAPDH and β-actin were taken for normalization and relative expression in untreated controls was set to 1.0. Drug-induced changes in gene expression of ≤0.5 and ≥2.0 were considered as different from untreated control. Alterations in the expression of genes found in the screeing assay were re-confirmed by separate real-time RT-PCR analysis performed in triplicate. The following primers were used for realtime PCR analyses: GAPDH, f: AACTTTGGCATTGTGGAAGG, r: CACATTGGGGGTAGGAACAC (222 bp product); β-actin, f: GCATTGCTGACAGGATGCAG, r: CCTGCTTGCTGATCCACATC (159 bp); connective tissue growth factor (CTGF), f: CAAAGCAGCTGCAAATACCA, r: GGCCAAATGTGTCTTCCAGT (220 bp); tumor necrosis factor alpha (TNFα, f: AGCCCCCAGTCTGTATCCTT, r: CTCCCTTTGCAGAACTCAGG (212 bp); heme oxygenase (ho-1); f: CACGCATATACCCGCTACCT r: CCAGAGTGTTCATTCGAGCA; glutathione peroxidase (gpx-1), f: GTCCACCGTGTATGCCTTCT r: GAACTGATTGCACGGGAAAC; multidrug resistance gene 1 (mdr-1), f: ACCATGGAGGAAATCACAGC r: TGGTGGCATCATCCAAGATA; multidrug resistance-associated protein 1 (mrp-1): f: AGGCCTACTACCCCAGCATT r: CAGTCTCTCCACTGCCACAA; nuclear factor like-2 (nrf-2) f: GCAACTCCAGAAGGAACAGG r: AGGCATCTTGTTTGGGAATG; kelch-like ECHassociated protein 1 (keap-1), f: ACGACGTGGAGACAGAGACC r: ATCAATTTGCTTCCGACAGG. For confirmation of the PCR-array-based data we used the following primers: Cdkn1a (p21), f: ACCTGAATAGCACTTTGGAAA r: TCTGAGCAATGTCAAGAGTC; Wee1, f: GTAGTTCTCTATTCATGGACACA r: GTTGCTTTCAGTAATTGTAATTCTTT; Fas receptor (FasR), f:

68

C. Henninger et al. / Toxicology and Applied Pharmacology 261 (2012) 66–73

AGAACCTCCAGTCGTGAA r: ATCTATCTTGCCCTCCTTGA; transcription factor c-Fos, f: AACTTCGACCATGATGTTCT r: GCACTAGAGACGGACAGA; transcription factor c-Jun, f: AACTTTCCTGACCCAGAG r: GCGAACTGGTAT GAGTATAG; breast cancer gene 2 (Brca 2), f: TAACGCCTGCTGACTCTC r: TGCCAGATGAATCTCCTAACA; cytochrome P450 type 1A1 (Cyp1a1), f: CCTCCGTTACCTGCCTAA r: GTCCTGACAATGCTCAATGA; Topo II alpha, f: CTTCAGGACCGTCACCAT r: GAGCAGTATATGTTCCAGTTGT; Topo II beta, f: GGGTGAACAATGCTACAAA r: TGTATGTATCAGGACGAAGGA. Analysis of hepatic fibrosis. To detect fibrosis in liver histologically, tissue was fixed with formalin and embedded into paraffin blocks by routine procedure (Institute of Pathology, Mainz). Three sections per liver were prepared for fibrosis staining using the Masson–Goldner trichrome staining kit (MERCK Darmstadt). Four animals per group were analyzed. Photographs were taken on a Zeiss Axiovert 35 microscope and representative pictures are shown. Immunohistochemical analysis of H2AX phosphorylation. Ser139 phosphorylation of histone H2AX (γH2AX) is an accepted surrogate marker of DNA damage (Kinner et al., 2008). It was monitored by routine immunohistochemistry. Tissue sections were incubated with γH2AX specific antibody (1:500) (3 h, 37 °C) in PBST (PBS containing 0.3% Triton X-100). After washing with PBST, incubation with the secondary fluorescent labelled antibody (Alexa Fluor 488; Invitrogen) (1:500 in PBST) was performed for 2 h at room temperature. Nuclei were stained with TO-PRO-3 (Invitrogen, UK) (1:1000, 20 min, RT). γH2AX foci were monitored by laser scanning microscopy (Zeiss LSM710). Detection of γH2AX by Western blot analysis. 15–30 mg of liver or kidney tissue was lysed in 300–600 μl lysis buffer (RotiLoad (Roth, Germany)) using TissueLyser (Qiagen). Proteins were separated by SDS-PAGE (15% gels) and transferred onto nitrocellulose membrane. Membranes were blocked in 5% non-fat milk in TBS / 0.1% Tween 20 for ≥ 1 h at RT. Incubation with the primary antibody was conducted overnight (4 °C). Incubation with anti-rabbit secondary antibody (1:10,000) (Licor) was performed for 3 h (RT). Bound antibodies were visualized with the Odyssey Infrared Imager (Licor) and autoradiographies were quantitated with the build-in software. Data shown are the mean ± SD from four to six animals. Determination of sphingolipid concentrations in liver tissue. Tissue samples (15–40 mg) used for quantification of sphingolipid concentrations were minced in PBS on ice. A 12.5 μl tissue suspension (30 mg/ml) was added to 87.5 μl of freshly prechilled PBS. Lipids were extracted in 700 μl of chloroform/methanol (7:1) after the addition of the internal standards (C17:0-Cer, C17:0-Sph, C17:0-S1P). The suspension was mixed using a vortex mixer (at 25 °C, 1 min) and centrifuged for 5 min at 25 °C and 14,000 rpm. The organic phase was collected and the extraction step was repeated. The combined organic phases were dried under a stream of nitrogen and redissolved in 200 μl of methanol for quantitation. After liquid– liquid extraction, concentrations of dhceramides and ceramides form C16:0–C24:1, Sph (sphingosine) and dhSph (dhsphingosine) and the internal standards were determined by liquid chromatography coupled with tandem mass spectrometry (LC-MS/MS) as described previously (Schiffmann et al., 2009). Data are shown as mean ± SD from triplicate determinations of liver tissue from 4 to 5 mice per group. Statistical analysis. For statistical analysis the Student's T-test or the Mann–Whitney U-test were applied. p-values of p ≤ 0.05 were considered significant and marked with an asterisk.

Results Lovastatin mitigates doxorubicin-induced formation of hepatic DNA damage and lowers acute inflammatory and fibrotic stress responses To address the question whether statins might have a more general organ-protective function following genotoxic insult, we extended our previous in vitro (Damrot et al., 2006) and in vivo (Huelsenbeck et al., 2011) work by investigating the impact of lovastatin on doxorubicin-induced acute and subacute hepatotoxicity and nephrotoxicity. Keeping in mind that anthracycline-induced cell death mainly results from the induction of DNA damage (Tewey et al., 1984), we asked the question whether lovastatin decreases the formation of DNA damage following doxorubicin administration. To this end, we monitored the phosphorylation of histone H2AX at Ser139 (γH2AX), which is a well accepted surrogate marker of the DNA damage response (DDR) (Harper and Elledge, 2007). Western blot analysis performed 48 h after exposure of BALB/c mice to a single dose of doxorubicin (10 mg/kg, i.p.) showed a strong increase in the level of γH2AX in liver extracts (Fig. 1A). Lovastatin pre-treatment (10 mg/kg, p.o) blocked doxorubicin-induced H2AX phosphorylation (Fig. 1A). γH2AX foci, which can be monitored by immunohistochemistry, are a strong indicator of DNA double-strand breaks (DSBs) (Rothkamm and Lobrich, 2003). In line with the results obtained in the western blots, increased formation of γH2AX foci was observed after doxorubicin treatment, whereby this response was attenuated by lovastatin (Fig. 1B). Quantitative analysis revealed 5.2±1.6 foci/nucleus in doxorubicintreated mice whereas in lovastatin co-treated mice the number of foci was significantly reduced to 2.0±1.0 foci/nucleus (p≤0.05). Based on the data we conclude that lovastatin protects hepatocytes from early DNA damage provoked by doxorubicin. Doxorubicin-induced acute pro-inflammatory and pro-fibrotic responses were also mitigated by the statin, as indicated by a reduced mRNA expression of the inflammatory cytokine TNFα and the pro-fibrotic cytokine connective tissue growth factor (CTGF) (Fig. 1C). A change in the expression of profibrotic TGFβ was not detected (Fig. 1C). Pathological examination of liver sections did not reveal major signs of inflammation or cell death (data not shown). Regarding kidney, which is a further important detoxification organ and for this reason was included into the study, no major increase in cytokine mRNA expression was detectable after doxorubicin treatment (Fig. 1D). Also, the anthracycline failed to increase the level of renal H2AX phosphorylation (data not shown).

Beneficial effects of lovastatin on subacute hepatotoxicity following doxorubicin treatment To better mimic the clinical situation of anthracyline-based antitumor therapy in humans, subacute toxicity was monitored 21 days after the first doxorubicin administration. Under this condition, doxorubicin provoked a ~5-fold upregulation of CTGF mRNA level, which was impaired by lovastatin (Fig. 2A). Alterations in the RNA levels of TNFα were not found at this late time point (data not shown). Monitoring fibrotic changes by Masson's trichrome staining of liver tissue sections, we detected incipient perivascular fibrosis in doxorubicin-treated animals, whereas in lovastatin co-treated animals this effect was not observed (Fig. 2B). Lovastatin also mitigated epirubicin-stimulated pro-inflammatory and pro-fibrotic stress responses of the liver (Fig. 2C), indicating that the protective effect of lovastatin pertains to anthracyclines in general. Moreover, analyzing the serum levels of the liver-specific enzymes GPT and GLDH, which are indicative of liver damage, we could confirm that lovastatin protects mice from doxorubicin-induced hepatic damage (Fig. 2D). With respect to the kidney, doxorubicin failed to induce CTGF mRNA expression (Fig. 2E). Moreover, serum creatinine level following doxorubicin administration was not elevated (Fig. 2F), indicating

C. Henninger et al. / Toxicology and Applied Pharmacology 261 (2012) 66–73

69

Fig. 1. Lovastatin reduces the level of doxorubicin-induced hepatic DNA damage. A: BALB/c mice were pre-treated with lovastatin and exposed to doxorubicin as described in Materials and methods. 48 h after drug exposure, mice were euthanized and liver tissue was analyzed by western blot analysis. The level of H2AX phosphorylation (γH2AX) is indicative of DNA damage. For quantitative analysis, γH2AX signal was normalized to ERK2 signals and set to 1.0 in untreated cells (Con). *p ≤ 0.05. B: Mice were treated as described under A and Ser139 phosphorylated H2AX (γH2AX) was detected in liver sections by immunohistochemistry. Shown are representative pictures. C: BALB/c mice were treated with lovastatin and doxorubicin as described under A. mRNA expression of genes encoding pro-inflammatory (TNFα) and pro-fibrotic (CTGF, TGFβ) cytokines was analyzed by real-time RT-PCR in the liver (n = 5 mice per group). Relative mRNA expression in control animals was set to 1.0. D: BALB/c mice were treated with lovastatin and doxorubicin as described under A. mRNA expression of genes encoding pro-inflammatory (TNFα) and pro-fibrotic (CTGF, TGFβ) cytokines was analyzed by real-time RT-PCR in the kidney (n = 5 mice per group). Relative mRNA expression in control animals was set to 1.0.

Fig. 2. Lovastatin attenuates subacute hepatic tissue damage induced by doxorubicin. A: BALB/c mice were co-treated with lovastatin and repeatedly exposed to doxorubicin as described in Materials and methods. One week after the last dosage of doxorubicin, mice were euthanized and mRNA expression of CTGF was analyzed in liver. The ethidum bromide stained gel shows the result of a semiquantitative analysis. The histogram shows data based on quantitative real-time RT-PCR. *p ≤ 0.05. B: Mice were treated with lovastatin and doxorubicin as described under A. Fibrotic tissue remodeling was analyzed in liver tissue sections by Masson's trichrome staining. Cyan staining shows collagen rich tissue (indicated by an arrow). C: BALB/c mice were co-treated with lovastatin and exposed to three single doses of epirubicin (cumulative dose of 18 mg/kg) as described in Materials and methods. One week after the last dosage of epirubicin, mice were euthanized and mRNA expression of IL6 and CTGF were analyzed in liver. The histogram shows data based on quantitative real-time RT-PCR. *p ≤ 0.05. D: BALB/c mice were treated as described under A. At the end of the experiment, hepatotoxicity was monitored by analyzing the serum concentrations of GPT and GLDH. *p ≤ 0.05. E: Mice were treated with doxorubicin and lovastatin as described under A. The mRNA expression of CTGF was analyzed in the kidney. The histogram shows data based on quantitative real-time RT-PCR analyses. F: BALB/c mice were treated as described under A. At the end of the experiment, kidney damage was monitored by analyzing the serum concentrations of creatinine. C, control; L, lovastatin; D, doxorubicin; D + L, doxorubicin plus lovastatin.

70

C. Henninger et al. / Toxicology and Applied Pharmacology 261 (2012) 66–73

that doxorubicin did not provoke major kidney damage under our experimental conditions.

Effect of lovastatin on doxorubicin-induced changes in the expression of drug transporters and anti-oxidative genes As shown by real-time RT-PCR analyses, doxorubicin did not stimulate the hepatic mRNA expression of genes coding for antioxidative factors (i.e. ho-1, gpx-1) or major drug transporters (i.e. mdr-1 and mrp-1) in the acute model (i.e. 48 h after doxorubicin exposure) (Fig. 3A). Also, the mRNA levels of nrf-2 and keap-1, which are important for the regulation of oxidiative stress responses (Singh et al., 2010), were not affected by doxorubicin (Fig. 3A). By contrast, in the subacute model, anthracycline treatment increased the mRNA levels of the drug transporters mdr-1 and mrp-1 as well as of nrf-2 (Fig. 3B). The mRNA expression of ho-1, gpx-1 and keap-1 remained unchanged (Fig. 3B). mRNA levels of these genes were differently affected by lovastatin; the statin slightly reduced doxorubicinstimulate expression of mrp-1, but not of mdr-1, and slightly attenuated the mRNA expression of nrf-2 (Fig. 3B). The data show that doxorubicin triggered changes in the mRNA expression of drug transporters and factors regulating the oxidative stress response are a late hepatic event. Lovastatin inhibited a subset of these stress responses. Regarding the kidney, doxorubicin stimulated the mRNA expression of nrf-2 in the acute model system, which, however, was not reduced by lovastatin (data not shown). In the subacute model, mdr-1 mRNA expression was increased following doxorubicin treatment and this response was attenuated by the statin (data not shown).

Doxorubicin alters the hepatic expression of genes involved in the regulation of DNA repair, cell cycle progression and death The mRNA expression of genes involved in DNA repair, cell cycle progression and death was monitored by PCR array-based real-time RT-PCR analyses 48 h after exposure to a single dose of doxorubicin (10 mg/kg; i.p.). Out of 94 genes subjected to investigation, doxorubicin stimulated the expression of 24 genes, including DNA repair genes (i.e ercc1, mgmt, mpg, xpa, xpa, xrcc3), cell cycle regulatory factors (i.e. cdkn1a (p21) and wee1) as well as death-related factors (i.e. fas, bax and benc1) (data not shown). Three genes were downregulated, with gadd45 showing the strongest reduction in mRNA expression following doxorubicin treatment (data not shown). Doxorubicininduced alterations in gene expression, which had been observed in the screening assay with and without lovastatin co-treatment, were confirmed by independent real-time RT-PCR analyses performed for selected genes. The data show that lovastatin mitigated the increase in the mRNA levels of the transcription factors c-jun and c-fos as well as of cdkn1a (p21) observed after doxorubicin administration (Fig. 3C). Doxorubicin-stimulated expression of fas or wee-1 phosphatase were not altered by lovastatin (Fig. 3C). Repeated doxorubicin exposure (i.e. 3 × 3 mg/kg; i.p.) and analysis of gene expression 8 days after administration of the last dose revealed an upregulation or downregulation of 20 and 4 genes, respectively (data not shown). The genes that responded to doxorubicin treatment in the acute model system were largely different from the ones responding in the subacute model. In the subacute setting, doxorubicin caused upregulation of the DSB repair gene brca2 as well as of topo II α, cyp1a1 and wee1. Upregulated expression of these genes was

Fig. 3. Influence of doxorubicin and lovastatin on the expression of genes involved in stress response. A: BALB/c mice were treated with lovastatin and exposed to a single dose of doxorubicin as described in Materials and methods. 48 h later, the mRNA expression of genes involved in oxidative stress response (ho-1, gpx-1, nrf-2 and keap-1) and drug transport (mdr-1, mrp-1) was analyzed in liver by real-time RT-PCR. Relative mRNA expression in control animals was set to 1.0. B: BALB/c mice were co-treated with lovastatin and exposed to three consecutive doses of doxorubicin as described in Materials and methods. mRNA expression of genes involved in oxidative stress response (ho-1, gpx-1, nrf-2 and keap-1) and drug transport (mdr-1, mrp-1) was analyzed one week after administration of the last dose of doxorubicin (subacute model). C, control; D, doxorubicin; D + L, doxorubicin plus lovastatin. C: Mice were exposed to doxorubicin and lovastatin as described under A (acute model). After PCR-array based screening of gene expression, several genes were selected and alterations in their mRNA expression provoked by doxorubicin and modulated by lovastatin was confirmed by separate real-time RT-PCR analysis. D: Mice were exposed to doxorubicin and lovastatin as described under B (subacute model). After PCR-array based screening of the mRNA expression of genes involved in DNA repair, checkpoint control and death, several genes were selected and alterations in mRNA expression was confirmed by separate real-time RT-PCR.

C. Henninger et al. / Toxicology and Applied Pharmacology 261 (2012) 66–73

inhibited by lovastatin (Fig. 3D). Notably, as opposed to topo IIα, the expression of topo IIβ remained unaffected by the anthracycline (Fig. 3D). The results obtained in kidney were different. In the acute model, the mRNA expression of cdkn1a, fas, c-fos and c-jun was upregulated, whereas wee-1 expression remained unchanged. The statin only mitigated the expression of fas and c-fos (data now shown). In the subacute setting, the mRNA expression of none of the genes under investigation was stimulated by doxorubicin (data not shown). Apparently, doxorubicin and lovastatin have different, organ-specific effects on gene expression. Doxorubicin stimulates sphingolipid metabolism in the liver Apart from damaging the DNA, genotoxins are also known to cause a DNA damage independent stress reaction. Among others, genotoxic agents stimulate the production of ceramides, which in turn lead to the activation of stress kinases that can trigger cell death (Brenner et al., 1997; Verheij et al., 1996). As shown in Fig. 4, doxorubicin provoked the formation of a variety of ceramides in the liver, including C16, C18 and C24:1 (Fig. 4A) as well as DHC18 and DHC24 (Fig. 4B). The level of sphingosine (Sph) was also significantly enhanced following doxorubicin exposure, whereas DHSph was not (Fig. 4C). Lovastatin had no significant impact on the hepatic formation of these lipid messengers (Fig. 4). Altogether, the findings show that lovastatin only affects a specific subset of doxorubicin-induced hepatic stress responses, with lipid messengers being not included. Hence, the data strongly indicate that protection from the deleterious effects of doxorubicin mediated by lovastatin is likely not due to the inhibition of pathways of inflammation and death that are related to sphingolipids. Discussion Hepatotoxicity is a frequent side effect of anticancer drugs, which is of particular relevance under situation of pre-existing abnormalities in liver function (e.g. hepatitis) (King and Perry, 2001).

A

700 600

71

Anthracycline derivatives such as doxorubicin are highly potent antineoplastic drugs that provoke considerable acute and delayed normal tissue damage, in particular of the heart (Ferreira et al., 2008; Gianni et al., 2008; Menna et al., 2008) and the liver (El-Sayyad et al., 2009; Kalender et al., 2005; Kimura et al., 2000). Both in vitro (Damrot et al., 2006; Nuebel et al., 2006) and in vivo (Haydont et al., 2007a, 2007b; Huelsenbeck et al., 2011; Ostrau et al., 2009) studies reported on a cytoprotective effect of statins following treatment with anthracyclines and ionizing radiation. Notably, statins protect from anthracycline-induced heart damage (Feleszko et al., 2000; Huelsenbeck et al., 2011; Riad et al., 2009), which is the clinically most relevant side effect of this group of anticancer drugs. Based on these data, we speculated that statins might have multiple cytoprotective functions under situation of genotoxic insult. In this context, detoxifying organs such as liver and kidney are considered of particular relevance, as damage to these organs can result in an increase in the systemic concentration of toxic drugs, which, in turn, promotes their organ-toxic potency. In the present study, we found that lovastatin largely attenuated acute pro-inflammatory and pro-fibrotic stress response of the liver following anthracycline treatment. Under our experimental conditions, the anthracycline did not provoke major injury to the kidney. The observed hepatoprotective statin effect likely rests on a reduction of doxorubicin-induced genotoxicity. Up to now, genoprotection by statins has only been demonstrated in vitro (Damrot et al., 2006; Huelsenbeck et al., 2011). Although the molecular mechanisms involved are still unclear, the in vitro data indicate that protection against doxorubicin-induced DNA damage by statins is independent of mechanisms of transport and ROS formation (Damrot et al., 2006; Huelsenbeck et al., 2011). Protective effects of lovastatin were also observed with respect to doxorubicin-induced subacute toxicity. Besides inhibiting the expression of the pro-fibrotic cytokine CTGF, the statin also reduced hepatotoxicity as shown by histopathological analysis of fibrotic tissue remodeling and monitoring the serum concentrations of GPT/GLDH, which are markers of hepatotoxicity. Residual DNA damage could

Con Lova Doxo Doxo + Lova

500

*

400 300 200

*

100

*

0

B 16 14 12

C

Con Lova Doxo Doxo + Lova

0.8 0.7

*

0.5

8 4

*

Con Lova Doxo Doxo + Lova

0.6

10 6

*

0.4

*

0.3 0.2

2

0.1

0

0.0 Sph

DHSph

Fig. 4. Doxorubicin-induced alterations in sphingolipid metabolism are not affected by lovastatin. A–C: BALB/c mice were co-treated or not with lovastatin and exposed to a single dose of doxorubicin (10 mg/kg; i.p.). 48 h after doxorubicin exposure, the level of ceramides (A) and dihydro-ceramides (B) as well as sphingosine and dihydro-sphingosine (C) was analyzed as described in Materials and methods. *p ≤ 0.05.

72

C. Henninger et al. / Toxicology and Applied Pharmacology 261 (2012) 66–73

not be detected under this situation (data not shown). Apart from lovastatin, metallothionein (Kimura et al., 2000) and antioxidants (Gokcimen et al., 2007) also protect against doxorubicin-induced liver injury. In contrast to the iron chelating agent dexrazoxane, which nowadays is the only approved drug for the prevention of cardiotoxicity evoked by anthracyclines, antioxidants are not cardioprotective in animal models in case of clinically relevant doses of anthracyclines have been used (Gewirtz, 1999; Simunek et al., 2009). Apparently, beneficial effects of antioxidants against anthracycline-induced damage are organ-specific. Previous reports demonstrated a reduction of normal tissue damage by statins following radiotherapy in vivo (Haydont et al., 2007a; Ostrau et al., 2009). It has been suggested that inhibition of Rho/ROCK signaling is relevant for radioprotection by statins (Haydont et al., 2007a). Taken together, the data available are indicative of multiple organ-protective functions of statins. This view gains further support by our finding that lovastatin also lowers doxorubicin-induced hematotoxicity as indicated by protection from the drop in whole blood cell count and increase in the number of platelets following doxorubicin administration (data not shown). Bearing in mind the observed genoprotective effect of lovastatin in liver, the data bring up the question whether statins might also be useful to counteract hepatocarcinogenesis, especially tumor initiation, induced by chemical mutagens present in the environment and food. This interesting aspect will be subject of forthcoming studies. In this context it is noteworthy however that statins are already reported to protect from 1,2-dimethylhydrazine-induced colon tumorigenesis (Narisawa et al., 1994). Whether this chemopreventive statin effect is mainly due to inhibition of tumor initiation or promotion or both is unclear. Quantitative real-time RT-PCR analyses revealed manifold inhibitory effects of lovastatin, in particular in the subacute model. Here, among others, the statin reduced the mRNA levels of topo IIα, brca2 and wee1. Bearing in mind that inhibition of Topo IIα protein is a major mechanism of doxorubicin-induced geno- and cytotoxicity, the observed attenuated expression of topo IIα might explain the lower level of DNA damage following doxorubicin treatment. It is rational to assume that, in consequence of a reduced level of initial DNA damage, DNA damage response is mitigated. Indeed, this is reflected by an attenuated expression of DNA repair (e.g. brca2) and checkpoint control mechanisms (e.g. wee1). In this context we would like to note that the effects of doxorubicin and lovastatin on renal gene expression were largely different from that in liver, in particular in the subacute model. Apart from DNA damage triggered stress responses, genotoxins can additionally provoke stress responses originating from membrane-associated structures, thereby causing the production of sphingolipids. Lipid messengers in turn can trigger pathways of inflammation and cell death (Brenner et al., 1997; Verheij et al., 1996). Bearing this in mind, it is important to note that the hepatoprotective effect of lovastatin observed in our study is likely not related to the sphingolipid metabolism, because the generation of ceramides and sphingosine was not blocked by lovastatin. Taken together, we have shown that lovastatin protects the murine liver from acute and subacute injury provoked by the anthracycline derivative doxorubicin. Whether statins are moreover also able to prevent chronic cardiotoxicity (i.e. cardiomyopathy) following anthracycline treatment will be subject of forthcoming studies. Hepatoprotection by lovastatin is likely due to attenuation of DNA damage induction and alleviation of pro-inflammatory and pro-fibrotic stress responses. In view of previous reports (Huelsenbeck et al., 2011; Yoshida et al., 2009), we assume that protection by statins rests on the inhibition of Rac1 signaling that is related to the function of type II topoisomerases. The sphingolipid metabolism is likely not of relevance under our experimental setting. Based on the data we suggest that including statins into anthracycline-based tumortherapeutic regimen is a feasible strategy for lowering hepatic damage. Since statins are well tolerated in humans, we further suggest them

as promising drugs to improve the tolerance of normal tissue against the deleterious effects of anticancer therapeutics. Conflict of interest statement There are no conflicts of interest with this manuscript. Acknowledgments This work was supported by the Deutsche Krebshilfe (107361 and 109188). We would like to thank Katrin Roth, Adriana Degreif, Lena Schumacher and Rebekka Kitzinger for excellent technical support. References Agarwal, B., Bhendwal, S., Halmos, B., Moss, S.F., Ramey, W.G., Holt, P.R., 1999. Lovastatin augments apoptosis induced by chemotherapeutic agents in colon cancer cells. Clin. Cancer Res. 5, 2223–2229. Antoine, D.J., Srivastava, A., Pirmohamed, M., Park, B.K., 2010. Statins inhibit aminoglycoside accumulation and cytotoxicity to renal proximal tubule cells. Biochem. Pharmacol. 79, 647–654. Bonovas, S., Filioussi, K., Tsavaris, N., Sitaras, N.M., 2006. Statins and cancer risk: a literature-based meta-analysis and meta-regression analysis of 35 randomized controlled trials. J. Clin. Oncol. 24, 4808–4817. Brenner, B., Koppenhoefer, U., Weinstock, C., Linderkamp, O., Lang, F., Gulbins, E., 1997. Fas- or ceramide-induced apoptosis is mediated by a Rac1-regulated activation of Jun N-terminal kinase/p38 kinases and GADD153. J. Biol. Chem. 272, 22173–22181. Cafforio, P., Dammacco, F., Gernone, A., Silvestris, F., 2005. Statins activate the mitochondrial pathway of apoptosis in human lymphoblasts and myeloma cells. Carcinogenesis 26, 883–891. Dale, K.M., Coleman, C.I., Henyan, N.N., Kluger, J., White, C.M., 2006. Statins and cancer risk: a meta-analysis. JAMA 295, 74–80. Damrot, J., Nuebel, T., Epe, B., Roos, W.P., Kaina, B., Fritz, G., 2006. Lovastatin protects human endothelial cells from the genotoxic and cytotoxic effects of the anticancer drugs doxorubicin and etoposide. Br. J. Pharmacol. 149, 988–997. Dimitroulakos, J., Ye, L.Y., Benzaquen, M., Moore, M.J., Kamel-Reid, S., Freedman, M.H., Yeger, H., Penn, L.Z., 2001. Differential sensitivity of various pediatric cancers and squamous cell carcinomas to lovastatin-induced apoptosis: therapeutic implications. Clin. Cancer Res. 7, 158–167. El-Sayyad, H.I., Ismail, M.F., Shalaby, F.M., Abou-El-Magd, R.F., Gaur, R.L., Fernando, A., Raj, M.H., Ouhtit, A., 2009. Histopathological effects of cisplatin, doxorubicin and 5-flurouracil (5-FU) on the liver of male albino rats. Int. J. Biol. Sci. 5, 466–473. Feleszko, W., Mlynarczuk, I., Balkowiec-Iskra, E.Z., Czajka, A., Switaj, T., Stoklosa, T., Giermasz, A., Jakobisiak, M., 2000. Lovastatin potentiates antitumor activity and attenuates cardiotoxicity of doxorubicin in three tumor models in mice. Clin. Cancer Res. 6, 2044–2052. Ferreira, A.L., Matsubara, L.S., Matsubara, B.B., 2008. Anthracycline-induced cardiotoxicity. Cardiovasc. Hematol. Agents Med. Chem. 6, 278–281. Fritz, G., 2009. Targeting the mevalonate pathway for improved anticancer therapy. Curr. Cancer Drug Targets 9, 626–638. Gewirtz, D.A., 1999. A critical evaluation of the mechanisms of action proposed for the antitumor effects of the anthracycline antibiotics adriamycin and daunorubicin. Biochem. Pharmacol. 57, 727–741. Gianni, L., Herman, E.H., Lipshultz, S.E., Minotti, G., Sarvazyan, N., Sawyer, D.B., 2008. Anthracycline cardiotoxicity: from bench to bedside. J. Clin. Oncol. 26, 3777–3784. Gokcimen, A., Cim, A., Tola, H.T., Bayram, D., Kocak, A., Ozguner, F., Ayata, A., 2007. Protective effect of N-acetylcysteine, caffeic acid and vitamin E on doxorubicin hepatotoxicity. Hum. Exp. Toxicol. 26, 519–525. Harper, J.W., Elledge, S.J., 2007. The DNA damage response: ten years after. Mol. Cell 28, 739–745. Haydont, V., Bourgier, C., Pocard, M., Lusinchi, A., Aigueperse, J., Mathe, D., Bourhis, J., Vozenin-Brotons, M.C., 2007a. Pravastatin inhibits the Rho/CCN2/extracellular matrix cascade in human fibrosis explants and improves radiation-induced intestinal fibrosis in rats. Clin. Cancer Res. 13, 5331–5340. Haydont, V., Gilliot, O., Rivera, S., Bourgier, C., Francois, A., Aigueperse, J., Bourhis, J., Vozenin-Brotons, M.C., 2007b. Successful mitigation of delayed intestinal radiation injury using pravastatin is not associated with acute injury improvement or tumor protection. Int. J. Radiat. Oncol. Biol. Phys. 68, 1471–1482. Huelsenbeck, J., Henninger, C., Schad, A., Lackner, K.J., Kaina, B., Fritz, G., 2011. Inhibition of Rac1 signaling by lovastatin protects against anthracycline-induced cardiac toxicity. Cell Death Dis. 2, e190. doi:10.1038/cddis.2011.1065. Kalender, Y., Yel, M., Kalender, S., 2005. Doxorubicin hepatotoxicity and hepatic free radical metabolism in rats. The effects of vitamin E and catechin. Toxicology 209, 39–45. Kimura, T., Fujita, I., Itoh, N., Muto, N., Nakanishi, T., Takahashi, K., Azuma, J., Tanaka, K., 2000. Metallothionein acts as a cytoprotectant against doxorubicin toxicity. J. Pharmacol. Exp. Ther. 292, 299–302. King, P.D., Perry, M.C., 2001. Hepatotoxicity of chemotherapy. Oncologist 6, 162–176. Kinner, A., Wu, W., Staudt, C., Iliakis, G., 2008. Gamma-H2AX in recognition and signaling of DNA double-strand breaks in the context of chromatin. Nucleic Acids Res. 36, 5678–5694.

C. Henninger et al. / Toxicology and Applied Pharmacology 261 (2012) 66–73 Ludman, A., Venugopal, V., Yellon, D.M., Hausenloy, D.J., 2009. Statins and cardioprotection —more than just lipid lowering? Pharmacol. Ther. 122, 30–43. Lyu, Y.L., Kerrigan, J.E., Lin, C.P., Azarova, A.M., Tsai, Y.C., Ban, Y., Liu, L.F., 2007. Topoisomerase IIbeta mediated DNA double-strand breaks: implications in doxorubicin cardiotoxicity and prevention by dexrazoxane. Cancer Res. 67, 8839–8846. Menna, P., Salvatorelli, E., Minotti, G., 2008. Cardiotoxicity of antitumor drugs. Chem. Res. Toxicol. 21, 978–989. Mistafa, O., Stenius, U., 2009. Statins inhibit Akt/PKB signaling via P2X7 receptor in pancreatic cancer cells. Biochem. Pharmacol. 78, 1115–1126. Narisawa, T., Fukaura, Y., Terada, K., Umezawa, A., Tanida, N., Yazawa, K., Ishikawa, C., 1994. Prevention of 1,2-dimethylhydrazine-induced colon tumorigenesis by HMG-CoA reductase inhibitors, pravastatin and simvastatin, in ICR mice. Carcinogenesis 15, 2045–2048. Nuebel, T., Damrot, J., Roos, W.P., Kaina, B., Fritz, G., 2006. Lovastatin protects human endothelial cells from killing by ionizing radiation without impairing induction and repair of DNA double-strand breaks. Clin. Cancer Res. 12, 933–939. Ostrau, C., Hulsenbeck, J., Herzog, M., Schad, A., Torzewski, M., Lackner, K.J., Fritz, G., 2009. Lovastatin attenuates ionizing radiation-induced normal tissue damage in vivo. Radiother. Oncol. 92, 492–499. Rao, S., Lowe, M., Herliczek, T.W., Keyomarsi, K., 1998. Lovastatin mediated G1 arrest in normal and tumor breast cells is through inhibition of CDK2 activity and redistribution of p21 and p27, independent of p53. Oncogene 17, 2393–2402. Rashid, M., Tawara, S., Fukumoto, Y., Seto, M., Yano, K., Shimokawa, H., 2009. Importance of Rac1 signaling pathway inhibition in the pleiotropic effects of HMG-CoA reductase inhibitors. Circ. J. 73, 361–370.

73

Riad, A., Bien, S., Westermann, D., Becher, P.M., Loya, K., Landmesser, U., Kroemer, H.K., Schultheiss, H.P., Tschope, C., 2009. Pretreatment with statin attenuates the cardiotoxicity of Doxorubicin in mice. Cancer Res. 69, 695–699. Rothkamm, K., Lobrich, M., 2003. Evidence for a lack of DNA double-strand break repair in human cells exposed to very low x-ray doses. Proc. Natl. Acad. Sci. U. S. A. 100, 5057–5062. Schiffmann, S., Sandner, J., Birod, K., Wobst, I., Angioni, C., Ruckhaberle, E., Kaufmann, M., Ackermann, H., Lotsch, J., Schmidt, H., Geisslinger, G., Grosch, S., 2009. Ceramide synthases and ceramide levels are increased in breast cancer tissue. Carcinogenesis 30, 745–752. Simunek, T., Sterba, M., Popelova, O., Adamcova, M., Hrdina, R., Gersl, V., 2009. Anthracyclineinduced cardiotoxicity: overview of studies examining the roles of oxidative stress and free cellular iron. Pharmacol. Rep. 61, 154–171. Singh, S., Vrishni, S., Singh, B.K., Rahman, I., Kakkar, P., 2010. Nrf2-ARE stress response mechanism: a control point in oxidative stress-mediated dysfunctions and chronic inflammatory diseases. Free Radic. Res. 44, 1267–1288. Tewey, K.M., Rowe, T.C., Yang, L., Halligan, B.D., Liu, L.F., 1984. Adriamycin-induced DNA damage mediated by mammalian DNA topoisomerase II. Science 226, 466–468. Verheij, M., Bose, R., Lin, X.H., Yao, B., Jarvis, W.D., Grant, S., Birrer, M.J., Szabo, E., Zon, L.I., Kyriakis, J.M., Haimovitz-Friedman, A., Fuks, Z., Kolesnick, R.N., 1996. Requirement for ceramide-initiated SAPK/JNK signalling in stress-induced apoptosis. Nature 380, 75–79. Yoshida, M., Shiojima, I., Ikeda, H., Komuro, I., 2009. Chronic doxorubicin cardiotoxicity is mediated by oxidative DNA damage-ATM-p53-apoptosis pathway and attenuated by pitavastatin through the inhibition of Rac1 activity. J. Mol. Cell. Cardiol. 47, 698–705. Zhou, Q., Liao, J.K., 2010. Pleiotropic effects of statins — basic research and clinical perspectives. Circ. J. 74, 818–826.