- Email: [email protected]
The LRRK2 G2385R variant is a risk factor for sporadic Parkinson's disease in the Korean population
Parkinsonism and Related Disorders 16 (2010) 85–88
Contents lists available at ScienceDirect
Parkinsonism and Related Disorders journal homepage: www.elsevier.com/locate/parkreldis
The LRRK2 G2385R variant is a risk factor for sporadic Parkinson’s disease in the Korean population Jong-Min Kim a, Jee-Young Lee b, Hee Jin Kim a, Ji Seon Kim a, Eun-Soon Shin c, Jin-Hwan Cho a, Sung Sup Park d, Beom S. Jeon a, * a
Department of Neurology, Seoul National University College of Medicine, MRC and BK-21, Clinical Research Institute, Seoul National University Hospital and Bundang Hospital, Boramae Municipal Hospital, Seoul, South Korea Department of Neurology , Inje University, Ilsan Paik Hospital, Koyang, South Korea c DNA Link Inc. Bioinformatics 1 Team, Seoul, South Korea d Department of Laboratory Medicine, Seoul National University College of Medicine, Seoul, South Korea b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 10 April 2009 Received in revised form 6 October 2009 Accepted 9 October 2009
The G2385R (SNP accession no. rs34778348) and R1628P (rs33949390) variants of leucine-rich repeat kinase 2 (LRRK2, PARK8) are emerging as an important risk factor for Parkinson’s disease (PD) in the ethnic Chinese and Japanese populations. The purpose of this study was to investigate whether these variants are a genetic risk factor in sporadic PD patients in the Korean population. A total of 923 patients and 422 healthy subjects were included. The variants were screened by a SNaPshot assay. The LRRK2 G2385R variant was detected in 82 PD patients (8.9%, two homozygous and 80 heterozygous) and in 21 normal controls (5.0%, all heterozygous). The frequency of the LRRK2 G2385R variant in PD was significantly higher than in normal controls (adjusted odds ratio 1.83, p ¼ 0.0170, 95% confidence interval 1.11–3.00). There were no differences in the mean age at onset or gender between the G2385R carriers and the non-carriers in PD patients. The LRRK2 R1628P variant was very rare (0.78% in patients versus 0.26% in controls) in the tested 384 patient–control pairs, and was not a significant risk factor. This study supports that the LRRK2 G2385R variant may be a genetic risk factor for sporadic PD in the Korean population. Ó 2009 Elsevier Ltd. All rights reserved.
Keywords: LRRK2 G2385R R1628P Parkinson’s disease Polymorphism
1. Introduction Leucine-rich repeat kinase 2 (LRRK2, PARK8) mutations are associated with familial autosomal dominant Parkinson’s disease (PD) [1,2]. Among LRRK2 mutations, the most common LRRK2 G2019S mutation accounts for about 3–7% of familial PD in a number of European populations with up to 40% prevalence in North Africans and Ashkenazi Jews [3–8]. Of greater clinical importance is the observation that this common LRRK2 mutation may be present in about 1–1.6% of sporadic PD, and some of these patients resemble clinically typical, late-onset PD [4,6]. However, this G2019S mutation has shown ethnic differences among Caucasian and Asian populations, and is rare in Asians [3–11]. In the Korean population, the G2019S mutation has not been detected [12,13].
On the other hand, a LRRK2 G2385R variant has been found to be a common genetic risk factor in Asians, but not in Caucasians [14–20]. In ethnic Chinese and Japanese samples, the LRRK2 G2385R has a frequency of 6.7–11.6% in sporadic PD patients and 3.6–5.6% in control subjects [16–20]. In Caucasian samples, the frequency of the LRRK2 G2385R variant was less than 1% in control subjects [14]. Recently, a LRRK2 R1628P variant has also been reported as a genetic risk factor for PD in ethnic Chinese from Taiwan, Singapore, and China [21–24]. In the Malay and Indian populations, this variant is very rare or absent, and does not appear to be a risk factor in these populations [23]. The ethnic specificity and prevalence in sporadic PD prompted us to investigate whether the LRRK2 G2385R and R1628P variants are genetic risk factors in sporadic PD patients and healthy controls in the Korean population. 2. Methods 2.1. Subjects
* Correspondence to: Beom S. Jeon, Department of Neurology, Seoul National University Hospital, Chongno-Ku Yunkeun-Dong 28, Seoul 110-744, South Korea. Tel.: þ82 2 2072 2876; fax: þ82 2 3672 7553. E-mail address: [email protected] (B.S. Jeon). 1353-8020/$ – see front matter Ó 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.parkreldis.2009.10.004
Gene samples were obtained from the gene bank at the Movement Disorder Division of Seoul National University Hospital. All patients and controls were native Koreans. All patients were personally examined and have been followed regularly by the senior neurologist (BSJ) at Seoul National University Hospital since 1993. The
86
J.-M. Kim et al. / Parkinsonism and Related Disorders 16 (2010) 85–88
Table 1 Demographic features of the subjects. Characteristics
Normal controls N ¼ 422
Total PD patients N ¼ 923
LOPD N ¼ 804
YOPD N ¼ 119
No. of male (%) Age, yr Age at onset, yr
190 (45.0%) 61.9 9.5 (37–85)
408 (44.3%) 63.7 9.9 (22–91) 54.8 10.9 (18–85)
349 (43.5%) 65.7 8.5 (44–91) 57.5 8.6
59 (49.6%) 50.5 8.1 (22–71) 35.9 3.9
Values are shown as mean standard deviation (range). PD ¼ Parkinson’s disease; LOPD ¼ late-onset PD; YOPD ¼ young-onset PD.
institutional review board of Seoul National University Hospital approved the study. Blood samples were collected after written informed consent was obtained from each participant. PD was diagnosed according to the United Kingdom Parkinson Disease Society Brain Bank criteria, with the exception of the positive family history criterion [25]. The patients were screened with LRRK2 G2019S, SCA2, SCA17, and SNCA mutations and with parkin, pink-1, DJ-1 mutations in patients with age of onset 40, and those who were positive were excluded from the study [12,13,26–28]. The screening for SNCA mutations was performed with direct sequencing and gene dosage analysis. A total of 923 PD patients were included in the study. Young-onset PD (YOPD) was defined as the age of onset 40 years. DNA from the 422 healthy subjects who had no family history of parkinsonism was analyzed. DNA from healthy subjects was obtained from the gene database at the Department of Laboratory Medicine, Seoul National University Hospital. Normal controls were either healthy spouses of PD patients, or those who presented for routine health examinations.
2.2. Genetic analysis Venous blood samples were drawn and genomic DNA was extracted using standard techniques. The genotyping of LRRK2 G2385R variant (7153G > A, single nucleotide polymorphism [SNP] accession no. rs34778348) and LRRK2 R1628P variant (c.4883G > C, SNP accession no. rs33949390) was screened with a single base primer extension assay using the ABI PRISM SNaPShot Multiplex kit (Applied Biosystems Inc., Foster City, CA, USA) according to the manufacturer’s recommendations. Analysis was carried out using Genemapper software (version 4.0). The primer sets used for the assay of G2385R variant were as follows: forward, TGCAATAGTCTAGCTTGTTT; reverse, GTGACACATGAAGTGCAA; SNP primer, GATAAG AAAACTGAAAAACTCTGT. As an SNP of LRRK2 G2385G variant (7155A > G, SNP accession no. rs33962975) is found in the same codon, the primers were designed to prevent the problems due to coexistence of two SNPs in the very close nucleotides [14]. The primer sets used for the assay of R1628P variant were as follows: forward, GGTACTGTGTTGCACTTGAA; reverse, CTCCTATTGGCAAAGCAA; SNP primer, CCAAA ACACCCTAAGGGMATTATTTCGC. To ensure accuracy of genotyping, blind tests were performed on the duplicate samples and negative controls were included.
2.3. Statistical analysis The Chi-squared test was used to compare the categorical variables, and the independent sample t-test was used for continuous variables. The odds ratios were calculated after adjusting for age and gender by multivariate logistic regression analysis. For non-parametric analysis, Fisher’s exact test and Jonckheere–Terpstra test were used. The statistical analyses were conducted using the SPSS software (version 12.0; SPSS Inc., Chicago, IL, USA) with the limit of significance set at 0.05 (two-tailed).
3. Results One hundred and nineteen patients had YOPD and 804 had lateonset PD (LOPD). Demographic features in both groups and normal controls are described in Table 1. Allele distributions of the patients and normal controls were concordant with the Hardy–Weinberg equilibrium. The results of the genotyping of LRRK2 G2385R variant are shown in Table 2. The G2385R variant was detected in 82 PD patients (8.9%, two homozygous and 80 heterozygous) and in 21 normal controls (5.0%, all heterozygous). For carriers, the odds ratio (OR), adjusted for age and gender, was 1.83 (p-value ¼ 0.0170, 95% confidence interval [CI] 1.11–3.00; Table 2). In LOPD, the OR was 1.81 with statistical significance, but in YOPD, the OR was 2.28 without statistical significance. There were no differences in the mean age at onset or gender between the G2385R carriers and the non-carriers amongst all the PD patients (Table 3). The two patients with homozygous substitution for the LRRK2 G2385R variant showed no atypical features such as early dementia or psychiatric manifestations. For the LRRK2 R1628P variant, 384 randomly selected patient– control pairs were analyzed (Table 4). The frequency of C allele and LRRK2 R1628P variant was very low. The OR was 2.98 and lacked statistical significance. 4. Discussion In this study, the LRRK2 G2385R variant was observed in 8.9% of sporadic PD patients and 5.0% of control subjects with an odds ratio of 1.83. These results were similar to the allele frequencies in the Chinese and Japanese populations, in which the G2385R has a frequency of 6.7–11.6% in patients and 3.6–5.6% in control subjects [16–20]. Our findings demonstrate that the LRRK2 G2385R variant may be a genetic risk factor for sporadic PD in the Korean population. In a previous genetic study of 72 PD patients (age of onset 50 years) in Korea, 12.5% of patients had the LRRK2 G2385R variant, and 5% of the control subjects had the variant (OR ¼ 2.71) [29].
Table 2 Distribution of the LRRK2 G2385R variant in Parkinson’s disease patients and normal controls and the odds ratios of the G2385R variant (dominant model). Normal controls
Total PD patients
LOPD
YOPD
p-Valuea
p-Valueb
p-Valuec
Allele, % G A
97.5 2.5
95.4 4.6
95.3 4.7
96.2 3.8
0.0104
0.0083
0.2831
Genotype, n (%) GG AG AA
401 (95.0) 21 (5.0) 0
841 (91.1) 80 (8.7) 2 (0.2)
731 (90.9) 71 (8.8) 2 (0.2)
110 (92.4) 9 (7.6) 0
0.0360
0.0297
0.2762
1.83 1.11–3.00 0.0170
1.81 1.09–3.02 0.0220
2.28 0.86–6.07 0.0984
OR (genotype) 95% CI p-Value
OR ¼ odds ratio; CI ¼ confidence interval. a Comparisons between total PD patients and normal controls. b Comparisons between LOPD and normal controls. c Comparisons between YOPD and normal controls.
J.-M. Kim et al. / Parkinsonism and Related Disorders 16 (2010) 85–88 Table 3 Comparisons of clinical characteristics between the G2385R carriers and noncarriers with Parkinson’s disease. Characteristics
Carriers N ¼ 82
Non-carriers N ¼ 841
p-Value
Age at onset, yr Age at visit, yr Gender (male, %) LOPD, n (%) YOPD, n (%)
55.3 11.5 (18–79) 64.1 11.7 (22–89) 35 (42.7) 73 (89.0) 9 (11.0)
54.7 10.8 (22–85) 63.7 9.7 (27–91) 373 (44.5) 731 (86.9) 110 (13.1)
0.6715a 0.7137a 0.7575b 0.5873b
Values are shown as mean standard deviation (range) or number (%). a Comparisons by independent sample t-test. b Comparisons by Chi-squared test.
Table 4 Distribution of the LRRK2 R1628P variant in Parkinson’s disease patients and normal controls. 95% CI
p-Valuea p-Valueb
2.98
0.31–28.68
0.62
0.32
Genotype, n (%) GG 378 (99.74) 380 (99.22) 2.98 GC 1 (0.26) 3 (0.78)
0.31–28.82
0.62
0.32
PD patients OR N ¼ 384
Age, yr 63.3 9.0 (male, %) (167, 43.5)
62.7 9.5c (174, 45.3)
Allele, % G C
99.61 0.39
99.87 0.13
rate of apoptosis than wild-type [19]. Further investigations of the effect of G2385R variant on the LRRK2 function are warranted. The frequency of LRRK2 R1628P variant was very low, and does not appear to be a genetic risk factor in ethnic Koreans. This finding contrasts with the ethnic Chinese in Taiwan, Singapore, and China [21–24]. Further studies involving more Korean patients and different populations are needed to understand the role of LRRK2 R1628P variant in PD. Role of the funding source The sponsor’s role was confined to financial support, and did not involve the design, data collection, analysis and preparation of the manuscript.
The results are similar to those obtained in our YOPD group (age of onset 40 years). Twelve patients (16.7%) had a positive family history. In contrast, our study investigated the LRRK2 G2385R variant in sporadic PD patients of all ages. In the subgroup of YOPD, there was only a tendency for an increased risk to develop PD in carriers of the LRRK2 G2385R variant without statistical significance. Our sample size of YOPD patients is small, and the results may be influenced by the underlying age distribution. Further studies including more YOPD patients are needed. Genetic risk factors might be population specific, and therefore, it is not surprising that the LRRK2 G2385R variant appears to be absent in Caucasian subjects whereas the LRRK2 G2019S mutation is rare in Asian subjects [9–20]. In ethnic Chinese Taiwanese, the ancestral mutation resulting in LRRK2 G2385R was assumed to occur some 4800 years ago [17]. Future haplotype analyses to trace the variant back to founders in the Korean population would be interesting in order to elucidate the ethnic specificity and geographical dispersion of the LRRK2 G2385R variant. In our PD patients, there were no differences in the mean age at onset or the gender distribution between carriers and non-carriers. Although the LRRK2 G2385R variant might increase the risk of development of PD, it does not seem to have a clear effect on the clinical features of the disease in our population. Tan et al. have reported that the LRRK2 G2385R variant has a small but significant effect in lowering the age at onset of PD [30]. Further studies involving more patients and normal controls would be helpful for solving this issue in our population. The amino-acid residue Gly2385 lies in the WD40 domain of LRRK2, which typically enables protein–protein interactions via multiple binding surfaces [31]. Under the conditions of oxidative stress, the LRRK2 G2385R variant was more toxic and led to a higher
Normal controls N ¼ 384
87
Values are shown as mean standard deviation or number (%). a Comparisons between PD patients and normal controls by Fisher’s exact test. b Comparisons by Jonckheere–Terpstra test. c The mean age at onset was 54.2 10.0 years.
Disclosure statement The authors report no conflicts of interest.
Acknowledgements This study was supported in part by a grant from the Korean Health 21 R&D Project, Ministry of Health & Welfare, Republic of Korea (A030001) and research grants from the Seoul National University Bundang and Borame Municipal Hospital (02-2009-017, 03-2008-11). We acknowledge a generous donation from Mr. Chung Suk-Gyoo and Shinyang Cultural Foundation.
References [1] Paisa´n-Ruı´z C, Jain S, Evans EW, Gilks WP, Simo´n J, van der Brug M, et al. Cloning of the gene containing mutations that cause PARK8-linked Parkinson’s disease. Neuron 2004;44(4):595–600. [2] Zimprich A, Biskup S, Leitner P, Lichtner P, Farrer M, Lincoln S, et al. Mutations in LRRK2 cause autosomal-dominant parkinsonism with pleomorphic pathology. Neuron 2004;44(4):601–7. [3] Nichols WC, Pankratz N, Hernandez D, Paisa´n-Ruı´z C, Jain S, Halter CA, et al. Genetic screening for a single common LRRK2 mutation in familial Parkinson’s disease. Lancet 2005;365(9457):410–2. [4] Di Fonzo A, Rohe´ CF, Ferreira J, Chien HF, Vacca L, Stocchi F, et al. A frequent LRRK2 gene mutation associated with autosomal dominant Parkinson’s disease. Lancet 2005;365(9457):412–5. [5] Gilks WP, Abou-Sleiman PM, Gandhi S, Jain S, Singleton A, Lees AJ, et al. A common LRRK2 mutation in idiopathic Parkinson’s disease. Lancet 2005; 365(9457):415–6. [6] Kachergus J, Mata IF, Hulihan M, Taylor JP, Lincoln S, Aasly J, et al. Identification of a novel LRRK2 mutation linked to autosomal dominant parkinsonism: evidence of a common founder across European populations. Am J Hum Genet 2005;76(4):672–80. [7] Lesage S, Du¨rr A, Tazir M, Lohmann E, Leutenegger AL, Janin S, et al. LRRK2 G2019S as a cause of Parkinson’s disease in North African Arabs. N Engl J Med 2006;354(4):422–3. [8] Ozelius LJ, Senthil G, Saunders-Pullman R, Ohmann E, Deligtisch A, Tagliati M, et al. LRRK2 G2019S as a cause of Parkinson’s disease in Ashkenazi Jews. N Engl J Med 2006;354(4):424–5. [9] Tan EK, Shen H, Tan LC, Farrer M, Yew K, Chua E, et al. The G2019S LRRK2 mutation is uncommon in an Asian cohort of Parkinson’s disease patients. Neurosci Lett 2005;384(3):327–9. [10] Tomiyama H, Li Y, Funayama M, Hasegawa K, Yoshino H, Kubo S, et al. Clinicogenetic study of mutations in LRRK2 exon 41 in Parkinson’s disease patients from 18 countries. Mov Disord 2006;21(8):1102–8. [11] Zabetian CP, Morino H, Ujike H, Yamamoto M, Oda M, Maruyama H, et al. Identification and haplotype analysis of LRRK2 G2019S in Japanese patients with Parkinson disease. Neurology 2006;67(4):697–9. [12] Cho JW, Kim SY, Park SS, Kim HJ, Ahn TB, Kim JM, et al. The G2019S LRRK2 mutation is rare in Korean patients with Parkinson’s disease. Can J Neurol Sci 2007;34(1):53–5. [13] Cho JW, Kim SY, Park SS, Jeon BS. The G2019S LRRK2 mutation is rare in Korean patients with Parkinson’s disease and multiple system atrophy. J Clin Neurol 2009;5:29–32. [14] Mata IF, Kachergus JM, Taylor JP, Lincoln S, Aasly J, Lynch T, et al. Lrrk2 pathogenic substitutions in Parkinson’s disease. Neurogenetics 2005;6(4): 171–7. [15] Di Fonzo A, Tassorelli C, De Mari M, Chien HF, Ferreira J, Rohe´ CF, et al. Comprehensive analysis of the LRRK2 gene in sixty families with Parkinson’s disease. Eur J Hum Genet 2006;14(3):322–31.
88
J.-M. Kim et al. / Parkinsonism and Related Disorders 16 (2010) 85–88
[16] Di Fonzo A, Wu-Chou YH, Lu CS, van Doeselaar M, Simons EJ, Rohe´ CF, et al. A common missense variant in the LRRK2 gene, Gly2385Arg, associated with Parkinson’s disease risk in Taiwan. Neurogenetics 2006;7(3):133–8. [17] Farrer MJ, Stone JT, Lin CH, Da¨chsel JC, Hulihan MM, Haugarvoll K, et al. Lrrk2 G2385R is an ancestral risk factor for Parkinson’s disease in Asia. Parkinsonism Relat Disord 2007;13(2):89–92. [18] Funayama M, Li Y, Tomiyama H, Yoshino H, Imamichi Y, Yamamoto M, et al. Leucine-rich repeat kinase 2 G2385R variant is a risk factor for Parkinson disease in Asian population. Neuroreport 2007;18(3):273–5. [19] Tan EK, Zhao Y, Skipper L, Tan MG, Di Fonzo A, Sun L, et al. The LRRK2 Gly2385Arg variant is associated with Parkinson’s disease: genetic and functional evidence. Hum Genet 2007;120(6):857–63. [20] Zabetian CP, Yamamoto M, Lopez AN, Ujike H, Mata IF, Izumi Y, et al. LRRK2 mutations and risk variants in Japanese patients with Parkinson’s disease. Mov Disord 2009;24(7):1034–41. [21] Ross OA, Wu YR, Lee MC, Funayama M, Chen ML, Soto AI, et al. Analysis of Lrrk2 R1628P as a risk factor for Parkinson’s disease. Ann Neurol 2008;64(1): 88–92. [22] Tan EK, Tan LC, Lim HQ, Li R, Tang M, Yih Y, et al. LRRK2 R1628P increases risk of Parkinson’s disease: replication evidence. Hum Genet 2008;124(3): 287–8. [23] Tan EK, Tang M, Tan LC, Wu YR, Wu RM, Ross OA, et al. Lrrk2 R1628P in nonChinese Asian races. Ann Neurol 2008;64(4):472–3.
[24] Zhang Z, Burgunder JM, An X, Wu Y, Chen W, Zhang J, et al. LRRK2 R1628P variant is a risk factor of Parkinson’s disease among Han-Chinese from mainland China. Mov Disord 11 Aug 2009. doi:10.1002/mds.22371. published online. [25] Hughes AJ, Daniel SE, Kilford L, Lees AJ. Accuracy of clinical diagnosis of idiopathic Parkinson’s disease: a clinico-pathological study of 100 cases. J Neurol Neurosurg Psychiatry 1992;55:181–4. [26] Kim JM, Hong S, Kim GP, Choi YJ, Kim YK, Park SS, et al. Importance of lowrange CAG expansion and CAA interruption in SCA2 Parkinsonism. Arch Neurol 2007;64:1510–8. [27] Ahn TB, Kim SY, Kim JY, Park SS, Lee DS, Min HJ, et al. a-Synuclein gene duplication is present in sporadic Parkinson disease. Neurology 2008;70:43–9. [28] Kim JY, Kim SY, Kim JM, Kim YK, Yoon KY, Kim JY, et al. Spinocerebellar ataxia type 17 mutation as a causative and susceptibility gene in parkinsonism. Neurology 2009;72:1385–9. [29] Choi JM, Woo MS, Ma HI, Kang SY, Sung YH, Yong SW, et al. Analysis of PARK genes in a Korean cohort of early-onset Parkinson disease. Neurogenetics 2008;9:263–9. [30] Tan EK, Peng R, Wu YR, Wu RM, Wu-Chou YH, Tan LC, et al. LRRK2 G2385R modulates age at onset in Parkinson’s disease: a multi-center pooled analysis. Am J Med Genet B Neuropsychiatr Genet 2009;150B(7):1022–3. [31] Mata IF, Wedemeyer WJ, Farrer MJ, Taylor JP, Gallo KA. LRRK2 in Parkinson’s disease: protein domains and functional insights. Trends Neurosci 2006;29(5): 286–93.
Contents lists available at ScienceDirect
Parkinsonism and Related Disorders journal homepage: www.elsevier.com/locate/parkreldis
The LRRK2 G2385R variant is a risk factor for sporadic Parkinson’s disease in the Korean population Jong-Min Kim a, Jee-Young Lee b, Hee Jin Kim a, Ji Seon Kim a, Eun-Soon Shin c, Jin-Hwan Cho a, Sung Sup Park d, Beom S. Jeon a, * a
Department of Neurology, Seoul National University College of Medicine, MRC and BK-21, Clinical Research Institute, Seoul National University Hospital and Bundang Hospital, Boramae Municipal Hospital, Seoul, South Korea Department of Neurology , Inje University, Ilsan Paik Hospital, Koyang, South Korea c DNA Link Inc. Bioinformatics 1 Team, Seoul, South Korea d Department of Laboratory Medicine, Seoul National University College of Medicine, Seoul, South Korea b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 10 April 2009 Received in revised form 6 October 2009 Accepted 9 October 2009
The G2385R (SNP accession no. rs34778348) and R1628P (rs33949390) variants of leucine-rich repeat kinase 2 (LRRK2, PARK8) are emerging as an important risk factor for Parkinson’s disease (PD) in the ethnic Chinese and Japanese populations. The purpose of this study was to investigate whether these variants are a genetic risk factor in sporadic PD patients in the Korean population. A total of 923 patients and 422 healthy subjects were included. The variants were screened by a SNaPshot assay. The LRRK2 G2385R variant was detected in 82 PD patients (8.9%, two homozygous and 80 heterozygous) and in 21 normal controls (5.0%, all heterozygous). The frequency of the LRRK2 G2385R variant in PD was significantly higher than in normal controls (adjusted odds ratio 1.83, p ¼ 0.0170, 95% confidence interval 1.11–3.00). There were no differences in the mean age at onset or gender between the G2385R carriers and the non-carriers in PD patients. The LRRK2 R1628P variant was very rare (0.78% in patients versus 0.26% in controls) in the tested 384 patient–control pairs, and was not a significant risk factor. This study supports that the LRRK2 G2385R variant may be a genetic risk factor for sporadic PD in the Korean population. Ó 2009 Elsevier Ltd. All rights reserved.
Keywords: LRRK2 G2385R R1628P Parkinson’s disease Polymorphism
1. Introduction Leucine-rich repeat kinase 2 (LRRK2, PARK8) mutations are associated with familial autosomal dominant Parkinson’s disease (PD) [1,2]. Among LRRK2 mutations, the most common LRRK2 G2019S mutation accounts for about 3–7% of familial PD in a number of European populations with up to 40% prevalence in North Africans and Ashkenazi Jews [3–8]. Of greater clinical importance is the observation that this common LRRK2 mutation may be present in about 1–1.6% of sporadic PD, and some of these patients resemble clinically typical, late-onset PD [4,6]. However, this G2019S mutation has shown ethnic differences among Caucasian and Asian populations, and is rare in Asians [3–11]. In the Korean population, the G2019S mutation has not been detected [12,13].
On the other hand, a LRRK2 G2385R variant has been found to be a common genetic risk factor in Asians, but not in Caucasians [14–20]. In ethnic Chinese and Japanese samples, the LRRK2 G2385R has a frequency of 6.7–11.6% in sporadic PD patients and 3.6–5.6% in control subjects [16–20]. In Caucasian samples, the frequency of the LRRK2 G2385R variant was less than 1% in control subjects [14]. Recently, a LRRK2 R1628P variant has also been reported as a genetic risk factor for PD in ethnic Chinese from Taiwan, Singapore, and China [21–24]. In the Malay and Indian populations, this variant is very rare or absent, and does not appear to be a risk factor in these populations [23]. The ethnic specificity and prevalence in sporadic PD prompted us to investigate whether the LRRK2 G2385R and R1628P variants are genetic risk factors in sporadic PD patients and healthy controls in the Korean population. 2. Methods 2.1. Subjects
* Correspondence to: Beom S. Jeon, Department of Neurology, Seoul National University Hospital, Chongno-Ku Yunkeun-Dong 28, Seoul 110-744, South Korea. Tel.: þ82 2 2072 2876; fax: þ82 2 3672 7553. E-mail address: [email protected] (B.S. Jeon). 1353-8020/$ – see front matter Ó 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.parkreldis.2009.10.004
Gene samples were obtained from the gene bank at the Movement Disorder Division of Seoul National University Hospital. All patients and controls were native Koreans. All patients were personally examined and have been followed regularly by the senior neurologist (BSJ) at Seoul National University Hospital since 1993. The
86
J.-M. Kim et al. / Parkinsonism and Related Disorders 16 (2010) 85–88
Table 1 Demographic features of the subjects. Characteristics
Normal controls N ¼ 422
Total PD patients N ¼ 923
LOPD N ¼ 804
YOPD N ¼ 119
No. of male (%) Age, yr Age at onset, yr
190 (45.0%) 61.9 9.5 (37–85)
408 (44.3%) 63.7 9.9 (22–91) 54.8 10.9 (18–85)
349 (43.5%) 65.7 8.5 (44–91) 57.5 8.6
59 (49.6%) 50.5 8.1 (22–71) 35.9 3.9
Values are shown as mean standard deviation (range). PD ¼ Parkinson’s disease; LOPD ¼ late-onset PD; YOPD ¼ young-onset PD.
institutional review board of Seoul National University Hospital approved the study. Blood samples were collected after written informed consent was obtained from each participant. PD was diagnosed according to the United Kingdom Parkinson Disease Society Brain Bank criteria, with the exception of the positive family history criterion [25]. The patients were screened with LRRK2 G2019S, SCA2, SCA17, and SNCA mutations and with parkin, pink-1, DJ-1 mutations in patients with age of onset 40, and those who were positive were excluded from the study [12,13,26–28]. The screening for SNCA mutations was performed with direct sequencing and gene dosage analysis. A total of 923 PD patients were included in the study. Young-onset PD (YOPD) was defined as the age of onset 40 years. DNA from the 422 healthy subjects who had no family history of parkinsonism was analyzed. DNA from healthy subjects was obtained from the gene database at the Department of Laboratory Medicine, Seoul National University Hospital. Normal controls were either healthy spouses of PD patients, or those who presented for routine health examinations.
2.2. Genetic analysis Venous blood samples were drawn and genomic DNA was extracted using standard techniques. The genotyping of LRRK2 G2385R variant (7153G > A, single nucleotide polymorphism [SNP] accession no. rs34778348) and LRRK2 R1628P variant (c.4883G > C, SNP accession no. rs33949390) was screened with a single base primer extension assay using the ABI PRISM SNaPShot Multiplex kit (Applied Biosystems Inc., Foster City, CA, USA) according to the manufacturer’s recommendations. Analysis was carried out using Genemapper software (version 4.0). The primer sets used for the assay of G2385R variant were as follows: forward, TGCAATAGTCTAGCTTGTTT; reverse, GTGACACATGAAGTGCAA; SNP primer, GATAAG AAAACTGAAAAACTCTGT. As an SNP of LRRK2 G2385G variant (7155A > G, SNP accession no. rs33962975) is found in the same codon, the primers were designed to prevent the problems due to coexistence of two SNPs in the very close nucleotides [14]. The primer sets used for the assay of R1628P variant were as follows: forward, GGTACTGTGTTGCACTTGAA; reverse, CTCCTATTGGCAAAGCAA; SNP primer, CCAAA ACACCCTAAGGGMATTATTTCGC. To ensure accuracy of genotyping, blind tests were performed on the duplicate samples and negative controls were included.
2.3. Statistical analysis The Chi-squared test was used to compare the categorical variables, and the independent sample t-test was used for continuous variables. The odds ratios were calculated after adjusting for age and gender by multivariate logistic regression analysis. For non-parametric analysis, Fisher’s exact test and Jonckheere–Terpstra test were used. The statistical analyses were conducted using the SPSS software (version 12.0; SPSS Inc., Chicago, IL, USA) with the limit of significance set at 0.05 (two-tailed).
3. Results One hundred and nineteen patients had YOPD and 804 had lateonset PD (LOPD). Demographic features in both groups and normal controls are described in Table 1. Allele distributions of the patients and normal controls were concordant with the Hardy–Weinberg equilibrium. The results of the genotyping of LRRK2 G2385R variant are shown in Table 2. The G2385R variant was detected in 82 PD patients (8.9%, two homozygous and 80 heterozygous) and in 21 normal controls (5.0%, all heterozygous). For carriers, the odds ratio (OR), adjusted for age and gender, was 1.83 (p-value ¼ 0.0170, 95% confidence interval [CI] 1.11–3.00; Table 2). In LOPD, the OR was 1.81 with statistical significance, but in YOPD, the OR was 2.28 without statistical significance. There were no differences in the mean age at onset or gender between the G2385R carriers and the non-carriers amongst all the PD patients (Table 3). The two patients with homozygous substitution for the LRRK2 G2385R variant showed no atypical features such as early dementia or psychiatric manifestations. For the LRRK2 R1628P variant, 384 randomly selected patient– control pairs were analyzed (Table 4). The frequency of C allele and LRRK2 R1628P variant was very low. The OR was 2.98 and lacked statistical significance. 4. Discussion In this study, the LRRK2 G2385R variant was observed in 8.9% of sporadic PD patients and 5.0% of control subjects with an odds ratio of 1.83. These results were similar to the allele frequencies in the Chinese and Japanese populations, in which the G2385R has a frequency of 6.7–11.6% in patients and 3.6–5.6% in control subjects [16–20]. Our findings demonstrate that the LRRK2 G2385R variant may be a genetic risk factor for sporadic PD in the Korean population. In a previous genetic study of 72 PD patients (age of onset 50 years) in Korea, 12.5% of patients had the LRRK2 G2385R variant, and 5% of the control subjects had the variant (OR ¼ 2.71) [29].
Table 2 Distribution of the LRRK2 G2385R variant in Parkinson’s disease patients and normal controls and the odds ratios of the G2385R variant (dominant model). Normal controls
Total PD patients
LOPD
YOPD
p-Valuea
p-Valueb
p-Valuec
Allele, % G A
97.5 2.5
95.4 4.6
95.3 4.7
96.2 3.8
0.0104
0.0083
0.2831
Genotype, n (%) GG AG AA
401 (95.0) 21 (5.0) 0
841 (91.1) 80 (8.7) 2 (0.2)
731 (90.9) 71 (8.8) 2 (0.2)
110 (92.4) 9 (7.6) 0
0.0360
0.0297
0.2762
1.83 1.11–3.00 0.0170
1.81 1.09–3.02 0.0220
2.28 0.86–6.07 0.0984
OR (genotype) 95% CI p-Value
OR ¼ odds ratio; CI ¼ confidence interval. a Comparisons between total PD patients and normal controls. b Comparisons between LOPD and normal controls. c Comparisons between YOPD and normal controls.
J.-M. Kim et al. / Parkinsonism and Related Disorders 16 (2010) 85–88 Table 3 Comparisons of clinical characteristics between the G2385R carriers and noncarriers with Parkinson’s disease. Characteristics
Carriers N ¼ 82
Non-carriers N ¼ 841
p-Value
Age at onset, yr Age at visit, yr Gender (male, %) LOPD, n (%) YOPD, n (%)
55.3 11.5 (18–79) 64.1 11.7 (22–89) 35 (42.7) 73 (89.0) 9 (11.0)
54.7 10.8 (22–85) 63.7 9.7 (27–91) 373 (44.5) 731 (86.9) 110 (13.1)
0.6715a 0.7137a 0.7575b 0.5873b
Values are shown as mean standard deviation (range) or number (%). a Comparisons by independent sample t-test. b Comparisons by Chi-squared test.
Table 4 Distribution of the LRRK2 R1628P variant in Parkinson’s disease patients and normal controls. 95% CI
p-Valuea p-Valueb
2.98
0.31–28.68
0.62
0.32
Genotype, n (%) GG 378 (99.74) 380 (99.22) 2.98 GC 1 (0.26) 3 (0.78)
0.31–28.82
0.62
0.32
PD patients OR N ¼ 384
Age, yr 63.3 9.0 (male, %) (167, 43.5)
62.7 9.5c (174, 45.3)
Allele, % G C
99.61 0.39
99.87 0.13
rate of apoptosis than wild-type [19]. Further investigations of the effect of G2385R variant on the LRRK2 function are warranted. The frequency of LRRK2 R1628P variant was very low, and does not appear to be a genetic risk factor in ethnic Koreans. This finding contrasts with the ethnic Chinese in Taiwan, Singapore, and China [21–24]. Further studies involving more Korean patients and different populations are needed to understand the role of LRRK2 R1628P variant in PD. Role of the funding source The sponsor’s role was confined to financial support, and did not involve the design, data collection, analysis and preparation of the manuscript.
The results are similar to those obtained in our YOPD group (age of onset 40 years). Twelve patients (16.7%) had a positive family history. In contrast, our study investigated the LRRK2 G2385R variant in sporadic PD patients of all ages. In the subgroup of YOPD, there was only a tendency for an increased risk to develop PD in carriers of the LRRK2 G2385R variant without statistical significance. Our sample size of YOPD patients is small, and the results may be influenced by the underlying age distribution. Further studies including more YOPD patients are needed. Genetic risk factors might be population specific, and therefore, it is not surprising that the LRRK2 G2385R variant appears to be absent in Caucasian subjects whereas the LRRK2 G2019S mutation is rare in Asian subjects [9–20]. In ethnic Chinese Taiwanese, the ancestral mutation resulting in LRRK2 G2385R was assumed to occur some 4800 years ago [17]. Future haplotype analyses to trace the variant back to founders in the Korean population would be interesting in order to elucidate the ethnic specificity and geographical dispersion of the LRRK2 G2385R variant. In our PD patients, there were no differences in the mean age at onset or the gender distribution between carriers and non-carriers. Although the LRRK2 G2385R variant might increase the risk of development of PD, it does not seem to have a clear effect on the clinical features of the disease in our population. Tan et al. have reported that the LRRK2 G2385R variant has a small but significant effect in lowering the age at onset of PD [30]. Further studies involving more patients and normal controls would be helpful for solving this issue in our population. The amino-acid residue Gly2385 lies in the WD40 domain of LRRK2, which typically enables protein–protein interactions via multiple binding surfaces [31]. Under the conditions of oxidative stress, the LRRK2 G2385R variant was more toxic and led to a higher
Normal controls N ¼ 384
87
Values are shown as mean standard deviation or number (%). a Comparisons between PD patients and normal controls by Fisher’s exact test. b Comparisons by Jonckheere–Terpstra test. c The mean age at onset was 54.2 10.0 years.
Disclosure statement The authors report no conflicts of interest.
Acknowledgements This study was supported in part by a grant from the Korean Health 21 R&D Project, Ministry of Health & Welfare, Republic of Korea (A030001) and research grants from the Seoul National University Bundang and Borame Municipal Hospital (02-2009-017, 03-2008-11). We acknowledge a generous donation from Mr. Chung Suk-Gyoo and Shinyang Cultural Foundation.
References [1] Paisa´n-Ruı´z C, Jain S, Evans EW, Gilks WP, Simo´n J, van der Brug M, et al. Cloning of the gene containing mutations that cause PARK8-linked Parkinson’s disease. Neuron 2004;44(4):595–600. [2] Zimprich A, Biskup S, Leitner P, Lichtner P, Farrer M, Lincoln S, et al. Mutations in LRRK2 cause autosomal-dominant parkinsonism with pleomorphic pathology. Neuron 2004;44(4):601–7. [3] Nichols WC, Pankratz N, Hernandez D, Paisa´n-Ruı´z C, Jain S, Halter CA, et al. Genetic screening for a single common LRRK2 mutation in familial Parkinson’s disease. Lancet 2005;365(9457):410–2. [4] Di Fonzo A, Rohe´ CF, Ferreira J, Chien HF, Vacca L, Stocchi F, et al. A frequent LRRK2 gene mutation associated with autosomal dominant Parkinson’s disease. Lancet 2005;365(9457):412–5. [5] Gilks WP, Abou-Sleiman PM, Gandhi S, Jain S, Singleton A, Lees AJ, et al. A common LRRK2 mutation in idiopathic Parkinson’s disease. Lancet 2005; 365(9457):415–6. [6] Kachergus J, Mata IF, Hulihan M, Taylor JP, Lincoln S, Aasly J, et al. Identification of a novel LRRK2 mutation linked to autosomal dominant parkinsonism: evidence of a common founder across European populations. Am J Hum Genet 2005;76(4):672–80. [7] Lesage S, Du¨rr A, Tazir M, Lohmann E, Leutenegger AL, Janin S, et al. LRRK2 G2019S as a cause of Parkinson’s disease in North African Arabs. N Engl J Med 2006;354(4):422–3. [8] Ozelius LJ, Senthil G, Saunders-Pullman R, Ohmann E, Deligtisch A, Tagliati M, et al. LRRK2 G2019S as a cause of Parkinson’s disease in Ashkenazi Jews. N Engl J Med 2006;354(4):424–5. [9] Tan EK, Shen H, Tan LC, Farrer M, Yew K, Chua E, et al. The G2019S LRRK2 mutation is uncommon in an Asian cohort of Parkinson’s disease patients. Neurosci Lett 2005;384(3):327–9. [10] Tomiyama H, Li Y, Funayama M, Hasegawa K, Yoshino H, Kubo S, et al. Clinicogenetic study of mutations in LRRK2 exon 41 in Parkinson’s disease patients from 18 countries. Mov Disord 2006;21(8):1102–8. [11] Zabetian CP, Morino H, Ujike H, Yamamoto M, Oda M, Maruyama H, et al. Identification and haplotype analysis of LRRK2 G2019S in Japanese patients with Parkinson disease. Neurology 2006;67(4):697–9. [12] Cho JW, Kim SY, Park SS, Kim HJ, Ahn TB, Kim JM, et al. The G2019S LRRK2 mutation is rare in Korean patients with Parkinson’s disease. Can J Neurol Sci 2007;34(1):53–5. [13] Cho JW, Kim SY, Park SS, Jeon BS. The G2019S LRRK2 mutation is rare in Korean patients with Parkinson’s disease and multiple system atrophy. J Clin Neurol 2009;5:29–32. [14] Mata IF, Kachergus JM, Taylor JP, Lincoln S, Aasly J, Lynch T, et al. Lrrk2 pathogenic substitutions in Parkinson’s disease. Neurogenetics 2005;6(4): 171–7. [15] Di Fonzo A, Tassorelli C, De Mari M, Chien HF, Ferreira J, Rohe´ CF, et al. Comprehensive analysis of the LRRK2 gene in sixty families with Parkinson’s disease. Eur J Hum Genet 2006;14(3):322–31.
88
J.-M. Kim et al. / Parkinsonism and Related Disorders 16 (2010) 85–88
[16] Di Fonzo A, Wu-Chou YH, Lu CS, van Doeselaar M, Simons EJ, Rohe´ CF, et al. A common missense variant in the LRRK2 gene, Gly2385Arg, associated with Parkinson’s disease risk in Taiwan. Neurogenetics 2006;7(3):133–8. [17] Farrer MJ, Stone JT, Lin CH, Da¨chsel JC, Hulihan MM, Haugarvoll K, et al. Lrrk2 G2385R is an ancestral risk factor for Parkinson’s disease in Asia. Parkinsonism Relat Disord 2007;13(2):89–92. [18] Funayama M, Li Y, Tomiyama H, Yoshino H, Imamichi Y, Yamamoto M, et al. Leucine-rich repeat kinase 2 G2385R variant is a risk factor for Parkinson disease in Asian population. Neuroreport 2007;18(3):273–5. [19] Tan EK, Zhao Y, Skipper L, Tan MG, Di Fonzo A, Sun L, et al. The LRRK2 Gly2385Arg variant is associated with Parkinson’s disease: genetic and functional evidence. Hum Genet 2007;120(6):857–63. [20] Zabetian CP, Yamamoto M, Lopez AN, Ujike H, Mata IF, Izumi Y, et al. LRRK2 mutations and risk variants in Japanese patients with Parkinson’s disease. Mov Disord 2009;24(7):1034–41. [21] Ross OA, Wu YR, Lee MC, Funayama M, Chen ML, Soto AI, et al. Analysis of Lrrk2 R1628P as a risk factor for Parkinson’s disease. Ann Neurol 2008;64(1): 88–92. [22] Tan EK, Tan LC, Lim HQ, Li R, Tang M, Yih Y, et al. LRRK2 R1628P increases risk of Parkinson’s disease: replication evidence. Hum Genet 2008;124(3): 287–8. [23] Tan EK, Tang M, Tan LC, Wu YR, Wu RM, Ross OA, et al. Lrrk2 R1628P in nonChinese Asian races. Ann Neurol 2008;64(4):472–3.
[24] Zhang Z, Burgunder JM, An X, Wu Y, Chen W, Zhang J, et al. LRRK2 R1628P variant is a risk factor of Parkinson’s disease among Han-Chinese from mainland China. Mov Disord 11 Aug 2009. doi:10.1002/mds.22371. published online. [25] Hughes AJ, Daniel SE, Kilford L, Lees AJ. Accuracy of clinical diagnosis of idiopathic Parkinson’s disease: a clinico-pathological study of 100 cases. J Neurol Neurosurg Psychiatry 1992;55:181–4. [26] Kim JM, Hong S, Kim GP, Choi YJ, Kim YK, Park SS, et al. Importance of lowrange CAG expansion and CAA interruption in SCA2 Parkinsonism. Arch Neurol 2007;64:1510–8. [27] Ahn TB, Kim SY, Kim JY, Park SS, Lee DS, Min HJ, et al. a-Synuclein gene duplication is present in sporadic Parkinson disease. Neurology 2008;70:43–9. [28] Kim JY, Kim SY, Kim JM, Kim YK, Yoon KY, Kim JY, et al. Spinocerebellar ataxia type 17 mutation as a causative and susceptibility gene in parkinsonism. Neurology 2009;72:1385–9. [29] Choi JM, Woo MS, Ma HI, Kang SY, Sung YH, Yong SW, et al. Analysis of PARK genes in a Korean cohort of early-onset Parkinson disease. Neurogenetics 2008;9:263–9. [30] Tan EK, Peng R, Wu YR, Wu RM, Wu-Chou YH, Tan LC, et al. LRRK2 G2385R modulates age at onset in Parkinson’s disease: a multi-center pooled analysis. Am J Med Genet B Neuropsychiatr Genet 2009;150B(7):1022–3. [31] Mata IF, Wedemeyer WJ, Farrer MJ, Taylor JP, Gallo KA. LRRK2 in Parkinson’s disease: protein domains and functional insights. Trends Neurosci 2006;29(5): 286–93.