The marine biotoxin okadaic acid affects intestinal tight junction proteins in human intestinal cells

Toxicology in Vitro 58 (2019) 150–160

Contents lists available at ScienceDirect

Toxicology in Vitro journal homepage: www.elsevier.com/locate/toxinvit

The marine biotoxin okadaic acid affects intestinal tight junction proteins in human intestinal cells

T

Jessica Dietricha, Irina Grassa, Dorothee Günzelb, Saadet Hereka, Albert Braeuninga, ⁎ Alfonso Lampena, Stefanie Hessel-Prasa, a b

German Federal Institute for Risk Assessment, Department of Food Safety, Max-Dohrn-Straße 8-10, 10589 Berlin, Germany Institute of Clinical Physiology, Campus Benjamin Franklin, Charité Berlin, Hindenburgdamm 30, 12203 Berlin, Germany

A R T I C LE I N FO

A B S T R A C T

Keywords: Caco-2 cells DSP toxins Intestinal barrier Okadaic acid Tight junction proteins

Okadaic acid (OA) is a lipophilic phycotoxin that accumulates in the hepatopancreas and fatty tissue of shellfish. Consumption of highly OA-contaminated seafood leads to diarrhetic shellfish poisoning which provokes severe gastrointestinal symptoms associated with a disruption of the intestinal epithelium. Since the molecular mechanisms leading to intestinal barrier disruption are not fully elucidated, we investigated the influence of OA on intestinal tight junction proteins (TJPs) in differentiated Caco-2 cells. We found a concentration- and time-dependent deregulation of genes encoding for intestinal TJPs of the claudin family, occludin, as well as zonula occludens (ZO) 1 and 2. Immunofluorescence staining showed concentrationdependent effects on the structural organization of TJPs already after treatment with a subtoxic but humanrelevant concentration of OA. In addition, changes in the structural organization of cytoskeletal F-actin as well as its associated protein ZO-1 were observed. In summary, we demonstrated effects of OA on TJPs in intestinal Caco-2 cells. TJP expressions were affected after treatment with food-relevant OA concentrations. These results might explain the high potential of OA to disrupt the intestinal barrier in vivo as its first target. Thereby the present data contribute to a better understanding of the OA-dependent induction of molecular effects within the intestinal epithelium.

1. Introduction The phycotoxin okadaic acid (OA, Fig. 1) is the lead compound of the diarrhetic shellfish poisoning (DSP) toxins and is produced by dinoflagellates of the genus Dinophysis spp. and Prorocentrum spp. (EFSA, 2008). These microalgae are globally distributed, with most frequent seasonal occurrence in Europe and Japan (Van Dolah, 2000). OA accumulates in the hepatopancreas and fatty tissue of shellfish like oysters, mussels or clams due to its lipophilic properties. The consumption of highly contaminated seafood provokes the DSP syndrome which is characterized by severe gastrointestinal symptoms like diarrhea, nausea, vomiting and abdominal pain. These symptoms occur within the first 30 min up to a few hours after ingestion. Gastrointestinal

symptoms are transient and decline within 3 days. To ensure a high level of consumer protection, the European Union has set a regulatory threshold of 160 μg OA and its equivalents per kg shellfish meat (EFSA, 2008). In vitro studies showed a decrease of the transepithelial electrical resistance (TEER) of monolayers of human intestinal T84 and Caco-2 cells after treatment with OA indicating an increase in paracellular permeability (Ehlers et al., 2011; Tripuraneni et al., 1997). Characteristic acute effects of OA intoxication in rodents include damage of the intestinal epithelium, liver and even lethality. Intragastric administration of 1 to 4 mg OA/kg body weight led to severe effects in the intestinal tract which resulted in morphological changes of the intestinal epithelium comprising accumulation of fluid in the intestine,

Abbreviations: CI, Cell index; CYP, Cytochrome P450; DAPI, 4′,6-diamidino-2-phenylindole; DMEM, Dulbecco's Modified Eagle's Medium; DSP, Diarrhetic shellfish poisoning; EC50, Half maximal effective concentration; EFSA, European Food Safety Authority; em, Emission; ex, Excitation; FBS, Fetal bovine serum; GAPDH, Glyceraldehyde 3-phosphate dehydrogenase; NRU, Neutral red uptake; OA, Okadaic acid; PBS, Phosphate-buffered saline; PC, Positive control; PP, Protein phosphatase; qPCR, Quantitative real-time reverse transcriptase polymerase chain reaction; SC, Solvent control; SD, Standard deviation; SDS, Sodium dodecyl sulfate; TBS-T, Tris-buffered saline with Tween 20; TEER, Transepithelial electrical resistance; TJP, Tight junction protein; WST-1, Water soluble tetrazolium; ZO, Zonula occludens ⁎ Corresponding author. E-mail address: [email protected] (S. Hessel-Pras). https://doi.org/10.1016/j.tiv.2019.03.033 Received 29 November 2018; Received in revised form 20 March 2019; Accepted 25 March 2019 Available online 26 March 2019 0887-2333/ © 2019 Elsevier Ltd. All rights reserved.

Toxicology in Vitro 58 (2019) 150–160

J. Dietrich, et al.

and claudin-1. As a consequence, OA affects the phosphorylation status of TJPs via inhibition of PP2A (Nunbhakdi-Craig et al., 2002; Seth et al., 2007). Beside the impairment of intracellular dephosphorylation reactions OA was also identified to affect the DNA methylation processes (Matias and Creppy, 1998). It is therefore conceivable that OA can interfere with TJP expression and functionality at several levels. Although several in vivo and in vitro data are available concerning the impact of OA on the integrity of the intestinal barrier, the molecular mechanisms which lead to these effects are not fully understood. Thus, the aim of the present study was to investigate in vitro the influence of OA on several intestinal-relevant TJPs at mRNA and protein levels in human intestinal Caco-2 cells in doses which can be human-relevant. TJPs of the claudin family which occur within the human intestinal epithelium were chosen according to Lu et al. (2013). In addition, occludin and ZO proteins were analyzed due to possible interactions with claudins (Fanning et al., 1998; Itoh et al., 1999). For the first time, deregulated genes of TJPs should be identified and verified on protein level by Western blotting and afterwards connected directly with their functionality in regard to the integrity of the cell monolayer using confocal microscopy after OA exposure. Caco-2 cells differentiate spontaneously into small intestinal epithelium-like cells with characteristic morphological and biochemical properties of human enterocytes, although derived from a human colon carcinoma (Artursson and Karlsson, 1991; Sambuy et al., 2005). After reaching 100% confluency, the cell monolayer begins to develop a typical brush-border membrane with hydrolases and transporter enzymes which are physiologically expressed in the human small intestine. In addition, the cells are interlinked and exchange ions via characteristic intestinal TJPs (Meunier et al., 1995) and therefore represent a well-suited in vitro model to elucidate OA-induced changes in expression levels and structural organization of TJPs.

Fig. 1. Chemical structure of okadaic acid.

enlargement of the villi, accumulation of goblet cells in the villi as well as development of diarrhea after 1 to 3 days (Berven et al., 2001). Studies on acute oral toxicity in mice indicate different lethal doses varying between 400 and 2000 μg/kg body weight (Ito et al., 2002; Le Hegarat et al., 2006; Tubaro et al., 2003). Besides symptoms of acute toxicity, OA exhibits a wide variety of additional toxic effects. OA exhibits genotoxic (Fessard et al., 1996; Le Hegarat et al., 2006; Le Hegarat et al., 2003) and embryotoxic (Ehlers et al., 2010; Nishina et al., 1995) properties. The compound is a potent inducer of apoptosis (Boe et al., 1991; Morimoto et al., 1997; Nuydens et al., 1998; Ravindran et al., 2011) and lipid peroxidation (Guzman and Castro, 1991; Matias et al., 1999) in various cell lines. The phycotoxin has been shown to enhance tumor formation in different species and organs like in mouse skin as well as in glandular stomach of rats (Suganuma et al., 1988; Suganuma et al., 1992). The key event of OA-induced toxicity is the inhibition of the serine/ threonine phosphatases 1 and 2A (PP1 and PP2A) at nanomolar OA concentrations which was first described in 1988 by Bialojan and Takai, 1988. This inhibition leads to a disturbance of the tightly regulated equilibrium of essential phosphorylation and dephosphorylation processes. An OA-induced accumulation of phosphorylated proteins regulating sodium excretion was observed in the intestine which is seen as a main reason for the occurrence of diarrhea after intoxication (Aune and Yndestad, 1993). By inhibiting PP2A OA can also affect cellular structural elements mediating cell adhesion or cell motility as well as proteins of the cytoskeleton (Eriksson et al., 1992; Romashko and Young, 2004). Tight junction proteins (TJPs) form a barrier for the paracellular passage of water and molecules within epithelia and endothelia and contribute to the development and maintenance of cell polarity (Gonzalez-Mariscal et al., 2003). Regulation of expression of TJPs underlies complex mechanisms and can occur on transcriptional as well as on translational level. Several transcription factors like for example βcatenin or SNAIL family members have been shown to play a role in transcriptional regulation of TJPs (Failor et al., 2007; Ikenouchi et al., 2003) but also gene silencing via promotor methylation was described as important regulatory mechanism for TJP expression (Di Cello et al., 2013). In addition, modifications like palmylation (Van Itallie et al., 2005) and phosphorylation (Banan et al., 2005) were described to play an important role especially for claudin family members and can occur on the post-translational level. Therefore, phosphatases are important for the regulation of TJPs. Especially PP2A is postulated to regulate the phosphorylation status of the TJPs zonula occludens 1 (ZO-1), occludin

2. Materials and methods 2.1. Chemicals OA was purchased from Enzo Life Sciences GmbH (98%, Lörrach, Germany) and dissolved in methanol (2 mg/mL, Roth, Karlsruhe, Germany). The resulting solution was diluted with H2O to an OA stock solution (0.04 mg/mL) with a final solvent concentration of 2% methanol. 2.2. Cell culture Caco-2 cells were obtained from the European Collection of Cell Cultures (Salisbury, UK). The cells were cultivated in Dulbecco's Modified Eagle's Medium (DMEM) high glucose (PAN-Biotech GmbH, Aidenbach, Germany) supplemented with 10% fetal bovine serum (FBS), 100 U/mL penicillin and 100 μg/mL streptomycin (all from Capricorn Scientific, Ebsdorfergrund, Germany). After seeding the desired cell number and reaching confluency after approximately 2 d which was evaluated by phase-contrast microscopy (AE2000 Inverted Microscope, Motic Deutschland GmbH, Wetzlar, Germany) the cells underwent a differentiation phase for 19 d with an exchange of the medium every 2 to 3 d. Subsequently cells were treated with OA for 8 or 24 h. Assay medium consisting of DMEM without phenol red (PANBiotech GmbH, Aidenbach, Germany) supplemented with 1% insulin, transferrin, selenium (100 x, Capricorn Scientific, Ebsdorfergrund, Germany) as well as 100 U/mL penicillin and 100 μg/mL streptomycin was used in all experiments to avoid interactions of OA with serum components. 2.3. Cell viability assays 2.3.1. Neutral red uptake The neutral red uptake (NRU) assay was used to determine OA151

Toxicology in Vitro 58 (2019) 150–160

J. Dietrich, et al.

induced cytotoxic effects. Therefore, 5 × 103 Caco-2 cells/well were seeded in 96-well plates. Before seeding, the wells had been coated with 0.1% gelatin dissolved in phosphate-buffered saline (PBS) for at least 30 min at 37 °C. Coating was performed to improve cell attachment during the washing procedure mentioned below. After 21 d of cultivation, the cells were treated with different OA concentrations (50–1000 nM) and the respective solvent control (SC) for 24 h. 0.01% Triton X-100 solution served as positive control (PC) for cytotoxicity. The neutral red dye (Sigma Aldrich, Steinheim, Germany) was dissolved in PBS to a 4 mg/mL stock solution. Neutral red medium was diluted from the neutral red stock solution using assay medium to a final concentration of 40 μg/mL and incubated over night at 37 °C. After the respective incubation period, the plates were centrifuged at 150 ×g for 3 min and the medium was discarded. Subsequent to a washing step with PBS, 100 μL of the supernatant of the previously centrifuged (677 ×g, 10 min) neutral red medium were added to the cells, followed by 2 h of incubation at 37 °C and 5% CO2. The plates were centrifuged at 150 ×g for 3 min. Subsequently, the medium was removed and the cells were washed twice with PBS. Finally, 150 μL/well of the destaining solution (50% ethanol, 49% H2O, 1% glacial acetic acid) were added for cell lysis. Therefore the cells were incubated for 30 min on a plate shaker at room temperature. Fluorescence was measured at excitation (ex)/emission (em) 530/645 nm using a microplate reader (Tecan infinite M200 PRO, Tecan Group Ltd., Männedorf, Switzerland).

TEER resistivity values. Monolayers with TEER values exceeding 300 Ω·cm2 were considered as intact due to the similarity to TEER values found in the human colon (Artursson and Karlsson, 1991) and used for experiments. The cells were incubated with different OA concentrations and the respective SC. After 8 or 24 h of incubation the resulting resistance between the basolateral and the apical compartment was determined and compared to the respective initial TEER value. 2.5. Gene expression analysis A total amount of 1.4 × 105 Caco-2 cells/well were seeded in 6-well plates to analyze OA-induced effects on gene regulation of intestinal TJPs. Differentiated cells were treated for 8 or 24 h with non-cytotoxic concentrations (20 and 80 nM) or a subtoxic concentration (150 nM) of OA and the respective SC. Afterwards, the cells were washed with icecold PBS and subsequently harvested with cold RLT-Buffer (RNeasy Mini Kit, Qiagen GmbH, Hilden, Germany) containing 1% β-mercaptoethanol (Merck Schuchardt OHG, Hohenbrunn, Germany). Subsequently, the RNA was isolated using the kit mentioned above with an integrated on-column DNA digestion step and afterwards reverse transcribed into cDNA with the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, USA). The following quantitative real-time reverse transcriptase polymerase chain reaction (qPCR) was conducted on a LightCycler 96 (Roche, Mannheim, Germany) using the Maxima SYBR Green/ROX qPCR Master Mix (Thermo Fisher Scientific, Waltham, USA). The temperature program used is shown in Table 1. The gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as constitutively expressed housekeeping gene. Table 2 shows the primer sequences (primer synthesis: TIB Biomol GmbH, Berlin, Germany) used for the mRNA expression analysis. The x-fold regulation was calculated based on the received fluorescence data using the 2-ΔΔct method according to Livak and Schmittgen (2001).

2.3.2. WST-1 assay Cultivation and incubation of Caco-2 cells for the water soluble tetrazolium (WST-1, Roche, Mannheim, Germany) cell viability assay were performed as described for the NRU assay (Section 2.3.1). After the desired incubation time, the incubation solutions were removed and fresh medium was added to the cells which contained the WST-1 reagent in a dilution of 1:10. The absorption of the generated formazan was determined at 450 nm and compared to a reference wavelength of 620 nm after 1 h of incubation at 37 °C using a Tecan infinite M200 PRO microplate reader (Tecan Group Ltd., Männedorf, Switzerland). 2.4. Electrical impedance measurements

2.6. Western blotting

2.4.1. Real-time cellular analysis The cellular impedance of differentiated Caco-2 cells up to 24 h after exposure to OA was measured with the xCelligence RTCA SP instrument (Roche, Mannheim, Germany). The method allows label-free real-time monitoring of cells by measuring the impedance with the help of noninvasive gold microelectrodes. The cellular impedance is plotted by the instrument as cell index (CI) values. The calculation is based on the eq. CI = (sample impedance - background impedance)/nominal impedance value. Resulting values provide information on cell number, cell adhesion and cell morphology (Ke et al., 2011). The E-Plate 96 (Roche, Mannheim, Germany) was equilibrated with 50 μL medium for at least 30 min at 37 °C and 5% CO2 before seeding of 5 × 103 Caco-2 cells/ well. During the growth phase and the subsequent differentiation phase the medium was renewed every 2 d. Cells were treated with OA concentrations ranging from 20 to 500 nM and the respective SC. The resulting cellular impedance was measured every 15 min within the first 8 h of incubation and then determined every 30 min for further 16 h.

The protein expression of TJPs identified as distinct deregulated at the transcript level was analyzed by Western blotting. The cultivation and incubation of Caco-2 cells were performed as described for gene expression analysis (Section 2.5). Subsequently to the respective incubation period, the cells were harvested in PBS after a washing step. The samples were centrifuged (5 min, 3000 ×g, 4 °C) and the supernatants were removed. The proteins from the pellets were isolated using RIPA lysis buffer (pH 7.5; 50 mM Tris-HCl, 150 mM NaCl, 2 μM EGTA, 0.1% sodium dodecyl sulfate (SDS), 0.5% desoxycholic acid) containing 1:50 protease inhibitor (Complete Protease Inhibitor Cocktail Tablets, Roche, Mannheim, Germany). After homogenization and incubation on ice (10 min), the lysates were sonicated with a SONOPULS ultrasonic homogenizer (Bandelin electronic GmbH & Co. KG, Berlin, Germany; 25% power, pulse 2) on ice and centrifuged (20,000 ×g) for 30 min at 4 °C. The protein content of the resulting supernatant was determined using the bicinchoninic acid assay according to Smith et al. (1985) Table 1 Temperature program used for the qPCR.

2.4.2. TEER value determination OA-induced changes in the monolayer integrity of differentiated Caco-2 cells were detected by measuring the TEER value. Therefore, 8 × 104 cells/well were seeded in 12 mm transwell inserts with 0.4 μm pore size (Corning BV Life Sciences, Corning, USA), effective filter area 1.12 cm2. The initial TEER value was determined with a voltage-ohm meter connected to a pair of chopstick electrodes (EVOM, World Precision Instruments, Sarasota, USA) after 21 d of cultivation. Raw resistance values were corrected for the value of the respective empty filter (132 Ω) and multiplied with the effective filter area to obtain 152

Reaction

Temperature

Time

Number of cycles

Initialization Denaturation, primer binding and elongation Final elongation Melting curve analysis

95 °C 95 °C 60 °C 60 °C 95 °C 60 °C 95 °C

15 min 15 s 60 s 15 min 15 s 20 s 15 s

1 40 1 1

Toxicology in Vitro 58 (2019) 150–160

J. Dietrich, et al.

Table 2 Used primer sequences for the qPCR. Gene name

Protein name

Forward primer 5` → 3`

Reverse primer 5` → 3`

TJP1 TJP2 TJP3 CLDN1 CLDN2 CLDN3 CLDN4 CLDN7 CLDN8 CLDN12 CLDN15 OCLN MARVELD2 GAPDH

ZO-1 ZO-2 ZO-3 Claudin-1 Claudin-2 Claudin-3 Claudin-4 Claudin-7 Claudin-8 Claudin-12 Claudin-15 Occludin Tricellulin GAPDH

GAGAAGATTTGGCCGAGGGA TGAAGACACGGACGGTGAAG GCTATGACGGCGACTCATCC TGAGGATGGCTGTCATTGGG AGGAATCCCGAGCCAAAGAC AAGGTGTACGACTCGCTGC ACTTCTACAATCCGCTGGTGG CTGTGGATGGACTGCGTCA GTGGTGCTCATCCCTGTGAG TGGAATCGCCTCAGTAGCAG GATGGCTGTGGAAACCTTTGG GTGAGTGCTATCCTGGGCAT CAAGCGACCTGCCCTATCAA ATTTGGCTACAGCAACAGGG

TTTAGCAGGCTGGCTGGAAG GAGCGGGTGATGGACGAC CCACCACCTGGGCTCCTA CGTACCTGGCATTGACTGGG CAGTGGTGAGTAGAAGTCCCG AGTCCCGGATAATGGTGTTGG GCGGAGTAAGGCTTGTCTGT CCAGGGAGACCACCATTAGG GTGCCGTGGTCCATCCTAAG CACTGCTCCCGTCATACCG TCTCGAAGATGGTGTTGGTGG TGAGCAGTTGGGTTCACTCC GTGGCTGTAATGGGAGAGGG CAACTGTGAGGAGGGGAGA

diamidino-2-phenylindole (DAPI, Roche, Mannheim, Germany) and the secondary antibody Cy-2-labeled goat anti-mouse. Cy-5-labeled goat anti-rabbit secondary antibody (Jackson ImmunoResearch, Dianova, Hamburg, Germany) or AlexaFluor594-conjugated phalloidin was added to the mixture depending on the second target protein of the costaining experiment. After incubation for 1 h at room temperature, the cells were washed with PBS and water, dehydrated with ethanol and mounted with ProTaqs MountFlour (BioCyc, Luckenwalde, Germany). Samples stained with Alexa594-conjugated phalloidin were not dehydrated with ethanol before mounting due to the alcohol sensitivity of Factin. 2 h after the mounting solution was bonded, fluorescence was detected at 63× magnification using a LSM780 confocal laser scanning microscope (Zeiss, Jena, Germany) at ex wavelengths of 405 nm (DAPI), 541 nm (AlexaFluor594), 488 nm (Cy-2) and 647 nm (Cy-5). Zstacks spanning from the apical to the basolateral side of the cell layer were recorded and analyzed using ZEN 2.3 SP1 software.

versus a bovine serum albumin calibration line. The protein lysates were diluted with 2× Laemmli buffer (100 mM Tris-HCl (pH 6.8), 20% glycerine, 6.67% SDS, 0.2% bromophenol blue, 10% β-mercaptoethanol) and heated to 95 °C for 5 min for denaturation of the proteins. SDS polyacrylamide gel electrophoresis was performed using a 5% stacking gel and 8% (ZO-1) or 10% (claudin-2, claudin-4) separation gels, respectively, followed by the transfer of separated proteins to nitrocellulose blotting membranes (GE Healthcare Life Science, Little Chalfont, UK). Unspecific binding sites were blocked by incubation with 5% milk powder in Tris-buffered saline with Tween 20 (TBS-T; pH 7.6, 20 mM Tris-HCl, 137 mM NaCl, 0.1% Tween 20) for 1 h. The proteins were visualized by immunodetection with rabbit anti-ZO1, mouse anti-claudin-2 and mouse anti-claudin-4 primary antibodies (Invitrogen, Carlsbad, USA; dilution factor 1:1000). After 3 washing steps with TBS-T, the membrane was incubated for 1 h with the secondary antibody sheep anti-mouse IgG (Seramun Diagnostica GmbH, Heidesee, Germany, HRP-conjugated; dilution factor 1:2500) or goat anti-rabbit IgG (R&D Systems, Minneapolis, USA, HRP-conjugated; dilution factor 1:1000). The nitrocellulose membrane was incubated with the SuperSignal West Femto Maximum Sensitivity Substrate Kit according to the manufacturer's protocol (Thermo Fisher Scientific, Waltham, USA) after 3 washing steps with TBS-T. Chemiluminescence was monitored using a Molecular Imager Versadoc MP 4000 (BioRad Laboratories GmbH, Munich, Germany). β-Actin was used as loading control. Therefore, the membrane was incubated for 1 h at room temperature with primary mouse anti-pan actin antibody (Thermo Fisher Scientific, Waltham, USA; dilution factor 1:1000) followed by 3 washing steps with TBS-T. Signal was visualized using the HRP-conjugated secondary antibody sheep anti-mouse IgG for 1 h at room temperature followed by protein detection as described above. For quantitation the band intensity was analyzed using Image Lab 5.2 software. Intensities were referred to the loading control β-actin.

2.8. Statistical analysis Statistical analysis was performed using SigmaPlot 14.0 software. One-Way ANOVA followed by Dunnett's test was applied to calculate statistical significance of differences between treatments and solventtreated control cells. Student's t-test was used to calculate statistical significance of differences before and after treatment of the same cell layer. Statistical significance was assumed at p < .05. 3. Results 3.1. OA-induced changes in cell viability and monolayer integrity Two different cell viability assays, NRU and WST-1, were performed to determine the cytotoxic properties of OA in Caco-2 cells. The assays showed similar results after 24 h of incubation of differentiated Caco-2 cells with OA concentrations ranging between 50 and 1000 nM. Both assays showed a concentration-dependent decrease of cell viability compared to solvent-treated control cells for concentrations of 200 nM OA or higher. The calculation of the half maximal effective concentration (EC50) of OA after curve fitting to dose-response equation resulted in an EC50 of 155 nM or 289 nM for the NRU assay or the WST1 assay, respectively (Fig. 2A). The xCelligence real-time cellular analysis method was used to determine the influence of OA in concentrations from 20 to 500 nM on the CI of differentiated Caco-2 cells up to 24 h after treatment. The results showed a concentration-dependent decrease of the CI if Caco-2 cells were exposed to 350 nM OA or higher compared to solvent-treated control cells (relative CI of solvent treated control cells = 1; Fig. 2B). A decrease of the CI is associated with a disruption of the cell monolayer suggesting that processes like apoptosis might be induced. Lower

2.7. Immunofluorescence staining 8 × 104 Caco-2 cells/well were seeded in 12 mm transwell inserts for immunofluorescence microscopy analysis. The differentiated cells were incubated with different OA concentrations for 24 h or the respective SC. Subsequently cells were fixed with methanol at −20 °C for 10 min, or with 4% paraformaldehyde for 20 min at room temperature for the cytoskeleton staining with AlexaFluor594-conjugated phalloidin after a washing step with PBS. The fixation agent was washed out and the cells were permeabilized for 10 min at room temperature with PBS containing 0.5% Triton X-100. The primary antibodies mouse anti-ZO1, rabbit anti-claudin-2, mouse anti-claudin-4 and mouse anti-occludin (Thermo Fisher Scientific, Waltham, USA) were diluted 1:150 in PBS and incubated over night at 4 °C. After the primary antibodies had been discarded, the cells were incubated with a mixture of 1 μg/mL 4′,6153

Toxicology in Vitro 58 (2019) 150–160

J. Dietrich, et al.

concentrations resulted concentration-dependently in an increase of the CI (CI > 1). However, treatment of Caco-2 cells with 150 nM OA resulted in an increase of CI but after 14 h this effect was reversed. Based on all cellular viability data evaluated in this study, concentrations of 20 and 80 nM OA as non-toxic concentrations and 150 nM as a subtoxic concentration with a cell mortality rate lower than 20% were chosen to investigate intestinal TJPs (Fig. 2A and B). The TEER value is considered as a characteristic value for the integrity of the intestinal barrier (Blume et al., 2010). Caco-2 cells were grown in a transwell system and treated with 20, 80, or 150 nM OA, or with the respective solvent for 8 or 24 h. Apical OA treatment for 8 h did not lead to any significant differences in TEER values (Fig. 2C). Treatment with 80 and 150 nM OA for 24 h resulted in a statistically significant reduction of TEER values comparing the TEER values at the start and the end of the incubation (Fig. 2C; comparison of black and gray bars). TEER values of the OA treatments did not reach statistical significance when tested against the end-of-experiment TEER value of the SC (Fig. 2C; comparison of gray bars). 3.2. OA treatment affects relative mRNA and protein expression of small intestinal TJPs Changes in gene expression of intestinal TJPs in differentiated Caco2 cells after OA treatment for 8 h and 24 h were determined using qPCR. The threshold for gene regulation was set as 1.5-fold expression of solvent control for upregulated and 0.7-fold expression for downregulated genes. For CLDN8 no fluorescence signal was detected by qPCR. The genes encoding claudin-2 (CLDN2), −4 (CLDN4), occludin (OCLN), ZO-1 (TJP1) and ZO-2 (TJP2) were upregulated after 8 h of incubation with OA: CLDN2 and TJP1 showed an upregulation after incubation with 80 (1.5-fold and 2.1-fold) and 150 nM (1.8-fold and 2.1-fold), respectively. CLDN4 and OCLN were upregulated in Caco-2 cells treated with 150 nM OA (4.4-fold and 1.6-fold). A 1.6-fold and 1.5fold upregulation of the genes encoding for ZO-2 and claudin-7 occurred only after incubation with 150 nM OA (Fig. 3A). Fewer genes were regulated after 24 h of incubation, as compared to 8 h of incubation: CLDN2 and CLDN7 were upregulated 3.8-fold and 1.6-fold after incubation with 150 nM OA. An upregulation of CLDN4 was observed after treatment with 80 and 150 nM OA for 24 h (2.3-fold and 4.9-fold). After 24 h of exposure of Caco-2 cells to OA, the calculated fold changes of the genes encoding claudin-2, claudin-12, ZO-1, ZO-2, ZO-3 and tricellulin were significantly different from the SC. All these genes tended to be downregulated (see Fig. 3B). However, these values were below the threshold set for the amplitude of gene regulation. Exemplary, the protein expressions of the three TJPs which were identified to be regulated by OA on mRNA level were determined by Western blotting (Fig. 3C). No changes in the relative protein amount of claudin-2 were detected after 8 or 24 h of incubation with the OA concentrations 20 nM, 80 nM, or 150 nM. In contrast, the relative protein amount of claudin-4 increased approximately 2-fold after treatment with 150 nM OA for 24 h. This effect seemed to be concentrationdependent but is not significant different compared to the amount of claudin-4 in solvent-treated control cells. A reduced protein amount (33%) of ZO-1 was detected after treatment with 150 nM OA following the same incubation period, as compared to solvent-treated control cells (Fig. 3D).

Fig. 2. OA-induced changes in cell viability and monolayer integrity. Differentiated Caco-2 cell monolayers were treated with different OA concentrations. (A) Cell viability was determined after 24 h treatment with OA concentrations ranging from 50 to 1000 nM with the NRU and WST-1 assays. 0.01% (v/v) Triton X-100 served as PC. Mean ± standard deviation (SD) of 4 independent experiments is shown. For statistical analysis OA treatment was compared with solvent-treated cells using One-Way ANOVA followed by Dunnett‘s test (*** p < .001). (B) Cellular impedance was determined up to 24 h after addition of OA (20–500 nM). Shown is the average CI ± SD of 3 incubations related to solvent-treated control cells. The starting time of incubation with OA was set to 0. (C) Intact monolayers on transwell inserts were incubated with different OA concentrations (20–150 nM). TEER values were determined with a voltage ohmmeter connected to a pair of chopstick electrodes after 8 and 24 h. The figures show mean + SD of 4 independent experiments. For statistical analysis TEER values of OA-treated monolayers were compared with solvent-treated monolayers (gray bars vs. gray bars) using OneWay ANOVA followed by Dunnett‘s test. Student's t-test was used for comparison of the TEER values of OA-treated cell monolayers with the initial TEER value of the respective cell monolayer (gray bars vs. black bars; # p < .05; ##

3.3. Immunofluorescence staining of selected TJPs after OA treatment Immunofluorescence staining followed by confocal microscopy was performed to visualize direct effects of OA on intestinal TJPs. Here we focused on TJPs which were distinct regulated by OA on mRNA level. Furthermore, cytoskeletal F-actin was stained which is known to be linked to claudins and occludin through ZO-1 (Fanning et al., 1998). Both TJPs were regulated by OA at the mRNA level. The staining of the Caco-2 cell monolayer with DAPI and antibodies 154

Toxicology in Vitro 58 (2019) 150–160

J. Dietrich, et al.

Fig. 3. OA-induced effects on relative mRNA and protein expression of TJPs of the small intestine. (A + B) Differentiated Caco-2 cells were treated with different OA concentrations (20–150 nM) for 8 (A) or 24 h (B). The mRNA was isolated and transcribed into cDNA and qPCR was performed. The resulting fold changes were calculated normalized to the housekeeping gene GAPDH and solvent-treated control cells using the 2-ΔΔCt-method. Heatmaps show the relative fold change values as well as statistical analysis of expression fold change values of 3 independent experiments. For statistical analysis OA treatment was compared with solvent-treated cells using One-Way ANOVA followed by Dunnett‘s test (* p < .05; ** p < .01; *** p < .001). Gray stars indicate significant difference to the solvent-treated control with values below the threshold set to 1.5 or 0.7 for the amplitude of gene regulation. (C + D) Differentiated Caco-2 cells were treated with OA concentrations ranging from non-cytotoxic (20 and 80 nM) to subtoxic (150 nM) for 8 or 24 h. Western blotting was performed with rabbit anti-ZO-1, mouse anti-claudin2 and mouse anti-claudin-4 primary antibodies. HRP-conjugated sheep anti-mouse or goat anti-rabbit secondary antibodies were used for detection. β-Actin was used as loading control. Panel C exemplarily shows one representative blot out of three independent experiments. Panel D shows the relative protein amount related to the loading control β-actin or GAPDH and solvent-treated control cells. For statistical analysis OA treatment was compared with solvent-treated cells using One-Way ANOVA followed by Dunnett‘s test (* = p < .05).

addition, a substantial amount of ZO-1 was now located in the in the cytosolic compartment. OA treatment induced unusual condensation of F-actin, thus demonstrating cytoskeletal alterations. Rising concentrations of OA induced concentration-dependently the complete destruction of F-actin structures as well as of the ZO-1 junction network (Fig. 5).

against claudin-2 and claudin-4 showed an undamaged distinct network of the two proteins in control cells: claudin-2 was located on the apical border and claudin-4 additionally on the lateral membrane of the cells. The incubation of the cells with 150 nM OA for 24 h mainly led to TJ structures which were diffuse and less sharp. Treatment with 350 nM OA for 24 h resulted in complete deregulation of the TJ network. The cell shape was irregular and did not appear as flat as the solvent-treated Caco-2 monolayer. These effects were even enhanced after cell treatment with 500 nM OA for 24 h, where a destroyed layer with barely intact TJ structures was observed. After treatment of Caco-2 cells with these high concentrations of OA the amount of apoptotic and necrotic Caco-2 cells increased (supplemental material Fig. S1) and the Caco-2 cell layer appeared in the microscopic images as strongly irregular compared to the solvent control (Fig. 4). The staining of a solvent-treated Caco-2 cell monolayer with DAPI, phalloidin and an antibody against ZO-1 showed undamaged actin structures and an intact ZO-1 network with ZO-1 located in the junction areas. Treatment with 150 nM OA for 24 h resulted in an enhanced staining intensity for ZO-1 pointing to an onset of cell damage due to the beginning loss of the distinct, defined network structure. In

4. Discussion The occurrence of OA and other DSP toxins in seafood has increased continuously over the last decades (Van Dolah, 2000) since the first reported cases of DSP in the 1970s in Japan (Yasumoto et al., 1978). Reasons are multifaceted and range from rising environmental pollution and shipping traffic to climate changes and the usage of costal water for aqua culture (Hallegraeff, 1993). The lowest observed adverse effect level for DSP-related symptoms is approximately 0.8 μg OA equivalents per kg body weight for adults, corresponding to 56 μg OA for a person of 70 kg. The consumption of 400 g shellfish meat is considered as a high portion size (EFSA, 2008). The ingestion of 400 g shellfish meat contaminated with the maximum legal limit value of 155

Toxicology in Vitro 58 (2019) 150–160

J. Dietrich, et al.

Fig. 4. Co-staining of differentiated Caco-2 cell monolayers with anti-claudin-2 and anti-claudin-4 antibodies. Cells were incubated for 24 h with different OA concentrations (150–500 nM). Immunostaining was carried out using primary antibodies against claudin-2 and claudin-4. Cy-2-labeled goat anti-mouse (green) and Cy-5-labeled goat anti-rabbit (red) as secondary antibodies were detected together with DAPI (blue) using a LSM780 confocal laser scanning microscope at ex wavelengths of 405 nm (DAPI), 488 nm (Cy-2) and 647 nm (Cy-5). Z-stacks spanning from apical to basolateral side of the cell layer were recorded at 63× magnification and analyzed using ZEN 2.3 SP1 software. Brightness and contrast were both increased by 40% for each image. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

160 μg/kg would correspond to an intake of 64 μg OA. This amount leads to an intestinal concentration of approximately 80 nM OA assuming a dilution of ingested OA in the stomach and intestine in a volume of 1 L. In the present study, concentrations ranging around this value were used for the investigation of the influence of OA on intestinal integrity including the expression and structural organization of TJPs. We detected early upregulation of TJPs at the mRNA level within this concentration range (Fig. 3A). Higher concentrations led to enhanced molecular effects of OA. When assessing the resulting risk of OA ingestion, however, it has to be considered that we used serum-free incubation conditions to avoid interactions of OA with serum ingredients. Therefore, the used model does not represent the in vivo situation in the human intestinal lumen where a large amount of food components, endogenous proteins and further constituents are present as possible interaction partners for OA which can lead to an altered toxic potential of the phycotoxin. The findings for OA-induced cytotoxic effects (Fig. 2A) are comparable to those of Ehlers et al. (2011) who detected cytotoxic effects in differentiated Caco-2 cells beginning at 100 nM. The calculation of the EC50 for the respective analysis resulted in 155 nM for NRU and 289 nM for WST-1 assay suggesting a mediocre correlation between the two different methods to estimate cell viability. Nevertheless, both assays showed a concentration-dependent decreased cell viability for concentrations beginning at 200 nM OA and can therefore be used for the determination of appropriate concentrations for further analysis of the

effects of OA on TJPs. Observed differences based on different assay sensitivities since different physiological endpoints were used for the measurement: the NRU assay indicates the lysosomal accumulation and retention of the neutral red dye in viable cells while the WST-1 assay reflects the activity of mitochondrial dehydrogenases of viable cells (Borenfreund et al., 1988; Repetto et al., 2008). However, a comparison of OA-induced cytotoxic effects with rather than one assay is reasonable due to possible interference of the assay reagent with the test compound. Furthermore, it is possible that the principle of the assay is disturbed by the mode of action of the respective test compound as it is the case for yessotoxin, a marine biotoxin that disrupts lysosomes (Malagoli et al., 2006) leading erroneously to enhanced cytotoxic effects within the NRU assay. Additionally, EC50 values for OA strongly depend on other factors like the cell type or the differentiation status of Caco-2 cells. This is clearly illustrated by comparison of the present results with a study of Ferron et al. (2014) who calculated EC50 values of 49 nM in undifferentiated Caco-2 cells and 75 nM in HT29-MTX cells after 24 h treatment with OA. Besides cell viability assays, the RTCA method provides a non-invasive possibility to monitor the CI in realtime over a defined period. The results indicate cytotoxic effects induced by concentrations starting at 350 nM which is in line with the results of the conducted cell viability assays considering the fact that the RTCA method offers the highest sensitivity of the three methods. However, treatment with lower concentrations led to a dose-dependent increase of the CI what might be associated with higher proliferation 156

Toxicology in Vitro 58 (2019) 150–160

J. Dietrich, et al.

Fig. 5. Co-staining of differentiated Caco-2 cell monolayers with anti-ZO-1 antibody and AlexaFluor594-conjugated phalloidin. Cells were incubated for 24 h with different OA concentrations (150–500 nM). Immunostaining was carried out using a primary antibody against ZO-1. Staining of cytoskeletal F-actin was performed using AlexaFluor594-conjugated phalloidin (red). Cy-2-labeled goat anti-mouse (green) was used as secondary antibody. Detection was conducted using a LSM780 confocal laser scanning microscope at ex wavelengths of 405 nm (DAPI, blue), 541 nm (AlexaFluor594) and 488 nm (Cy-2). Z-stacks spanning from apical to basolateral side of the cell layer were recorded at 63× magnification and analyzed using ZEN 2.3 SP1 software. Brightness and contrast were both increased by 40% for each image. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

paracellular permeability is considered to be main cause for diarrhetic effects (Blume et al., 2010; Ewe, 1988). Thereby, it is important to keep in mind that the resistance of solvent-treated monolayers within this study was ~ 1500–1700 Ω·cm2 which is 17–34-fold higher than in mammalian small intestinal epithelium (Madara, 1989). Therefore, a higher sensitivity of the human small intestine compared to the Caco-2 cell monolayer might be assumed. On the other hand it has to be considered that the cell monolayer was exposed to OA in vitro for at least 8 h. In an in vivo situation intestinal peristalsis prevents long exposure times within the same intestine section. To the best of our knowledge, the differential expression of intestinal TJPs by OA was investigated for the first time in this study (Fig. 3A and B). The upregulation of claudin-4 was confirmed at the protein level although the observed increased protein amount was not statistically different to untreated control cells due to high experimental variability. This protein is known as one important functional component for the formation of the intestinal barrier. Hering et al. (2011) published that an increased protein level of claudin-4 enhanced the barrier resistance of HT-29/B6 cell monolayers. Considering the results of the immunofluorescence staining of claudin-4 (Fig. 4), we hypothesize that the observed upregulation of claudin-4 gene expression may represent a feedback mechanism to compensate for disrupted intercellular junctions. For CLDN8 no fluorescence signal was detected by qPCR which is probably due to culture-related variations of the parental cell line which have often been observed during the last decades of

rate of the cells induced by low concentrations of OA. This assumption is consistent with a study of Nuydens et al. (1998) who observed a dosedependent increase of cell viability with an enhanced number of mitotic TR14 neuronal cells after treatment with OA in lower concentrations while higher concentrations induced dose-dependently cytotoxic effects. TJPs regulate the paracellular permeability of the intestinal barrier, cell-cell adhesion as well as the maintenance of cell polarity (Balda et al., 1996; Lu et al., 2013). A decreased TEER value is often associated with a decreased integrity of the cell monolayer due to functional changes of TJPs (Lu et al., 2013; MacCallum et al., 2005). Therefore, the findings shown in Fig. 2B and C suggest that there might be an influence of OA on the functionality of TJPs. As shown in the real time monitoring of CI and measurement of TEER value we identified 150 nM OA as concentration with beginning cytotoxic and barrier disturbing properties accompanied with a very low cytotoxicity in differentiated Caco-2 cells. Former in vitro studies with intestinal cells showed a strong decrease of the TEER values of Caco-2 and T84 cell monolayers soon after treatment with OA at higher concentrations (> 500 nM) than used in this study (Ehlers et al., 2011; Tripuraneni et al., 1997). The OAinduced accumulation of hyperphosphorylated intestinal proteins regulating sodium excretion is considered as the main reason for diarrhetic effects (Aune and Yndestad, 1993). Our results show the induction of molecular effects that may contribute to the development of diarrhea after poisoning with OA due to barrier disruption, as increased

157

Toxicology in Vitro 58 (2019) 150–160

J. Dietrich, et al.

first hours in an increased CI compared to solvent-treated cells. This might be associated with detoxification processes e.g. a P-glycoproteindependent efflux (Ehlers et al., 2014) however, after approximately 14 h this effect is reversed, and the CI decreased. This may be due to the saturation of detoxification capacity. Concentrations higher 150 nM OA caused very fast a strong decrease in CI after treatment. Overall, we demonstrated that OA affects intestinal TJPs in a concentration- and time-dependent manner in the Caco-2 cell model. Upregulation of genes encoding for intestinal TJPs occurred after treatment with non-cytotoxic or subtoxic OA concentrations at the mRNA level. OA-induced changes at the protein level were also detected by Western blotting. Immunofluorescence staining showed effects on the structural organization of the respective TJPs already after treatment with a subtoxic concentration of OA. Treatment with higher concentrations which induce clearly cytotoxic effects led to a strong disruption of TJPs and the cell monolayer. Thereby it is difficult to consider if the mechanism leading to these observations occur directly or indirectly. On the one hand it is possible that OA disrupts TJ networks in a direct way via for example hyperphosphorylation resulting in disturbance of phosphorylation and dephosphorylation processes which then leads to the induction of cytotoxic, apoptotic or necrotic effects. On the other hand it may be also conceivable that OA-induced cytotoxic effects lead to the disruption of the TJ network. Nevertheless, the present results do not provide insights into transcriptional or translational regulatory mechanisms behind the deregulation of TJPs which would be interesting for further studies. We conclude that our results help to explain the molecular mode of action by which OA leads to a disruption of the intestinal barrier in vivo. Understanding of the molecular effects of OA on intestinal TJPs can contribute to improved risk assessment of DSP toxins which is indispensable for an effective consumer protection.

Caco-2 cell cultivation (Sambuy et al., 2005). As an example, Lambert et al. (2007) used Caco-2 cells to investigate the protein expression of different TJPs and found claudin-8 expressed at the limits of detection in Western blotting analysis. ZO-1 is known to regulate TJPs and to mediate cell-cell contacts via various protein binding domains (Fanning et al., 1998; Stevenson et al., 1986). In addition, it seems to play a role in cellular signal transduction (Willott et al., 1993). In contrast to the gene expression results, which showed an upregulation of TJP1 (Fig. 3A), the protein amount of ZO-1 decreased after treatment of Caco-2 cells with OA (Fig. 3D). Our Western blotting results correlate with the observations by Singer et al. (1994) who found reduced levels of ZO-1 after co-incubation of 31EG4 cells with OA. Additionally, the same authors found a strong reduction of the TEER values by OA and assumed that this effect is due to the OAinduced disruption of ZO-1 which was now confirmed by our immunofluorescence staining of ZO-1 (Fig. 5). Until now, the molecular mechanisms of ZO-1 regulation and recruitment to the membrane are not fully understood, but it has been shown that ZO-1 is associated with ZO-2, occludin, the actin cytoskeleton and claudins via PDZ binding motifs (Fanning et al., 1998; Furuse et al., 1994; Van Itallie et al., 2017). With regard to the F-actin cytoskeleton we showed OA-induced changes in the distribution of F-actin in differentiated Caco-2 cells (Fig. 5). Such an effect has already been observed for other compounds affecting the permeability of Caco-2 cell monolayers, for example chitosan (Artursson et al., 1994) or other PP2A inhibitors like phorbol esters and calyculin A, which is plausible since phosphorylating and dephosphorylating processes are key events for structural and functional organization of the cytoskeleton (Eriksson et al., 1992; Kreienbuhl et al., 1992). Therefore, OA and other DSP toxins have been shown to change and disrupt the cytoskeleton in various cell lines (Baba et al., 2003; Cabado et al., 2004; Fiorentini et al., 1996; Leira et al., 2001; Vale and Botana, 2008) as well as in human platelets (Yano et al., 1995). The disruption of F-actin organization may be associated with the influence of OA on the expression level of ZO-1 since ZO-1 mediates the connection between F-actin and occludin. Concentration-dependent effects of OA were also observed on the occludin functionality using immunostaining (supplemental material Fig. S2) although the effects on mRNA expression were very weak. Claudin-2 proteins form cation and water channels in epithelial tissues like kidney and intestine. The protein controls paracellular ion permeability as well as water transport which was shown in MDCK C7 cells (Amasheh et al., 2002; Rosenthal et al., 2010). Within this study we found claudin-2 to be upregulated at the mRNA but not on protein level. In contrast, Yasuda et al. (2012) showed an upregulation of the claudin-2 protein after 16 h of treatment in MDCK II cells with 20 or 100 nM OA. We hypothesize that these differences may be due to the complex and tissue-specific expression patterns of TJPs which provide barriers with various requirements in different organs (Turksen and Troy, 2004). The Caco-2 cell model is regarded as the gold standard cell line for the investigation of transport processes of xenobiotics and is particularly suitable for the investigation of TJPs due to its high expression of TJPs typical for the human small intestine (Delie and Rubas, 1997; Meunier et al., 1995). One important disadvantage is the low expression level of phase I cytochrome P450 (CYP) enzymes which are present at remarkably higher amounts in human enterocytes (Engman et al., 2001; Kublbeck et al., 2016). Different studies showed that OA is a substrate for CYP3A4, CYP3A5 and CYP1A2 (Guo et al., 2010; Kolrep et al., 2016; Le Hegarat et al., 2004). Therefore, the influence of OA metabolites on TJPs is probably not depicted sufficiently in our study and should be considered during the characterization of the risk potential of OA since the CYP-driven biotransformation in the case of OA can lead to both, biological activation and detoxification, as compared to the mother compound (Ferron et al., 2016; Kolrep et al., 2016). However, regarding the CI measurement some metabolic effects can be hypothesized: Treatment of Caco-2 cells with 150 nM OA resulted within the

Acknowledgement This work was supported by the German Research Foundation (grant number LA 1177/11-1) and by the German Federal Institute for Risk Assessment (grant number 1322-662). Further the authors would like to special thank Almut Leffke for the technical support with the protein analysis. Conflict of interest The authors declare no conflict of interest. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.tiv.2019.03.033. References Amasheh, S., Meiri, N., Gitter, A.H., Schoneberg, T., Mankertz, J., Schulzke, J.D., Fromm, M., 2002. Claudin-2 expression induces cation-selective channels in tight junctions of epithelial cells. J. Cell Sci. 115, 4969–4976. Artursson, P., Karlsson, J., 1991. Correlation between oral drug absorption in humans and apparent drug permeability coefficients in human intestinal epithelial (Caco-2) cells. Biochem. Biophys. Res. Commun. 175, 880–885. Artursson, P., Lindmark, T., Davis, S.S., Illum, L., 1994. Effect of chitosan on the permeability of monolayers of intestinal epithelial cells (Caco-2). Pharm. Res. 11, 1358–1361. Aune, T., Yndestad, M., 1993. Diarrhetic shellfish poisoning. In: Falconer, I.R. (Ed.), Algal Toxins in Seafood and Drinking Water. Academic Press, New York, pp. 87–104. Baba, T., Udaka, K., Terada, N., Ueda, H., Fujii, Y., Ohno, S., Sato, S.B., 2003. Actin-rich spherical extrusion induced in okadaic acid-treated K562 cells by crosslinking of membrane microdomains. J. Histochem. Cytochem. 51, 245–252. Balda, M.S., Whitney, J.A., Flores, C., Gonzalez, S., Cereijido, M., Matter, K., 1996. Functional dissociation of paracellular permeability and transepithelial electrical resistance and disruption of the apical-basolateral intramembrane diffusion barrier by expression of a mutant tight junction membrane protein. J. Cell Biol. 134, 1031–1049.

158

Toxicology in Vitro 58 (2019) 150–160

J. Dietrich, et al.

Itoh, M., Furuse, M., Morita, K., Kubota, K., Saitou, M., Tsukita, S., 1999. Direct binding of three tight junction-associated MAGUKs, ZO-1, ZO-2, and ZO-3, with the COOH termini of claudins. J. Cell Biol. 147, 1351–1363. Ke, N., Wang, X., Xu, X., Abassi, Y.A., 2011. The xCELLigence system for real-time and label- free monitoring of cell viability. Methods Mol. Biol. 740, 33–43. Kolrep, F., Hessel, S., These, A., Ehlers, A., Rein, K., Lampen, A., 2016. Differences in metabolism of the marine biotoxin okadaic acid by human and rat cytochrome P450 monooxygenases. Arch. Toxicol. 90, 2025–2036. Kreienbuhl, P., Keller, H., Niggli, V., 1992. Protein phosphatase inhibitors okadaic acid and calyculin A alter cell shape and F-actin distribution and inhibit stimulus-dependent increases in cytoskeletal actin of human neutrophils. Blood 80, 2911–2919. Kublbeck, J., Hakkarainen, J.J., Petsalo, A., Vellonen, K.S., Tolonen, A., Reponen, P., Forsberg, M.M., Honkakoski, P., 2016. Genetically modified Caco-2 cells with improved cytochrome P450 metabolic capacity. J. Pharm. Sci. 105, 941–949. Lambert, D., O'Neill, C.A., Padfield, P.J., 2007. Methyl-beta-cyclodextrin increases permeability of Caco-2 cell monolayers by displacing specific claudins from cholesterol rich domains associated with tight junctions. Cell. Physiol. Biochem. 20, 495–506. Le Hegarat, L., Puech, L., Fessard, V., Poul, J.M., Dragacci, S., 2003. Aneugenic potential of okadaic acid revealed by the micronucleus assay combined with the FISH technique in CHO-K1 cells. Mutagenesis 18, 293–298. Le Hegarat, L., Fessard, V., Poul, J.M., Dragacci, S., Sanders, P., 2004. Marine toxin okadaic acid induces aneuploidy in CHO-K1 cells in presence of rat liver postmitochondrial fraction, revealed by cytokinesis-block micronucleus assay coupled to FISH. Environ. Toxicol. 19, 123–128. Le Hegarat, L., Jacquin, A.G., Bazin, E., Fessard, V., 2006. Genotoxicity of the marine toxin okadaic acid, in human Caco-2 cells and in mice gut cells. Environ. Toxicol. 21, 55–64. Leira, F., Alvarez, C., Vieites, J.M., Vieytes, M.R., Botana, L.M., 2001. Study of cytoskeletal changes induced by okadaic acid in BE(2)-M17 cells by means of a quantitative fluorimetric microplate assay. Toxicol. in Vitro 15, 277–282. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(−Delta Delta C(T)) method. Methods 25, 402–408. Lu, Z., Ding, L., Lu, Q., Chen, Y.H., 2013. Claudins in intestines: distribution and functional significance in health and diseases. Tissue Barriers 1, e24978. MacCallum, A., Hardy, S.P., Everest, P.H., 2005. Campylobacter jejuni inhibits the absorptive transport functions of Caco-2 cells and disrupts cellular tight junctions. Microbiology 151, 2451–2458. Madara, J.L., 1989. Loosening tight junctions. Lessons from the intestine. J. Clin. Invest. 83, 1089–1094. Malagoli, D., Marchesini, E., Ottaviani, E., 2006. Lysosomes as the target of yessotoxin in invertebrate and vertebrate cell lines. Toxicol. Lett. 167, 75–83. Matias, W.G., Creppy, E.E., 1998. 5-Methyldeoxycytosine as a biological marker of DNA damage induced by okadaic acid in vero cells. Environ. Toxicol. Water Qual. 13, 83–88. Matias, W.G., Traore, A., Bonini, M., Sanni, A., Creppy, E.E., 1999. Oxygen reactive radicals production in cell culture by okadaic acid and their implication in protein synthesis inhibition. Hum. Exp. Toxicol. 18, 634–639. Meunier, V., Bourrie, M., Berger, Y., Fabre, G., 1995. The human intestinal epithelial cell line Caco-2; pharmacological and pharmacokinetic applications. Cell Biol. Toxicol. 11, 187–194. Morimoto, Y., Ohba, T., Kobayashi, S., Haneji, T., 1997. The protein phosphatase inhibitors okadaic acid and calyculin a induce apoptosis in human osteoblastic cells. Exp. Cell Res. 230, 181–186. Nishina, Y., Sumi, T., Iwai, S.A., Nishimune, Y., 1995. Effects of protein phosphatase inhibition by okadaic acid on the differentiation of F9 embryonal carcinoma cells. Exp. Cell Res. 217, 288–293. Nunbhakdi-Craig, V., Machleidt, T., Ogris, E., Bellotto, D., White 3rd, C.L., Sontag, E., 2002. Protein phosphatase 2A associates with and regulates atypical PKC and the epithelial tight junction complex. J. Cell Biol. 158, 967–978. Nuydens, R., de Jong, M., Van Den Kieboom, G., Heers, C., Dispersyn, G., Cornelissen, F., Nuyens, R., Borgers, M., Geerts, H., 1998. Okadaic acid-induced apoptosis in neuronal cells: evidence for an abortive mitotic attempt. J. Neurochem. 70, 1124–1133. Ravindran, J., Gupta, N., Agrawal, M., Bala Bhaskar, A.S., Lakshmana Rao, P.V., 2011. Modulation of ROS/MAPK signaling pathways by okadaic acid leads to cell death via, mitochondrial mediated caspase-dependent mechanism. Apoptosis 16, 145–161. Repetto, G., del Peso, A., Zurita, J.L., 2008. Neutral red uptake assay for the estimation of cell viability/cytotoxicity. Nat. Protoc. 3, 1125–1131. Romashko, A.A., Young, M.R., 2004. Protein phosphatase-2A maintains focal adhesion comple xes in keratinocytes and the loss of this regulation in squamous cell carcinomas. Clin. Exp. Metastasis 21, 371–379. Rosenthal, R., Milatz, S., Krug, S.M., Oelrich, B., Schulzke, J.D., Amasheh, S., Gunzel, D., Fromm, M., 2010. Claudin-2, a component of the tight junction, forms a paracellular water channel. J. Cell Sci. 123, 1913–1921. Sambuy, Y., De Angelis, I., Ranaldi, G., Scarino, M.L., Stammati, A., Zucco, F., 2005. The Caco-2 cell line as a model of the intestinal barrier: influence of cell and culturerelated factors on Caco-2 cell functional characteristics. Cell Biol. Toxicol. 21, 1–26. Seth, A., Sheth, P., Elias, B.C., Rao, R., 2007. Protein phosphatases 2A and 1 interact with occludin and negatively regulate the assembly of tight junctions in the CACO-2 cell monolayer. J. Biol. Chem. 282, 11487–11498. Singer, K.L., Stevenson, B.R., Woo, P.L., Firestone, G.L., 1994. Relationship of serine/ threonine phosphorylation/dephosphorylation signaling to glucocorticoid regulation of tight junction permeability and ZO-1 distribution in nontransformed mammary epithelial cells. J. Biol. Chem. 269, 16108–16115. Smith, P.K., Krohn, R.I., Hermanson, G.T., Mallia, A.K., Gartner, F.H., Provenzano, M.D., Fujimoto, E.K., Goeke, N.M., Olson, B.J., Klenk, D.C., 1985. Measurement of protein using bicinchoninic acid. Anal. Biochem. 150, 76–85.

Banan, A., Zhang, L.J., Shaikh, M., Fields, J.Z., Choudhary, S., Forsyth, C.B., Farhadi, A., Keshavarzian, A., 2005. Theta isoform of protein kinase C alters barrier function in intestinal epithelium through modulation of distinct claudin isotypes: a novel mechanism for regulation of permeability. J. Pharmacol. Exp. Ther. 313, 962–982. Berven, G., Saetre, F., Halvorsen, K., Seglen, P.O., 2001. Effects of the diarrhetic shellfish toxin, okadaic acid, on cytoskeletal elements, viability and functionality of rat liver and intestinal cells. Toxicon 39, 349–362. Bialojan, C., Takai, A., 1988. Inhibitory effect of a marine-sponge toxin, okadaic acid, on protein phosphatases. Specificity and kinetics. Biochem. J. 256, 283–290. Blume, L.F., Denker, M., Gieseler, F., Kunze, T., 2010. Temperature corrected transepithelial electrical resistance (TEER) measurement to quantify rapid changes in paracellular permeability. Pharmazie 65, 19–24. Boe, R., Gjertsen, B.T., Vintermyr, O.K., Houge, G., Lanotte, M., Doskeland, S.O., 1991. The protein phosphatase inhibitor okadaic acid induces morphological changes typical of apoptosis in mammalian cells. Exp. Cell Res. 195, 237–246. Borenfreund, E., Babich, H., Martin-Alguacil, N., 1988. Comparisons of two in vitro cytotoxicity assays-the neutral red (NR) and tetrazolium MTT tests. Toxicol. in Vitro 2, 1–6. Cabado, A.G., Leira, F., Vieytes, M.R., Vieites, J.M., Botana, L.M., 2004. Cytoskeletal disruption is the key factor that triggers apoptosis in okadaic acid-treated neuroblastoma cells. Arch. Toxicol. 78, 74–85. Delie, F., Rubas, W., 1997. A human colonic cell line sharing similarities with enterocytes as a model to examine oral absorption: advantages and limitations of the Caco-2 model. Crit. Rev. Ther. Drug Carrier Syst. 14, 221–286. Di Cello, F., Cope, L., Li, H., Jeschke, J., Wang, W., Baylin, S.B., Zahnow, C.A., 2013. Methylation of the claudin 1 promoter is associated with loss of expression in estrogen receptor positive breast cancer. PLoS ONE 8, e68630. EFSA, 2008. Scientific opinion of the panel on contaminants in the food chain on a request from the European Commission on marine biotoxins in shellfish – okadaic acid and analogue. EFSA J. 589, 1–62. Ehlers, A., Stempin, S., Al-Hamwi, R., Lampen, A., 2010. Embryotoxic effects of the marine biotoxin okadaic acid on murine embryonic stem cells. Toxicon 55, 855–863. Ehlers, A., Scholz, J., These, A., Hessel, S., Preiss-Weigert, A., Lampen, A., 2011. Analysis of the passage of the marine biotoxin okadaic acid through an in vitro human gut barrier. Toxicology 279, 196–202. Ehlers, A., These, A., Hessel, S., Preiss-Weigert, A., Lampen, A., 2014. Active elimination of the marine biotoxin okadaic acid by P-glycoprotein through an in vitro gastrointestinal barrier. Toxicol. Lett. 225, 311–317. Engman, H.A., Lennernas, H., Taipalensuu, J., Otter, C., Leidvik, B., Artursson, P., 2001. CYP3A4, CYP3A5, and MDR1 in human small and large intestinal cell lines suitable for drug transport studies. J. Pharm. Sci. 90, 1736–1751. Eriksson, J.E., Brautigan, D.L., Vallee, R., Olmsted, J., Fujiki, H., Goldman, R.D., 1992. Cytoskeletal integrity in interphase cells requires protein phosphatase activity. Proc. Natl. Acad. Sci. U. S. A. 89, 11093–11097. Ewe, K., 1988. Intestinal transport in constipation and diarrhoea. Pharmacology 36 (Suppl. 1), 73–84. Failor, K.L., Desyatnikov, Y., Finger, L.A., Firestone, G.L., 2007. Glucocorticoid-induced degradation of glycogen synthase kinase-3 protein is triggered by serum- and glucocorticoid-induced protein kinase and Akt signaling and controls beta-catenin dynamics and tight junction formation in mammary epithelial tumor cells. Mol. Endocrinol. 21, 2403–2415. Fanning, A.S., Jameson, B.J., Jesaitis, L.A., Anderson, J.M., 1998. The tight junction protein ZO- 1 establishes a link between the transmembrane protein occludin and the actin cytoskeleton. J. Biol. Chem. 273, 29745–29753. Ferron, P.J., Hogeveen, K., Fessard, V., Le Hegarat, L., 2014. Comparative analysis of the cytotoxic effects of okadaic acid-group toxins on human intestinal cell lines. Mar Drugs 12, 4616–4634. Ferron, P.J., Hogeveen, K., De Sousa, G., Rahmani, R., Dubreil, E., Fessard, V., Le Hegarat, L., 2016. Modulation of CYP3A4 activity alters the cytotoxicity of lipophilic phycotoxins in human hepatic HepaRG cells. Toxicol. in Vitro 33, 136–146. Fessard, V., Grosse, Y., Pfohl-Leszkowicz, A., Puiseux-Dao, S., 1996. Okadaic acid treatment induces DNA adduct formation in BHK21 C13 fibroblasts and HESV keratinocytes. Mutat. Res. 361, 133–141. Fiorentini, C., Matarrese, P., Fattorossi, A., Donelli, G., 1996. Okadaic acid induces changes in the organization of F-actin in intestinal cells. Toxicon 34, 937–945. Furuse, M., Itoh, M., Hirase, T., Nagafuchi, A., Yonemura, S., Tsukita, S., Tsukita, S., 1994. Direct association of occludin with ZO-1 and its possible involvement in the localization of occludin at tight junctions. J. Cell Biol. 127, 1617–1626. Gonzalez-Mariscal, L., Betanzos, A., Nava, P., Jaramillo, B.E., 2003. Tight junction proteins. Prog. Biophys. Mol. Biol. 81, 1–44. Guo, F.J., An, T.Y., Rein, K.S., 2010. The algal hepatoxoxin okadaic acid is a substrate for human cytochromes CYP3A4 and CYP3A5. Toxicon 55, 325–332. Guzman, M., Castro, J., 1991. Okadaic acid stimulates carnitine palmitoyltransferase I activity and palmitate oxidation in isolated rat hepatocytes. FEBS Lett. 291, 105–108. Hallegraeff, G.M., 1993. A review of harmful algal blooms and their apparent global increase. Phycologia 32, 79–99. Hering, N.A., Andres, S., Fromm, A., van Tol, E.A., Amasheh, M., Mankertz, J., Fromm, M., Schulzke, J.D., 2011. Transforming growth factor-beta, a whey protein component, strengthens the intestinal barrier by upregulating claudin-4 in HT-29/B6 cells. J. Nutr. 141, 783–789. Ikenouchi, J., Matsuda, M., Furuse, M., Tsukita, S., 2003. Regulation of tight junctions during the epithelium-mesenchyme transition: direct repression of the gene expression of claudins/occludin by Snail. J. Cell Sci. 116, 1959–1967. Ito, E., Yasumoto, T., Takai, A., Imanishi, S., Harada, K., 2002. Investigation of the distribution and excretion of okadaic acid in mice using immunostaining method. Toxicon 40, 159–165.

159

Toxicology in Vitro 58 (2019) 150–160

J. Dietrich, et al.

occurrence. Environ. Health Perspect. 108 (Suppl. 1), 133–141. Van Itallie, C.M., Gambling, T.M., Carson, J.L., Anderson, J.M., 2005. Palmitoylation of claudins is required for efficient tight-junction localization. J. Cell Sci. 118, 1427–1436. Van Itallie, C.M., Tietgens, A.J., Anderson, J.M., 2017. Visualizing the dynamic coupling of claudin strands to the actin cytoskeleton through ZO-1. Mol. Biol. Cell 28, 524–534. Willott, E., Balda, M.S., Fanning, A.S., Jameson, B., Van Itallie, C., Anderson, J.M., 1993. The tight junction protein ZO-1 is homologous to the Drosophila discs-large tumor suppressor protein of septate junctions. Proc. Natl. Acad. Sci. U. S. A. 90, 7834–7838. Yano, Y., Sakon, M., Kambayashi, J., Kawasaki, T., Senda, T., Tanaka, K., Yamada, F., Shibata, N., 1995. Cytoskeletal reorganization of human platelets induced by the protein phosphatase 1/2 A inhibitors okadaic acid and calyculin A. Biochem. J. 307, 439–449 Pt 2. Yasuda, T., Saegusa, C., Kamakura, S., Sumimoto, H., Fukuda, M., 2012. Rab27 effector Slp2-a transports the apical signaling molecule podocalyxin to the apical surface of MDCK II cells and regulates claudin-2 expression. Mol. Biol. Cell 23, 3229–3239. Yasumoto, T., Oshima, Y., Yamaguchi, M., 1978. Occurrence of a new type of shellfish poisoning in Tohoku District. Bull. Jpn. Soc. Sci. Fish. 44, 1249–1255.

Stevenson, B.R., Siliciano, J.D., Mooseker, M.S., Goodenough, D.A., 1986. Identification of ZO- 1: a high molecular weight polypeptide associated with the tight junction (zonula occludens) in a variety of epithelia. J. Cell Biol. 103, 755–766. Suganuma, M., Fujiki, H., Suguri, H., Yoshizawa, S., Hirota, M., Nakayasu, M., Ojika, M., Wakamatsu, K., Yamada, K., Sugimura, T., 1988. Okadaic acid: an additional nonphorbol-12-tetradecanoate-13-acetate-type tumor promoter. Proc. Natl. Acad. Sci. U. S. A. 85, 1768–1771. Suganuma, M., Tatematsu, M., Yatsunami, J., Yoshizawa, S., Okabe, S., Uemura, D., Fujiki, H., 1992. An alternative theory of tissue specificity by tumor promotion of okadaic acid in glandular stomach of SD rats. Carcinogenesis 13, 1841–1845. Tripuraneni, J., Koutsouris, A., Pestic, L., De Lanerolle, P., Hecht, G., 1997. The toxin of diarrheic shellfish poisoning, okadaic acid, increases intestinal epithelial paracellular permeability. Gastroenterology 112, 100–108. Tubaro, A., Sosa, S., Carbonatto, M., Altinier, G., Vita, F., Melato, M., Satake, M., Yasumoto, T., 2003. Oral and intraperitoneal acute toxicity studies of yessotoxin and homoyessotoxins in mice. Toxicon 41, 783–792. Turksen, K., Troy, T.C., 2004. Barriers built on claudins. J. Cell Sci. 117, 2435–2447. Vale, C., Botana, L.M., 2008. Marine toxins and the cytoskeleton: okadaic acid and dinophysistoxins. FEBS J. 275, 6060–6066. Van Dolah, F.M., 2000. Marine algal toxins: origins, health effects, and their increased

160