- Email: [email protected]
The LncRNA ZBED3-AS1 induces chondrogenesis of human synovial fluid mesenchymal stem cells
Biochemical and Biophysical Research Communications xxx (2017) 1e7
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
The LncRNA ZBED3-AS1 induces chondrogenesis of human synovial fluid mesenchymal stem cells Farong Ou 1, Kai Su 1, Jiadong Sun, Wenting Liao, Yu Yao, Youhua Zheng, Zhiguang Zhang* Department of Oral and Maxillofacial Surgery, Guanghua School of Stomatology, Hospital of Stomatology, Sun Yat-sen University, Guangdong Provincial Key Laboratory of Stomatology, Guangzhou, Guangdong, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 10 April 2017 Accepted 17 April 2017 Available online xxx
Human synovial fluid-derived mesenchymal stem cells (SFMSCs) have great potential for cartilage induction and are promising for cell-based strategies for articular cartilage repair. Many long non-coding RNAs (lncRNAs) regulate chondrogenesis of MSCs. We hypothesized that the divergent lncRNA ZBED3AS1, which binds locally to chromatin, could promote the expression of zbed3, a novel Axininteracting protein that activates Wnt/b-catenin signaling, involved in chondrogenesis. However, the function of ZBED3-AS1 in SFMSCs is unclear. In this study, the expression, biological function, and roles of ZBED3-AS1 in SFMSC chondrogenesis were examined by multilineage differentiation, flow cytometry, and gain-of-function studies. We found that ZBED3-AS1 promotes chondrogenesis. Furthermore, ZBED3AS1 could directly increase zbed3 expression. Finally, the wnt-inhibitor DKK1 could reverse the stimulatory effect of ZBED3-AS1 on chondrogenesis. These findings demonstrate the role of a new lncRNA, ZBED3-AS1, in SFMSC chondrogenesis and may improve osteoarthritis treatment. © 2017 Elsevier Inc. All rights reserved.
Keywords: Human synovial fluid-derived mesenchymal stem cell lncRNA ZBED3-AS1
1. Introduction Osteoarthritis is a degenerative joint disease accompanied by progressive reductions in the extracellular matrix of joint cartilage and bone, eventually leading to joint dysfunction [1]. Stressbearing joints, such as the knee, hip, and temporomandibular joint (TMJ), are commonly affected. Cartilage tissues have a limited capacity for self-repair and remodeling. Current treatment strategies are generally aimed at relieving symptoms, instead of curing the disease. However, one potential treatment strategy for articular cartilage repair is cell-based therapy. Human mesenchymal stem cells (hMSCs), which have the capacity for self-renewal and multipotential differentiation, especially chondrogenic differentiation, are promising for cell-based strategies for articular cartilage repair [2,3]. MSCs can be obtained from a variety of tissues, including the bone marrow, adipose tissue, synovium, and synovial fluid. They are particularly easy to obtain from TMJ synovial fluid [4e7].
* Corresponding author. E-mail addresses: [email protected] (F. Ou), fi[email protected] (K. Su), [email protected] (J. Sun), [email protected] (W. Liao), [email protected] (Y. Yao), [email protected] (Y. Zheng), [email protected] (Z. Zhang). 1 These authors contributed to the work equally.
Human synovial fluid-derived mesenchymal stem cells (SFMSCs) have greater potential for cartilage induction than other tissues [8]. Accordingly, SFMSCs derived from patients with TMJ disorders could be used for therapeutic approaches. Long non-coding RNAs (lncRNAs) are a large class of nonprotein-coding transcripts of > 200 bases involved in numerous physiological and pathological processes [9]. A number of lncRNAs regulate stem cell chondrogenesis, including ZBED3-AS1 [10], H19 [11], HOTAIR [12], and HOTTIP [13]. ZBED3-AS1 is one of the most highly expressed lncRNAs in the chondrogenic differentiation of human bone marrow MSCs [14]. Based on genomic and functional analyses of pluripotent cells, Luo et al. [15] suggest that a major class of lncRNAs arranged divergently to nearby genes play pivotal roles in transcriptional regulation to fine-tune gene expression and lineage differentiation. We hypothesize that as a divergent lncRNA, ZBED3-AS1, which binds locally to zbed3, promotes zbed3 transcription in cis. There is convincing evidence that Zbed3, a novel Axin-interacting protein, activates Wnt/b-catenin signaling [16e18], which promotes chondrogenesis [19,20]. Accordingly, ZBED3-AS1 could promote chondrogenesis of SFMSCs. We examined the ZBED3-AS1 and zbed3 expression in induced SFMSCs, overexpressed ZBED3-AS1 to detect its function in chondrogenesis, and examined its relationship with zbed3 and Wnt signaling. These analyses clarified the roles of ZBED3-AS1 in SFMSC chondrogenesis.
http://dx.doi.org/10.1016/j.bbrc.2017.04.090 0006-291X/© 2017 Elsevier Inc. All rights reserved.
Please cite this article in press as: F. Ou, et al., The LncRNA ZBED3-AS1 induces chondrogenesis of human synovial fluid mesenchymal stem cells, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.04.090
2
F. Ou et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e7
2. Materials and methods
2.3. Flow cytometric analysis of SFMSCs
2.1. SFMSC culture
Surface markers, including CD90 (1:20; cat. no. 562245; BD Biosciences, San Jose, CA, USA), CD105 (1:11; cat. no. 130-094-941; Miltenyi Biotec, Bergisch Gladbach, Germany), CD73 (1:20), CD44 (1:20), and CD45/CD34/CD11b/CD19/HLA-DR (1:20) (cat. no. 562245; all from BD Biosciences), were detected using the FC500 flow cytometer and MXP software and data were analyzed using CXP software (both from Beckman Coulter, Brea, CA, USA).
This study was performed in accordance with the relevant polices of the Institutional Review Board of Guanghua School of Stomatology, Sun Yat-sen University, and complies with the principles of the Declaration of Helsinki. Informed consent was obtained from all subjects. Synovial fluid samples were collected from ten TMD patients (nine women and one man, ranging in age from 20 to 35 years) during arthrocentesis of the TMJ cavity. Cells of individual samples were seeded on 6-cm culture dishes with 3 mL of complete culture medium (10% fetal bovine serum (FBS) þ aMEM) and incubated at 37 C in 5% CO2. After 72 h, the medium was withdrawn to remove non-adherent cells and fresh medium was added. Adherent cells were expanded in a monolayer culture. The medium was refreshed every 3 days; after reaching confluence, SFMSCs were trypsinized and plated at 1000/cm2 in 10-cm dishes. SFMSC experiments were carried out at passages 4 to 6. One volunteer with a mandibular tumor was subjected to mandibular resection, and the normal condylar process was removed for research. 2.2. Multilineage differentiation of SFMSCs 2.2.1. Osteogenic differentiation Cells were plated in 6-well plates and incubated in complete culture medium at 37 C in 5% CO2. When cells reached ~ 80% confluence, the medium was replaced with osteogenic induction medium consisting of a-MEM (Gibco, Waltham, MA, USA) with 10% FBS (Gibco), 10 mM sodium-glycerophosphate (Santa Cruz Biotechnology, Santa Cruz, CA, USA), 100 nM dexamethasone (MP Biomedicals, Santa Ana, CA, USA), and 50 mM ascorbic acid-2phosphate (Wako, Osaka, Japan). The medium was replaced every 3 days for 14 days. Osteogenesis was assessed by Alizarin red staining. Cells were examined under an inverted phase contrast microscope (Axiovert 40; Zeiss, Oberkochen, Germany). 2.2.2. Adipogenic differentiation Cells were plated in 6-well plates and cultured in complete culture medium. After cells reached ~80% confluence, the medium was replaced with adipogenic induction medium that consisted of a-MEM (Gibco) containing 10% FBS (Gibco), 200 mM indomethacin (Sigma-Aldrich, St. Louis, MO, USA), 0.5 mM isobutyl methylxanthine (MP Biomedicals), 1 mM dexamethasone (MP Biomedicals), and 10 mg/mL insulin (MP Biomedicals). The medium was replaced every 3 days for 14 days. After 14 days, adipogenic induction was assessed by Oil Red O staining and visualization under an inverted phase contrast microscope (Axiovert 40; Zeiss). 2.2.3. Chondrogenic differentiation Approximately 3 105 cells were transferred to a 15-mL centrifuge tube and centrifuged at 450g for 10 min. Then, 450 mL of chondrocyte differentiation induction medium consisting of a-MEM (Gibco), 1 ITS-A (Gibco), 100 nM dexamethasone (MP Biomedicals), 50 mM ascorbic acid (Sigma-Aldrich), 40 mg/mL proline (Sigma-Aldrich), and 10 ng/mL transforming growth factor (TGF)-b1 (Life Technologies, Carlsbad, CA, USA) was added. The medium was added with or without 250 ng/mL wnt3a (R&D Systems, Minneapolis, MN, USA) or 200 ng/mL rhDKK1 (R&D Systems) and was refreshed every 3 days. The cell mass formed a pellet automatically. Experiments were carried out using the pellets. Chondrogenic differentiation was assessed by immunochemical staining for col II, Safranin O, and Alcian blue as well as an sGAG analysis.
2.4. Western blotting Proteins were isolated from SFMSCs and pellets were ground using liquid nitrogen. Equal amounts of protein were extracted in RIPA Lysis Buffer (Thermo Scientific, Waltham, MA, USA) with Protease/Phosphatase Inhibitor Cocktail (Cell Signaling Technology, Danvers, MA, USA). Proteins were separated on a Protein Gel (1.0 mm), transferred to a PVDC membrane (Bio-Rad, Hercules, CA, USA), blocked with 5% BSA, and detected with anti-sox9 (1:1000; Cell Signaling Technology), anti-col II (1:1000; Abcam, Cambridge, UK), anti-zbed3 (1:1000; Abcam), anti-b-catenin (1:1000; Cell Signaling Technology), anti-GSK-3beta (1:1000; Cell Signaling Technology), and anti-axin1 (1:1000, Cell Signaling Technology) antibodies. Images were developed with ECL using an HRPsecondary goat anti-rabbit IgG antibody. 2.5. Immunofluorescent staining for zbed3 and b-catenin Cells were plated in 35-mm glass bottom dishes and incubated in complete culture medium or chondrogenic medium for 2 weeks. The cells were fixed in 4% paraformaldehyde for 30 min before treatment with 0.3%-Triton-X100 for 15 min. Cells were blocked for 2 h with 5% bovine serum albumin (BSA). Cells were washed with 1 PBS and stained with rabbit anti-human zbed3 (Abcam) or bcatenin (CST) diluted 1:200 for 18 h at 4 C. After they were washed with 1 PBS, the cells were incubated with the secondary antibody, DyLight 488-TFP ester-conjugated goat anti-rabbit IgG antibody (EarthOx, Millbrae, CA, USA) diluted 1:100 in 1% BSA for 60 min at 37 C. After washing with 1 PBS, the cells were incubated with 1 mg/mL DAPI (Cell Signaling Technology) for 5 min. The cells were then washed before viewing under a confocal microscope (Zeiss). 2.6. Immunochemical staining for zbed3 and col II The condylar process was decalcified for 7 days, and the condylar process and pellet were then fixed with 4% formalin for 24 h and placed in embedding cassettes. Samples were embedded in paraffin blocks and cut at 5 mm. Sections were deparaffinized, and treated with 3% H2O2 for 10 min. Sections were incubated in 0.01 M citrate buffer for 20 min at 94e98 C, cooled at room temperature for 30 min, immersed in blocking buffer (5% BSA in PBS), and incubated at 37 C for 1 h. The tissue sections were then incubated in a solution of rabbit anti-human zbed3 (Abcam) diluted 1:100 and rabbit anti-human col II (Abcam) diluted 1:100 in blocking buffer for 16 h at 4 C. After three 5-min washes in PBS, slides were incubated in a solution of biotinylated goat anti-rabbit IgG (Boster, Pleasanton, CA, USA) for 30 min at 37 C. Slides were washed in PBS and streptavidin-biotin complex reagent (Boster) was applied for 30 min at 37 C. After three 3-min washes in PBS, 3,30 -diaminobenzidine (DAB; Boster) was applied for visualization. Slides were viewed under a light microscope (Axioskop 40; Zeiss). 2.7. Gene expression analysis by RT-PCR Total RNA was isolated using TRIzol (Invitrogen, Carlsbad, CA,
Please cite this article in press as: F. Ou, et al., The LncRNA ZBED3-AS1 induces chondrogenesis of human synovial fluid mesenchymal stem cells, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.04.090
F. Ou et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e7
USA) as per the manufacturer's instructions. cDNA synthesis was performed with random hexamer primers using the iScript™ cDNA Synthesis Kit (Bio-Rad). RNA expression was measured by quantitative real-time PCR using the SYBR method. The reaction was performed in 10 mL of SYBR® Green PCR Master Mix (Applied Biosystems, Waltham, MA, USA), 0.5 mM each 50 and 30 primer, 4 mL of sample, and H2O to a final volume of 20 mL. Samples were amplified for 45 cycles with denaturation at 95 C for 5 s, followed by annealing and extension at 60 C for 34 s. SYBR green fluorescence intensity was measured to determine the amount of double-
Table 1 Oligonucleotide primers used in the RT-PCR analysis. Gene
Primer sequence
ACTIN
F GACATCCGCAAAGACCTG R GGAAGGTGGACAGCGAG F TACAACTTTGCATTAACCTTCC R TGCCCTGTCCTCATGTTCG F TTCCGTCCGGGACAAAATGT R CCGCACGCCCTTTACCC F ACACACAGCTCACTCGACCTTG R AGGGAATTCTGGTTGGTCCTCT F GGCAATAGCAGGTTCACGTACA R CGATAACAGTCTTGCCCCACTT F CGACACCAAGAAGCAGAG R GAATCAATCCAACAGTAGCC
ZBED3-AS1 ZBED3 SOX 9 COL II
b-Catenin
3
stranded DNA. Relative RNA levels of target genes, i.e., sox9, col II, ZBED3-AS1, zbed3, and b-catenin, were normalized to actin levels and further compared with the control using the 2DDCt method. Primers are listed in Table 1.
2.8. FISH SFMSC climbing tablets placed in 4% paraformaldehyde (DEPC) were fixed for 20 min in PBS (pH 7.4), washed 3 times (5 min each), supplemented with proteinase K (20 mg/mL) for digestion for 8 min, and washed with PBS 3 times 5 min. Pre-hybridization was performed in a 37 C incubator for 1 h, followed by complete cooling, and hybridization (containing the ZBED3-AS1 lncRNA probe, concentration 5 ng/ml) for 35 C overnight. The mixture was washed with 2 SSC at 37 C for 10 min, 1 SSC at 37 C twice for 5 min. Slices were washed in hybridization solution, containing the probe (ZBED3 mRNA) at 5 ng/mL and maintained at 39 C for hybridization overnight. The solution was rinsed with 2 SSC at 37 C for 10 min, 1 SSC at 37 C twice for 5 min. DAPI was added, followed by incubation in the dark for 8 min, fluorescent quenching using tablets and observation under inverted fluorescence microscope. The ZBED3-AS1 probe sequence 50 -CGCCT ACAGC CGTCT TCCAG TGCCT CATTC TTG-30 was visualized with CY3, and the ZBED3 probe sequence 50 -GCGCT CCTCA GGTGC CTCCA CAACG CCGAG GTCCC-30 was visualized with FLUOR488.
Fig. 1. Characterization and differentiation of SFMSCs. (A) Typical spindle-shaped morphology of SFMSCs adhered to culture plates. Scale bar ¼ 100 mm. (B, C, D) SFMSCs showing osteogenesis based on Alizarin red staining, adipogenesis based on Oil Red O staining, and chondrogenesis based on immunohistochemical staining of Col II. B,C Scale bar ¼ 100 mm. (E) Flow cytometric analysis of SFMSCs expressing CD90, CD44, CD105, CD73, CD146 CD45, CD34, CD11b, CD19, and HLA-DR. (F) ZBED3-AS1 and ZBED3 co-localized in the cytoplasm of SFMSCs based on FISH; scale bar ¼ 50 mm.
Please cite this article in press as: F. Ou, et al., The LncRNA ZBED3-AS1 induces chondrogenesis of human synovial fluid mesenchymal stem cells, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.04.090
4
F. Ou et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e7
2.9. Construction of recombinant retroviral vectors and cell infection Full-length human ZBED3-AS1 cDNA was cloned from normal human tissue RNA pools by RT-PCR. Full-length human ZBED3-AS1 cDNA was inserted into the pHBLV-CMVIE-ZsGreen-Puro mammalian lentivirus expression vector. The recombinant retrovirus was transduced into HEK-293T cells. After the medium was removed from the HEK-293T cell cultures, retroviral particles were concentrated by centrifugation using the Retro X concentrator (Clontech, Mountain View, CA, USA) for 1 h at 1500 g at 4 C. The retroviral particles were then resuspended in 5% FBS/DMEM and stored at 80 C. For viral infection, SFMSCs at passage 3 were seeded in six-well plates at 5 104 cells per well. The next day, SFMSCs were transduced with either an overexpression or empty vector at a multiplicity of infection (MOI) of 3 in the presence of 8 mg/mL Polybrene (Sigma). Stable cells were established by 1 mg/ mL puromycin selection. The efficiency of transduction was evaluated by fluorescence microscopy. 2.10. sGAG assay The pellet samples were digested overnight at 56 C using 100 mL of 50 mg/mL proteinase K in 100 mM Na2HPO4 (pH 8.0). Proteinase K was then inactivated by heating for 10 min at 90 C. Following centrifugation, 500 mL of working DMMB solution was added to 50 mL of proteinase K-treated or untreated samples, and the mixture was vigorously vortexed for 30 min to promote complete GAG/DMMB complexation. The samples were centrifuged at 12,000g for 10 min. The supernatant was discarded, and the pellet
was dissolved with DMMB decomplexation solution and vortexed for 30 min. The absorbance at 656 nm was used to quantify the sGAG levels.
2.11. Statistical analysis All experiments were performed at least three times. All quantitative data are expressed as means ± standard deviation (SD). Differences were analyzed by Student's t-test or one-way ANOVA and were considered statistically significant when p < 0.05.
3. Results 3.1. Characterization and differentiation of SFMSCs Based on our previous research [4,5,7], we obtained SFMSCs by culturing diluted synovial fluid samples for 72 h, after which most individual spindle-type cells were adhered to culture plates (Fig. 1A). After culturing in osteogenic and adipogenic medium for 14 days, calcium deposits or lipid drops were observed in SFMSC cultures and confirmed by positive Alizarin red staining or Oil Red O staining, respectively. After 14 days of culturing in chondrogenic induction medium, col II was detected by immunochemical staining (Fig. 1B,C,D). Based on flow cytometry, SFMSCs expressed the surface markers CD90, CD44, CD105, CD73, but did not express CD146 CD45, CD34, CD11b, CD19, and HLA-DR (Fig. 1E), indicating that SFMSCs had the characteristics of MSCs.
Fig. 2. ZBED3-AS1 and zbed3 expression in SFMSCs and differentiated SFMSCs. (A,B,C) Immunofluorescent staining of zbed3 in SFMSCs, the human condylar process and an induced cartilage nodule; scale bar ¼ 25 mm. (D) Comparison of relative expression levels of ZBED3-AS1, ZBED3, SOX9, COL II, and b-catenin in SFMSCs before and 2 weeks after chondrogenic differentiation by qPCR (*p < 0.05). (E) Relative levels of zbed3, sox9, col II, GSK-3b, Axin1, and b-catenin expression before and 2 weeks after chondrogenic differentiation by western blotting.
Please cite this article in press as: F. Ou, et al., The LncRNA ZBED3-AS1 induces chondrogenesis of human synovial fluid mesenchymal stem cells, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.04.090
F. Ou et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e7
3.2. Identification of ZBED3-AS1 and zbed3 in SFMSCs ZBED3-AS1 and zbed3 expression in SFMSCs was mostly detected in the cytoplasm based on FISH (Fig. 1F). SFMSCs, the human condylar process, and a cartilage pellet all demonstrated zbed3 expression (Fig. 2A, B, C). The expression levels of ZBED3-
5
AS1, ZBED3, sox 9, and col II in SFMSCs were higher after 14 days of chondrogenic induction than before induction (Fig. 2D). Similarly, in a western blotting analysis, relatively higher zbed3, sox9, and col II expression, but lower GSK-3b, Axin1, and b-catenin expression levels were detected after induction than before induction (Fig. 2E).
Fig. 3. ZBED3-AS1 promotes chondrogenic differentiation of SFMSCs. (A) Overexpression of ZBED3-AS1 by lentivirus transfection with GFP; scale bar ¼ 100 mm. (B) The relative expression levels of ZBED3-AS1 and zbed3 in normal, vector, and overexpression groups determined by qPCR (*p < 0.05). (C) The relative protein levels of zbed3 in the vector and overexpression groups determined by western blotting. (D) Protein expression levels of col II, sox 9, and b-catenin before and 2 weeks after chondrogenic differentiation in the normal, vector, and overexpression groups detected by western blotting. (E) Gene expression levels of col II, sox 9, ZBED3-AS1, ZBED3, and b-catenin detected by PCR (*p < 0.05). (F) Alcian blue staining and Safranin O staining were detected in pellets of the vector and overexpression groups. (G) sGAG contents in pellets of the normal, vector, and overexpression groups (*p < 0.05).
Please cite this article in press as: F. Ou, et al., The LncRNA ZBED3-AS1 induces chondrogenesis of human synovial fluid mesenchymal stem cells, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.04.090
6
F. Ou et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e7
3.3. ZBED3-AS1 promotes chondrogenic differentiation To investigate the function of ZBED3-AS1 in chondrogenic differentiation, we overexpressed ZBED3-AS1 by lentivirus infection and puromycin screening for 3 days, resulting in a 70% transfection efficiency (Fig. 3A). We verified higher expression of ZBED3-AS1 and ZBED3 in the transfected cells than in the normal and vector control groups by PCR and western blotting (Fig. 3B and C). After 2 weeks of chondrogenic induction, the ZBED3-AS1 overexpression group had higher protein and mRNA expression levels of chondrocyte-specific markers than those in the normal and vector control groups (Fig. 3D and E). To further determine the relative contribution of ZBED3-AS1 to chondrogenesis, we analyzed Alcian blue staining, Safranin O staining, and the sGAG content. The overexpression group showed higher expression levels of chondrogenic markers than those of other groups (Fig. 3F and G).
3.4. ZBED3-AS1 enhances chondrogenic differentiation by upregulating zbed3 To study the effects of zbed3 on Wnt/b-catenin signaling, we included the wnt-pathway activator wnt3a and inhibitor DKK-1 in the chondrogenic medium. We also added DKK-1 to the overexpression group. The western blotting results (Fig. 4A) showed that the overexpression group and wnt3a group had higher expression levels of sox 9 and col II than those of the other groups. In the overexpression group treated with DKK-1, expression levels were lower than those in the overexpression group, indicating that DKK-1 could reverse the function of ZBED3-AS1. Zbed3 exhibited higher expression in the overexpression group and DKK-1 group
than in the other groups. The PCR results were consistent with the western blotting results (Fig. 4B). After 2 weeks of monolayer chondrogenic induction, b-catenin entered the nucleus based on immunofluorescent staining (Fig. 4C). During the induction of SFMSCs, b-catenin levels decreased in week 2 and subsequently increased in week 3 (Fig. 4D).
4. Discussion Many lncRNAs are involved in the regulation of stem cell differentiation [21e24]. Owing to their accessibility and high chondrogenic potential [25], SFMSCs are considered a highly suitable cell source for cartilage repair. However, the role of lncRNAs in SFMSCs is not clear. A previous study demonstrated a role of ZBED3-AS1 in the chondrogenic differentiation of human marrow MSCs [14]. Our study is the first to demonstrate the function of ZBED3-AS1 in SFMSCs. Based on the proposal of the Mesenchymal and Tissue Stem Cell Committee of the International Society for Cellular Therapy (ISCT) [26], SFMSCs could be identified as MSCs from multilineage differentiation and surface makers. Luo et al. [15] suggested that a major class of lncRNAs arranged divergently to nearby genes plays a role in transcriptional regulation to fine-tune gene expression and lineage differentiation. We found that ZBED3-AS1 is arranged divergently to the nearby gene ZBED3. ZBED3-AS1 and ZBED3 were concomitantly located in the cytoplasm of SFMSCs, and the overexpression of ZBED3-AS1 resulted in increased ZBED3 at the mRNA and protein levels. Accordingly, ZBED3-AS1 could promote the transcription of ZBED3 in cis and increase its expression. Zbed3 is a novel Axin-interacting protein that activates Wnt/
Fig. 4. ZBED3-AS1 enhances chondrogenic differentiation of SFMSCs via the upregulation of zbed3, which promotes Wnt signaling. (A) The expression of Col II, Sox9, and zbed3 were detected by western blotting after 2 weeks of chondrogenic differentiation of SFMSCs in normal, vector, overexpression, overexpression þ DKK-1, wnt3a, and DKK-1 groups. (B) Gene expression levels of col II, sox9, ZBED3, ZBED3-AS1, and b-catenin in the same groups were detected by PCR (*p < 0.05). (C) Changes in b-catenin in the nucleus were detected after 2 weeks of monolayer chondrogenic induction by immunofluorescent staining. (D) b-Catenin and sox 9 expression at 0e4 weeks was detected by western blotting.
Please cite this article in press as: F. Ou, et al., The LncRNA ZBED3-AS1 induces chondrogenesis of human synovial fluid mesenchymal stem cells, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.04.090
F. Ou et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e7
beta-catenin signaling [16,17]. Wnt signaling is important for many developmental processes. We found that zbed3 was more highly expressed than in the induced cartilage pellets. Additionally, it has been reported [20] [27,28] that the combination of TGF-b and Wnt signaling stimulates the chondrogenic differentiation of human marrow stromal cells, and the canonical Wnt signaling pathway promotes chondrocyte differentiation in a sox9-dependent manner. GSK-3 inhibitors can induce the wnt signaling pathway and promote the chondrogenic differentiation of hWJ-MSCs in the presence of TGF-b3, without inducing chondrocyte hypertrophy [29]. In the overexpression group, we detected relatively high levels of zbed3, sox 9, and col II expression, and these high expression levels could be reversed by treatment with the wnt-inhibitor DKK1. Furthermore, the wnt activator wnt3a could promote SFMSC chondrogenesis, while the wnt inhibitor DKK-1 could not. These results indicated that ZBED3-AS1 induces chondrogenesis via the wnt pathway. The detailed mechanisms by which ZBED3-AS1 influences SFMSC differentiation require further investigation. Sox9 could inhibit wnt signaling by promoting the phosphorylation of b-catenin in the nucleus [30]. In our study, wnt pathway proteins were negatively related to GSK-3b and Axin 1, which act as scaffold proteins in the phosphorylation and degradation of cytoplasmic b-catenin; these proteins exhibited decreased expression, but b-catenin expression was lower in week 2 than that of the other proteins. It is possible that in the chondrogenesis of SFMSCs, gradually increased sox 9 expression could temporarily reduce bcatenin. Interestingly, we observed that b-catenin can still be transferred to the nucleus to activate the wnt pathway after 2 weeks of monolayer chondrogenic induction. In conclusion, we demonstrated that the overexpression of the lncRNA ZBED3-AS1 in SFMSCs enhances chondrogenic potential via the upregulation of zbed3. Furthermore, zbed3 may function in chondrogenesis by regulating the Wnt pathway. Additional studies are needed to illuminate the exact functions of this lncRNA in order to facilitate the clinical application of SFMSC-based cartilage regeneration and osteoarthritis treatment. Conflicts of interest None. Acknowledgements We would like to thank all the nurses and physicians for their valuable assistance in this study. This study was supported by grants from the National Science Foundation of China (81271115), The founders had no role in the study design, data collection and analysis, decision to publish, or preparation of this manuscript. Transparency document Transparency document related to this article can be found online at http://dx.doi.org/10.1016/j.bbrc.2017.04.090. References [1] J. Ringe, M. Sittinger, Tissue engineering in the rheumatic diseases, Arthritis Res. Ther. 11 (1) (2009) 211. [2] K. Johnson, et al., A stem cell-based approach to cartilage repair, Science 336 (6082) (2012) 717e721.
7
[3] Y. Qi, G. Feng, W. Yan, Mesenchymal stem cell-based treatment for cartilage defects in osteoarthritis, Mol. Biol. Rep. 39 (5) (2012) 5683e5689. [4] Y.P. Sun, et al., Synovium fragment-derived cells exhibit characteristics similar to those of dissociated multipotent cells in synovial fluid of the temporomandibular joint, PLoS One 9 (7) (2014) e101896. [5] Y.L. Zheng, et al., Mesenchymal stem cells obtained from synovial fluid mesenchymal stem cell-derived induced pluripotent stem cells on a matrigel coating exhibited enhanced proliferation and differentiation potential, PLoS One 10 (12) (2015) e0144226. [6] N. Koyama, et al., Pluripotency of mesenchymal cells derived from synovial fluid in patients with temporomandibular joint disorder, Life Sci. 89 (19e20) (2011) 741e747. [7] W. Liu, et al., IL-1beta impedes the chondrogenic differentiation of synovial fluid mesenchymal stem cells in the human temporomandibular joint, Int. J. Mol. Med. 39 (2) (2017) 317e326. [8] Y. Isobe, et al., Comparison of human mesenchymal stem cells derived from bone marrow, synovial fluid, adult dental pulp, and exfoliated deciduous tooth pulp, Int. J. Oral Maxillofac. Surg. 45 (1) (2016) 124e131. [9] K.C. Wang, H.Y. Chang, Molecular mechanisms of long noncoding RNAs, Mol. Cell 43 (6) (2011) 904e914. [10] L. Wang, et al., Long noncoding RNAs expression signatures in chondrogenic differentiation of human bone marrow mesenchymal stem cells, Biochem. Biophys. Res. Commun. 456 (1) (2015) 459e464. [11] E. Steck, et al., Regulation of H19 and its encoded microRNA-675 in osteoarthritis and under anabolic and catabolic in vitro conditions, J. Mol. Med. Berl. 90 (10) (2012) 1185e1195. [12] C. Zhang, et al., Upregulation of lncRNA HOTAIR contributes to IL-1betainduced MMP overexpression and chondrocytes apoptosis in temporomandibular joint osteoarthritis, Gene 586 (2) (2016) 248e253. [13] D. Kim, et al., Two non-coding RNAs, MicroRNA-101 and HOTTIP contribute cartilage integrity by epigenetic and homeotic regulation of integrin-alpha1, Cell Signal 25 (12) (2013) 2878e2887. [14] L. Wang, et al., Long noncoding RNAs expression signatures in chondrogenic differentiation of human bone marrow mesenchymal stem cells, Biochem. Biophys. Res. Commun. 456 (1) (2015) 459e464. [15] S. Luo, et al., Divergent lncRNAs regulate gene expression and lineage differentiation in pluripotent cells, Cell Stem Cell 18 (5) (2016) 637e652. [16] T. Chen, et al., Identification of zinc-finger BED domain-containing 3 (Zbed3) as a novel Axin-interacting protein that activates Wnt/beta-catenin signaling, J. Biol. Chem. 284 (11) (2009) 6683e6689. [17] C. Fan, et al., Zbed3 contributes to malignant phenotype of lung cancer via regulating beta-catenin and P120-catenin 1, Mol. Carcinog. 54 (Suppl 1) (2015) E138eE147. [18] A. Hayward, et al., ZBED evolution: repeated utilization of DNA transposons as regulators of diverse host functions, PLoS One 8 (3) (2013) e59940. [19] T. Gaur, et al., Secreted frizzled related protein 1 regulates Wnt signaling for BMP2 induced chondrocyte differentiation, J. Cell Physiol. 208 (1) (2006) 87e96. [20] F. Yano, et al., The canonical Wnt signaling pathway promotes chondrocyte differentiation in a Sox9-dependent manner, Biochem. Biophys. Res. Commun. 333 (4) (2005) 1300e1308. [21] S. Loewer, et al., Large intergenic non-coding RNA-RoR modulates reprogramming of human induced pluripotent stem cells, Nat. Genet. 42 (12) (2010) 1113e1117. [22] Y. Wang, et al., Endogenous miRNA sponge lincRNA-RoR regulates Oct4, Nanog, and Sox2 in human embryonic stem cell self-renewal, Dev. Cell 25 (1) (2013) 69e80. [23] T.R. Mercer, M.E. Dinger, J.S. Mattick, Long non-coding RNAs: insights into functions, Nat. Rev. Genet. 10 (3) (2009) 155e159. [24] M.C. Tsai, et al., Long noncoding RNA as modular scaffold of histone modification complexes, Science 329 (5992) (2010) 689e693. [25] Y. Isobe, et al., Comparison of human mesenchymal stem cells derived from bone marrow, synovial fluid, adult dental pulp, and exfoliated deciduous tooth pulp, Int. J. Oral Maxillofac. Surg. 45 (1) (2016) 124e131. [26] M. Dominici, et al., Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement, Cytotherapy 8 (4) (2006) 315e317. [27] S. Zhou, K. Eid, J. Glowacki, Cooperation between TGF-beta and Wnt pathways during chondrocyte and adipocyte differentiation of human marrow stromal cells, J. Bone Min. Res. 19 (3) (2004) 463e470. [28] V. Church, et al., Wnt regulation of chondrocyte differentiation, J. Cell Sci. 115 (Pt 24) (2002) 4809e4818. [29] P. Tanthaisong, et al., Enhanced chondrogenic differentiation of human umbilical cord Wharton's jelly derived mesenchymal stem cells by GSK-3 inhibitors, PLoS One 12 (1) (2017) e0168059. [30] L. Topol, et al., Sox9 inhibits Wnt signaling by promoting beta-catenin phosphorylation in the nucleus, J. Biol. Chem. 284 (5) (2009) 3323e3333.
Please cite this article in press as: F. Ou, et al., The LncRNA ZBED3-AS1 induces chondrogenesis of human synovial fluid mesenchymal stem cells, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.04.090
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
The LncRNA ZBED3-AS1 induces chondrogenesis of human synovial fluid mesenchymal stem cells Farong Ou 1, Kai Su 1, Jiadong Sun, Wenting Liao, Yu Yao, Youhua Zheng, Zhiguang Zhang* Department of Oral and Maxillofacial Surgery, Guanghua School of Stomatology, Hospital of Stomatology, Sun Yat-sen University, Guangdong Provincial Key Laboratory of Stomatology, Guangzhou, Guangdong, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 10 April 2017 Accepted 17 April 2017 Available online xxx
Human synovial fluid-derived mesenchymal stem cells (SFMSCs) have great potential for cartilage induction and are promising for cell-based strategies for articular cartilage repair. Many long non-coding RNAs (lncRNAs) regulate chondrogenesis of MSCs. We hypothesized that the divergent lncRNA ZBED3AS1, which binds locally to chromatin, could promote the expression of zbed3, a novel Axininteracting protein that activates Wnt/b-catenin signaling, involved in chondrogenesis. However, the function of ZBED3-AS1 in SFMSCs is unclear. In this study, the expression, biological function, and roles of ZBED3-AS1 in SFMSC chondrogenesis were examined by multilineage differentiation, flow cytometry, and gain-of-function studies. We found that ZBED3-AS1 promotes chondrogenesis. Furthermore, ZBED3AS1 could directly increase zbed3 expression. Finally, the wnt-inhibitor DKK1 could reverse the stimulatory effect of ZBED3-AS1 on chondrogenesis. These findings demonstrate the role of a new lncRNA, ZBED3-AS1, in SFMSC chondrogenesis and may improve osteoarthritis treatment. © 2017 Elsevier Inc. All rights reserved.
Keywords: Human synovial fluid-derived mesenchymal stem cell lncRNA ZBED3-AS1
1. Introduction Osteoarthritis is a degenerative joint disease accompanied by progressive reductions in the extracellular matrix of joint cartilage and bone, eventually leading to joint dysfunction [1]. Stressbearing joints, such as the knee, hip, and temporomandibular joint (TMJ), are commonly affected. Cartilage tissues have a limited capacity for self-repair and remodeling. Current treatment strategies are generally aimed at relieving symptoms, instead of curing the disease. However, one potential treatment strategy for articular cartilage repair is cell-based therapy. Human mesenchymal stem cells (hMSCs), which have the capacity for self-renewal and multipotential differentiation, especially chondrogenic differentiation, are promising for cell-based strategies for articular cartilage repair [2,3]. MSCs can be obtained from a variety of tissues, including the bone marrow, adipose tissue, synovium, and synovial fluid. They are particularly easy to obtain from TMJ synovial fluid [4e7].
* Corresponding author. E-mail addresses: [email protected] (F. Ou), fi[email protected] (K. Su), [email protected] (J. Sun), [email protected] (W. Liao), [email protected] (Y. Yao), [email protected] (Y. Zheng), [email protected] (Z. Zhang). 1 These authors contributed to the work equally.
Human synovial fluid-derived mesenchymal stem cells (SFMSCs) have greater potential for cartilage induction than other tissues [8]. Accordingly, SFMSCs derived from patients with TMJ disorders could be used for therapeutic approaches. Long non-coding RNAs (lncRNAs) are a large class of nonprotein-coding transcripts of > 200 bases involved in numerous physiological and pathological processes [9]. A number of lncRNAs regulate stem cell chondrogenesis, including ZBED3-AS1 [10], H19 [11], HOTAIR [12], and HOTTIP [13]. ZBED3-AS1 is one of the most highly expressed lncRNAs in the chondrogenic differentiation of human bone marrow MSCs [14]. Based on genomic and functional analyses of pluripotent cells, Luo et al. [15] suggest that a major class of lncRNAs arranged divergently to nearby genes play pivotal roles in transcriptional regulation to fine-tune gene expression and lineage differentiation. We hypothesize that as a divergent lncRNA, ZBED3-AS1, which binds locally to zbed3, promotes zbed3 transcription in cis. There is convincing evidence that Zbed3, a novel Axin-interacting protein, activates Wnt/b-catenin signaling [16e18], which promotes chondrogenesis [19,20]. Accordingly, ZBED3-AS1 could promote chondrogenesis of SFMSCs. We examined the ZBED3-AS1 and zbed3 expression in induced SFMSCs, overexpressed ZBED3-AS1 to detect its function in chondrogenesis, and examined its relationship with zbed3 and Wnt signaling. These analyses clarified the roles of ZBED3-AS1 in SFMSC chondrogenesis.
http://dx.doi.org/10.1016/j.bbrc.2017.04.090 0006-291X/© 2017 Elsevier Inc. All rights reserved.
Please cite this article in press as: F. Ou, et al., The LncRNA ZBED3-AS1 induces chondrogenesis of human synovial fluid mesenchymal stem cells, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.04.090
2
F. Ou et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e7
2. Materials and methods
2.3. Flow cytometric analysis of SFMSCs
2.1. SFMSC culture
Surface markers, including CD90 (1:20; cat. no. 562245; BD Biosciences, San Jose, CA, USA), CD105 (1:11; cat. no. 130-094-941; Miltenyi Biotec, Bergisch Gladbach, Germany), CD73 (1:20), CD44 (1:20), and CD45/CD34/CD11b/CD19/HLA-DR (1:20) (cat. no. 562245; all from BD Biosciences), were detected using the FC500 flow cytometer and MXP software and data were analyzed using CXP software (both from Beckman Coulter, Brea, CA, USA).
This study was performed in accordance with the relevant polices of the Institutional Review Board of Guanghua School of Stomatology, Sun Yat-sen University, and complies with the principles of the Declaration of Helsinki. Informed consent was obtained from all subjects. Synovial fluid samples were collected from ten TMD patients (nine women and one man, ranging in age from 20 to 35 years) during arthrocentesis of the TMJ cavity. Cells of individual samples were seeded on 6-cm culture dishes with 3 mL of complete culture medium (10% fetal bovine serum (FBS) þ aMEM) and incubated at 37 C in 5% CO2. After 72 h, the medium was withdrawn to remove non-adherent cells and fresh medium was added. Adherent cells were expanded in a monolayer culture. The medium was refreshed every 3 days; after reaching confluence, SFMSCs were trypsinized and plated at 1000/cm2 in 10-cm dishes. SFMSC experiments were carried out at passages 4 to 6. One volunteer with a mandibular tumor was subjected to mandibular resection, and the normal condylar process was removed for research. 2.2. Multilineage differentiation of SFMSCs 2.2.1. Osteogenic differentiation Cells were plated in 6-well plates and incubated in complete culture medium at 37 C in 5% CO2. When cells reached ~ 80% confluence, the medium was replaced with osteogenic induction medium consisting of a-MEM (Gibco, Waltham, MA, USA) with 10% FBS (Gibco), 10 mM sodium-glycerophosphate (Santa Cruz Biotechnology, Santa Cruz, CA, USA), 100 nM dexamethasone (MP Biomedicals, Santa Ana, CA, USA), and 50 mM ascorbic acid-2phosphate (Wako, Osaka, Japan). The medium was replaced every 3 days for 14 days. Osteogenesis was assessed by Alizarin red staining. Cells were examined under an inverted phase contrast microscope (Axiovert 40; Zeiss, Oberkochen, Germany). 2.2.2. Adipogenic differentiation Cells were plated in 6-well plates and cultured in complete culture medium. After cells reached ~80% confluence, the medium was replaced with adipogenic induction medium that consisted of a-MEM (Gibco) containing 10% FBS (Gibco), 200 mM indomethacin (Sigma-Aldrich, St. Louis, MO, USA), 0.5 mM isobutyl methylxanthine (MP Biomedicals), 1 mM dexamethasone (MP Biomedicals), and 10 mg/mL insulin (MP Biomedicals). The medium was replaced every 3 days for 14 days. After 14 days, adipogenic induction was assessed by Oil Red O staining and visualization under an inverted phase contrast microscope (Axiovert 40; Zeiss). 2.2.3. Chondrogenic differentiation Approximately 3 105 cells were transferred to a 15-mL centrifuge tube and centrifuged at 450g for 10 min. Then, 450 mL of chondrocyte differentiation induction medium consisting of a-MEM (Gibco), 1 ITS-A (Gibco), 100 nM dexamethasone (MP Biomedicals), 50 mM ascorbic acid (Sigma-Aldrich), 40 mg/mL proline (Sigma-Aldrich), and 10 ng/mL transforming growth factor (TGF)-b1 (Life Technologies, Carlsbad, CA, USA) was added. The medium was added with or without 250 ng/mL wnt3a (R&D Systems, Minneapolis, MN, USA) or 200 ng/mL rhDKK1 (R&D Systems) and was refreshed every 3 days. The cell mass formed a pellet automatically. Experiments were carried out using the pellets. Chondrogenic differentiation was assessed by immunochemical staining for col II, Safranin O, and Alcian blue as well as an sGAG analysis.
2.4. Western blotting Proteins were isolated from SFMSCs and pellets were ground using liquid nitrogen. Equal amounts of protein were extracted in RIPA Lysis Buffer (Thermo Scientific, Waltham, MA, USA) with Protease/Phosphatase Inhibitor Cocktail (Cell Signaling Technology, Danvers, MA, USA). Proteins were separated on a Protein Gel (1.0 mm), transferred to a PVDC membrane (Bio-Rad, Hercules, CA, USA), blocked with 5% BSA, and detected with anti-sox9 (1:1000; Cell Signaling Technology), anti-col II (1:1000; Abcam, Cambridge, UK), anti-zbed3 (1:1000; Abcam), anti-b-catenin (1:1000; Cell Signaling Technology), anti-GSK-3beta (1:1000; Cell Signaling Technology), and anti-axin1 (1:1000, Cell Signaling Technology) antibodies. Images were developed with ECL using an HRPsecondary goat anti-rabbit IgG antibody. 2.5. Immunofluorescent staining for zbed3 and b-catenin Cells were plated in 35-mm glass bottom dishes and incubated in complete culture medium or chondrogenic medium for 2 weeks. The cells were fixed in 4% paraformaldehyde for 30 min before treatment with 0.3%-Triton-X100 for 15 min. Cells were blocked for 2 h with 5% bovine serum albumin (BSA). Cells were washed with 1 PBS and stained with rabbit anti-human zbed3 (Abcam) or bcatenin (CST) diluted 1:200 for 18 h at 4 C. After they were washed with 1 PBS, the cells were incubated with the secondary antibody, DyLight 488-TFP ester-conjugated goat anti-rabbit IgG antibody (EarthOx, Millbrae, CA, USA) diluted 1:100 in 1% BSA for 60 min at 37 C. After washing with 1 PBS, the cells were incubated with 1 mg/mL DAPI (Cell Signaling Technology) for 5 min. The cells were then washed before viewing under a confocal microscope (Zeiss). 2.6. Immunochemical staining for zbed3 and col II The condylar process was decalcified for 7 days, and the condylar process and pellet were then fixed with 4% formalin for 24 h and placed in embedding cassettes. Samples were embedded in paraffin blocks and cut at 5 mm. Sections were deparaffinized, and treated with 3% H2O2 for 10 min. Sections were incubated in 0.01 M citrate buffer for 20 min at 94e98 C, cooled at room temperature for 30 min, immersed in blocking buffer (5% BSA in PBS), and incubated at 37 C for 1 h. The tissue sections were then incubated in a solution of rabbit anti-human zbed3 (Abcam) diluted 1:100 and rabbit anti-human col II (Abcam) diluted 1:100 in blocking buffer for 16 h at 4 C. After three 5-min washes in PBS, slides were incubated in a solution of biotinylated goat anti-rabbit IgG (Boster, Pleasanton, CA, USA) for 30 min at 37 C. Slides were washed in PBS and streptavidin-biotin complex reagent (Boster) was applied for 30 min at 37 C. After three 3-min washes in PBS, 3,30 -diaminobenzidine (DAB; Boster) was applied for visualization. Slides were viewed under a light microscope (Axioskop 40; Zeiss). 2.7. Gene expression analysis by RT-PCR Total RNA was isolated using TRIzol (Invitrogen, Carlsbad, CA,
Please cite this article in press as: F. Ou, et al., The LncRNA ZBED3-AS1 induces chondrogenesis of human synovial fluid mesenchymal stem cells, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.04.090
F. Ou et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e7
USA) as per the manufacturer's instructions. cDNA synthesis was performed with random hexamer primers using the iScript™ cDNA Synthesis Kit (Bio-Rad). RNA expression was measured by quantitative real-time PCR using the SYBR method. The reaction was performed in 10 mL of SYBR® Green PCR Master Mix (Applied Biosystems, Waltham, MA, USA), 0.5 mM each 50 and 30 primer, 4 mL of sample, and H2O to a final volume of 20 mL. Samples were amplified for 45 cycles with denaturation at 95 C for 5 s, followed by annealing and extension at 60 C for 34 s. SYBR green fluorescence intensity was measured to determine the amount of double-
Table 1 Oligonucleotide primers used in the RT-PCR analysis. Gene
Primer sequence
ACTIN
F GACATCCGCAAAGACCTG R GGAAGGTGGACAGCGAG F TACAACTTTGCATTAACCTTCC R TGCCCTGTCCTCATGTTCG F TTCCGTCCGGGACAAAATGT R CCGCACGCCCTTTACCC F ACACACAGCTCACTCGACCTTG R AGGGAATTCTGGTTGGTCCTCT F GGCAATAGCAGGTTCACGTACA R CGATAACAGTCTTGCCCCACTT F CGACACCAAGAAGCAGAG R GAATCAATCCAACAGTAGCC
ZBED3-AS1 ZBED3 SOX 9 COL II
b-Catenin
3
stranded DNA. Relative RNA levels of target genes, i.e., sox9, col II, ZBED3-AS1, zbed3, and b-catenin, were normalized to actin levels and further compared with the control using the 2DDCt method. Primers are listed in Table 1.
2.8. FISH SFMSC climbing tablets placed in 4% paraformaldehyde (DEPC) were fixed for 20 min in PBS (pH 7.4), washed 3 times (5 min each), supplemented with proteinase K (20 mg/mL) for digestion for 8 min, and washed with PBS 3 times 5 min. Pre-hybridization was performed in a 37 C incubator for 1 h, followed by complete cooling, and hybridization (containing the ZBED3-AS1 lncRNA probe, concentration 5 ng/ml) for 35 C overnight. The mixture was washed with 2 SSC at 37 C for 10 min, 1 SSC at 37 C twice for 5 min. Slices were washed in hybridization solution, containing the probe (ZBED3 mRNA) at 5 ng/mL and maintained at 39 C for hybridization overnight. The solution was rinsed with 2 SSC at 37 C for 10 min, 1 SSC at 37 C twice for 5 min. DAPI was added, followed by incubation in the dark for 8 min, fluorescent quenching using tablets and observation under inverted fluorescence microscope. The ZBED3-AS1 probe sequence 50 -CGCCT ACAGC CGTCT TCCAG TGCCT CATTC TTG-30 was visualized with CY3, and the ZBED3 probe sequence 50 -GCGCT CCTCA GGTGC CTCCA CAACG CCGAG GTCCC-30 was visualized with FLUOR488.
Fig. 1. Characterization and differentiation of SFMSCs. (A) Typical spindle-shaped morphology of SFMSCs adhered to culture plates. Scale bar ¼ 100 mm. (B, C, D) SFMSCs showing osteogenesis based on Alizarin red staining, adipogenesis based on Oil Red O staining, and chondrogenesis based on immunohistochemical staining of Col II. B,C Scale bar ¼ 100 mm. (E) Flow cytometric analysis of SFMSCs expressing CD90, CD44, CD105, CD73, CD146 CD45, CD34, CD11b, CD19, and HLA-DR. (F) ZBED3-AS1 and ZBED3 co-localized in the cytoplasm of SFMSCs based on FISH; scale bar ¼ 50 mm.
Please cite this article in press as: F. Ou, et al., The LncRNA ZBED3-AS1 induces chondrogenesis of human synovial fluid mesenchymal stem cells, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.04.090
4
F. Ou et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e7
2.9. Construction of recombinant retroviral vectors and cell infection Full-length human ZBED3-AS1 cDNA was cloned from normal human tissue RNA pools by RT-PCR. Full-length human ZBED3-AS1 cDNA was inserted into the pHBLV-CMVIE-ZsGreen-Puro mammalian lentivirus expression vector. The recombinant retrovirus was transduced into HEK-293T cells. After the medium was removed from the HEK-293T cell cultures, retroviral particles were concentrated by centrifugation using the Retro X concentrator (Clontech, Mountain View, CA, USA) for 1 h at 1500 g at 4 C. The retroviral particles were then resuspended in 5% FBS/DMEM and stored at 80 C. For viral infection, SFMSCs at passage 3 were seeded in six-well plates at 5 104 cells per well. The next day, SFMSCs were transduced with either an overexpression or empty vector at a multiplicity of infection (MOI) of 3 in the presence of 8 mg/mL Polybrene (Sigma). Stable cells were established by 1 mg/ mL puromycin selection. The efficiency of transduction was evaluated by fluorescence microscopy. 2.10. sGAG assay The pellet samples were digested overnight at 56 C using 100 mL of 50 mg/mL proteinase K in 100 mM Na2HPO4 (pH 8.0). Proteinase K was then inactivated by heating for 10 min at 90 C. Following centrifugation, 500 mL of working DMMB solution was added to 50 mL of proteinase K-treated or untreated samples, and the mixture was vigorously vortexed for 30 min to promote complete GAG/DMMB complexation. The samples were centrifuged at 12,000g for 10 min. The supernatant was discarded, and the pellet
was dissolved with DMMB decomplexation solution and vortexed for 30 min. The absorbance at 656 nm was used to quantify the sGAG levels.
2.11. Statistical analysis All experiments were performed at least three times. All quantitative data are expressed as means ± standard deviation (SD). Differences were analyzed by Student's t-test or one-way ANOVA and were considered statistically significant when p < 0.05.
3. Results 3.1. Characterization and differentiation of SFMSCs Based on our previous research [4,5,7], we obtained SFMSCs by culturing diluted synovial fluid samples for 72 h, after which most individual spindle-type cells were adhered to culture plates (Fig. 1A). After culturing in osteogenic and adipogenic medium for 14 days, calcium deposits or lipid drops were observed in SFMSC cultures and confirmed by positive Alizarin red staining or Oil Red O staining, respectively. After 14 days of culturing in chondrogenic induction medium, col II was detected by immunochemical staining (Fig. 1B,C,D). Based on flow cytometry, SFMSCs expressed the surface markers CD90, CD44, CD105, CD73, but did not express CD146 CD45, CD34, CD11b, CD19, and HLA-DR (Fig. 1E), indicating that SFMSCs had the characteristics of MSCs.
Fig. 2. ZBED3-AS1 and zbed3 expression in SFMSCs and differentiated SFMSCs. (A,B,C) Immunofluorescent staining of zbed3 in SFMSCs, the human condylar process and an induced cartilage nodule; scale bar ¼ 25 mm. (D) Comparison of relative expression levels of ZBED3-AS1, ZBED3, SOX9, COL II, and b-catenin in SFMSCs before and 2 weeks after chondrogenic differentiation by qPCR (*p < 0.05). (E) Relative levels of zbed3, sox9, col II, GSK-3b, Axin1, and b-catenin expression before and 2 weeks after chondrogenic differentiation by western blotting.
Please cite this article in press as: F. Ou, et al., The LncRNA ZBED3-AS1 induces chondrogenesis of human synovial fluid mesenchymal stem cells, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.04.090
F. Ou et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e7
3.2. Identification of ZBED3-AS1 and zbed3 in SFMSCs ZBED3-AS1 and zbed3 expression in SFMSCs was mostly detected in the cytoplasm based on FISH (Fig. 1F). SFMSCs, the human condylar process, and a cartilage pellet all demonstrated zbed3 expression (Fig. 2A, B, C). The expression levels of ZBED3-
5
AS1, ZBED3, sox 9, and col II in SFMSCs were higher after 14 days of chondrogenic induction than before induction (Fig. 2D). Similarly, in a western blotting analysis, relatively higher zbed3, sox9, and col II expression, but lower GSK-3b, Axin1, and b-catenin expression levels were detected after induction than before induction (Fig. 2E).
Fig. 3. ZBED3-AS1 promotes chondrogenic differentiation of SFMSCs. (A) Overexpression of ZBED3-AS1 by lentivirus transfection with GFP; scale bar ¼ 100 mm. (B) The relative expression levels of ZBED3-AS1 and zbed3 in normal, vector, and overexpression groups determined by qPCR (*p < 0.05). (C) The relative protein levels of zbed3 in the vector and overexpression groups determined by western blotting. (D) Protein expression levels of col II, sox 9, and b-catenin before and 2 weeks after chondrogenic differentiation in the normal, vector, and overexpression groups detected by western blotting. (E) Gene expression levels of col II, sox 9, ZBED3-AS1, ZBED3, and b-catenin detected by PCR (*p < 0.05). (F) Alcian blue staining and Safranin O staining were detected in pellets of the vector and overexpression groups. (G) sGAG contents in pellets of the normal, vector, and overexpression groups (*p < 0.05).
Please cite this article in press as: F. Ou, et al., The LncRNA ZBED3-AS1 induces chondrogenesis of human synovial fluid mesenchymal stem cells, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.04.090
6
F. Ou et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e7
3.3. ZBED3-AS1 promotes chondrogenic differentiation To investigate the function of ZBED3-AS1 in chondrogenic differentiation, we overexpressed ZBED3-AS1 by lentivirus infection and puromycin screening for 3 days, resulting in a 70% transfection efficiency (Fig. 3A). We verified higher expression of ZBED3-AS1 and ZBED3 in the transfected cells than in the normal and vector control groups by PCR and western blotting (Fig. 3B and C). After 2 weeks of chondrogenic induction, the ZBED3-AS1 overexpression group had higher protein and mRNA expression levels of chondrocyte-specific markers than those in the normal and vector control groups (Fig. 3D and E). To further determine the relative contribution of ZBED3-AS1 to chondrogenesis, we analyzed Alcian blue staining, Safranin O staining, and the sGAG content. The overexpression group showed higher expression levels of chondrogenic markers than those of other groups (Fig. 3F and G).
3.4. ZBED3-AS1 enhances chondrogenic differentiation by upregulating zbed3 To study the effects of zbed3 on Wnt/b-catenin signaling, we included the wnt-pathway activator wnt3a and inhibitor DKK-1 in the chondrogenic medium. We also added DKK-1 to the overexpression group. The western blotting results (Fig. 4A) showed that the overexpression group and wnt3a group had higher expression levels of sox 9 and col II than those of the other groups. In the overexpression group treated with DKK-1, expression levels were lower than those in the overexpression group, indicating that DKK-1 could reverse the function of ZBED3-AS1. Zbed3 exhibited higher expression in the overexpression group and DKK-1 group
than in the other groups. The PCR results were consistent with the western blotting results (Fig. 4B). After 2 weeks of monolayer chondrogenic induction, b-catenin entered the nucleus based on immunofluorescent staining (Fig. 4C). During the induction of SFMSCs, b-catenin levels decreased in week 2 and subsequently increased in week 3 (Fig. 4D).
4. Discussion Many lncRNAs are involved in the regulation of stem cell differentiation [21e24]. Owing to their accessibility and high chondrogenic potential [25], SFMSCs are considered a highly suitable cell source for cartilage repair. However, the role of lncRNAs in SFMSCs is not clear. A previous study demonstrated a role of ZBED3-AS1 in the chondrogenic differentiation of human marrow MSCs [14]. Our study is the first to demonstrate the function of ZBED3-AS1 in SFMSCs. Based on the proposal of the Mesenchymal and Tissue Stem Cell Committee of the International Society for Cellular Therapy (ISCT) [26], SFMSCs could be identified as MSCs from multilineage differentiation and surface makers. Luo et al. [15] suggested that a major class of lncRNAs arranged divergently to nearby genes plays a role in transcriptional regulation to fine-tune gene expression and lineage differentiation. We found that ZBED3-AS1 is arranged divergently to the nearby gene ZBED3. ZBED3-AS1 and ZBED3 were concomitantly located in the cytoplasm of SFMSCs, and the overexpression of ZBED3-AS1 resulted in increased ZBED3 at the mRNA and protein levels. Accordingly, ZBED3-AS1 could promote the transcription of ZBED3 in cis and increase its expression. Zbed3 is a novel Axin-interacting protein that activates Wnt/
Fig. 4. ZBED3-AS1 enhances chondrogenic differentiation of SFMSCs via the upregulation of zbed3, which promotes Wnt signaling. (A) The expression of Col II, Sox9, and zbed3 were detected by western blotting after 2 weeks of chondrogenic differentiation of SFMSCs in normal, vector, overexpression, overexpression þ DKK-1, wnt3a, and DKK-1 groups. (B) Gene expression levels of col II, sox9, ZBED3, ZBED3-AS1, and b-catenin in the same groups were detected by PCR (*p < 0.05). (C) Changes in b-catenin in the nucleus were detected after 2 weeks of monolayer chondrogenic induction by immunofluorescent staining. (D) b-Catenin and sox 9 expression at 0e4 weeks was detected by western blotting.
Please cite this article in press as: F. Ou, et al., The LncRNA ZBED3-AS1 induces chondrogenesis of human synovial fluid mesenchymal stem cells, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.04.090
F. Ou et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e7
beta-catenin signaling [16,17]. Wnt signaling is important for many developmental processes. We found that zbed3 was more highly expressed than in the induced cartilage pellets. Additionally, it has been reported [20] [27,28] that the combination of TGF-b and Wnt signaling stimulates the chondrogenic differentiation of human marrow stromal cells, and the canonical Wnt signaling pathway promotes chondrocyte differentiation in a sox9-dependent manner. GSK-3 inhibitors can induce the wnt signaling pathway and promote the chondrogenic differentiation of hWJ-MSCs in the presence of TGF-b3, without inducing chondrocyte hypertrophy [29]. In the overexpression group, we detected relatively high levels of zbed3, sox 9, and col II expression, and these high expression levels could be reversed by treatment with the wnt-inhibitor DKK1. Furthermore, the wnt activator wnt3a could promote SFMSC chondrogenesis, while the wnt inhibitor DKK-1 could not. These results indicated that ZBED3-AS1 induces chondrogenesis via the wnt pathway. The detailed mechanisms by which ZBED3-AS1 influences SFMSC differentiation require further investigation. Sox9 could inhibit wnt signaling by promoting the phosphorylation of b-catenin in the nucleus [30]. In our study, wnt pathway proteins were negatively related to GSK-3b and Axin 1, which act as scaffold proteins in the phosphorylation and degradation of cytoplasmic b-catenin; these proteins exhibited decreased expression, but b-catenin expression was lower in week 2 than that of the other proteins. It is possible that in the chondrogenesis of SFMSCs, gradually increased sox 9 expression could temporarily reduce bcatenin. Interestingly, we observed that b-catenin can still be transferred to the nucleus to activate the wnt pathway after 2 weeks of monolayer chondrogenic induction. In conclusion, we demonstrated that the overexpression of the lncRNA ZBED3-AS1 in SFMSCs enhances chondrogenic potential via the upregulation of zbed3. Furthermore, zbed3 may function in chondrogenesis by regulating the Wnt pathway. Additional studies are needed to illuminate the exact functions of this lncRNA in order to facilitate the clinical application of SFMSC-based cartilage regeneration and osteoarthritis treatment. Conflicts of interest None. Acknowledgements We would like to thank all the nurses and physicians for their valuable assistance in this study. This study was supported by grants from the National Science Foundation of China (81271115), The founders had no role in the study design, data collection and analysis, decision to publish, or preparation of this manuscript. Transparency document Transparency document related to this article can be found online at http://dx.doi.org/10.1016/j.bbrc.2017.04.090. References [1] J. Ringe, M. Sittinger, Tissue engineering in the rheumatic diseases, Arthritis Res. Ther. 11 (1) (2009) 211. [2] K. Johnson, et al., A stem cell-based approach to cartilage repair, Science 336 (6082) (2012) 717e721.
7
[3] Y. Qi, G. Feng, W. Yan, Mesenchymal stem cell-based treatment for cartilage defects in osteoarthritis, Mol. Biol. Rep. 39 (5) (2012) 5683e5689. [4] Y.P. Sun, et al., Synovium fragment-derived cells exhibit characteristics similar to those of dissociated multipotent cells in synovial fluid of the temporomandibular joint, PLoS One 9 (7) (2014) e101896. [5] Y.L. Zheng, et al., Mesenchymal stem cells obtained from synovial fluid mesenchymal stem cell-derived induced pluripotent stem cells on a matrigel coating exhibited enhanced proliferation and differentiation potential, PLoS One 10 (12) (2015) e0144226. [6] N. Koyama, et al., Pluripotency of mesenchymal cells derived from synovial fluid in patients with temporomandibular joint disorder, Life Sci. 89 (19e20) (2011) 741e747. [7] W. Liu, et al., IL-1beta impedes the chondrogenic differentiation of synovial fluid mesenchymal stem cells in the human temporomandibular joint, Int. J. Mol. Med. 39 (2) (2017) 317e326. [8] Y. Isobe, et al., Comparison of human mesenchymal stem cells derived from bone marrow, synovial fluid, adult dental pulp, and exfoliated deciduous tooth pulp, Int. J. Oral Maxillofac. Surg. 45 (1) (2016) 124e131. [9] K.C. Wang, H.Y. Chang, Molecular mechanisms of long noncoding RNAs, Mol. Cell 43 (6) (2011) 904e914. [10] L. Wang, et al., Long noncoding RNAs expression signatures in chondrogenic differentiation of human bone marrow mesenchymal stem cells, Biochem. Biophys. Res. Commun. 456 (1) (2015) 459e464. [11] E. Steck, et al., Regulation of H19 and its encoded microRNA-675 in osteoarthritis and under anabolic and catabolic in vitro conditions, J. Mol. Med. Berl. 90 (10) (2012) 1185e1195. [12] C. Zhang, et al., Upregulation of lncRNA HOTAIR contributes to IL-1betainduced MMP overexpression and chondrocytes apoptosis in temporomandibular joint osteoarthritis, Gene 586 (2) (2016) 248e253. [13] D. Kim, et al., Two non-coding RNAs, MicroRNA-101 and HOTTIP contribute cartilage integrity by epigenetic and homeotic regulation of integrin-alpha1, Cell Signal 25 (12) (2013) 2878e2887. [14] L. Wang, et al., Long noncoding RNAs expression signatures in chondrogenic differentiation of human bone marrow mesenchymal stem cells, Biochem. Biophys. Res. Commun. 456 (1) (2015) 459e464. [15] S. Luo, et al., Divergent lncRNAs regulate gene expression and lineage differentiation in pluripotent cells, Cell Stem Cell 18 (5) (2016) 637e652. [16] T. Chen, et al., Identification of zinc-finger BED domain-containing 3 (Zbed3) as a novel Axin-interacting protein that activates Wnt/beta-catenin signaling, J. Biol. Chem. 284 (11) (2009) 6683e6689. [17] C. Fan, et al., Zbed3 contributes to malignant phenotype of lung cancer via regulating beta-catenin and P120-catenin 1, Mol. Carcinog. 54 (Suppl 1) (2015) E138eE147. [18] A. Hayward, et al., ZBED evolution: repeated utilization of DNA transposons as regulators of diverse host functions, PLoS One 8 (3) (2013) e59940. [19] T. Gaur, et al., Secreted frizzled related protein 1 regulates Wnt signaling for BMP2 induced chondrocyte differentiation, J. Cell Physiol. 208 (1) (2006) 87e96. [20] F. Yano, et al., The canonical Wnt signaling pathway promotes chondrocyte differentiation in a Sox9-dependent manner, Biochem. Biophys. Res. Commun. 333 (4) (2005) 1300e1308. [21] S. Loewer, et al., Large intergenic non-coding RNA-RoR modulates reprogramming of human induced pluripotent stem cells, Nat. Genet. 42 (12) (2010) 1113e1117. [22] Y. Wang, et al., Endogenous miRNA sponge lincRNA-RoR regulates Oct4, Nanog, and Sox2 in human embryonic stem cell self-renewal, Dev. Cell 25 (1) (2013) 69e80. [23] T.R. Mercer, M.E. Dinger, J.S. Mattick, Long non-coding RNAs: insights into functions, Nat. Rev. Genet. 10 (3) (2009) 155e159. [24] M.C. Tsai, et al., Long noncoding RNA as modular scaffold of histone modification complexes, Science 329 (5992) (2010) 689e693. [25] Y. Isobe, et al., Comparison of human mesenchymal stem cells derived from bone marrow, synovial fluid, adult dental pulp, and exfoliated deciduous tooth pulp, Int. J. Oral Maxillofac. Surg. 45 (1) (2016) 124e131. [26] M. Dominici, et al., Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement, Cytotherapy 8 (4) (2006) 315e317. [27] S. Zhou, K. Eid, J. Glowacki, Cooperation between TGF-beta and Wnt pathways during chondrocyte and adipocyte differentiation of human marrow stromal cells, J. Bone Min. Res. 19 (3) (2004) 463e470. [28] V. Church, et al., Wnt regulation of chondrocyte differentiation, J. Cell Sci. 115 (Pt 24) (2002) 4809e4818. [29] P. Tanthaisong, et al., Enhanced chondrogenic differentiation of human umbilical cord Wharton's jelly derived mesenchymal stem cells by GSK-3 inhibitors, PLoS One 12 (1) (2017) e0168059. [30] L. Topol, et al., Sox9 inhibits Wnt signaling by promoting beta-catenin phosphorylation in the nucleus, J. Biol. Chem. 284 (5) (2009) 3323e3333.
Please cite this article in press as: F. Ou, et al., The LncRNA ZBED3-AS1 induces chondrogenesis of human synovial fluid mesenchymal stem cells, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.04.090