The Long Noncoding RNA UCA1 Negatively Regulates Melanogenesis in Melanocytes

ORIGINAL ARTICLE

The Long Noncoding RNA UCA1 Negatively Regulates Melanogenesis in Melanocytes Shiyao Pei1,5, Jing Chen1,5, Jianyun Lu1, Shuanghai Hu1, Ling Jiang1, Li Lei1,2, Yujie Ouyang1, Chuhan Fu1, Yufang Ding1, Si Li1, Liyang Kang1, Lihua Huang3, Hong Xiang3, Rong Xiao4, Qinghai Zeng1 and Jinhua Huang1 The long noncoding RNA UCA1 was first discovered in bladder cancer and is known to regulate the proliferation and migration of melanoma. However, its role in melanogenesis is unclear. In this study, we aimed to explore the role and mechanism of UCA1 in melanogenesis. Our findings showed that the expression of UCA1 was negatively correlated with melanin content in melanocytes and pigmented nevus. Overexpression of UCA1 in melanocytes decreased melanin content and the expression of melanogenesis-related genes, whereas knockdown of UCA1 in melanocytes had the opposite effect. High-throughput sequencing revealed that microphthalmia-associated transcription factor (MITF), an important transcription factor affecting melanogenesis, was also negatively correlated with the expression of UCA1. Furthermore, the transcription factor CRE-binding protein (CREB), which promotes MITF expression, was negatively regulated by UCA1. The cAMP/ protein kinase A (PKA), extracellular signaleregulated kinase (ERK), and c-Jun N-terminal kinase (JNK) signaling pathways, which are upstream of the CREB/MITF/melanogenesis axis, were activated or inhibited in response to silencing or enhancing UCA1 expression, respectively. In addition, enhanced UCA1 expression downregulates the expression of melanogenesis-related genes induced by UVB in melanocytes. In conclusion, UCA1 may negatively regulate the CREB/MITF/melanogenesis axis through inhibiting the cAMP/PKA, ERK, and JNK signaling pathways in melanocytes. UCA1 may be a potential therapeutic target for the treatment of pigmented skin diseases. Journal of Investigative Dermatology (2019) -, -e-; doi:10.1016/j.jid.2019.04.029

INTRODUCTION Long noncoding RNA (lncRNA) is a type of noncoding RNA that encodes a transcript longer than 200 nucleotides and does not code for proteins (Bergmann and Spector, 2014; Kaikkonen and Adelman, 2018; Krause, 2018). A small number of studies have confirmed that lncRNAs play important roles in pigmented skin diseases (Pei et al., 2018; Zeng et al., 2016). For example, Nan-Hyung Kim and

1

Department of Dermatology, Third Xiangya Hospital, Central South University, Changsha, Hunan, China; 2Hunan Key Laboratory of Skin Cancer and Psoriasis, Xiangya Hospital, Central South University, Changsha, Hunan, China; 3Central Laboratory, Third Xiangya Hospital of Central South University, Changsha, Hunan, China; and 4Department of Dermatology, Second Xiangya Hospital, Central South University, Changsha, Hunan, China

5

These authors contributed equally to this work.

Correspondence: Qinghai Zeng, Department of Dermatology, Third Xiangya Hospital, Central South University, 138 Tongzipo Road, Changsha, Hunan 410013, P.R. China. E-mail: [email protected] or Jinhua Huang, Department of Dermatology, Third Xiangya Hospital, Central South University, 138 Tongzipo Road, Changsha, Hunan 410013, P.R. China. E-mail: [email protected] Abbreviations: a-MSH, a-melanocyte-stimulating hormone; Akt, protein kinase B; CREB, CRE-binding protein; ERK, extracellular signaleregulated kinase; lncRNA, long noncoding RNA; MAPK, mitogen-activated protein kinase; MC, melanocytes; miRNA, microRNA; MITF, microphthalmia-associated transcription factor; PIG1, human immortalized melanocytes; PKA, protein kinase A; qRT-PCR, quantitative real-time reverse transcriptaseePCR; TYR, tyrosinase Received 12 December 2018; revised 8 April 2019; accepted 14 April 2019; accepted manuscript published online 2 July 2019; corrected proof published online XXX

others found that microRNA (miRNA)-67, which was derived from the lncRNA H19 in keratinocytes, could enter melanocytes (MCs) through exosomes to affect the expression of melanogenesis-related genes (Kim et al., 2014). Our previous study also found that H19 could affect melanogenesis by a paracrine effect (Pei et al., 2018). LncRNA UCA1 was first discovered in bladder cancer (Li et al., 2015; Li et al., 2017b) and is also involved in the development of various tumors, such as breast cancer (Liu et al., 2016; Wu and Luo, 2016), nonesmall cell lung cancer (Wu and Zhou, 2018), gastric cancer (Gu et al., 2018), and liver cancer (Hu et al., 2018; Li et al., 2017c). Studies have demonstrated that UCA1 can regulate downstream target molecules by competitively binding to miRNAs (Li et al., 2018a; Liang et al., 2018). At the same time, UCA1 also promotes tumor development, invasion, and metastasis by regulating the PI3K/protein kinase B (Akt) (Yang et al., 2012), Wnt/b-catenin (Liu et al., 2016; Lu and Liu, 2018), and Akt/mTOR (Li et al., 2017a; Wu and Luo, 2016) pathways, as well as other signaling pathways. In melanoma, the expression of UCA1 is significantly increased, and UCA1 promotes the invasion and metastasis of melanoma (Chen et al., 2018c; Wei et al., 2016). However, no literature has reported if UCA1 plays a regulatory role in the melanogenesis of MCs. The synthesis and transportation of melanin in MCs play an important role in skin pigmentation (Correia et al., 2018; Zhou et al., 2016). The key enzyme that regulates the melanin synthesis pathway is tyrosinase (TYR), and its activity and expression directly reflect the melanin synthesis levels (Mann et al., 2018). TYRP1 and TYRP2 are also key enzymes

ª 2019 The Authors. Published by Elsevier, Inc. on behalf of the Society for Investigative Dermatology.

www.jidonline.org

1

S Pei et al.

UCA1 Negatively Regulates Melanogenesis

that promote melanin production (Camacho-Hubner and Beermann, 2000; Sarangarajan et al., 2000). Studies have demonstrated that TYR, TYRP1, and TYRP2 can exist as a high-molecular-weight complex that is not easily attacked and cleaved by melanin intermediates in melanosomes (Kobayashi and Hearing, 2007; Kobayashi et al., 1998). Therefore, TYR, TYRP1, and TYRP2 can be used as molecular markers for melanin synthesis. When melanin is deposited in melanosomes, the melanin will be transported from the nucleus to the dendrites (Fujita et al., 2009; Hasse et al., 2018). Various transport-related proteins, such as RAB27A, FSCN1, and MYO5A, are involved in the transportation of melanosomes and thus can be regarded as molecular markers for melanin transportation (Chiaverini et al., 2008; Lopes et al., 2007). Melanogenesis is regulated by a series of transcription factors, among which microphthalmia-associated transcription factor (MITF) plays an important role (Chen et al., 2018b; Ishii et al., 2017). MITF promotes melanogenesis by inducing melanogenesis-related genes, such as TYR, TYRP1, TYRP2, and RAB27A (Alves et al., 2017; Sultana et al., 2018). Studies have shown that the phosphorylation state of the transcription factor CRE-binding protein (CREB) promotes the expression of MITF by binding to and activating the promoter of MITF, thereby promoting the activation of MC function (Alam et al., 2018; Shin et al., 2018). The transcription factor CREB is regulated by a variety of signaling pathways, among which are confirmed pathways such as the cAMP/protein kinase A (PKA) (Park et al., 2018; Xie et al., 2018), mitogen-activated protein kinase (MAPK) family (Fujimura and Usuki, 2018; Yu et al., 2019), Ca2þ/CaMK (Chen et al., 2018a; Liu et al., 2018), and PI3K/Akt signaling pathways (Dong et al., 2018; Nishina et al., 2018). The cAMP/PKA signaling pathway is one of the key regulatory pathways that promotes the activation of MITF (Choi et al., 2018; Sun et al., 2017). Under UVB, a-melanocyte-stimulating hormone (a-MSH), and other types of stimulation, MCs will exhibit increased intracellular cAMP levels, and PKA will be activated; this further enhances the expression of MITF by activating CREB phosphorylation (Shin et al., 2018). Meanwhile, the MAPK family members extracellular signaleregulated kinase (ERK) and P38 also have been shown to regulate the phosphorylation levels of CREB, which in turn regulates the expression of MITF (Byun et al., 2017; Castro-Vega et al., 2016). In this study, we explored the role of UCA1 in the process of melanogenesis. Moreover, the mechanism underlying the regulation of melanogenesis by UCA1 was also investigated. RESULTS

The expression of UCA1 is negatively correlated with the melanin content in MCs and pigmented nevus

The basal expression levels of UCA1 in keratinocytes, HaCaT cells, fibroblasts, human immortalized fibroblast cells, MCs, and human immortalized MC (PIG1) cells were examined. The results show that the UCA1 levels were the lowest in MCs and PIG1 cells and were relatively high in keratinocytes and HaCaT cells (Figure 1a). Meanwhile, it was observed that when the same numbers of MCs and PIG1, SK-MEL-28, and A375 cells, which are all melanin-producing but differ in color, were centrifuged, the quantitative detection by NaOH 2

Journal of Investigative Dermatology (2019), Volume

-

assay demonstrated that melanin content was the highest in MCs; this was followed by PIG1, SK-MEL-28, and A375 cells (Figure 1b). In contrast, UCA1 levels were the highest in SKMEL-28 cells, followed by A375 cells, PIG1 cells, and MCs (Figure 1c). During the subsequent MC subculture, it was found that the melanin content of cells decreased (Figure 1d) but the expression of UCA1 increased (Figure 1e). Furthermore, we collected eight different melanin-containing nevus tissues. Hematoxylin and eosin staining results showed that the content of melanin granules increased with the darkening of the pigmented nevus (Figure 1f). The UCA1 levels in tissues were detected by quantitative real-time reverse transcriptaseePCR (qRT-PCR) assay, and the expression of UCA1 decreased in nevus tissues with high melanin content (Figure 1g). UCA1 negatively regulates melanogenesis

Because the expression level of UCA1 is moderate in PIG1 cells, PIG1 cells were selected for follow-up experiments. We overexpressed UCA1 in PIG1 cells using an overexpression plasmid (Figure 2a). qRT-PCR and western blot assays demonstrated that the expression of TYR, TYRP1, TYRP2, RAB27A, FSCN1, and MYO5A was significantly downregulated (Figure 2b and c). We also knocked down UCA1 in PIG1 cells using three short hairpin RNAs. The results showed that sh-UCA1-1 and sh-UCA1-2 significantly inhibited the expression of UCA1 (Figure 2d) but increased the expression of TYR, TYRP1, TYRP2, RAB27A, FSCN1, and MYO5A (Figure 2e and f). In MCs, in which the expression of UCA1 was low, we overexpressed UCA1 (Figure 2g) and found that, with overexpressed UCA1, the color of the cells was significantly lighter, and the melanin content and the expression of melanogenesis-related genes were reduced (Figure 2h and i). The distribution of melanosomes in the cells was observed by immunofluorescence, and the number of melanosomes decreased after overexpression of UCA1 (Figure 2j). A 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide experiment showed that UCA1 had no significant effect on cell proliferation activity (Supplementary Figure S1). UCA1 negatively regulates the expression of MITF

High-throughput sequencing was used to detect differentially expressed genes at the transcriptomic level after UCA1 was overexpressed in PIG1 cells. The results showed that there were 805 differentially expressed genes exhibiting changes of more than two-fold, of which 144 genes were upregulated and 661 genes were downregulated (Figure 3a). The details of the differentially expressed genes are shown in the Supplementary Material (Supplementary Figure 2aed and Supplementary Table S1). Gene Ontology and pathway enrichment analysis demonstrated that the melanogenesisrelated genes were highly enriched (Figure 3b and c). The distribution of these pigment-related genes in the Kyoto Encyclopedia of Genes and Genomes pathway is shown in Supplementary Figure S2e. A total of 16 melanogenesisrelated genes were identified; 15 genes were downregulated, with the exception being PLCB1. Among those genes, the key transcription factor MITF, which regulates melanogenesis, was significantly downregulated (Figure 3d). qRT-PCR and western blot assays further revealed that MITF expression decreased after UCA1 overexpression in PIG1

S Pei et al.

UCA1 Negatively Regulates Melanogenesis Figure 1. The expression of UCA1 is negatively correlated with the melanin content in melanocytes and pigmented nevus. (a) The UCA1 expression levels in different skin cells are shown. (b) The color and melanin contents of MCs and PIG1, SK-MEL28, and A375 cells were determined by NaOH assay. (c) qRT-PCR shows the UCA1 levels in A375, SK-MEL-28, and PIG1 cells and MCs. (d) The melanin contents of different generations of MCs are shown. (e) qRT-PCR shows the expression of UCA1 in different cell generations. (f) H&E staining was performed with eight different melanin-containing nevus tissues. (g) The UCA1 levels of the eight tissues were detected by qRT-PCR assay. (b, d, g) Mean  SEM; n ¼ 3. Two-tailed t-test, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. BJ, human immortalized fibroblasts; FB, fibroblast; H&E, hematoxylin and eosin; KC, keratinocyte; MC, melanocyte; PIG1, human immortalized melanocytes; qRT-PCR, quantitative real-time reverse transcriptaseePCR; SEM, standard error of the mean. Bar ¼ 50 mm.

www.jidonline.org

3

S Pei et al.

UCA1 Negatively Regulates Melanogenesis

Figure 2. UCA1 negatively regulates melanogenesis. (a) UCA1 was overexpressed in PIG1 cells using an overexpression plasmid. (b, c) The expression levels of TYR, TYRP1, TYRP2, RAB27A, FSCN1, and MYO5A in the UCA1-overexpressing and control groups were detected by qRT-PCR and WB assays. (d) UCA1 was knocked down in PIG1 cells using three shRNAs. (e, f) The expression levels of TYR, TYRP1, TYRP2, RAB27A, FSCN1, and MYO5A were detected by qRT-PCR and WB assays. (g) UCA1 was overexpressed in MCs. (h) The cell colors are shown. (i) The melanin content and the expression of melanogenesis-related genes were detected by NaOH and qRT-PCR assays, respectively. (j) The distribution of melanosomes in the cells was observed by immunofluorescence. (a, b, d, e, gei) Mean  SEM; n ¼ 5. Two-tailed t-test, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. MC, melanocyte; NC, negative control; PIG1, human immortalized melanocytes; qRT-PCR, quantitative real-time reverse transcriptaseePCR; SEM, standard error of the mean; shRNA, short hairpin RNA; WB, western blot. Bar ¼ 20 mm.

cells but increased after knockdown of UCA1 expression in PIG1 cells (Figure 3eeg). UCA1 negatively regulates the CREB/MITF/melanogenesis axis by inhibiting the cAMP/PKA, ERK, and c-Jun N-terminal kinase (JNK) signaling pathways

We further found that the phosphorylation of CREB was significantly reduced after overexpression of UCA1 in PIG1 cells but increased after inhibition of UCA1 expression (Figure 4a). We further explored the changes in key proteins in the cAMP/PKA, MAPK, Ca2þ/CaMK, and PI3K/Akt signaling pathways. Both the expression levels and the phosphorylation levels of PKA, ERK, and JNK were significantly downregulated with UCA1 overexpression in PIG1 cells, whereas they were significantly upregulated after inhibition of UCA1 expression in PIG1 cells. However, there were no significant changes in the key protein levels in the 4

Journal of Investigative Dermatology (2019), Volume

-

other pathways (Figure 4a). The statistical charts are shown in the Supplementary Material (Supplementary Figure S3). We further examined the intracellular cAMP levels using the cAMP-Glo kit (Promega, Madison, WI) and found a negative correlation between UCA1 expression and cAMP content (Figure 4b and c). qRT-PCR and western blot assays further revealed that the expression of the adenylyl cyclase subtypes ADCY2 and ADCY5 decreased after overexpression of UCA1 but increased after knockdown of UCA1 in PIG1 cells (Figure 4def). UCA1 may antagonize UVB-induced melanogenesis

In our study, it was found that both the melanin content and the expression of melanogenesis-related genes in MCs were significantly promoted after three days of continuous UVB irradiation, which is one of the important external causes of skin pigmentation (Figure 5a and b). In addition,

S Pei et al.

UCA1 Negatively Regulates Melanogenesis

b

a

Enriched KEGG Pathway

Volcano plot for NC–VS–UCA.DEGseq_Method

d

TGF–beta signaling pathway Proteoglycans in cancer

300

Rap1 signaling pathway

250

Notch signaling pathway Arginine and proline metabolism

–log10(q–value)

Gene

Fold changes (UCA1/NC)

p-value

Gene

Fold changes (UCA1/NC)

p-value

TYRP2 KIT EDNRB PRKCB PNMAL1 TYR MC1R TYRP1

0.24 0.31 0.33 0.38 0.39 0.39 0.41 0.40

0 3.00E-07 1.52E-94 1.56E-158 1.60E-36 0 0 0

ADCY2 NRROS ADCY5 WNT11 MCAM MITF PNMA3 PLCB1

0.40 0.41 0.43 0.46 0.46 0.46 0.48 3.34

3.57E-17 3.05E-68 0.000513 4.34E-06 0 0 1.48E-08 2.91E-11

Glutamatergic synapse

NF–kappa B signaling pathway

200

Measles Arrhythmogenic right ventricular cardiomyopathy (ARVC)

150

Bile secretion

100

Inflammatory mediator regulation of TRP channels

Ovarian steroidogenesis Vascular smooth muscle contraction Hypertrophic cardiomyopathy (HCM)

50

Salivary secretion Glycosaminoglycan biosynthesis – heparan sulfate / heparin

0

Mucin type O–glycan biosynthesis

A1

-1

-2 A1 C -U sh

-U sh

C

N

5

C

A1

-1

sh

-U

C -U sh

g

C

A1

C

-2

0

N

10

*

1

U

UpDown down up

A1

15

C

DEGs Number

20

*

2

C

0.0 N

DEGs Number of The Most Enriched Pathway

*

0.5

3

N

0.100 0.075 0.050

1.0

Relative MiTF mRNA level

Rich Factor

A1

0. 0 0. 75 1 0. 00 1 0. 25 1 0. 50 17 5

Qvalue

C

no–DEGs: 15235 abs(FoldChange) < 2 or qValue > 0.001

Gene_number 10 15 20

1.5

U

Down: 661 FoldChange ≤ –2 ,qValue ≤ 0.001

f

C

Dilated cardiomyopathy Cell adhesion molecules (CAMs)

Up: 144 FoldChange ≥ 2 ,qValue ≤ 0.001

c

e

Melanogenesis

5

0 log2(fold change)

Relative MiTF mRNA level

–5

0

GAPDH

C

el

PI 3K –A l a R kt s dh ap ign es 1 s al io ig ing Pr n m nal pa ot ol ing th eo ec p w gl ul at ay yc es hw Va In an (C a sc fla y u m Ax s in AM la m r on ca s) sm at or gu nc oo y er i d I t m h M n a ed D mu el flue nc ila s an n e ia to te cle og za rr d eg c c en A ul S ard ont es at a io ra is H Ar io liv m ct yp n i rh er of ary yop on yt tro hm TR se ath ph Gl og P cre y ic uta c en t ha ion ca m ic n rd at rig Ald NF i e M n ht os –k C om rgi ea els ve ter ap irc yo c s sl nt on pa ad pa yn es ric e B ia th ap ul sy si n e y ( se ar n gn n H ca the al tra CM rd sis ing inm ) io TG m an pa en F– Ga yop d s thw t be str at ec ay ta ic a hy ret G si ci (A ion ly gn d R co al se VC sa in cr ) m g e in Bi pa tio og le th n Ar ly g s w N in o ca G ec ay i t I n a n e ch nsu p reti bi M an si li ju on os u yn cin O d p gna n s nct th ty va ro lin ec ion Va es p r lin g re lin is e O ian e pa tio e, – – s m th n he gl te et w le uc p y ro a a in b ara can ido bol y e et n b g ism an a– s io en d Al ulf sy es is an at n is ol in e th eu e / es ci m he is ne e pa bi tab rin os ol yn ism th es is

MiTF

Figure 3. UCA1 negatively regulates the expression of MITF. (a) High-throughput sequencing shows the DEGs at the transcriptomic level. (b, c) GO and pathway enrichment analyses were performed. (d) A total of 16 melanogenesis-related genes were identified. (eeg) qRT-PCR and western blot assays were used to verify the expression of MITF after overexpression and knockdown of UCA1 in PIG1 cells. (e, g) Mean  SEM; n ¼ 3. Two-tailed t-test, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. DEG, differentially expressed gene; GAPDH, glucose-6-phosphate dehydrogenase; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; MITF, microphthalmia-associated transcription factor; NC, negative control; PIG1, human immortalized melanocytes; qRT-PCR, quantitative real-time reverse transcriptaseePCR; SEM, standard error of the mean.

melanosomes increased after UVB irradiation and were transported from the nucleus to the dendrites (Figure 5c). Interestingly, the expression of UCA1 was upregulated after repeated irradiation of MCs with low-dose UVB (Figure 5d). Therefore, we irradiated cells with low doses of UVB for three consecutive days after overexpression of UCA1 in MCs; we found that UCA1 downregulated the expression of melanogenesis-related genes induced by UVB (Figure 5e). Meanwhile, we performed the same experiments in PIG1 cells, and the same results were obtained (Supplementary Figure S4). We further explored the effects of stimuli, such as oxidative stress, nutritional deficiencies, a-MSH, and FGF2 on UCA1 expression. The results show that under nonlethal dose stimulation, a-MSH can inhibit the expression of UCA1 but that others cannot (Supplementary Figure S5). DISCUSSION The expression level of UCA1 in skin cells is not well defined. This study reveals that UCA1 is differentially expressed in different skin cells, and that UCA1 is expressed at low levels in MCs. Furthermore, we found that the expression of UCA1

is negatively correlated with melanin content, and we showed that UCA1 can inhibit melanogenesis by negatively regulating the expression of melanogenesis-related genes. MITF is a key transcription factor that regulates the expression of many melanogenesis-related genes (Nguyen et al., 2018). Binding to the promoters of genes such as TYR, TYPR1, TYPR2, and MITF promotes their expression; this, in turn, induced melanin synthesis and increased transport (Lee et al., 2018; Sultana et al., 2018). In this study, high-throughput sequencing revealed a decrease in MITF expression after overexpression of UCA1 in PIG1 cells. Our experiments further confirmed that UCA1 could negatively regulate MITF expression. Previous studies have found that transcription factors, such as CREB and PAX3; miRNAs, such as miRNA-26a (Qian et al., 2017), miRNA-340 (Zhao et al., 2017) and miRNA-143 (Ji et al., 2018); and proteins, such as SC7A11 (Yang et al., 2018) and BRN-2 (Fane et al., 2017), can regulate the expression or transcriptional activity of MITF at the levels of transcription, posttranscription, and translation. To our knowledge previously unreported, our study found that UCA1 negatively regulated CREB and its www.jidonline.org

5

S Pei et al.

UCA1 Negatively Regulates Melanogenesis Figure 4. UCA1 negatively regulates the CREB/MITF/melanogenesis axis by inhibiting the cAMP/PKA, ERK, and JNK signaling pathways. (a) The expression levels and phosphorylation levels of CREB, PKA, ERK, JNK, Akt, STAT, and CaMKIV were detected by western blot assay. (b, c) The intracellular cAMP levels were examined by using the cAMP-Glo kit. (def) The expression levels of ADCY2 and ADCY5 were examined by qRTPCR and western blot assays after the overexpression and downregulation of UCA1 in PIG1 cells. (b, c) Mean  SEM; n ¼ 3. Two-tailed t-test, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. Akt, protein kinase B; CREB, CRE-binding protein; ERK, extracellular signaleregulated kinase; GAPDH, glucose-6-phosphate dehydrogenase; JNK, c-Jun N-terminal kinase; MITF, microphthalmiaassociated transcription factor; NC, negative control; p-Akt, phosphorylated protein kinase B; p-CREB, phosphorylated CRE-binding protein; p-ERK, phosphorylated extracellular signaleregulated kinase; p-JNK, phosphorylated c-Jun N-terminal kinase; p-PKA, phosphorylated protein kinase A; p-STAT, phosphorylated STAT; PIG1, human immortalized melanocytes; PKA, protein kinase A; qRT-PCR, quantitative real-time reverse transcriptaseePCR; SEM, standard error of the mean.

phosphorylation levels. Additionally, it is known that the transcriptional activity of CREB increases 10e20 times after phosphorylation (Kim et al., 2019). Therefore, at the transcriptional level, UCA1 inhibits MITF-induced melanogenesis by regulating the transcriptional activity of CREB. Whether UCA1 plays a role in inhibiting melanogenesis 6

Journal of Investigative Dermatology (2019), Volume

-

through post-transcriptional and translational regulation mechanisms remains to be confirmed by subsequent experiments. The transcription factor CREB is regulated by a variety of signaling pathways. It has been confirmed that the signaling pathways that regulate CREB include cAMP/PKA

S Pei et al.

UCA1 Negatively Regulates Melanogenesis

Figure 5. UCA1 may antagonize UVB-induced melanogenesis. (a, b) The expression levels of melanogenesis-related genes in MCs were examined after three days of continuous UVB irradiation. (c) The transportation of melanosomes was observed by immunofluorescence. (d) The expression of UCA1 in MCs was detected after repeated UVB irradiation. (e) The expression of melanogenesis-related genes was examined in UCA1-overexpressing MCs treated with low doses of UVB. (b, d, e) Mean  SEM; n ¼ 3. Two-tailed t-test, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. MC, melanocyte; NC, negative control; SEM, standard error of the mean. Bar ¼ 20 mm.

www.jidonline.org

7

S Pei et al.

UCA1 Negatively Regulates Melanogenesis Figure 6. Signaling pathways of UCA1-regulated melanogenesis in melanocytes. UCA1 may negatively regulate the CREB/MITF/ melanogenesis axis by inhibiting the cAMP/PKA, ERK, and JNK signaling pathways in melanocytes. Additionally, MAPK may regulate the expression of melanogenesis-related genes such as MITF and TYR in a noneCREB-dependent manner. CREB, CRE-binding protein; ERK, extracellular signaleregulated kinase; JNK, c-Jun N-terminal kinase; MAPK, mitogen-activated protein kinase; MITF, microphthalmiaassociated transcription factor; PKA, protein kinase A.

(Konar et al., 2018; Park et al., 2018), MAPK (Daniel et al., 2018; Fujimura and Usuki, 2018; Kim et al., 2019), Ca2þ/ CaMK (Chen et al., 2018b; Liu et al., 2018), STAT (Deng et al., 2018), and PI3K/Akt (Daniel et al., 2018; Nishina et al., 2018). In this study, we investigated the possible mechanism of UCA1 regulation of CREB through signaling pathways. The experimental results showed that the expression levels of PKA, ERK, and JNK and their phosphorylation levels were negatively regulated by UCA1. The amount of the second messenger cAMP, which activates PKA, was also negatively correlated with UCA1 levels. Therefore, UCA1 may negatively regulate the CREB/MITF/melanogenesis axis through the cAMP/PKA, ERK, and JNK signaling pathways. Our study also found that UCA1 negatively regulates the expression of ADCY2 and ADCY5, the subtypes of adenylyl cyclase (Halls and Cooper, 2017) that promote the synthesis of cAMP. These results indicate that UCA1 may specifically and negatively regulate cAMP/PKA signaling by inhibiting the expression of ADCY2 and ADCY5. It is worth noting that in tumor cells, UCA1 can promote tumor proliferation and metastasis by activating signaling pathways such as PI3K/Akt and MAPK (C Li et al., 2017; Wang et al., 2017). Factors such as tissue specificity and heterogeneity between tumor cells and normal cells may be the reason for the different regulatory effects of UCA1 on signaling pathways. Notably, the regulation of signaling pathways for melanogenesis is a complex and interactional network. Signaling pathways such as MAPK may also regulate the expression of melanogenesisrelated genes, such as MITF and TYR, in a noneCREBdependent manner (Figure 6). 8

Journal of Investigative Dermatology (2019), Volume

-

UV radiation is the most important external cause of melanogenesis (Glady et al., 2018; Mishima and Tanay, 1968). Current studies have found that UV light can promote melanogenesis through epigenetic modifications (Zhang et al., 2019), DNA damage repair (Kemp et al., 2019; Oonincx et al., 2018), signal transduction (Hu et al., 2019), and the alteration of the MC microenvironment (Glady et al., 2018; Pei et al., 2018). It is well known that any biological behavior exerts positive and negative feedback to maintain homeostasis. Unfortunately, there are currently few reports of negative feedback mechanisms that antagonize UV-induced melanogenesis. Our results show that the expression of UCA1 is increased after UV irradiation. We also found that with upregulation of UCA1, UVB-induced melanogenesis is significantly downregulated, suggesting that UCA1 plays a negative feedback role in UVB-induced melanogenesis. We also found that UCA1 was affected by a-MSH stimulation (Supplementary Figure S5). However, further experiments are needed to demonstrate the mechanism of UCA1 expression changes caused by those stimuli. We found that the UCA1 expression levels in MCs are very low. However, the reason for the low expression of UCA1 in MCs is not fully understood. The regulation of lncRNA expression is mainly determined by transcriptional and posttranscriptional mechanisms. UPF1 is an RNA-binding protein that specifically binds to RNAs and causes the degradation of the target RNA (Chicois et al., 2018; Kim and Maquat, 2019). StarBase v2.0 software was used to predict that there are binding sites between UPF1 and UCA1. Additionally, in our consecutive experiments, UPF1 was found to be highly

S Pei et al.

UCA1 Negatively Regulates Melanogenesis

expressed in MCs compared with the expression in melanoma cells (Supplementary Figure S6a). We wondered whether the low expression of UCA1 in MCs is associated with the degradation of UCA1 by UPF1. Unfortunately, there was no significant change in UCA1 expression after inhibition of UPF1 expression in MCs (Supplementary Figure S6b and c). Studies have shown that the promoter of the UCA1 gene has no CpG island (Xue et al., 2013), so the low expression of UCA1 is unlikely to be regulated by DNA methylationerelated enzymes. Transcription factors are involved in the transcriptional regulation of genes. It was reported in the literature that the transcription factors HIF-1a and c-Myb can bind to the UCA1 gene promoter and promote the expression of UCA1 (Li et al., 2018b; Wang et al., 2018). Studies have revealed that HIF-1a and c-Myb have low expression levels in MCs relative to the levels in melanoma cells (Slominski et al., 2014; Walker et al., 1998). Therefore, we hypothesize that the low expression of UCA1 in melanocytes may be associated with the low expression of HIF-1a and c-Myb. However, more experiments are needed to further confirm this hypothesis. In our study, we confirmed that UCA1 plays an important role in melanogenesis. Therefore, upregulating or downregulating the expression of UCA1 in local skin could be a potential treatment for hyperpigmentation and hypopigmentation skin disorders. The abnormal expression of UCA1 is related to a variety of tumor types, and whether its upregulation or downregulation will affect tumors remains unclear. Therefore, a large number of preclinical trials are needed before UCA1 can be used as a therapeutic target. In conclusion, UCA1 is expressed at low levels in MCs and negatively regulates melanogenesis. UCA1 may reduce the CREB/MITF/melanogenesis axis by inhibiting the cAMP/PKA, ERK, and JNK signaling pathways. In addition, UCA1 plays a negative feedback role in UVB-induced melanogenesis. Our results suggest that UCA1 may be a potential therapeutic target for the treatment of pigmented skin diseases. MATERIALS AND METHODS Cell culture PIG1 cells (a gift from Dr. Caroline Le Poole at Loyola University, Chicago, IL) were cultured in M254 cell culture medium (#M-254500, Gibco, Waltham, MA) containing 5% fetal bovine serum (Biological Industries, Beit-Haemek, Israel). HaCaT cells, human immortalized fibroblasts, and the human cutaneous malignant melanoma cell lines SK-MEL-28 and A375 were cultured in DMEM cell culture medium with 10% fetal bovine serum. Human skin keratinocytes, human dermal fibroblasts, and human cutaneous MCs were extracted from fresh foreskin tissue donated after circumcision in adolescents. Prior patient consent and approval from the Institutional Research Ethics Committee were obtained.

Sample collection Completely excised pigmented nevus tissue was collected from the Dermatology Department of the Third Xiangya Hospital of Central South University. The criteria for sample collection were as follows: (i) written informed consent was obtained from each patient; (ii) patients had no history of systemic diseases or malignancies; (iii) the samples were pathologically diagnosed as pigmented nevus; (iv) the weight of each sample was greater than 200 mg; and (v) no

degradation was found in the RNA extracted from the samples. In total, eight pigmented nevus samples with different shades of color were selected. The experiment was approved by the Institutional Research Ethics Committee.

Determination of melanin content The melanin content in the cells was determined with a sodium hydroxide assay. The same number of cells was seeded into a 96well plate, and after the cells were attached, they were mixed with 100 ml of 1 mol/L sodium hydroxide and allowed to stand in a water bath at 70  C for 2 hours. Then, the absorbance of the cells at 490 nm was measured with a microplate reader.

Cell infection Virus particleebased plasmids for overexpression of UCA1 and the negative control were provided by Shanghai GeneChem Company (Shanghai, China). Virus particleebased short hairpin RNAs targeting UCA1 and nonsilencing short hairpin RNAs were purchased from GenePharma Biotechnology Company (Shanghai, China). The viral infection was performed according to the manufacturer’s instructions. According to the sequence of UPF1, three target UPF1 small interfering RNAs with different sites were designed to avoid an off-target effect. The target small interfering RNAs and the control small interfering RNA were synthesized by GenePharma Company. Small interfering RNAs were transfected into PIG1 cells using Lipofectamine 3000 (#L3000015, Invitrogen, San Diego, CA) according to the corresponding instructions.

UV irradiation and other stimuli of MCs Human primary MCs or PIG1 cells (normal cells or cells infected with lentivirus) were inoculated into the culture dishes at an appropriate density. After the cells attached, they were irradiated with different doses and repeated low doses of UVB by UV-inducing instruments (SS-03B, Sigma, Shanghai, China). Detailed procedures are described in our published articles (Zeng et al., 2016). We used 150 mM a-MSH, 100 ng/ml FGF2, a nonlethal dose (1 mM) of H2O2, and serum-free DMEM to treat the melanocytes for 24 hours, and we detected the level of UCA1.

3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay The cells were seeded at a suitable density into 96-well plates and were allowed to attach. The cell proliferation activity was measured using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay (Beyotime, Shanghai, China), and a multifunction microplate reader was utilized to measure the absorbance value of each well at a wavelength of 490 nm.

Immunofluorescence The cells were fixed with 4% paraformaldehyde and were incubated with a PMEL17 antibody (Novus Biologicals, Centennial, CO) overnight. Then, the cells were incubated in the dark with a fluorescent secondary antibody and DAPI staining solution. Finally, the cells were observed under a fluorescence confocal microscope (LSM800, Zeiss, Oberkochen, Germany). Green fluorescence indicated melanin, and blue fluorescence revealed the nuclei.

RNA extraction and qRT-PCR The total cellular RNA was extracted with the E.Z.N.A. Total RNA Kit II (#R6934-02, Omega Bio-Tek, Norcross, GA) and was then reversetranscribed into cDNA using a reverse transcription kit (#FS1-301, Toyobo, Osaka, Japan). The PCR system was prepared according to the SYBR qPCR Mix (#QPS-201T, Toyobo) kit. Variance in the www.jidonline.org

9

S Pei et al.

UCA1 Negatively Regulates Melanogenesis expression of UCA1, TYR, TYRP1, TYRP2, RAB27A, FSCN1, MYO5A, ADCY1, ADCY2, UPF1, and GAPDH (Supplementary Table S2) was detected using a real-time PCR instrument (Roche LightCycler480II, Basel, Switzerland) with GAPDH as the internal reference; DCT¼2-DDCt.

High-throughput sequencing Transcriptomic changes after the overexpression of UCA1 in PIG1 cells (three replicates for each group) were analyzed using the BGISEQ-50 high-throughput sequencing platform (BGI, Shenzhen, China). The processes of library construction and RNA sequencing were performed according to a procedure described previously (Zhu et al., 2018).

Western blotting The total cellular protein was extracted from RIPA lysate (Beyotime). The protein concentration was determined by a bicinchoninic acid protein concentration quantification kit (#KGPBCA, Nanjing Kaki Biotechnology, Nanjing, China). Primary antibodies against MITF (#MABE78, Millipore, San Diego, CA), TYR (#ab180753, Abcam, Cambridge, United Kingdom), TYRP1 (#MABC592, Millipore), TYRP2 (NBP1-56058, Novus Biologicals), RAB27A (#69295, Cell Signaling Technology, Danvers, MA), FSCN1 (#9269, Cell Signaling Technology), MYO5A (#3402, Cell Signaling Technology), CREB (#9197, Cell Signaling Technology), p-CREB (#9198, Cell Signaling Technology), ERK (#4695, Cell Signaling Technology), p-ERK (#4370, Cell Signaling Technology), JNK (#9252, Cell Signaling Technology), p-JNK (#4668, Cell Signaling Technology), p38 (#8690, Cell Signaling Technology), p-p38 (#4511, Cell Signaling Technology), Akt (#4691, Cell Signaling Technology), p-Akt (#4060, Cell Signaling Technology), STAT (#4904, Cell Signaling Technology), pSTAT (#9145, Cell Signaling Technology), PKA (#3927, Cell Signaling Technology), CaMKIV (13263-1-AP, Proteintech, Rosemont, IL), ADCY2 (A9805, ABclonal, Woburn, MA), ADCY5 (bs3922R, Bioss, Woburn, MA), and GAPDH (#2118, Cell Signaling Technology) were incubated with the membranes overnight at 4  C. After washing three times with tris-buffered salineeTween20, the membranes were incubated with a goat anti-mouse secondary antibody or a goat anti-rabbit secondary antibody. Fluorescence development analysis was performed to detect protein changes using a two-color infrared laser imaging system (Odyssey CLx, Nanjing, China).

cAMP-Glo Normal PIG1 cells and PIG1 cells overexpressing or downregulating UCA1 were seeded at the same cell density into black 96-well plates. cAMP content in the cells was detected according to the instructions of the cAMP-Glo content detection kit.

Statistical analysis Statistical analysis was performed with SPSS 22.0 (SPSS Inc, Chicago, IL). Data are presented as the mean  standard deviation. Significance tests were conducted on the data groups using analysis of variance followed by a comparison between the specific groups using Student’s t-test. P-values < 0.05 were considered statistically significant (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001). Each experiment was repeated at least three times.

Data availability statement The high-throughput sequencing datasets related to this article can be found at http://cdts-wh.genomics.cn:90, hosted at the BGI Data Delivery System, which is available after making an account. 10

Journal of Investigative Dermatology (2019), Volume

-

ORCIDs Shiyao Pei: https://orcid.org/0000-0003-0821-5260 Jing Chen: https://orcid.org/0000-0001-9359-6568 Jianyun Lu: https://orcid.org/0000-0002-4757-6141 Shuanghai Hu: https://orcid.org/0000-0002-0702-879X Ling Jiang: https://orcid.org/ 0000-0001-5082-097X Li Lei: https://orcid.org/0000-0002-3172-6467 Yujie Ouyang: https://orcid.org/0000-0002-6924-5968 Chuhan Fu: https://orcid.org/0000-0003-0116-4675 Yufang Ding: https://orcid.org/0000-0002-3378-2059 Si Li: https://orcid.org/0000-0001-5997-7383 Liyang Kang: https://orcid.org/0000-0001-9838-7378 Lihua Huang: https://orcid.org/0000-0003-1207-6128 Hong Xiang: https://orcid.org/0000-0003-4896-1321 Rong Xiao: https://orcid.org/0000-0002-6214-8057 Qinghai Zeng: https://orcid.org/0000-0002-6747-1486 Jinhua Huang: https://orcid.org/0000-0001-6915-4284

CONFLICT OF INTEREST The authors state no conflict of interest.

ACKNOWLEDGMENTS This work was supported by the National Natural Science Foundation of China (No. 81703101), the New Xiangya Talent Projects of the Third Xiangya Hospital of Central South University (No. JY201623 and No. 20170301), and the Natural Science Foundation of Hunan Province (No. 2018JJ3788 and No. 2018JJ3793).

AUTHOR CONTRIBUTIONS Conceptualization: JC, QZ, JH; Data Curation: SP, SH, YO, LJ, CF, YD; Formal Analysis: SP, QZ, JH; Funding Acquisition: JC, QZ, JH; Investigation: JL, SH; Methodology: JL, SH, LL, YO, LJ, CF, YD, LK, LH, RX; Project Administration: SP; Resources: JC, LL, SL, LK, LH, HX; Supervision: RX, QZ, JH; Validation: RX, QZ, JH; Writing - Original Draft Preparation: SP, QZ, JH; Writing - Review and Editing: SP, RX, QZ, JH.

SUPPLEMENTARY MATERIAL Supplementary material is linked to the online version of the paper at www. jidonline.org, and at https://doi.org/10.1016/j.jid.2019.04.029.

REFERENCES Alam MB, Ahmed A, Motin MA, Kim S, Lee S. Attenuation of melanogenesis by Nymphaea nouchali (Burm.f) flower extract through the regulation of cAMP/CREB/MAPKs/MITF and proteasomal degradation of tyrosinase. Sci Rep 2018;8:13928. Alves CP, Yokoyama S, Goedert L, Pontes CLS, Sousa JF, Fisher DE, et al. MYO5A gene is a target of MITF in melanocytes. J Invest Dermatol 2017;137:985e9. Bergmann JH, Spector DL. Long non-coding RNAs: modulators of nuclear structure and function. Curr Opin Cell Biol 2014;26:10e8. Byun EB, Song HY, Mushtaq S, Kim HM, Kang JA, Yang MS, et al. Gammairradiated luteolin inhibits 3-isobutyl-1-methylxanthine-induced melanogenesis through the regulation of CREB/MITF, PI3K/Akt, and ERK pathways in B16BL6 melanoma cells. J Med Food 2017;20:812e9. Camacho-Hubner A, Beermann F. Cellular and molecular features of mammalian pigmentation - tyrosinase and TRPs. Pathol Biol 2000;48: 577e83. Castro-Vega LJ, Kiando SR, Burnichon N, Buffet A, Amar L, Simian C, et al. The MITF, p.E318K Variant, as a Risk Factor for Pheochromocytoma and Paraganglioma. J Clin Endocrinol Metab 2016;101:4764e8. Chen SP, Sun J, Zhou YQ, Cao F, Braun C, Luo F, et al. Sinomenine attenuates cancer-induced bone pain via suppressing microglial JAK2/STAT3 and neuronal CAMKII/CREB cascades in rat models. Mol Pain 2018a;14: 1744806918793232. Chen T, Zhao B, Liu Y, Wang R, Yang Y, Yang L, et al. MITF-M regulates melanogenesis in mouse melanocytes. J Dermatol Sci 2018b;90:253e62. Chen X, Gao J, Yu Y, Zhao Z, Pan Y. Long non-coding RNA UCA1 targets miR185-5p and regulates cell mobility by affecting epithelial-mesenchymal transition in melanoma via Wnt/beta-catenin signaling pathway. Gene 2018c;676:298e305. Chiaverini C, Beuret L, Flori E, Busca R, Abbe P, Bille K, et al. Microphthalmia-associated transcription factor regulates RAB27A gene

S Pei et al.

UCA1 Negatively Regulates Melanogenesis expression and controls melanosome transport. J Biol Chem 2008;283: 12635e42. Chicois C, Scheer H, Garcia S, Zuber H, Mutterer J, Chicher J, et al. The UPF1 interactome reveals interaction networks between RNA degradation and translation repression factors in Arabidopsis. Plant J 2018;96:119e32. Choi MH, Jo HG, Yang JH, Ki SH, Shin HJ. Antioxidative and AntiMelanogenic Activities of Bamboo Stems (Phyllostachys nigra variety Henosis) via PKA/CREB-Mediated MITF Downregulation in B16F10 Melanoma Cells. Int J Mol Sci 2018;19:E409. Correia MS, Moreiras H, Pereira FJC, Neto MV, Festas TC, Tarafder AK, et al. Melanin transferred to keratinocytes resides in nondegradative endocytic compartments. J Invest Dermatol 2018;138:637e46. Daniel PM, Filiz G, Tymms MJ, Ramsay RG, Kaye AH, Stylli SS, et al. Intratumor MAPK and PI3K signaling pathway heterogeneity in glioblastoma tissue correlates with CREB signaling and distinct target gene signatures. Exp Mol Pathol 2018;105:23e31. Deng WW, Hu Q, Liu ZR, Chen QH, Wang WX, Zhang HG, et al. KDM4B promotes DNA damage response via STAT3 signaling and is a target of CREB in colorectal cancer cells. Mol Cell Biochem 2018;449:81e90. Dong Y, Pu K, Duan W, Chen H, Chen L, Wang Y. Involvement of Akt/CREB signaling pathways in the protective effect of EPA against interleukin-1betainduced cytotoxicity and BDNF down-regulation in cultured rat hippocampal neurons. BMC Neurosci 2018;19:52. Fane ME, Chhabra Y, Hollingsworth DEJ, Simmons JL, Spoerri L, Oh TG, et al. NFIB mediates BRN2 driven melanoma cell migration and invasion through regulation of EZH2 and MITF. EBioMedicine 2017;16:63e75. Fujimura M, Usuki F. Methylmercury induces oxidative stress and subsequent neural hyperactivity leading to cell death through the p38 MAPK-CREB pathway in differentiated SH-SY5Y cells. Neurotoxicology 2018;67: 226e33. Fujita H, Motokawa T, Katagiri T, Yokota S, Yamamoto A, Himeno M, et al. Inulavosin, a melanogenesis inhibitor, leads to mistargeting of tyrosinase to lysosomes and accelerates its degradation. J Invest Dermatol 2009;129: 1489e99. Glady A, Tanaka M, Moniaga CS, Yasui M, Hara-Chikuma M. Involvement of NADPH oxidase 1 in UVB-induced cell signaling and cytotoxicity in human keratinocytes. Biochem Biophys Rep 2018;14:7e15. Gu L, Lu LS, Zhou DL, Liu ZC. UCA1 promotes cell proliferation and invasion of gastric cancer by targeting CREB1 sponging to miR-590-3p. Cancer Med 2018;7:1253e63. Halls ML, Cooper DMF. Adenylyl cyclase signalling complexes - Pharmacological challenges and opportunities. Pharmacol Ther 2017;172: 171e80. Hasse S, Mu¨ller MC, Schallreuter KU, von Woedtke TV. Stimulation of melanin synthesis in melanoma cells by cold plasma. Biol Chem 2018;400: 101e9. Hu ML, Wang XY, Chen WM. TGF-beta1 upregulates the expression of lncRNA UCA1 and its downstream HXK2 to promote the growth of hepatocellular carcinoma. Eur Rev Med Pharmacol Sci 2018;22:4846e54. Hu S, Huang J, Pei S, Ouyang Y, Ding Y, Jiang L, et al. Ganoderma lucidum polysaccharide inhibits UVB-induced melanogenesis by antagonizing cAMP/PKA and ROS/MAPK signaling pathways. J Cell Physiol 2019;234: 7330e40.

Kim Y, Kwon SY, Jung HS, Park YJ, Kim YS, In JH, et al. Amitriptyline inhibits the MAPK/ERK and CREB pathways and proinflammatory cytokines through A3AR activation in rat neuropathic pain models. Korean J Anesthesiol 2019;72:60e7. Kim YK, Maquat LE. UPFront and center in RNA decay: UPF1 in nonsensemediated mRNA decay and beyond. RNA 2019;25:407e22. Kobayashi T, Hearing VJ. Direct interaction of tyrosinase with Tyrp1 to form heterodimeric complexes in vivo. J Cell Sci 2007;120:4261e8. Kobayashi T, Imokawa G, Bennett DC, Hearing VJ. Tyrosinase stabilization by Tyrp1 (the brown locus protein). J Biol Chem 1998;273:31801e5. Konar A, Kumar A, Maloney B, Lahiri DK, Thakur MK. A serine protease KLK8 emerges as a regulator of regulators in memory: microtubule protein dependent neuronal morphology and PKA-CREB signaling. Sci Rep 2018;8: 9928. Krause HM. New and prospective roles for lncRNAs in organelle formation and function. Trends Genet 2018;34:736e45. Lee DH, Ahn SS, Kim JB, Lim Y, Lee YH, Shin SY. Downregulation of alphamelanocyte-stimulating hormone-Induced Activation of the Pax3-MITFtyrosinase Axis by Sorghum ethanolic Extract in B16F10 Melanoma Cells. Int J Mol Sci 2018;19:E1640. Li C, Liang G, Yang S, Sui J, Yao W, Shen X, et al. Dysregulated lncRNA-UCA1 contributes to the progression of gastric cancer through regulation of the PI3K-Akt-mTOR signaling pathway. Oncotarget 2017a;8:93476e91. Li D, Cui C, Chen J, Hu Z, Wang Y, Hu D. Long noncoding RNA UCA1 promotes papillary thyroid cancer cell proliferation via miR204mediated BRD4 activation. Mol Med Rep 2018a;18:3059e67. Li HJ, Li X, Pang H, Pan JJ, Xie XJ, Chen W. Long non-coding RNA UCA1 promotes glutamine metabolism by targeting miR-16 in human bladder cancer. Jpn J Clin Oncol 2015;45:1055e63. Li HJ, Sun XM, Li ZK, Yin QW, Pang H, Pan JJ, et al. LncRNA UCA1 promotes mitochondrial function of bladder cancer via the MiR-195/ARL2 signaling pathway. Cell Physiol Biochem 2017b;43:2548e61. Li J, Gao J, Kan A, Hao T, Huang L. SNHG and UCA1 as prognostic molecular biomarkers in hepatocellular carcinoma: recent research and meta-analysis. Minerva Med 2017c;108:568e74. Li T, Xiao Y, Huang T. HIF1alphainduced upregulation of lncRNA UCA1 promotes cell growth in osteosarcoma by inactivating the PTEN/AKT signaling pathway. Oncol Rep 2018b;39:1072e80. Liang C, Yang Y, Guan J, Lv T, Qu S, Fu Q, et al. LncRNA UCA1 sponges miR204-5p to promote migration, invasion and epithelial-mesenchymal transition of glioma cells via upregulation of ZEB1. Pathol Res Pract 2018;214: 1474e81. Liu H, Wang G, Yang L, Qu J, Yang Z, Zhou X. Knockdown of Long NonCoding RNA UCA1 Increases the tamoxifen Sensitivity of Breast Cancer Cells through Inhibition of Wnt/beta-catenin Pathway. PLOS ONE 2016;11: e0168406. Liu X, Zhang L, Jin L, Tan Y, Li W, Tang J. HCN2 contributes to oxaliplatininduced neuropathic pain through activation of the CaMKII/CREB cascade in spinal neurons. Mol Pain 2018;14:1744806918778490. Lopes VS, Ramalho JS, Owen DM, Karl MO, Strauss O, Futter CE, et al. The ternary Rab27a-Myrip-Myosin VIIa complex regulates melanosome motility in the retinal pigment epithelium. Traffic 2007;8:486e99.

Ishii N, Ryu M, Suzuki YA. Lactoferrin inhibits melanogenesis by downregulating MITF in melanoma cells and normal melanocytes. Biochem Cell Biol 2017;95:119e25.

Lu HW, Liu XD. UCA1 promotes papillary thyroid carcinoma development by stimulating cell proliferation via Wnt pathway. Eur Rev Med Pharmacol Sci 2018;22:5576e82.

Ji K, Zhang P, Zhang J, Fan R, Liu Y, Yang S, et al. MicroRNA 143e5p regulates alpaca melanocyte migration, proliferation and melanogenesis. Exp Dermatol 2018;27:166e71.

Mann T, Gerwat W, Batzer J, Eggers K, Scherner C, Wenck H, et al. Inhibition of human tyrosinase requires molecular motifs distinctively different from mushroom tyrosinase. J Invest Dermatol 2018;138:1601e8.

Kaikkonen MU, Adelman K. Emerging roles of non-coding RNA transcription. Trends Biochem Sci 2018;43:654e67.

Mishima Y, Tanay A. The effect of alpha-methyldopa and ultraviolet irradiation on melanogenesis. Dermatologica 1968;136:105e14.

Kemp MG, Krishnamurthy S, Kent MN, Schumacher DL, Sharma P, Excoffon K, et al. Spironolactone depletes the XPB protein and inhibits DNA damage responses in UVB-irradiated human skin. J Invest Dermatol 2019;139:448e54.

Nguyen J, Alexander T, Jiang H, Hill N, Abdullaev Z, Pack SD, et al. Melanoma in patients with GATA2 deficiency. Pigment Cell Melanoma Res 2018;31:337e40.

Kim NH, Choi SH, Kim CH, Lee CH, Lee TR, Lee AY. Reduced MiR-675 in Exosome in H19 RNA-Related Melanogenesis via MITF as a Direct Target. J Invest Dermatol 2014;134:1075e82.

Nishina A, Miura A, Goto M, Terakado K, Sato D, Kimura H, et al. Mansonone E from Mansonia gagei Inhibited a-MSH-Induced Melanogenesis in B16 Cells by Inhibiting CREB Expression and Phosphorylation in the PI3K/Akt Pathway. Biol Pharm Bull 2018;41:770e6.

www.jidonline.org

11

S Pei et al.

UCA1 Negatively Regulates Melanogenesis Oonincx DGAB, van Keulen P, Finke MD, Baines FM, Vermeulen M, Bosch G. Evidence of vitamin D synthesis in insects exposed to UVb light. Sci Rep 2018;8:10807.

Wei Y, Sun Q, Zhao L, Wu J, Chen X, Wang Y, et al. LncRNA UCA1-miR-507FOXM1 axis is involved in cell proliferation, invasion and G0/G1 cell cycle arrest in melanoma. Med Oncol 2016;33:88.

Park KH, Choi Y, Yoon DS, Lee KM, Kim D, Lee JW. Zinc promotes osteoblast differentiation in human mesenchymal stem cells via activation of the cAMP-PKA-CREB signaling pathway. Stem Cells Dev 2018;27:1125e35.

Wu C, Luo J. Long Non-Coding RNA (lncRNA) urothelial carcinomaassociated 1 (UCA1) enhances tamoxifen resistance in breast cancer cells via inhibiting mTOR signaling pathway. Med Sci Monit 2016;22:3860e7.

Pei S, Huang J, Chen J, Hu S, Lei L, Fu C, et al. UVB-inhibited H19 activates melanogenesis by paracrine effects. Exp Dermatol 2018;27:1120e5.

Wu H, Zhou C. Long non-coding RNA UCA1 promotes lung cancer cell proliferation and migration via microRNA-193a/HMGB1 axis. Biochem Biophys Res Commun 2018;496:738e45.

Qian H, Yang C, Yang Y. MicroRNA-26a inhibits the growth and invasiveness of malignant melanoma and directly targets on MITF gene. Cell Death Discov 2017;3:17028. Sarangarajan R, Zhao Y, Babcock G, Cornelius J, Lamoreux ML, Boissy RE. Mutant alleles at the brown locus encoding tyrosinase-related protein-1 (TRP-1) affect proliferation of mouse melanocytes in culture. Pigment Cell Res 2000;13:337e44. Shin SY, Gil HN, Choi JH, Lim Y, Lee YH. Agerarin inhibits a-MSHeinduced TYR gene transcription via STAT3 suppression independent of CREB-MITF pathway. J Dermatol Sci 2018;91:107e10. Slominski A, Kim et al. The role melanogenesis HIF-dependent 79e93.

_ T-K, Brozyna AA, Janjetovic Z, Brooks DLP, Schwab LP, of melanogenesis in regulation of melanoma behavior: leads to stimulation of HIF-1alpha expression and attendant pathways. Arch Biochem Biophys 2014;563:

Sultana H, Seo D, Choi NR, Bhuiyan MSA, Lee SH, Heo KN, et al. Identification of polymorphisms in MITF and DCT genes and their associations with plumage colors in Asian duck breeds. Asian-Australas J Anim Sci 2018;31:180e8. Sun L, Guo Y, Zhang Y, Zhuang Y. Antioxidant and anti-tyrosinase activities of phenolic extracts from rape bee pollen and inhibitory melanogenesis by cAMP/MITF/TYR pathway in B16 mouse melanoma cells. Front Pharmacol 2017;8:104.

12

Xie W, Ye Y, Feng Y, Xu T, Huang S, Shen J, et al. Linderane suppresses hepatic gluconeogenesis by inhibiting the cAMP/PKA/CREB pathway through indirect activation of PDE 3 via ERK/STAT3. Front Pharmacol 2018;9:476. Xue M, Li X, Chen W. [Bioinformatics analysis and identification of transcriptional regulation of human UCA1 gene]. Nan Fang Yi Ke Da Xue Xue Bao 2013;33:1596e9 [in Chinese]. Yang C, Li X, Wang Y, Zhao L, Chen W. Long non-coding RNA UCA1 regulated cell cycle distribution via CREB through PI3-K dependent pathway in bladder carcinoma cells. Gene 2012;496:8e16. Yang N, Mu L, Zhao B, Wang M, Hu S, Zhao B, et al. RNAi-mediated SLC7A11 knockdown inhibits melanogenesis-related genes expression in rabbit skin fibroblasts. J Genet 2018;97:463e8. Yu W, Xu M, Zhang T, Zhang Q, Zou C. Mst1 promotes cardiac ischemiareperfusion injury by inhibiting the ERK-CREB pathway and repressing FUNDC1-mediated mitophagy. J Physiol Sci 2019;69:113e27. Zeng Q, Wang Q, Chen X, Xia K, Tang J, Zhou X, et al. Analysis of lncRNAs expression in UVB-induced stress responses of melanocytes. J Dermatol Sci 2016;81:53e60. Zhang K, Anumanthan G, Scheaffer S, Cornelius LA. HMGB1/RAGE Mediates UVB-induced Secretory inflammatory Response and Resistance to Apoptosis in Human Melanocytes. J Invest Dermatol 2019;139:202e12.

Walker MJ, Silliman E, Dayton MA, Lang JC. The expression of C-myb in human metastatic melanoma cell lines and specimens. Anticancer Res 1998;18:1129e35.

Zhao H, Zhang J, Shao H, Liu J, Jin M, Chen J, et al. miRNA-340 inhibits osteoclast differentiation via repression of MITF. Biosci Rep 2017;37(4).

Wang Y, Hou Z, Li D. Long noncoding RNA UCA1 promotes anaplastic thyroid cancer cell proliferation via miR135amediated cmyc activation. Mol Med Rep 2018;18:3068e76.

Zhou J, Geng KK, Ping FF, Gao YY, Liu L, Feng BN. Cross-talk between 5hydroxytryptamine and substance P in the melanogenesis and apoptosis of B16F10 melanoma cells. Eur J Pharmacol 2016;775:106e12.

Wang ZQ, Cai Q, Hu L, He CY, Li JF, Quan ZW, et al. Long noncoding RNA UCA1 induced by SP1 promotes cell proliferation via recruiting EZH2 and activating AKT pathway in gastric cancer. Cell Death Dis 2017;8:e2839.

Zhu FY, Chen MX, Ye NH, Qiao WM, Gao B, Law WK, et al. Comparative performance of the BGISEQ-500 and Illumina HiSeq4000 sequencing platforms for transcriptome analysis in plants. Plant Methods 2018;14:69.

Journal of Investigative Dermatology (2019), Volume

-

S Pei et al.

UCA1 Negatively Regulates Melanogenesis

Supplementary Figure S1. The effect of UCA1 on PIG1 proliferation activity was detected by MTT assay. H, hours; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5diphenyltetrazolium bromide; NC, negative control; OD, optical density; PIG1, human immortalized melanocytes.

Supplementary Figure S2. Details of the DEGs identified after UCA1 was overexpressed in PIG1 cells. (a) Heatmap for NC and UCA1. The X-axis represents the sample, the Y-axis represents the DEGs. The color represents the log10-transformed gene expression level. (b) GO analysis of DEGs. The X-axis represents the number of DEGs, the Y-axis represents the GO terms. (c) GO classification of upregulated and downregulated genes. The X-axis represents the GO terms, the Y-axis represents the amount of up- or downregulated genes. (d) Pathway classification of DEGs. The X-axis represents the number of DEGs, the Y-axis represents KEGG functional classifications. There are seven branches for KEGG pathways. (e) The melanogenesis pathway. The green boxes indicate downregulation, and the red box indicates upregulation. DEG, differentially expressed gene; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; NC, negative control; PIG1, human immortalized melanocytes.

www.jidonline.org 12.e1

S Pei et al.

UCA1 Negatively Regulates Melanogenesis

Supplementary Figure S3. Relative quantitative results of Figure 4a. The changes in PKA, ERK, JNK and their phosphorylation levels are statistically significant. ERK, extracellular signaleregulated kinase; JNK, c-Jun N-terminal kinase; PKA, protein kinase A.

12.e2 Journal of Investigative Dermatology (2019), Volume

-

S Pei et al.

UCA1 Negatively Regulates Melanogenesis

Supplementary Figure S4. UCA1 may antagonize UVB-induced melanogenesis in PIG1 cells. (a) Cell density and cell status were observed 24 hours after a single exposure to different doses of UVB irradiation. (b, c) The cell viability was measured by MTT assay after a single exposure and after consecutive three days of UVB irradiation. (d, e) The expression of UCA1 in PIG1 cells was detected after single and repeated UVB irradiation. (f, g) qRT-PCR and western blot results show the expression of melanogenesis-related genes in PIG1 cells after three days of continuous UVB irradiation. (h) The expression of melanogenesis-related genes was examined in overexpressed UCA1 PIG1 cells treated with low doses of UVB. (def, h) Mean  SEM; n ¼ 3. Two-tailed t-test, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; PIG1, human immortalized melanocytes; qRT-PCR, quantitative real-time reverse transcriptaseePCR; SEM, standard error of the mean. Bar ¼ 100mm

www.jidonline.org 12.e3

S Pei et al.

UCA1 Negatively Regulates Melanogenesis Supplementary Figure S5. Stimuli of oxidative stress, nutritional deficiencies, a-MSH, and FGF2 on UCA1 expression. (aed) The expression of UCA1 in melanocytes was detected after respective treatment of 150 mM a-MSH, 100 ng/ml FGF2, nonlethal dose (1mM) of H2O2, and serum-free DMEM for 24 hours. Mean  SEM; n ¼ 3. Twotailed t-test, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. a-MSH, a-melanocyte-stimulating hormone.

Supplementary Figure S6. The change of UCA1 expression after inhibiting UPF1 expression in MCs. (a) The expression of UPF1 was detected by qRT-PCR in MCs, PIG1, SK-MEL-28, and A375. (b) Three siRNA including si-UPF1-1, si-UPF1-2, and si-UPF1-3 were used to infect in PIG1 cells, and the first two siRNAs could downregulate the expression of UPF1. (c) The expression of UCA1 was detected by qRT-PCR assay. Mean  SEM; n ¼ 3. Two-tailed t-test, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. MC, melanocyte; PIG1, human immortalized melanocytes; qRT-PCR, quantitative real-time reverse transcriptaseePCR; SEM, standard error of the mean; siRNA, small interfering RNA.

12.e4 Journal of Investigative Dermatology (2019), Volume

-

S Pei et al.

UCA1 Negatively Regulates Melanogenesis

Supplementary Table S1. The Top 29 DEGs and Their Variation Multiples Gene NPIPA7 ATP5J2-PTCD1 FSBP MRGPRX4 RIMBP3C SYNJ2BP-COX16 FABP4 CGB3 FXYD7 ACOT12 WRB-SH3BGR LYL1 INSM1 ANKRD20A1 ZNF541 FXYD3 HOXA10 GRIN2C PPP1R14A KLF14 OPRD1 KRT27 CLYBL LDB2 HSD3B1 TMEM191C DCT SLC18A1 IGSF11

log2ratio (UCA1/NC)

Gene

log2ratio (UCA1/NC)

-8.904231703 -8.077283988 -6.168998688 -4.730300485 -4.610432285 -4.504637621 -3.624931854 -3.40869166 -2.863091592 -2.731847058 -2.635960884 -2.409918963 -2.344031028 -2.336775389 -2.246420231 -2.246420231 -2.212068726 -2.198008026 -2.185182602 -2.153310827 -2.131454517 -2.126125997 -2.094417138 -2.094417138 -2.094082444 -2.075434034 -2.067679921 -2.06199566 -2.058499696

PLA2G4B PYURF GAGE12I PAK6 HS3ST1 ASTN1 KCNJ15 TM4SF20 MX2 UPB1 C4B_2 TFPI2 ADGRL2 UGT1A6 SCN3A IL24 C8ORF44-SGK3 BEND4 MX1 IFI44L DCSTAMP CORO7-PAM16 BHLHE22 BRINP2 TRIM22 TMEM47 TMEM200A OAS2 POC1B-GALNT4

8.16222795 7.290992328 4.775947582 4.554479669 3.775947582 3.775947582 3.719364054 3.368866806 2.971672053 2.660470365 2.550942919 2.534939482 2.524815265 2.512090893 2.456100655 2.249604583 2.215565352 2.190985081 2.17881596 2.152111431 2.099354606 2.068963728 2.034865879 1.96859266 1.948874425 1.92350477 1.901478464 1.889645966 1.888298719

Abbreviations: DEG, differentially expressed gene; NC, negative control.

Supplementary Table S2. PCR Primer Sequences Gene UCA1 MITF TYR TYRP1 TYRP2 RAB27A FSCN1 ADCY2 ADCY5 UPF1 MYO5A GAPDH

Forward Primer (5’-3’)

Reverse Primer (5’-3’)

TTAGTGGCTGAAGACTGATGC AAATACGTTGCCTGTCTCGG TCAGCCCAGCATCATTCTTC ACCAGAGGGTTCTCATAGTCAG GGGCAGCGAGACCAGACGAT GTAGTGAAAGAGGAGGAAGC TGCCAATCAGGACGAGGAGAC TTTATCCTGGTCTGCATCGAGT TCTCCTGCACCAACATCGTG ACCGACTTTACTCTTCCTAGCC GCCCGATGCTATGCTAAGTT TGACGTGGACATCCGCAAAG

GAGGCTGTAGAGTTTGAGGG TGTTGGGAAGGTTGGCTGGA GGCATCCGCTATCCCAGTAA TTCTCAAATTGTGGCGTGTT TTGGCAATTTCATGCTGTTTCTTC TCATTATCAGGTCCAGAAGC TCACGCCACTCGATGTCAAAGT TGGCAACAAGGCATATCCATATC CATGGCAACATGACGGGGA AGGTCCTTCGTGTAATAGGTGTC GCCAAGAAGCCTCGCAAGTA CTGGAAGGTGGACAGCGAGG

www.jidonline.org 12.e5