β-catenin signaling pathway in mice

Journal Pre-proof The long noncoding RNA Crnde regulates osteoblast proliferation through the Wnt/␤-catenin signaling pathway in mice Mieradili Mulati, Yutaka Kobayashi, Akira Takahashi, Hoashi Numata, Masanori Saito, Yuichi Hiraoka, Hiroki Ochi, Shingo Sato, Yoichi Ezura, Masato Yuasa, Takashi Hirai, Toshitaka Yoshii, Atsushi Okawa, Hiroyuki Inose

PII:

S8756-3282(19)30369-2

DOI:

https://doi.org/10.1016/j.bone.2019.115076

Reference:

BON 115076

To appear in: Received Date:

5 July 2019

Revised Date:

18 September 2019

Accepted Date:

21 September 2019

Please cite this article as: Mulati M, Kobayashi Y, Takahashi A, Numata H, Saito M, Hiraoka Y, Ochi H, Sato S, Ezura Y, Yuasa M, Hirai T, Yoshii T, Okawa A, Inose H, The long noncoding RNA Crnde regulates osteoblast proliferation through the Wnt/␤-catenin signaling pathway in mice, Bone (2019), doi: https://doi.org/10.1016/j.bone.2019.115076

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.

The long noncoding RNA Crnde regulates osteoblast proliferation through the Wnt/βcatenin signaling pathway in mice

Mieradili Mulati MDa, Yutaka Kobayashi MDa, Akira Takahashi MD, PhDa, Hoashi

ro of

Numata MDa, Masanori Saito MD, PhDa, Yuichi Hiraoka PhDb,c, Hiroki Ochi DVM, PhDa, Shingo Sato MD, PhDa, Yoichi Ezura MD, PhDd, Masato Yuasa MD, PhDa,

Takashi Hirai MD, PhDa, Toshitaka Yoshii MD, PhDa, Atsushi Okawa MD, PhDa, and

re

Department of Orthopedics, Graduate School, Tokyo Medical and Dental University, 1-

lP

a

-p

Hiroyuki Inose MD, PhDa,*

5-45 Yushima, Bunkyo-ku, Tokyo 113-8519, Japan;

b

Laboratory of Molecular

na

Neuroscience, Medical Research Institute, Tokyo Medical and Dental University

ur

(TMDU), Bunkyo-ku, Tokyo 113-8510, Japan; cLaboratory of Genome Editing for Biomedical Research, Medical Research Institute, Tokyo Medical and Dental University

Jo

(TMDU), Bunkyo-ku, Tokyo 113-8510, Japan; dDepartment of Molecular Pharmacology, Medical Research Institute, Tokyo Medical and Dental University, Tokyo 113-8510, Japan

1

*To whom correspondence should be addressed: Hiroyuki Inose, MD, PhD: Department of Orthopedics, Graduate School, Tokyo Medical and Dental University, 1-5-45 Yushima, Bunkyo-ku, Tokyo 113-8519, Japan; [email protected]; Phone: +81-3-5803-5279; Fax: +81-3-5803-5281



ro of

Highlights The lncRNA Crnde is expressed in osteoblasts and regulates osteoblast proliferation

Crnde knockout mice showed low bone mass due to impaired osteoblast

-p



Crnde regulates bone formation and thus bone metabolism via Wnt/β-catenin

lP



re

proliferation

Abstract

na

signaling

ur

In the past decade, a growing importance has been placed on understanding the

Jo

significance of long noncoding RNAs (lncRNAs) in regulating development, metabolism, and homeostasis. Osteoblast proliferation and differentiation are essential elements in skeletal development, bone metabolism, and homeostasis. However, the underlying mechanisms of lncRNAs in the process of osteoblast proliferation and differentiation

2

remain largely unknown. Through comprehensive analysis of lncRNAs during bone formation, we show that colorectal neoplasia differentially expressed (Crnde), previously viewed as a cancer-related lncRNA, is an important regulator of osteoblast proliferation and differentiation. Crnde was found to be expressed in osteoblasts, and its expression

ro of

was induced by parathyroid hormone. Furthermore, Crnde knockout mice developed a low bone mass phenotype due to impaired osteoblast proliferation and differentiation. Overexpression of Crnde in osteoblasts promoted their proliferation, and conversely,

-p

reduced Crnde expression inhibited osteoblast proliferation. Although ablation of Crnde

re

inhibited osteoblast differentiation, overexpression of Crnde restored it. Finally, we

lP

provided evidence that Crnde modulates bone formation through Wnt/β-catenin signaling.

Keywords:

na

Therefore, our data suggest that Crnde is a novel regulator of bone metabolism.

Parathyroid

hormone;

noncoding

RNA;

osteoporosis;

osteoblast;

Jo

ur

proliferation; Wnt signaling

1. Introduction With advancing age, an imbalance in bone remodeling can lead to osteoporosis,

the prevalence of which has increased rapidly owing to an overall aging society. Osteoblasts play an important role in skeletal development and bone remodeling [1, 2]. 3

Thus, elucidating the regulatory mechanism for osteoblast differentiation and proliferation is imperative to facilitate the development of novel strategies to treat bone loss diseases [3-5]. Molecular and genetic research has uncovered various regulatory mechanisms

ro of

for bone remodeling [1, 2, 4, 6-12]; among them, transcription factors play a pivotal role. Specifically, Runx2 and Osterix (Osx) are the only known transcription factors described

as essential for osteoblast differentiation [2]. However, considering that the total number

-p

of coding genes is comparable between vertebrates and invertebrates despite the

re

differences in morphological and functional complexity of the organisms [13], additional

lP

mechanisms for controlling skeletal development and bone remodeling may exist in vertebrates.

na

Recently, long noncoding RNAs (lncRNAs) have emerged as important

ur

regulators in many physiological processes including tumorigenesis, immune response to viral infection, and cellular differentiation and function [14, 15]. lncRNAs are single-

Jo

stranded RNA molecules that are more than 200 nucleotides long [16]. They do not encode proteins, but instead regulate gene expression by behaving as signals, decoys, guides, and scaffolds [17]. Surprisingly, non-coding RNA accounts for 98% of all genomic output in humans [18], and biological complexity is positively correlated with

4

the proportion of non-coding RNA compared to protein-coding RNA [19]. Additionally, previous reports have implicated lncRNAs in the differentiation of osteoclasts and osteoblasts in vitro [20-24]. However, whether lncRNAs maintain this bone remodeling function in vivo remains to be established. Therefore, the aim of this study was to

ro of

investigate the lncRNA regulatory mechanism in bone formation in vivo.

2. Materials and Methods

-p

2.1 Cell culture

re

MC3T3-E1 cells were purchased from the Riken Cell Bank (Tsukuba, Japan).

lP

Primary osteoblasts were cultured as previously described [6]. Bone marrow mesenchymal stem cells (BMSCs) were cultured as previously described [25]. MC3T3-

na

E1 cells, primary calvarial cells, and BMSCs were maintained in Minimum Essential

ur

Medium Eagle Alpha Modification (α-MEM; Sigma) containing 2 mM L-glutamine, 100 units/ml penicillin, 10 µg/ml streptomycin, and 10% fetal bovine serum (FBS; Sigma) in

Jo

5% CO2. For osteogenic differentiation, when cells became 100% confluent, the culture medium was changed to osteogenic medium containing 10 mM -glycerophosphate (Sigma) and 50 g/ml ascorbic acid phosphate (Wako). Cells were treated with or without 20 nM PTH, 100 nM dexamethasone (Sigma), or 100 ng/ml BMP2 to further promote

5

bone formation. The total number of cells in the visual field of four different regions was determined. For adipogenic differentiation, when cells became 100% confluent, the culture medium was changed to adipogenic medium consisting of control medium supplemented with 100 nM dexamethasone, 500 M isobutylmethylxanthine (Sigma),

ro of

and 100 M indomethacin (Sigma). The results are representative of four independent experiments.

-p

2.2 Microarrays

re

MC3T3-E1 cells were treated with PTH at 20 nM or PBS. Total RNA from each

lP

sample was isolated following 60 min of TRIzol treatment. Microarray analysis was performed using the Affymetrix “ExonExprChip.MoGene-1_0-st-v1,” according to

ur

na

previously described protocols [26].

2.3 Cloning and gene expression

Jo

Full-length Crnde cDNA fragments were chemically synthesized and then

cloned into the pcDNA3.2/V5-DEST vector (Invitrogen). For Crnde overexpression studies, MC3T3-E1 cells and mouse primary calvarial osteoblasts were seeded in 24-well

6

plates and transfected using the Lipofectamine LTX reagent (Invitrogen) according to the manufacturer’s instructions.

2.4 Quantitative real-time PCR analysis

ro of

To acquire RNA from mouse bones, bone marrow was flushed from the femur with PBS, and bone RNA was extracted with TRIzol reagent (Invitrogen); RNA from other tissues and cultured cells was also extracted using TRIzol reagent. Reverse

-p

transcription was performed using the High-Capacity cDNA Reverse Transcription Kit

re

(Applied Biosystems) according to the manufacturer’s instructions. We performed

lP

quantitative analysis of gene expression using the Mx3000p qPCR system (Agilent Technologies). GAPDH expression was used as an internal control. Primer sequences are

ur

na

available upon request.

2.5 Generation of Crnde knockout mice

Jo

Crnde knockout mice (hereafter Crnde-/- mice) were established by CRISPR-

mediated genome editing by utilizing a cloning-free CRISPR/Cas system as described previously [27]. Two distinct CRISPR RNAs (crRNAs) were designed in the flanking region of the Crnde coding genomic region (NC_000074.6:92,359,129-92,323,022). The

7

whole Crnde coding region was ablated by microhomology-mediated end joining with a single-stranded oligo DNA donor, which contains a 75 bp region up- or downstream from the DNA double-stranded breaks determined by each crRNA. All the CRISPR/Cas9 components and donor oligo nucleotides were co-injected to fertilized mouse eggs from

ro of

C57/BL/6J mice by microinjection. The sequences of the crRNAs, trans-activating crRNA (tracrRNA), and oligo DNA donor were as follows: for

upstream

of

Crnde:

-p

crRNA

5'-

for

downstream

of

Crnde:

lP

crRNA

re

GGAGACCAACGCCCAAUCAGGUUUUAGAGCUAUGCUGUUUUG-3', 5'-

UUAGCAAGCAAGAACAGGGGGUUUUAGAGCUAUGCUGUUUUG-3', 5'-

na

tracrRNA:

ur

AAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAA AGUGGCACCGAGUCGGUGCU-3',

Jo

oligo

DNA

donor:

5'-

GTTGGACCCCGCGGACTACATTCTCCAAGAACCTCTAGGCCTACCCCGCCCT TCCCCTACACAGCTTCGCCTCTGGGGCGGAGCTCAGAGAAAATGCCTATCTA GTATTGAAAACAGAGAGGGGGTTGTCTCTATCGCCGTGTCTCTAAG-3'.

8

All oligonucleotides were chemically synthesized and purified by high-pressure liquid chromatography (FASMAC). Genomic DNA was prepared from the tails of F0 and F1 newborn mice by proteinase K treatment and subsequent standard phenol extraction. Crnde-/- mice were screened by PCR with ExTaq (Takara) and three different pairs of

were further cloned and analyzed by sequencing (Fig. S2).

ro of

primers and analyzed by electrophoresis in 1% or 2% agarose gel (Fig. S1). PCR products

All mice were maintained under standard conditions with food and water available ad

-p

libitum under a 12 h light/dark cycle. All animal experiments were performed with the

re

approval of the Animal Study Committee of Tokyo Medical and Dental University and

lP

conformed to relevant ethics guidelines and laws.

na

2.6 Western blot and immunohistochemistry

ur

For immunological detection, 20 μg of cell lysate was separated via SDS-PAGE (7.5 to 10% Tris gel). After the proteins were blotted onto a polyvinylidene difluoride

Jo

(PVDF) membrane, the membrane was incubated with PVDF Blocking Reagent for Can Get Signal (TOYOBO). Proteins were probed with primary antibodies against CCND1 (Santa Cruz Biotechnology) and GAPDH (MBL). A horseradish peroxidase-conjugated

9

goat anti-rabbit secondary antibody was then added and detected through autoradiography using enhanced chemiluminescence (ECL Plus, General Electric Healthcare). Frozen samples were embedded in 4% carboxymethyl cellulose (CMC) sodium (Leica Microsystems A/S) and fixed in 4% paraformaldehyde prior to immunostaining.

ro of

Frozen tissue sections (7 µm) were immunostained overnight with an anti-Ki67 (Abcam, 1:1000) primary antibody and an anti-Runx2 primary antibody (R&D Systems, 1:200) at

4 °C. We then applied goat anti-rabbit IgG H&L secondary antibody (Abcam, 1:200) and

-p

donkey anti-goat IgG H&L secondary antibody (Abcam, 1:200). Following 4,6-

re

diamidino-2-phenylindole (DAPI) staining, slides were mounted in Fluorescence

lP

Mounting Medium (DAKO) and stored at 4 °C in the dark. Detection by microscopy was performed on a Nikon Eclipse 80i microscope, and composite images were created using

ur

na

ImageJ (National Institutes of Health).

2.7 BrdU labeling

Jo

Mice were injected intraperitoneally with BrdU (100 μg/g body weight) 24 h and

2 h before sacrifice. Limbs were dissected and embedded in 4% CMC sodium. BrdU was detected using a BrdU immunohistochemistry kit (Abcam) according to the manufacturer’s protocol. After incubation in a streptavidin-horseradish peroxidase

10

conjugate, a tyramide signal amplification system (PerkinElmer) was used to detect fluorescent signals.

2.8 TUNEL assay

ro of

Osteoblast apoptosis in 12-week-old wild-type or Crnde-/- mouse femur was examined via TUNEL assays. TUNEL assays were performed with the ApopTag system (Millipore) according to the manufacturer’s instructions. After applying anti-digoxigenin

-p

conjugate, a tyramide signal amplification system (PerkinElmer) was used to detect

lP

re

fluorescent signals.

2.9 Histology and histomorphometry

na

Bone histology and histomorphometry were performed at the L3 and L4

ur

vertebrae in 3-month-old female mice, as described previously [7, 28]. Histological sections were viewed under a microscope (Olympus) using a 20× objective lens.

Jo

Histomorphometric analysis was performed using the Osteomeasure System (OsteoMetrics). For each group, 4-6 mice were analyzed.

2.10 MicroCT analysis

11

We obtained 3D images of distal femurs via microCT (μCT, Comscan). We examined seven to nine mice in each group for bone morphometric analysis.

2.11 Biochemistry

ro of

Blood samples were collected through cardiac puncture. These samples were kept at room temperature for 30 min and centrifuged at 12,000 g for 15 min at 4 °C. Serum procollagen type 1 N-terminal propeptide (P1NP) and C-terminal telopeptide of type 1

-p

collagen (CTX-I) levels were measured via ELISA for mouse P1NP (Cloud-Clone) and

re

CTX-I (Immunodiagnostic Systems) according to the manufacturer's instructions,

lP

respectively.

na

2.12 Luciferase reporter assays

ur

Primary calvarial osteoblasts from wild-type and Crnde-/- mice were plated into 24-well plates and incubated overnight at 37°C. The next day, the cells were transfected

Jo

with pTOP-FLASH or pFOP-FLASH reporter plasmids (0.5 μg each) and pGL4.74 hRluc/TK Renilla plasmid using Lipofectamine LTX. Twenty-four hours later, luciferase activity was examined.

12

2.13 Statistics All data are presented as the means ± SD. We performed statistical analysis using Student’s t-test, and P < 0.05 was considered statistically significant.

ro of

3. Results 3.1 Identification of varying lncRNA expression during bone formation

To study the potential involvement of lncRNAs in bone formation, we first

-p

attempted to identify lncRNAs that are expressed within the osteoblastic cell lineage,

re

particularly those with expression that is altered during bone formation. To that end, we

lP

treated MC3T3-E1 cells with PTH, an established model for studying osteoblast differentiation and proliferation [7, 26, 29]. We then comprehensively analyzed lncRNA

na

expression after PTH treatment using a microarray that detects known lncRNAs [30]. Alp

ur

was found to be upregulated by PTH treatment as previously reported [29]. Our results demonstrated that osteoblasts express many lncRNAs, and that PTH induces >1.7-fold

Jo

changes in the expression of 118 lncRNAs (4.9%) (Fig. 1a). Crnde was the lncRNA that was chosen for further analysis because it was determined to be the most abundantly expressed in MC3T3-E1 cells, and its role in bone remodeling has not yet been described (Fig. 1a). Since Crnde was originally found to be expressed exclusively in cancer cells

13

[31-34]. we first verified its expression in the osteoblastic lineage using primary mouse osteoblasts. Using real-time PCR analysis, we observed Crnde expression in primary calvarial osteoblasts (Fig. 1b) and MC3T3-E1 cells (Fig. 1c), and interestingly, Crnde expression transiently increased during osteoblast differentiation (Fig. 1b and c). Next,

ro of

we investigated whether Crnde expression was induced during osteoblast differentiation of MC3T3-E1 cells cultured in osteogenic medium supplemented with dexamethasone.

Indeed, Crnde expression was transiently increased during osteoblast differentiation by

-p

dexamethasone (Fig. 1d). We then examined its expression levels in various tissues.

re

Results indicated that while Crnde expression was highest in lung tissue, its expression

lP

was higher in bone compared to kidney, heart, brain, or liver tissue (Fig. 1e). Taken together, these experiments confirmed that Crnde is expressed in the osteoblastic cell

ur

na

lineage and within multiple types of tissue including bone.

3.2 Crnde is a regulator of bone formation in vivo

Jo

We next sought to address the in vivo role of Crnde in bone formation; we

therefore generated Crnde-/- mice using a CRISPR/Cas9 system (Fig. 2a). Through μCT and histological analysis, we determined that these mice displayed a low bone mass phenotype both in trabecular and cortical bones (Fig. 2a and 2b). Furthermore, bone

14

histomorphometric analysis revealed that bone formation parameters, such as bone formation rate, osteoblast number/bone surface, osteoid thickness, and mineralizing surface to bone surface (MS/BS) were significantly decreased in Crnde-/- mice (Fig. 2c and 2d). In contrast, osteoclast surface, a marker of bone resorption, was similar in wild-

ro of

type mice and Crnde-/- mice, indicating that osteoclastic bone resorption was not affected (Fig. 2e). The expression of osteoblastic gene markers such as Alp, Runx2, Osx, Col1a1,

Spp1, and Bglap2 were significantly downregulated in Crnde-/- mice (Fig. 2f).

-p

Accordingly, serum levels of P1NP, a biomarker correlated with bone formation [35],

re

were decreased in Crnde-/- mice (Fig. 2g). Conversely, CTX-I, a biomarker for bone

lP

resorption, showed no difference between Crnde-/- mice and wild-type mice (Fig. 2g). Collectively, these results demonstrated that deletion of Crnde led to low bone mass in

ur

na

vivo.

3.3 Crnde regulates osteoblast proliferation and differentiation

Jo

The increase in PTH-induced Crnde expression and low number of osteoblasts

in Crnde-/- mice prompted us to examine whether Crnde regulates osteoblast proliferation and/or differentiation. To this end, we transiently transfected a Crndeexpressing vector into MC3T3-E1 cells. Indeed, results revealed that Crnde promoted

15

osteoblastic proliferation (Fig. 3a). Accordingly, we then determined whether decreasing Crnde expression inhibits osteoblast proliferation. Because the knockdown efficiency of Crnde using siRNA was low, we used primary calvarial osteoblasts for in vitro loss-offunction experiments. Indeed, deletion of Crnde was found to significantly inhibit

ro of

proliferation (Fig. 3b). In particular, the MTT assay demonstrated an 80% decrease in cell proliferation of Crnde-/- osteoblasts (Fig. 3b). We then determined if the previously

observed decrease in the number of osteoblasts within Crnde-/- mice was directly

-p

attributable to decreased osteoblast proliferation, increased apoptosis, or both, and thus,

re

Ki-67, BrdU, and TUNEL staining were performed. In Crnde-/- mice, fewer Ki-67- and

lP

BrdU-positive osteoblasts were found compared with wild-type controls (Fig. 3c and d). In addition, TUNEL staining revealed no significant difference in the number of apoptotic

na

osteoblasts in Crnde-/- mice compared to controls (Fig. 3e). Regarding Crnde regulation

ur

of osteoblast differentiation, Crnde deletion inhibited osteoblast differentiation as indicated by an approximately 30% decrease in Alp expression based on qPCR analysis

Jo

(Fig. 3f). Because deletion of Crnde inhibited osteoblast differentiation, we next asked whether increasing Crnde expression would increase osteoblast differentiation. Indeed, overexpression of Crnde significantly promoted osteoblast differentiation as demonstrated by the increase in Alp, Spp1, and Col1a1 expression (Fig. 3g). Moreover,

16

whereas the ablation of Crnde inhibited osteoblast differentiation, overexpression of Crnde partially restored it (Fig. 3h). Then, we evaluated whether Crnde regulates differentiation of BMSCs. Although ablation of Crnde repressed osteoblast differentiation of BMSCs, there was no significant difference in adipogenic

ro of

differentiation between Crnde knockout and wild-type mice based on Ppar expression determined by qPCR analysis (Fig. 3i). Taken together, these results suggest that Crnde, which is expressed in the osteoblastic cell lineage, regulates osteoblast proliferation and

re

-p

differentiation but does not appear to regulate apoptosis.

lP

3.4 Crnde modulates Wnt/β-catenin signaling in osteoblasts To examine the molecular mechanism by which Crnde regulates osteoblast

na

proliferation and differentiation, we first investigated the expression of possible target

ur

genes of Crnde in osteoblasts. Previous studies showed that increased CRNDE expression in human cancer cells promotes their proliferation through silencing CDKN1A expression

Jo

in colorectal cancer cells [31], or by positively regulating IRS1 in pancreatic cancer cells [36]. However, our qPCR analysis indicated that the expression of both these genes was not changed in osteoblasts (Fig. 4a). Instead, we identified several target genes known to be downstream of the Wnt/-catenin signaling that were downregulated in Crnde-

17

deficient osteoblasts, such as Ccnd1, C-myc, Tcf7I2, Tcf7, and Dkk1 (Fig. 4a). Western blotting showed that CCND1 was significantly repressed in Crnde-/- calvaria compared with wild-type calvaria (Fig. 4b). Moreover, the effects of Crnde were reversed in Crndeoverexpressing MC3T3-E1 cells (Fig. 4c). Thus, we hypothesized that activation of the

ro of

Wnt/-catenin pathway is one of the major mechanisms responsible for the cell proliferation induced by Crnde in osteoblasts. To test this hypothesis, we performed the TOP/FOP luciferase activity assay to demonstrate suppressed Wnt/-catenin signaling in

-p

Crnde-deficient osteoblasts in culture (Fig. 4d). Although there may be additional

re

pathways that explain the suppressed osteoblast differentiation by Crnde deficiency as

lP

demonstrated by decreased Alp, Runx2, and Osx expression in calvarial osteoblasts, our study indicated that Crnde is one of the molecules responsible for bone mass maintenance

ur

least in part.

na

in mouse, regulating osteoblast proliferation by activating Wnt/-catenin signaling, at

Jo

4. Discussion

Our study demonstrates an important role for Crnde in bone formation. Firstly,

we showed that Crnde is expressed in the osteoblastic lineage and is induced by PTH. We then provided evidence that Crnde regulates osteoblast proliferation and differentiation

18

in vivo. Overexpression of Crnde in osteoblasts promoted their proliferation, and conversely, reduced

Crnde expression inhibited osteoblast

proliferation

and

differentiation. Lastly, we have shown that Crnde modulates the Wnt/β-catenin signaling pathway in osteoblasts. Although recent reports have suggested the involvement of

ro of

lncRNAs in bone formation [21, 22], these reports were based solely on in vitro observations. Thus, little is known regarding the in vivo regulation of bone remodeling

role for lncRNA in osteoblast proliferation.

-p

by lncRNAs. To our knowledge, this study is the first to demonstrate an in vivo regulatory

re

Previous studies revealed that CRNDE is elevated in various human cancers

lP

including colorectal cancer, glioma, and hepatocellular carcinoma. Accordingly, the role of CRNDE in the regulation of cell proliferation within the context of cancer has been

na

described previously. For example, in colorectal cancer cells, CRNDE has been shown to

ur

promote cell proliferation via silencing of CDNK1A expression [31]. Furthermore, in glioma cells, CRNDE exerts oncogenic function by attenuating mir-384 [37]. However,

Jo

the impact that CRNDE exerts on bone metabolism had not been extensively investigated. Although the homology of CRNDE between human and mouse is not high, there

are two highly conserved genomic regions in vertebrates as far as chicken: one in intron 1 (gVC-In1) and the other in intron 4 (gVC-In4). In particular, conservation of gVC-In4

19

extends to Xenopus and zebrafish [38]. siRNA-mediated knockdown studies of gVC-In4 indicated that CRNDE transcripts can regulate cellular metabolism in colorectal cancer cells [39]. Because the predictive regulatory element gVC-In4 is highly conserved in human and mouse, Crnde might also regulate cellular metabolism in murine cells.

ro of

Moreover, mouse studies have shown that Crnde expression is associated with cell cycle progression and regulation, and with brain oncogenesis [40]. Interestingly, significant downregulation of genes with predicted binding sites in their upstream regulatory regions

-p

for the E2F family of transcription factors was observed in Crnde knockout mouse brains

re

[40]. Therefore, Crnde deletion may be expected to inhibit osteoblast proliferation.

lP

Indeed, we have demonstrated that Crnde was expressed in osteoblasts and that it regulated osteoblast proliferation in vivo. Thus, the role of CRNDE in skeletal

na

malignancies involving abnormal osteoblast proliferation, such as osteosarcoma, should

ur

be investigated further.

Recently, the lncRNA Bmncr was shown to regulate adipogenic and osteoblast

Jo

differentiation of BMSCs [41]. Because Crnde regulates osteoblast differentiation and proliferation, we investigated whether Crnde is involved in cell fate switch of BMSCs. However, although ablation of Crnde inhibited osteoblast differentiation of BMSCs, it did not affect adipogenic differentiation of BMSCs (Fig. 3f). Therefore, Crnde appears to

20

be involved in osteoblast differentiation of BMSCs but not regulation of cell fate switch of BMSCs. We also sought to elucidate the molecular mechanism associated with the observed effects of Crnde on bone formation. Western blotting verified that CCND1

ro of

accumulation was regulated, at least in part, by Crnde in osteoblasts. However, considering that lncRNAs can regulate multiple target genes, the effect of Crnde on bone formation may not depend solely on Ccnd1. Although the results of this study suggested

-p

that Crnde regulates osteoblast proliferation and differentiation, Ccnd1 is primarily

re

involved in osteoblast proliferation rather than proliferation [42]. Therefore, it is likely

lP

that other genes affecting osteoblast differentiation may be targets of Crnde as well. A more precise analysis of all the putative targets of Crnde will allow us to address this

na

question.

ur

Considering the regulation of bone resorption by Crnde, Crnde-/- mice showed no significant differences in osteoclast parameters in this study. On the contrary, bone

Jo

formation was repressed in Crnde-/- mice; bone turnover markers showed the same trend. These results demonstrated that Crnde may not be essential for osteoclasts and regulates bone metabolism through bone formation in mice. At present, the molecular mechanism responsible for Crnde regulation is

21

unknown. Crnde is expressed in osteoblastic cells and regulates osteoblast proliferation. It is, therefore, possible that transcription factors regulating osteoblast proliferation such as Runx2 [43] and Osx [44] also regulate Crnde expression. Indeed, there are many putative binding sites for these factors in the sequence upstream of Crnde. Moreover,

ro of

Crnde shares a bidirectional promoter with the Iroquois homeobox gene IRX5 [40]. IRX5 is expressed during bone tissue formation and facilitates patterning and mineralization of

the skeleton [45]. Interestingly, while humans carrying mutations in IRX5 were

-p

susceptible to osteoporosis and craniofacial defects (Hamamy syndrome) [46], mice

re

lacking Irx5 have a largely normal phenotype [45]. Considering that antisense genomic

lP

pairing of lncRNAs with protein coding genes offers a reciprocal regulatory potential [47],

syndrome.

na

it would be of interest to investigate the role of CRNDE in patients with Hamamy

ur

In conclusion, we demonstrated a regulatory role for Crnde in bone formation in vivo. From a clinical point of view, promoting CRNDE expression may represent a novel

Jo

therapeutic option for bone degenerative diseases.

Author Contributions

22

A.O. and H.I. designed the study; M.M., A.T., H. N., M.S., Y.E., Y.K., Y.H., and H.O. performed the study; M.M., S.S., M.Y, T.H., T.Y., and H.I. analyzed the data; M.M. and H.I. take responsibility for the integrity of the data analysis; and H.I. wrote the paper.

Funding

ro of

This work was supported by Japan Society for the Promotion of Science [grant number 15K15542 (to H.I.)], Nakatomi Foundation [grant number NF-2018-R10 (to Y.K.)], the General Insurance Association of Japan [grant number 18-1-106 (to Y.K.)], and Japan

Acknowledgments

re

lP

Declarations of interest: None.

-p

Osteoporosis Society (to H.I.).

na

We would like to thank Editage [http://www.editage.com] for editing and reviewing this

Jo

ur

manuscript for English language.

23

References [1] G. Karsenty, H.M. Kronenberg, C. Settembre, Genetic Control of Bone Formation, Annual Review of Cell and Developmental Biology 25(1) (2009). [2] T. Komori, Regulation of osteoblast differentiation by transcription factors, J Cell Biochem 99(5) (2006) 1233-9. [3] S. Khosla, J.J. Westendorf, M.J. Oursler, Building bone to reverse osteoporosis and repair fractures, J Clin Invest 118(2) (2008) 421-8. [4] C.J. Rosen, Clinical practice. Postmenopausal osteoporosis, N Engl J Med 353(6) (2005)

ro of

595-603. [5] P. Sambrook, C. Cooper, Osteoporosis, Lancet 367(9527) (2006) 2010-2018.

[6] H. Inose, H. Ochi, A. Kimura, K. Fujita, R. Xu, S. Sato, M. Iwasaki, S. Sunamura, Y. Takeuchi, S. Fukumoto, K. Saito, T. Nakamura, H. Siomi, H. Ito, Y. Arai, K. Shinomiya, S. Takeda, A microRNA regulatory mechanism of osteoblast differentiation, Proc Natl Acad Sci

-p

U S A 106(49) (2009) 20794-9.

[7] A. Takahashi, M. Mulati, M. Saito, H. Numata, Y. Kobayashi, H. Ochi, S. Sato, P. Kaldis, A. Okawa, H. Inose, Loss of cyclin-dependent kinase 1 impairs bone formation, but does not

re

affect the bone-anabolic effects of parathyroid hormone, The Journal of biological chemistry (2018).

lP

[8] Y. Yu, H. Newman, L. Shen, D. Sharma, G. Hu, A.J. Mirando, H. Zhang, E. Knudsen, G.F. Zhang, M.J. Hilton, C.M. Karner, Glutamine Metabolism Regulates Proliferation and Lineage Allocation in Skeletal Stem Cells, Cell metabolism 29(4) (2019) 966-978.e4. [9] M. Hayashi, T. Nakashima, N. Yoshimura, K. Okamoto, S. Tanaka, H. Takayanagi,

na

Autoregulation of Osteocyte Sema3A Orchestrates Estrogen Action and Counteracts Bone Aging, Cell metabolism 29(3) (2019) 627-637.e5. [10] Y. Fan, J.I. Hanai, P.T. Le, R. Bi, D. Maridas, V. DeMambro, C.A. Figueroa, S. Kir, X.

ur

Zhou, M. Mannstadt, R. Baron, R.T. Bronson, M.C. Horowitz, J.Y. Wu, J.P. Bilezikian, D.W. Dempster, C.J. Rosen, B. Lanske, Parathyroid Hormone Directs Bone Marrow Mesenchymal

Jo

Cell Fate, Cell metabolism 25(3) (2017) 661-672. [11] W. Zou, M.B. Greenblatt, N. Brady, S. Lotinun, B. Zhai, H. de Rivera, A. Singh, J. Sun, S.P. Gygi, R. Baron, L.H. Glimcher, D.C. Jones, The microtubule-associated protein DCAMKL1 regulates osteoblast function via repression of Runx2, The Journal of experimental medicine 210(9) (2013) 1793-806. [12] M. Brunner, A. Millon-Frémillon, G. Chevalier, I.A. Nakchbandi, D. Mosher, M.R. Block, C. Albigès-Rizo, D. Bouvard, Osteoblast mineralization requires b1 integrin/ICAP-1– dependent fibronectin deposition, The Journal of experimental medicine 208(8) (2011) i26-

24

i26. [13] J.C. Venter, M.D. Adams, E.W. Myers, P.W. Li, R.J. Mural, G.G. Sutton, H.O. Smith, M. Yandell, C.A. Evans, R.A. Holt, J.D. Gocayne, P. Amanatides, R.M. Ballew, D.H. Huson, J.R. Wortman, Q. Zhang, C.D. Kodira, X.H. Zheng, L. Chen, M. Skupski, G. Subramanian, P.D. Thomas, J. Zhang, G.L. Gabor Miklos, C. Nelson, S. Broder, A.G. Clark, J. Nadeau, V.A. McKusick, N. Zinder, A.J. Levine, R.J. Roberts, M. Simon, C. Slayman, M. Hunkapiller, R. Bolanos, A. Delcher, I. Dew, D. Fasulo, M. Flanigan, L. Florea, A. Halpern, S. Hannenhalli, S. Kravitz, S. Levy, C. Mobarry, K. Reinert, K. Remington, J. Abu-Threideh, E. Beasley, K. Biddick, V. Bonazzi, R. Brandon, M. Cargill, I. Chandramouliswaran, R. Charlab, K.

ro of

Chaturvedi, Z. Deng, V. Di Francesco, P. Dunn, K. Eilbeck, C. Evangelista, A.E. Gabrielian, W. Gan, W. Ge, F. Gong, Z. Gu, P. Guan, T.J. Heiman, M.E. Higgins, R.R. Ji, Z. Ke, K.A.

Ketchum, Z. Lai, Y. Lei, Z. Li, J. Li, Y. Liang, X. Lin, F. Lu, G.V. Merkulov, N. Milshina, H.M. Moore, A.K. Naik, V.A. Narayan, B. Neelam, D. Nusskern, D.B. Rusch, S. Salzberg, W. Shao,

B. Shue, J. Sun, Z. Wang, A. Wang, X. Wang, J. Wang, M. Wei, R. Wides, C. Xiao, C. Yan, A.

-p

Yao, J. Ye, M. Zhan, W. Zhang, H. Zhang, Q. Zhao, L. Zheng, F. Zhong, W. Zhong, S. Zhu, S.

Zhao, D. Gilbert, S. Baumhueter, G. Spier, C. Carter, A. Cravchik, T. Woodage, F. Ali, H. An, A. Awe, D. Baldwin, H. Baden, M. Barnstead, I. Barrow, K. Beeson, D. Busam, A. Carver, A.

re

Center, M.L. Cheng, L. Curry, S. Danaher, L. Davenport, R. Desilets, S. Dietz, K. Dodson, L. Doup, S. Ferriera, N. Garg, A. Gluecksmann, B. Hart, J. Haynes, C. Haynes, C. Heiner, S.

lP

Hladun, D. Hostin, J. Houck, T. Howland, C. Ibegwam, J. Johnson, F. Kalush, L. Kline, S. Koduru, A. Love, F. Mann, D. May, S. McCawley, T. McIntosh, I. McMullen, M. Moy, L. Moy, B. Murphy, K. Nelson, C. Pfannkoch, E. Pratts, V. Puri, H. Qureshi, M. Reardon, R. Rodriguez, Y.H. Rogers, D. Romblad, B. Ruhfel, R. Scott, C. Sitter, M. Smallwood, E. Stewart, R. Strong,

na

E. Suh, R. Thomas, N.N. Tint, S. Tse, C. Vech, G. Wang, J. Wetter, S. Williams, M. Williams, S. Windsor, E. Winn-Deen, K. Wolfe, J. Zaveri, K. Zaveri, J.F. Abril, R. Guigo, M.J. Campbell, K.V. Sjolander, B. Karlak, A. Kejariwal, H. Mi, B. Lazareva, T. Hatton, A. Narechania, K.

ur

Diemer, A. Muruganujan, N. Guo, S. Sato, V. Bafna, S. Istrail, R. Lippert, R. Schwartz, B. Walenz, S. Yooseph, D. Allen, A. Basu, J. Baxendale, L. Blick, M. Caminha, J. Carnes-Stine,

Jo

P. Caulk, Y.H. Chiang, M. Coyne, C. Dahlke, A. Mays, M. Dombroski, M. Donnelly, D. Ely, S. Esparham, C. Fosler, H. Gire, S. Glanowski, K. Glasser, A. Glodek, M. Gorokhov, K. Graham, B. Gropman, M. Harris, J. Heil, S. Henderson, J. Hoover, D. Jennings, C. Jordan, J. Jordan, J. Kasha, L. Kagan, C. Kraft, A. Levitsky, M. Lewis, X. Liu, J. Lopez, D. Ma, W. Majoros, J. McDaniel, S. Murphy, M. Newman, T. Nguyen, N. Nguyen, M. Nodell, S. Pan, J. Peck, M. Peterson, W. Rowe, R. Sanders, J. Scott, M. Simpson, T. Smith, A. Sprague, T. Stockwell, R. Turner, E. Venter, M. Wang, M. Wen, D. Wu, M. Wu, A. Xia, A. Zandieh, X. Zhu, The sequence of the human genome, Science 291(5507) (2001) 1304-51.

25

[14] L. Li, H.Y. Chang, Physiological roles of long noncoding RNAs: insight from knockout mice, Trends in cell biology 24(10) (2014) 594-602. [15] M. Sauvageau, L.A. Goff, S. Lodato, B. Bonev, A.F. Groff, C. Gerhardinger, D.B. SanchezGomez, E. Hacisuleyman, E. Li, M. Spence, S.C. Liapis, W. Mallard, M. Morse, M.R. Swerdel, M.F. D'Ecclessis, J.C. Moore, V. Lai, G. Gong, G.D. Yancopoulos, D. Frendewey, M. Kellis, R.P. Hart, D.M. Valenzuela, P. Arlotta, J.L. Rinn, Multiple knockout mouse models reveal lincRNAs are required for life and brain development, eLife 2 (2013) e01749. [16] W.P. Kloosterman, R.H. Plasterk, The diverse functions of microRNAs in animal development and disease, Dev Cell 11(4) (2006) 441-50.

ro of

[17] K.C. Wang, H.Y. Chang, Molecular mechanisms of long noncoding RNAs, Molecular cell 43(6) (2011) 904-14.

[18] J.S. Mattick, Non-coding RNAs: the architects of eukaryotic complexity, EMBO Rep 2(11) (2001) 986-91.

[19] J.S. Mattick, I.V. Makunin, Non-coding RNA, Hum Mol Genet 15 Spec No 1 (2006) R17-

-p

29.

[20] G. Nardocci, M.E. Carrasco, E. Acevedo, C. Hodar, C. Meneses, M. Montecino, Biochem 119(9) (2018) 7657-7666.

re

Identification of a novel long noncoding RNA that promotes osteoblast differentiation, J Cell [21] Y. Huang, Y. Zheng, L. Jia, W. Li, Long Noncoding RNA H19 Promotes Osteoblast

lP

Differentiation Via TGF-beta1/Smad3/HDAC Signaling Pathway by Deriving miR-675, Stem cells (Dayton, Ohio) 33(12) (2015) 3481-92.

[22] Q. He, S. Yang, X. Gu, M. Li, C. Wang, F. Wei, Long noncoding RNA TUG1 facilitates osteogenic differentiation of periodontal ligament stem cells via interacting with Lin28A, Cell

na

death & disease 9(5) (2018) 455.

[23] C. Dou, Z. Cao, B. Yang, N. Ding, T. Hou, F. Luo, F. Kang, J. Li, X. Yang, H. Jiang, J. Xiang, H. Quan, J. Xu, S. Dong, Changing expression profiles of lncRNAs, mRNAs, circRNAs

ur

and miRNAs during osteoclastogenesis, Scientific reports 6 (2016) 21499. [24] Y. Sakaguchi, K. Nishikawa, S. Seno, H. Matsuda, H. Takayanagi, M. Ishii, Roles of

Jo

Enhancer RNAs in RANKL-induced Osteoclast Differentiation Identified by Genome-wide Cap-analysis of Gene Expression using CRISPR/Cas9, Scientific reports 8(1) (2018) 7504. [25] D.E. Maridas, E. Rendina-Ruedy, P.T. Le, C.J. Rosen, Isolation, Culture, and Differentiation of Bone Marrow Stromal Cells and Osteoclast Progenitors from Mice, Journal of visualized experiments : JoVE (131) (2018). [26] J. Shirakawa, H. Harada, M. Noda, Y. Ezura, PTH-Induced Osteoblast Proliferation Requires Upregulation of the Ubiquitin-Specific Peptidase 2 (Usp2) Expression, Calcified tissue international 98(3) (2016) 306-15.

26

[27] T. Aida, K. Chiyo, T. Usami, H. Ishikubo, R. Imahashi, Y. Wada, K.F. Tanaka, T. Sakuma, T. Yamamoto, K. Tanaka, Cloning-free CRISPR/Cas system facilitates functional cassette knock-in in mice, Genome Biology 16(1) (2015) 87. [28] D.W. Dempster, J.E. Compston, M.K. Drezner, F.H. Glorieux, J.A. Kanis, H. Malluche, P.J. Meunier, S.M. Ott, R.R. Recker, A.M. Parfitt, Standardized Nomenclature, Symbols, and Units for Bone Histomorphometry: A 2012 Update of the Report of the ASBMR Histomorphometry Nomenclature Committee, Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research 28(1) (2013) 2-17. [29] Y. Tian, Y. Xu, Q. Fu, M. He, Parathyroid hormone regulates osteoblast differentiation (2011) 211-6.

ro of

in a Wnt/beta-catenin-dependent manner, Molecular and cellular biochemistry 355(1-2) [30] H. Hohjoh, T. Fukushima, Marked change in microRNA expression during neuronal

differentiation of human teratocarcinoma NTera2D1 and mouse embryonal carcinoma P19 cells, Biochem Biophys Res Commun 362(2) (2007) 360-7.

-p

[31] J. Ding, J. Li, H. Wang, Y. Tian, M. Xie, X. He, H. Ji, Z. Ma, B. Hui, K. Wang, G. Ji, Long noncoding RNA CRNDE promotes colorectal cancer cell proliferation via epigenetically silencing DUSP5/CDKN1A expression, Cell death & disease 8(8) (2017) e2997.

re

[32] P. Han, J.W. Li, B.M. Zhang, J.C. Lv, Y.M. Li, X.Y. Gu, Z.W. Yu, Y.H. Jia, X.F. Bai, L. Li, Y.L. Liu, B.B. Cui, The lncRNA CRNDE promotes colorectal cancer cell proliferation and

lP

chemoresistance via miR-181a-5p-mediated regulation of Wnt/beta-catenin signaling, Molecular cancer 16(1) (2017) 9.

[33] D. Ji, C. Jiang, L. Zhang, N. Liang, T. Jiang, B. Yang, H. Liang, LncRNA CRNDE promotes hepatocellular carcinoma cell proliferation, invasion, and migration through

na

regulating miR-203/ BCAT1 axis, J Cell Physiol

(2018).

[34] H. Jiang, Y. Wang, M. Ai, H. Wang, Z. Duan, H. Wang, L. Zhao, J. Yu, Y. Ding, S. Wang, Long noncoding RNA CRNDE stabilized by hnRNPUL2 accelerates cell proliferation and

ur

migration in colorectal carcinoma via activating Ras/MAPK signaling pathways, Cell death & disease 8(6) (2017) e2862.

Jo

[35] H. Inose, T. Yamada, M. Mulati, T. Hirai, S. Ushio, T. Yoshii, T. Kato, S. Kawabata, A. Okawa, Bone Turnover Markers as a New Predicting Factor for Nonunion After Spinal Fusion Surgery, Spine 43(1) (2018) E29-e34. [36] G. Wang, J. Pan, L. Zhang, Y. Wei, C. Wang, Long non-coding RNA CRNDE sponges miR384 to promote proliferation and metastasis of pancreatic cancer cells through upregulating IRS1, Cell proliferation 50(6) (2017). [37] J. Zheng, X. Liu, P. Wang, Y. Xue, J. Ma, C. Qu, Y. Liu, CRNDE Promotes Malignant Progression of Glioma by Attenuating miR-384/PIWIL4/STAT3 Axis, Molecular therapy : the

27

journal of the American Society of Gene Therapy 24(7) (2016) 1199-215. [38] B. Ellis, P. Molloy, L. Graham, CRNDE: A Long Non-Coding RNA Involved in CanceR, Neurobiology, and DEvelopment, Frontiers in Genetics 3(270) (2012). [39] B.C. Ellis, L.D. Graham, P.L. Molloy, CRNDE, a long non-coding RNA responsive to insulin/IGF signaling, regulates genes involved in central metabolism, Biochimica et biophysica acta 1843(2) (2014) 372-86. [40] L.A. Goff, A.F. Groff, M. Sauvageau, Z. Trayes-Gibson, D.B. Sanchez-Gomez, M. Morse, R.D. Martin, L.E. Elcavage, S.C. Liapis, M. Gonzalez-Celeiro, O. Plana, E. Li, C. Gerhardinger, G.S. Tomassy, P. Arlotta, J.L. Rinn, Spatiotemporal expression and National Academy of Sciences 112(22) (2015) 6855-6862.

ro of

transcriptional perturbations by long noncoding RNAs in the mouse brain, Proceedings of the [41] C.-J. Li, Y. Xiao, M. Yang, T. Su, X. Sun, Q. Guo, Y. Huang, X.-H. Luo, Long noncoding RNA Bmncr regulates mesenchymal stem cell fate during skeletal aging, The Journal of Clinical Investigation 128(12) (2018) 5251-5266.

-p

[42] N.S. Datta, G.J. Pettway, C. Chen, A.J. Koh, L.K. McCauley, Cyclin D1 as a target for

the proliferative effects of PTH and PTHrP in early osteoblastic cells, Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research

re

22(7) (2007) 951-64.

[43] J. Pratap, M. Galindo, S.K. Zaidi, D. Vradii, B.M. Bhat, J.A. Robinson, J.Y. Choi, T.

lP

Komori, J.L. Stein, J.B. Lian, G.S. Stein, A.J. van Wijnen, Cell growth regulatory role of Runx2 during proliferative expansion of preosteoblasts, Cancer research 63(17) (2003) 535762.

[44] C. Zhang, K. Cho, Y. Huang, J.P. Lyons, X. Zhou, K. Sinha, P.D. McCrea, B. de

na

Crombrugghe, Inhibition of Wnt signaling by the osteoblast-specific transcription factor Osterix, Proc Natl Acad Sci U S A 105(19) (2008) 6936-41. [45] C.J. Cain, N. Gaborit, W. Lwin, E. Barruet, S. Ho, C. Bonnard, H. Hamamy, M. Shboul,

ur

B. Reversade, H. Kayserili, B.G. Bruneau, E.C. Hsiao, Loss of Iroquois homeobox transcription factors 3 and 5 in osteoblasts disrupts cranial mineralization, Bone reports 5

Jo

(2016) 86-95.

[46] C. Bonnard, A.C. Strobl, M. Shboul, H. Lee, B. Merriman, S.F. Nelson, O.H. Ababneh, E. Uz, T. Güran, H. Kayserili, H. Hamamy, B. Reversade, Mutations in IRX5 impair craniofacial development and germ cell migration via SDF1, Nature Genetics 44 (2012) 709. [47] A.S. Albrecht, U.A. Orom, Bidirectional expression of long ncRNA/protein-coding gene pairs in cancer, Briefings in functional genomics 15(3) (2016) 167-73.

28

Figure legends Figure 1 Expression of Crnde during bone formation. (a) lncRNA array expression data from MC3T3-E1 cells cultured in growth medium or in medium containing PTH for 60 min.

ro of

Only the representative lncRNAs that were significantly upregulated by PTH are shown. (b and c) Changes in Crnde mRNA expression induced by PTH treatment during primary calvarial osteoblast (b) and MC3T3-E1 cell (c) differentiation, as determined via qPCR.

-p

Crnde expression increased during osteoblast differentiation. *, P<0.05 versus vehicle. n

re

= 4. (d) Changes in Crnde mRNA expression induced by osteogenic medium containing

lP

dexamethasone during MC3T3-E1 cell differentiation. Crnde expression transiently increased during osteoblast differentiation. *, P<0.05 versus vehicle. n = 4. (e) Crnde

na

expression in murine tissues. Note that Crnde is highly expressed in calvaria. n = 3. We

Jo

tissues.

ur

set the expression level in bone as the standard for comparison of expression in other

29

30

ro of

-p

re

lP

na

ur

Jo

Figure 2 Low bone mass in Crnde-/- mice due to reduced bone formation. (a) µCT analysis of femurs from 12-week-old male wild-type or Crnde-/- mice. The trabecular parameters [bone volume per tissue volume (BV/TV), trabecular thickness (Tb.Th.), and trabecular

ro of

number (Tb. N)] and cortical parameter [cortical thickness (CT. Th.)] were significantly decreased in Crnde-/- mice. *, P<0.05, n = 7-9. (b) Histological analysis of the vertebrae

of 12-week-old male wild-type or Crnde-/- mice. Von Kossa staining. Note the significant

-p

decrease in BV/TV in Crnde-/- mice. *, P<0.05, n = 5-6. (c) Histomorphometric analysis

re

of the vertebrae of 12-week-old male mice. Bone formation rate over bone surface area

lP

(BFR/BS), mineral apposition rate (MAR), osteoid thickness (O.Th), and mineralizing surface to bone surface (MS/BS). Representative images of calcein labeling are shown.

na

The distance between the two calcein labels represents the MAR. Note the significant

ur

decrease in bone formation in Crnde-/- mice. *, P<0.05, n = 5-6. (d) Histomorphometric analysis of the vertebrae of 12-week-old male mice. Osteoblast surface area over bone

Jo

surface area (Ob.S/BS). Representative images of toluidine blue staining are shown (Upper). White arrowheads show osteoblasts. Osteoclast surface area over bone surface area (Oc.S/BS). Representative images of TRAP staining are shown (Lower). Black arrowheads show osteoclasts. *, P<0.05, n = 5-6. (e) Gene expression in Crnde-/- mice

31

calvaria. Quantitative RT-PCR analysis of osteoblastic genes. Note the significant decrease in osteoblastic genes in Crnde-/- mice. *, P<0.05, n = 5-6. (f) Serum P1NP and CTX-I levels measured in 3-month-old mice. P1NP is decreased in Crnde-/- male mice.

Jo

ur

na

lP

re

-p

ro of

*, P<0.05 versus wild-type mice. n = 5-6.

32

Figure 3 Regulation of osteoblast proliferation by Crnde. (a) Effect of Crnde expression on MC3T3-E1 cell proliferation. MC3T3-E1 cells were transiently transfected with Crnde. Note the significant increase in absorbance and cell number in Crnde-expressing cells. *,

ro of

P<0.05, n = 4. (b) Effect of Crnde deletion on osteoblast proliferation; osteoblasts were isolated from wild-type and Crnde-/- mice. Note the significant decrease induced by Crnde deletion. *, P<0.05, n = 4. (c) Fluorescence immunohistochemistry analysis of Ki-

-p

67 (green) and Runx2 (red) in the trabecular region of femurs from 3-month-old male

re

mice. DAPI (Blue) was used to stain the nuclei. These images show fewer Ki-67 and

lP

Runx2 double-positive osteoblasts (white arrows) in the Crnde-/- sections than in the wild-type sections. *, P<0.05. (d) Fluorescence immunohistochemistry analysis of BrdU

na

in the trabecular region of femurs from 3-month-old male mice. Fewer BrdU-positive

ur

osteoblasts are shown in the Crnde-/- sections than in the wild-type sections. *, P<0.05. (e) TUNEL assays were performed in 3-month-old wild-type and Crnde-/- mice. No

Jo

difference in apoptotic cells was detected between the two groups. n.s: not significant. (f) Effect of Crnde deletion on osteoblast differentiation. Primary calvarial osteoblasts from wild-type and Crnde-/- mice were cultured for 7 days and their Alp gene expression analyzed. Values were normalized to Alp expression levels of wild-type mice calvarial

33

osteoblasts. Note the decreased osteoblast differentiation in Crnde-/- cells. *, P<0.05, n = 4. (g) Effect of Crnde expression on MC3T3-E1 cell differentiation by BMP2. MC3T3E1 cells were transiently transfected with Crnde. Note the significant increase in osteoblast differentiation markers in Crnde-expressing cells. *, P<0.05, n = 4. (h) Effect

ro of

of Crnde overexpression on osteoblast differentiation. Primary calvarial osteoblasts from wild-type and Crnde-/- mice were cultured and transiently transfected with Crnde-

overexpressing plasmid. Note that the inhibitory effect of Crnde deletion on osteoblast

-p

differentiation was partially rescued by overexpression of Crnde. *, P<0.05, n = 4. (i)

re

Effect of Crnde deletion on osteoblastic and adipogenic differentiation of BMSCs.

lP

Primary BMSCs from wild-type and Crnde-/- mice were cultured. Note the decreased

Jo

ur

na

osteoblast differentiation in Crnde-/- cells. *, P<0.05, n = 4.

34

ro of -p re lP na ur Jo Figure 4

Identification of the molecular mechanism of Crnde in bone formation. (a) Gene expression in 3-month-old wild-type and Crnde-/- mice calvaria. Targets of Wnt/βcatenin signaling were downregulated in Crnde-/- mouse. ND: not detected. *, P<0.05, n 35

= 5-6. (b) Protein levels in Crnde-/- mice calvaria. Note the decrease in CCND1 protein levels in Crnde-/- mice calvaria. (c) Changes in CCND1 protein expression of MC3T3E1 cells transfected with pcDNA (control) or Crnde pcDNA (Crnde overexpression). CCND1 was upregulated following Crnde overexpression. (d) Primary mouse calvarial

ro of

osteoblasts were transfected with TOPFlash or FOPFlash as indicated. Transfection efficiency was monitored by co-transfection with Renilla luciferase vector, which

constitutively expresses the Renilla luciferase reporter. The luciferase activity of each

-p

sample was normalized to the respective Renilla luciferase activity. TOPFlash activity

Jo

ur

na

lP

re

was found to be decreased in Crnde-/- osteoblasts. *, P<0.05, n = 4.

36

37

ro of

-p

re

lP

na

ur

Jo