- Email: [email protected]
The MCP-8 gene and its possible association with resistance to Streptococcus agalactiae in tilapia
Fish & Shellfish Immunology 40 (2014) 331e336
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
The MCP-8 gene and its possible association with resistance to Streptococcus agalactiae in tilapia Gui Hong Fu a, 1, Zi Yi Wan a, 1, Jun Hong Xia a, Feng Liu a, Xiao Jun Liu a, Gen Hua Yue a, b, * a b
Molecular Population Genetics Group, Temasek Life Sciences Laboratory, 1 Research Link, National University of Singapore, Singapore 117604, Singapore Department of Biological Sciences, National University of Singapore, 14 Science Drive 4, Singapore 117543, Singapore
a r t i c l e i n f o
a b s t r a c t
Article history: Received 16 May 2014 Received in revised form 8 July 2014 Accepted 9 July 2014 Available online 17 July 2014
Mast cell proteases play an important role in the regulation of the immune response. We identified the cDNA of the mast cell protease 8 (MCP-8) gene and analyzed its genomic structure in tilapia. The ORF of the MCP-8 was 768 bp, encoding 255 amino acids. Quantitative real-time PCR revealed that the MCP-8 gene was expressed predominantly in spleen, moderately in liver, blood, brain, gill, intestine, skin, and weakly expressed in kidney, muscle and eye. After a challenge with Streptococcus agalactiae, the gene was induced significantly (p < 0.05) in intestine, kidney, spleen and liver. Furthermore, we identified five single nucleotide polymorphisms (SNPs) in the MCP-8 gene and found that three SNPs were significantly associated (p < 0.05) with resistance against S. agalactiae. However, we found no association between four SNPs and growth traits (p > 0.05). These results suggest that the MCP-8 gene play an important role in the resistance to S. agalactiae in tilapia. The SNP markers in the MCP-8 gene associated with the resistance to the bacterial pathogen may facilitate selection of tilapia resistant to the bacterial disease. © 2014 Elsevier Ltd. All rights reserved.
Keywords: Mast cell protease SNP Streptococcus agalactiae Tilapia
1. Introduction Tilapia is the common name for a group of cichlid fish native to North Africa and the Middle East [1,2]. Tilapia is the third most important aquaculture fish species in the world. Selective breeding for growth traits started in 1980s, leading to a substantial improvement in growth performance [3]. Diseases are the major bottleneck for sustainable and profitable aquaculture [4]. Streptococcus agalactiae (S. agalactiae) is one of the causative agents associated with warm-water streptococcosis, which causes massive mortality in aquaculture [5]. The emergence of this disease in tilapia farms usually occurs during high temperature season, which causes tilapia to be more susceptible towards streptococcosis [6]. Interactions between fish and pathogens, that may be harmless under natural conditions, often result in serious disease outbreak in aquaculture systems. Moreover, there are not many effective approaches in conventional breeding for resistance against this disease. Marker-assisted breeding for disease-
* Corresponding author. Temasek Life Sciences Laboratory, 1 Research Link, National University of Singapore, Singapore 117604, Singapore. Tel.: þ65 68727405; fax: þ65 68727007. E-mail address: [email protected] (G.H. Yue). 1 Equal contribution. http://dx.doi.org/10.1016/j.fsi.2014.07.019 1050-4648/© 2014 Elsevier Ltd. All rights reserved.
resistance traits is believed to be an effective method for preventing disease outbreak [7e9]. DNA markers associated with disease resistance are essential in marker-assisted breeding for accelerating genetic improvement for disease resistance. Single nucleotide polymorphisms (SNPs) markers are the markers of choice for many genetic studies because they are abundant in genomes, and can be genotyped by many methods [10]. SNPs in immune genes may be related to the resistance of hosts against pathogens [11e13]. However, DNA markers associated with disease resistance were only identified in a few aquaculture species, such as salmon [14], rainbow trout [15], Asian seabass [16], Japanese flounder [7] and Penaeus chinesis [17]. Therefore, to perform marker-assisted breeding for disease resistance in fish, it is essential to study more immune related candidate genes and to examine whether the polymorphisms in these genes are associated with disease resistance. Mast cells are resident cells in several types of tissues and contain many granules rich in histamine and heparin. Mast cells are well known for their role in allergic and anaphylactic reactions, as well as their involvement in innate and acquired immunity, as well as inflammatory disease [18,19]. Mast cell proteases are major components in secretory granules of these mature mast cells. Many of them are stored in membrane-enclosed intracellular granules until liberated by degranulating stimuli, which includes crosslinking of high affinity IgE receptor F(c)εRI by IgE bound to
332
G.H. Fu et al. / Fish & Shellfish Immunology 40 (2014) 331e336
multivalent allergen [20]. Mast cell protease dependent proteolysis is critical to host defense against invading pathogens [21]. It also participates in beneficial functions, most with regards to their role in innate immune response against parasitic infestations, bacterial infections and down-regulation of adaptive immunity [20,22,23]. However, limited information regarding mast cell proteases in fish is available. The purposes of this study were to characterize the mast cell protease 8 gene and to examine whether SNPs in the gene were associated with the resistance to the pathogen infection in tilapia. We identified the cDNA of the MCP-8 gene in tilapia and analyzed its genomic structure and expression profiles in normal individuals and individuals challenged with S. agalactiae at different time-points. We also identified SNPs in the MCP-8 gene, and detected significant associations between SNPs in the MCP-8 gene and resistance to S. agalactiae in tilapia. This study will provide new insight on the immunity function of MCP-8 in tilapia and supply DNA markers for disease-resistant selection in tilapia breeding programs. 2. Materials and methods 2.1. Fishes and ethics statement Tilapia individuals were cultured in a fish farm in Singapore. Four hundred forty-five individuals of tilapia at the age of 75 days posthatch (dph) with an average body weight of 25.00 ± 2.68 g were used. The fishes were transported to a large tank containing 500 L freshwater located in the animal house of our institute three weeks before the commencement of the experiment. The fishes were maintained in the large tank, and were fed twice daily with pellet feed (Biomar, Nersac, France). All handling of fishes was conducted in accordance with the guidelines on the care and use of animals for scientific purposes set up by the Institutional Animal Care and Use Committee (IACUC) of the Temasek Life Sciences Laboratory, Singapore. The IACUC has specially approved this study within the project “Breeding of Tilapia” (approval number TLL (F)12-004). 2.2. Identification of the MCP-8 cDNA and genomic DNA sequences The cDNA sequence (Genbank no. XM_005478749) of the MCP-8 gene of tilapia was downloaded from NCBI database. Genomic DNA sequence was derived from the assembled Nile tilapia genome sequence by blasting the cDNA sequence against the genome sequence of the Nile tilapia available at (http://www.ensembl.org/ Oreochromis_niloticus/blastview). The sequence was used to design primers (details see Table 1) for confirming the cDNA and genomic DNA sequences, identifying of SNPs of genomic DNA and analyzing mRNA expression, respectively. The primer pairs MCP8G-F1R1 and MCP-8G-F2R1 was used in confirming the cDNA,
Table 1 Primers used for characterizing the MCP-8 gene in tilapia. Name
Primer sequence
Ta Product Purpose (oC) length (bp)
MCP-8RT-F1 MCP-8RT-R1 b-actin F1 b-actin R1 MCP-8G1-F1
CGGGTTAGCTGTTGGCATTGT AAGCAAGCAGAGAAAACCACTTCA TGACCCAGATCATGTTCGAGAC GTGGTGGTGAAGGAGTAGCC TCACCTCGACACTCCTACAAACAC
55
198
qRT-PCR
60
253
qRT-PCR
55
1275
Genomic DNA
MCP-8G1-R1 ACAAAGCAAGCAGAGAAAACCACT MCP-8G1-F2 ATGCTCGGTCTGCAGAAAATCCTG 55
1167
SNP detection
MCP-8G1-R1 ACAAAGCAAGCAGAGAAAACCACT
genomic DNA sequencing and in detecting SNPs in the MCP-8 gene, respectively. 2.3. RNA extraction, cDNA synthesis and quantitative real-time RTPCR In order to determine the tissue specific expression of MCP-8 mRNA, total RNA from five individuals was isolated from various tissues including spleen, blood, brain, gill, intestine, liver, skin, kidney, muscle and eye. To determine the temperate expression profile in liver, spleen, kidney and intestine after challenging with S. agalactiae bacteria, we used quantitative real-time PCR (qRT-PCR) with the primer pair MCP-8RT-F1R1 (Table 1) to analyze the mRNA distribution in these samples. b-actin (Primers b-actin F1 and R1, sequences see Table 1) was used as the reference gene based on previous demonstration of its stability [24]. PCR amplification was done in a total volume of 20 ml containing 1 MaximaTM SYBR Green qPCR Master Mix (Fermentas, PA, USA), 0.2 ml (10 mM) of each primer and 1 ml template cDNA. The cycling conditions consisted of an initial, single cycle of 10 min at 95 C followed by 40 cycles of 15 s at 95 C, 30 s at 56 C and 20 s at 72 C. PCRs were performed in triplicates. The transcription level of MCP-8 was analyzed using DDCT method [25]. 2.4. Bacterial challenge and sampling 2.4.1. Bacterial strains and culture conditions S. agalactiae strain ATCC® 624™ (ATTC, VA, USA) was grown in brain-heart infusion broth (Oxoid, Hampshire, UK) in a shaking incubator at 37 C for 24 h. The concentration of the incubated bacterium determined was 1.0 108 CFU/ml. 2.4.2. Bacterial challenge and sampling for studying gene regulation Fifty-six disease-free fish weighing 25.0 ± 0.2 g were used in this experiment. In the challenge experiment, each fish was injected intraperitoneally with 0.1 ml of S. agalactiae of 106 CFU/ml. Then the fish were placed into a tank containing fresh water at 28 C. Sampling was performed 1, 3, 6, 12, 24, 48 and 72 h after challenge, with four fishes sampled in each time point. Fishes without any challenge were used as control. Liver, spleen, kidney and intestine were sampled and kept in liquid nitrogen for total RNA extraction. This was because the spleen and kidney are systemic immune organs while the intestine is one of the important mucosal immune organs and liver is the detoxification organ in fish. 2.4.3. Bacterial challenge and sampling for SNP analysis Three hundred and eighty four disease-free fish weighing 25.8 ± 0.75 g were use in this experiment. Tilapias were challenged by immersion exposure with approximately 105 viable bacteria ml1 tank water for 2 h in a 0.15-ton tank. Dissolved oxygen levels (ca. 5e7 ml/L) were maintained throughout the exposure procedure. After an exposure period of 2 h, the fish were removed and placed into their respective aquaria and maintained at 28 C in fresh water. Mortalities were recorded for 14 days after infection. The dead fish were removed and recorded daily. The fin clips of all the dead fish were collected and preserved in 75% ethanol. We observed over a 14-day period, and collected fins from the surviving fish as resistant individuals against S. agalactiae disease. DNA was extracted with the method described by Yue and Orban [26]. 2.5. Identification and genotyping of SNPs in the MCP-8 gene To identify SNPs in the MCP-8 gene, one pair of primers (MCP8G-F2 and R1, See Table 1) were designed using PrimerSelect
G.H. Fu et al. / Fish & Shellfish Immunology 40 (2014) 331e336
(DNAstar, WI, USA) to amplify the genomic DNA of tilapia. PCR was conducted using the following program: 3 min at 94 C followed by 36 cycles of 30 s at 94 C, 30 s at 55 C and 1.5 min at 72 C and final step at 72 C for 6 min. The genotyping of 5 SNPs was conducted by directly sequencing the PCR products in both directions with the primers MCP-8G-F2, R1 and BigDye chemicals (ABI, CA, USA) using an ABI 3730xl sequencer (ABI, CA, USA). SNP genotypes were analyzed by using the software Sequencher (Genecodes, MA, USA). The marker genotypes were deposited in our database of marker genotypes of tilapia for later analysis of associations between markers and traits. 2.6. Analysis of the associations of the SNPs in MCP-8 gene with the resistance against S. agalactiae In order to examine whether the SNPs in MCP-8 were associated with resistance towards streptococcosis agalactiae, we collected fin clips from 214 individuals susceptible to the disease and 170 individuals resistant to the disease for genotyping of MCP-8. We genotyped the surviving and dead individuals after challenging tilapia with S. agalactiae by PCR amplication and direct sequencing the genomic sequences of the MCP-8 gene as described above. The Statistical Program for Social Science (SPSS) (SPSS Inc., Chicago, IL, USA) version 1.0 was used for data analysis. The genotype frequency and allele frequency were compared in the susceptible and resistant individuals collected. 2.7. Analysis of the association of the SNPs in the MCP-8 gene with growth traits A population including 270 individuals was used for analyzing associations between growth traits and SNPs in the MCP-8 gene. Fish were raised in the marine fish facility of Temasek Life Science laboratory. Individuals were raised communally in big tanks and maintained on strict feeding regimes until 140 dph. Body weight, standard length and total length data were measured at 140 dph. Fulton's condition factor K (KTL and SKL) was calculated based on BW, TL and SL. Fin clips were sampled from each individual, and stored in 100% ethanol for subsequent DNA extraction with the method described by Yue and Orban [26]. All individuals were genotyped by PCR amplification and sequencing the genomic DNA of the MCP-8 gene as described above. Allele frequency for all of the SNPs was statistically assessed using Haploview software package [27] (version 4.2; http://www.broad.mit.edu/mpg/haploview). Association between MCP-8 SNPs and quantitative traits were analyzed with SPSS 19.0 program.
333
MCP-8 gene contained a 768 bp open reading frame (ORF) that translated into a putative peptide of 255 amino acid residues. The amino acid sequence showed a similarity of 50e73% with that of the mouse, dogs, human and Maylandia zebra [28e30]. The genomic sequence of MCP-8 gene from the transcriptional start site to the transcriptional end site was 1167 bp. It comprised of five exons (58, 151, 133, 259, 167 bp, respectively) and four introns (78, 97, 128, 96 bp, respectively) (Fig. 1). 3.2. Expression pattern of the MCP-8 gene in normal individuals The expression of the MCP-8 gene was detected in all ten tissues of normal individuals using qRT-PCR, including spleen, blood, brain, gill, intestine, liver, skin, kidney, muscle and eye (Fig. 2). The expression level of the MCP-8 gene in the eye was defined as 1. The expression levels in other tissues were presented as a ratio to the expression in the eye. The spleen displayed the most abundant expression levels, with over 164.8-fold when compared with the eye. It is then followed by blood (24.5), brain (24.5), gill (16.7), intestine (16.5), liver (15.5), skin (8.3), kidney (2.7) and muscle (1.7). 3.3. Expression profiles of the MCP-8 gene after a challenge with S. agalactiae The MCP-8 gene was induced in different time-points in liver, spleen, kidney and intestine (Fig. 3) after a challenge with the bacteria. It was significantly up-regulated post S. agalactiae infection and reached the highest expression level at 3 h (97.8-fold, p < 0.05) in the intestine, and then mRNA level reduced to normal level at other time-points. In liver, MCP-8 expression peaked at 3 h (12.8-fold, p < 0.05) post S. agalactiae challenge, with significant difference compared with the control (p < 0.05). In the spleen, the expression of the MCP-8 gene was significantly up-regulated post S. agalactiae infection and reached the highest level at 24 h (21.4fold, p < 0.05), with significant difference compared with the control (p < 0.05). In kidney, the expression of MCP-8 peaked at 48 h (48.5-fold, p < 0.05) with significant difference compared with the control (p < 0.05). In a period of 48 h after the S. agalactiae challenge, the highest expression of the MCP-8 gene was seen in intestine, followed by kidney, spleen and liver. 3.4. Identification of SNPs in the MCP-8 gene Five SNPs were identified in the MCP-8 gene in 10 individuals from different mass crosses. SNP1 g.318 C > T was located in intron 2. SNP2 g.483 G > A and SNP3 g.489 G > C were located in exon 3.
2.8. Mapping the MCP-8 gene to the genome of tilapia The cDNA sequence of the MCP-8 gene was blasted against the assembled genome sequence of tilapia (http://www.ensembl.org/ Oreochromis_niloticus/blastview). The hit with the lowest E value was regarded as the position of the gene in the tilapia genome. The scaffold containing the MCP-8 gene was derived and scanned for genes located near the MCP-8 gene using web-based software GENSCAN (http://genes.mit.edu/GENSCAN.html). 3. Results 3.1. Sequence of cDNA and genomic DNA of the MCP-8 gene We identified the cDNA (Genbank no. XM_005478749) and genomic sequences of the MCP-8 gene by using bioinformatic tools. We further confirmed the cDNA and genomic DNA sequences of MCP-8 gene using PCR and sequencing. The full-length cDNA of the
Fig. 1. Exoneintron structure of the MCP-8 gene and positions of known SNP in tilapia. The 1167 bp genomic sequence, intron/exon structure, five SNPs positions of the MCP-8 gene are presented.
334
G.H. Fu et al. / Fish & Shellfish Immunology 40 (2014) 331e336
survival individuals were used to examine whether the SNPs in the MCP-8 gene were associated with the resistance to S. agalactiae. The genotype distributions and allele frequencies of the SNPs in the MCP-8 gene in susceptible and resistant groups of tilapia are shown in Table 2. The results showed that there were significant differences in the SNP genotype distributions and allele frequencies in the SNP1 and SNP2 (p < 0.05) between susceptible and resistant groups. However, both SNP4 and SNP5 have no significant differences between SNP genotypes and alleles distributions (p > 0.05). In contrast, SNP3 has significant difference in genotype distributions, but no difference in allele frequencies (Table 2.) 3.6. Association between SNPs in the MCP-8 gene and growth traits
Fig. 2. Expressions of the MCP-8 gene in different tissues of tilapia. The transcripts of the gene were measured by qRT-PCR. The tissues, including liver, brain, spleen, kidney, gill, eye, intestine, muscle and heart were collected from five individuals tilapia. **: p < 0.01.
In the population where the growth traits of 270 individuals were measured at 140 dph, the five SNPs were polymorphic. The analyses of associations between SNP markers and growth traits revealed that four SNPs were not significantly associated with growth traits. The SNP3 was associated with body weight (Supplementary Table 1).
SNP4 g.664 C > T and SNP5 g.801 C > T were located in exon 4 (Fig. 1). In the alleles (A and G) detected in SNP2, the A to G transversion caused the amino acid Glutamine (Gln/Q) change to Arginine (Arg/R) in the polypeptide sequence. In the alleles (C and G) detected in SNP3, the C to G transversion caused the amino acid Alanine (Ala/A) change to Glycine (Gly/G) in the polypeptide sequence. The remaining three SNPs did not change amino acid sequences in the gene.
3.7. Mapping the MCP-8 gene to the genome of tilapia
3.5. Associations between SNPs in the MCP-8 gene and resistance against S. agalactiae
4. Discussion
After the challenge with S. agalactiae, tilapia exhibited various signs and lesions resembling streptococcosis such as skin or visceral organs hemorrhage, peritonitis and ascites. Fourteen days after the challenge with S. agalactiae, among the 384 individuals, 214 individuals were dead and 170 survived, indicating a death rate of 55.73%. High mortality was seen in the first 48 h after the challenge with the S. agalactiae. All 214 dead individuals and 170
Fig. 3. Relative expression levels of the MCP-8 gene in tilapia challenged with S. agalactiae. The expression of the MCP-8 gene was determined in liver, kidney, spleen and intestine using qRT-PCR. The samples were analyzed at 1 h, 3 h, 6 h, 12 h, 24 h, 48 h and 72 h post-treatment. Expression of b-actin was used as an internal control. Each experiment was performed at least in triplicate. Data are shown as mean ± SE (n ¼ 4). **: p < 0.01.
Using an in-silico mapping method, we mapped the MCP-8 gene to the linkage group 23 of the genome of the Nile tilapia. Near to the linkage location of the MCP-8 gene, we detected some other immune-related genes, including galectin-3-binding protein, kallikrein-11, granzyme K and granzyme B and duodenase-1 in the Scaffold GL831234.1 in the Ensembl Nile tilapia version 75.1 (Orenil1.0).
S. agalactiae is a cause of streptococcosis in many mammalian and fish species. To date, streptococcosis is recognized as a major infectious disease causing significant economic loss in aquaculture. In this study, hybrid tilapia challenged via immersion with S. agalactiae exhibited various signs and lesions resembling streptococcosis such as skin or visceral organs hemorrhage, peritonitis and ascites, suggesting that septicemia conditions occured [31]. Our immersion challenge study showed a high mortality within the first 48 h, and an overall mortality rate of 55.7% in hybrid tilapia. Similar results were reported by others. For example, in Nile and red tilapia, the mortality rate was 40%e58% after an immersion challenge with S. agalactiae for over 10 days [32,33]. Rodkhum et al. reported a mortality of 60% in Nile tilapia when exposed to S. agalactiae [34]. Rapid mortalities occurred after exposure to Streptococcus spp. were also reported from other experimentally infected fish [35,36]. All these data support that S. agalactiae is a serious bacterial pathogen to tilapia, causing high mortality. In this study, we identified the full-length cDNA of the MCP-8 gene with an ORF of 768 bp encoding 255 amino acid residues. It showed an amino acid sequence similarity of 50e73% with that of mouse, dogs, human and Maylandia zebra [28e30]. The low amino acid similarity of the MCP-8 gene in different species suggests a rapid evolution of this gene. Usually, immune-related genes are under positive selection [37], thus evolving more rapidly than other genes. The tilapia MCP-8 gene consisted of five exons and four introns. The genomic structure of the MCP-8 gene was similar in different vertebrate species, such as the mouse [38]. In mammals, mast cell proteinases have been extensively studied [23]. Many studies showed that mast cell proteases may account for many of the effects ascribed to mast cells and are currently emerging as promising candidates for treatment of mast cell driven diseases. Recent studies have highlighted the important
G.H. Fu et al. / Fish & Shellfish Immunology 40 (2014) 331e336
335
Table 2 The allele and genotype distributions of five SNPs in the MCP-8 gene in tilapia susceptible and resistant to Streptococcus agalactiae. SNP
SNP1 CC (N ¼ 58) CT (N ¼ 118) TT (N ¼ 202) SNP2 AA (n ¼ 96) AG (n ¼ 144) GG (n ¼ 116) SNP3 CC (n ¼ 116) CG (n ¼ 162) GG (n ¼ 100) SNP4 CC (n ¼ 48) CT (n ¼ 150) TT (n ¼ 172) SNP5 CC (n ¼ 54) CT (n ¼ 152) TT (n ¼ 178)
Genotype (individual no.)
X2
Allele frequency (%.)
Susceptible
Resistant
X2
Allele
Susceptible
Resistant
26 58 126
32 60 76
8.06 (p < 0.05)
C T
110 310
124 212
19.95 (p < 0.005)
60 82 48
36 62 68
11.32 (p < 0.005)
A G
202 178
134 198
21.83 (p < 0.005)
72 96 44
44 66 56
3.13 (p > 0.05)
C G
240 184
154 178
14.11 (p < 0.005)
22 90 90
26 60 82
3.44 (p > 0.05)
C T
134 270
112 224
0.01 (p > 0.05)
28 90 96
26 62 82
1.16 (p > 0.05)
C T
146 282
114 226
0.05 (p > 0.05)
p < 0.05 is considered to be statistically significant.
role that mast cells play in the protection against infection with a variety of pathogens [39]. However, in fish, not much is known about the functions of genes encoding mast cell proteinases. In this study, MCP-8 mRNA was detected in all tested tissues, including spleen, blood, brain, gill, intestine, liver, skin, kidney, muscle and eye in normal tilapia, suggesting diverse roles of the gene in tilapia. The relatively higher expression levels in immune-related organs (i.e. spleen, liver) suggest that the MCP-8 gene is involved in immune system in tilapia. However, in mouse, MCP-8 mRNA could not be detected in liver, intestine, lung or ears [28]. The specific expression patterns of the gene in different species suggest different functions of the MCP-8 gene in fish and land animals. In order to elucidate some functions of the MCP-8 gene in tilapia in response to a challenge with a bacterial pathogen S. agalactiae, we determined the expression levels of the MCP-8 gene after a challenge with S. agalactiae in four tissues of tilapia, including liver, spleen, kidney and intestine. We found that the expression levels in all four tissues increased 3 h after the challenge with the S. agalactiae by an intraperitoneal injection, further supporting that the MCP-8 gene plays an important role in the innate immune response against bacterial pathogens. We found that the increase of the expression of the MCP-8 gene at 3 h post challenge was much more substantial in liver and intestine than in spleen and kidney. The strongest responses of the MCP-8 gene in spleen and kidney were much later than those in the liver and intestine. The quick response of the MCP-8 genes in intestine and its later response in spleen and kidney are understandable. In this study, the fishes were challenged with S. agalactiae by an intraperitoneal injection. The first organ that contacted the bacteria is most likely the intestine, thus the first induced mucosal immune response starts there, and then followed by the response of systemic immune organs, such as, spleen and kidney. However, it is difficult to understand why the response of the MCP-8 in liver started so early (i.e. 3 h after the challenge). We speculate that the S. agalactiae can invade in liver very quickly. However, further detailed study is required to examine this speculation. SNPs associated with disease resistance could be used in marker-assisted selection to accelerate the genetic improvement [8]. In this study, we identified five SNPs in the MCP-8 gene in tilapia. For the first time, we detected significant associations between three SNPs and the resistance to S. agalactiae in tilapia. We
found that genotype distributions and allele frequencies of SNP1, SNP2 and SNP3 in MCP-8 were significantly different in dead and surviving tilapia after a challenge with the bacterial pathogen S. agalactiae. The SNPs significantly associated with the resistance to S. agalactiae may be used in selection of tilapia resistant to S. agalactiae. We noted that SNP2 and SNP3 detected in MCP-8 changed the sequences of amino acids. However, with our current data, we were not able to know whether these significant associations were due to the mutations in SNP2 and SNP3 or other genes linked to the MCP-8 gene. Therefore, to examine this, it is essential to further study. By using in-silico mapping, we mapped the MCP-8 gene on LG 23 of the tilapia genome. Near to the linkage location of MCP-8 there are other immune-related genes, including galectin-3binding protein, kallikrein-11, granzyme K and granzyme B and duodenase-1. Thus, by QTL mapping in segregating families using more DNA markers on the LG23, it is possible to examine whether the resistance to the bacterial pathogen was caused by the mutations in SNP2 and SNPs in the MCP-8 gene or by linked genes on the LG 23. Certainly, association mapping in populations with a large number of survival and dead individuals after a challenge with S. agalactiae, it is also possible to dissect the phenotypic variation of resistance to S. agalactiae. In this study, we found no significant correlations between four of the five SNPs in the MCP-8 gene and growth traits in tilapia. In Asian seabass, the SNPs in the LECT2 gene associated with resistance to the big belly disease was not associated with growth [16]. It is generally believed that disease resistance was negatively correlated with growth performances [40]. However, a few recent studies showed positive correlations between disease resistance and growth performances in some species. For example, in Atlantic halibut, the interrelationship between growth and resistance to Vibrio anguillarum disease was seen [41]. In Atlantic salmon, a positive correlation between the survival in the Vibrio salmonicida challenge and growth rate were reported [42]. In rainbow trout, significant positive correlations were found for end body weight and resistance to the infectious hematopoietic necrosis (IHN) virus and for early body weight and resistance to bacterial cold water disease (BCWD) [43]. In this study, only the SNP3 in the MCP-8 gene was associated with growth traits. It seems that whether the existence of positive associations between disease resistance and growth performances depends on the nature of diseases and genes.
336
G.H. Fu et al. / Fish & Shellfish Immunology 40 (2014) 331e336
In conclusion, we identified the MCP-8 gene in tilapia, characterized it and mapped it to the genome of tilapia. Our results suggest that the MCP-8 gene plays an important role in innate immunity and also showed that intestine and kidney were the major expression sites for MCP-8 gene. We found significant associations between three SNPs in the MCP-8 gene and resistance against the bacterial pathogen S. agalactiae. In contrast, there was no association between four SNPs in the MCP-8 gene and growth traits. These SNPs associated with resistance against the bacterial pathogen could facilitate the selection of fish resistant to S. agalactiae. Further study on whether SNPs in the MCP-8 are associated with the resistance to other bacterial and viral infections could be useful in understanding more functions of the MCP-8 gene. Acknowledgments This research is supported by the National Research Foundation, Prime Minister's Office, Singapore under its Competitive Research Program (CRP Award No. NRF-CRP002-001). We thank colleagues Mr. Huiming Liu in our group and staff members from TLL's animal house for taking care of fishes, as well as May Lee for editing English. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2014.07.019. References [1] El-Sayed A-FM. Tilapia culture. CABI; 2006. [2] Gupta MV, Acosta BO. A review of global tilapia farming practices. Aqua Asia 2004;9:7e12. [3] Galman O, Moreau J, Avtalion R. Breeding characteristics and growth performance of Philippine red tilapia. In: The second international symposium on Tilapia in aquaculture. WorldFish; 1988. p. 169. [4] Shoemaker C, Xu D, Evans J, Klesius P, Lim C, Webster C. Parasites and diseases. In: Lim C, Webster CD, editors. Tilapia: biology, culture, and nutrition. CABI; 2006. pp. 561e82. [5] Suanyuk N, Kong F, Ko D, Gilbert GL, Supamattaya K. Occurrence of rare genotypes of Streptococcus agalactiae in cultured red tilapia Oreochromis sp. and Nile tilapia O. niloticus in Thailanddrelationship to human isolates? Aquaculture 2008;284:35e40. [6] Amal M, Zamri-Saad M. Streptococcosis in tilapia (Oreochromis niloticus): a review. J Trop Agric Sci 2011;34. [7] Fuji K, Hasegawa O, Honda K, Kumasaka K, Sakamoto T, Okamoto N. Markerassisted breeding of a lymphocystis disease-resistant Japanese flounder (Paralichthys olivaceus). Aquaculture 2007;272:291e5. [8] Yue GH. Recent advances of genome mapping and marker-assisted selection in aquaculture. Fish Fish 2014;15:376e96. [9] Xu TJ, Chen SL, Ji XS, Tian YS. MHC polymorphism and disease resistance to Vibrio anguillarum in 12 selective Japanese flounder (Paralichthys olivaceus) families. Fish Shellfish Immunol 2008;25:213e21. [10] Kwok P-Y. Methods for genotyping single nucleotide polymorphisms. Annu Rev Genomics Hum 2001;2:235e58. [11] Kongchum P, Palti Y, Hallerman EM, Hulata G, David L. SNP discovery and development of genetic markers for mapping innate immune response genes in common carp (Cyprinus carpio). Fish Shellfish Immunol 2010;29: 356e61. [12] Lazarus R, Vercelli D, Palmer LJ, Klimecki WJ, Silverman EK, Richter B, et al. Single nucleotide polymorphisms in innate immunity genes: abundant variation and potential role in complex human disease. Immunol Rev 2002;190: 9e25. € der NW, Schumann RR. Single nucleotide polymorphisms of toll-like [13] Schro receptors and susceptibility to infectious disease. Lancet Infect Dis 2005;5: 156e64. [14] Gheyas A, Haley C, Guy D, Hamilton A, Tinch A, Mota-Velasco J, et al. Effect of a major QTL affecting IPN resistance on production traits in Atlantic salmon. Anim Genet 2010;41:666e8.
[15] Ozaki A, Sakamoto T, Khoo S, Nakamura K, Coimbra M, Akutsu T, et al. Quantitative trait loci (QTLs) associated with resistance/susceptibility to infectious pancreatic necrosis virus (IPNV) in rainbow trout (Oncorhynchus mykiss). Mol Genet Genomics 2001;265:23e31. [16] Fu GH, Bai ZY, Xia JH, Liu XJ, Liu F, GH Y. Characterization of the LECT2 gene and its associations with resistance to the big belly disease in Asian seabass. Fish Shellfish Immunol 2014;37:131e8. [17] Dong S, Kong J, Meng X, Zhang Q, Zhang T, Wang R. Microsatellite DNA markers associated with resistance to WSSV in Penaeus ( Fenneropenaeus) chinensis. Aquaculture 2008;282:138e41. [18] Yu Z, Guo X. Identification and mapping of disease-resistance QTLs in the eastern oyster, Crassostrea virginica Gmelin. Aquaculture 2006;254:160e70. [19] Theoharides TC, Alysandratos K-D, Angelidou A, Delivanis D-A, Sismanopoulos N, Zhang B, et al. Mast cells and inflammation. BBA-Mole Basis Dis 2012;1822:21e33. [20] Caughey GH. Mast cell proteases as protective and inflammatory mediators. Mast cell biology. Springer; 2011. pp. 212e34. [21] Gallwitz M, Enoksson M, Hellman L. Expression profile of novel members of the rat mast cell protease (rMCP)-2 and (rMCP)-8 families, and functional analyses of mouse mast cell protease (mMCP)-8. Immunogenetics 2007;59: 391e405. [22] Pejler G, Åbrink M, Ringvall M, Wernersson S. Mast cell proteases. Adv Immunol 2007;95:167e255. €nnberg E, Waern I, Wernersson S. Mast cell proteases: multifac[23] Pejler G, Ro eted regulators of inflammatory disease. Blood 2010;115:4981e90. [24] Xia JH, He XP, Bai ZY, Lin G, Yue GH. Analysis of the Asian seabass transcriptome based on expressed sequence tags. DNA Res 2011;18:513e22. [25] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2DDCT method. Methods 2001;25:402e8. [26] Yue GH, Orban L. A simple and affordable method for high-throughput DNA extraction from animal tissues for polymerase chain reaction. Electrophoresis 2005;26:3081e3. [27] Barrett JC. Haploview: visualization and analysis of SNP genotype data. Cold Spring Harb Protoc 2009;2009. pdb. ip.71. [28] Lützelschwab C, Huang MR, Kullberg MC, Aveskogh M, Hellman L. Characterization of mouse mast cell protease-8, the first member of a novel subfamily of mouse mast cell serine proteases, distinct from both the classical chymases and tryptases. Eur J Immunol 1998;28:1022e33. [29] Caughey GH, Raymond WW, Vanderslice P. Dog mast cell chymase: molecular cloning and characterization. Biochemistry 1990;29:5166e71. [30] Vanderslice P, Ballinger SM, Tam EK, Goldstein SM, Craik CS, Caughey GH. Human mast cell tryptase: multiple cDNAs and genes reveal a multigene serine protease family. Proc Natl Acad Sci 1990;87:3811e5. [31] Austin B, Austin DDA. Bacterial fish pathogens: diseases of farmed and wild fish. Springer; 2007. [32] Mian G, Godoy D, Leal C, Yuhara T, Costa G, Figueiredo H. Aspects of the natural history and virulence of S. agalactiae infection in Nile tilapia. Vet Microbiol 2009;136:180e3. [33] Ng WK, Koh CB, Sudesh K, Siti-Zahrah A. Effects of dietary organic acids on growth, nutrient digestibility and gut microflora of red hybrid tilapia, Oreochromis sp., and subsequent survival during a challenge test with Streptococcus agalactiae. Aquacult Res 2009;40:1490e500. [34] Rodkhum C, Pirarat PKN. Effect of water temperature on susceptibility to Streptococcus agalactiae serotype Ia infection in nile Tilapia (Oreochromis niloticus). Thai J Vet Med 2011;41:309e14. [35] Boomker J, Imes Jr G, Cameron C, Naude T, Schoonbee H. Trout mortalities as a result of Streptococcus infection. Am J Vet Res 1979;46:71e7. [36] Minami T. Streptococcus sp., pathogenic to cultured yellowtail, isolated from fishes for diets. Fish Pathol 1979;14. [37] Nielsen R, Bustamante C, Clark AG, Glanowski S, Sackton TB, Hubisz MJ, et al. A scan for positively selected genes in the genomes of humans and chimpanzees. Plos Biol 2005;3:e170. [38] Lunderius C, Hellman L. Characterization of the gene encoding mouse mast cell protease 8 (mMCP-8), and a comparative analysis of hematopoietic serine protease genes. Immunogenetics 2001;53:225e32. [39] Urb M, Sheppard DC. The role of mast cells in the defence against pathogens. PloS Patho 2012;8:e1002619. [40] Axford R, Bishop S, Nicholas F, Owen J. Breeding for disease resistance in farm animals. CABI publishing; 2000. [41] Imsland AK, Jonassen TM, Langston A, Hoare R, Wergeland H, FitzGerald R, et al. The interrelation of growth and disease resistance of different populations of juvenile Atlantic halibut (Hippoglossus hippoglossus L.). Aquaculture 2002;204:167e77. [42] Standal M, Gjerde B. Genetic variation in survival of Atlantic salmon during the sea-rearing period. Aquaculture 1987;66:197e207. [43] Overturf K, LaPatra S, Towner R, Campbell N, Narum S. Relationships between growth and disease resistance in rainbow trout, Oncorhynchus mykiss (Walbaum). J Fish Dis 2010;33:321e9.
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
The MCP-8 gene and its possible association with resistance to Streptococcus agalactiae in tilapia Gui Hong Fu a, 1, Zi Yi Wan a, 1, Jun Hong Xia a, Feng Liu a, Xiao Jun Liu a, Gen Hua Yue a, b, * a b
Molecular Population Genetics Group, Temasek Life Sciences Laboratory, 1 Research Link, National University of Singapore, Singapore 117604, Singapore Department of Biological Sciences, National University of Singapore, 14 Science Drive 4, Singapore 117543, Singapore
a r t i c l e i n f o
a b s t r a c t
Article history: Received 16 May 2014 Received in revised form 8 July 2014 Accepted 9 July 2014 Available online 17 July 2014
Mast cell proteases play an important role in the regulation of the immune response. We identified the cDNA of the mast cell protease 8 (MCP-8) gene and analyzed its genomic structure in tilapia. The ORF of the MCP-8 was 768 bp, encoding 255 amino acids. Quantitative real-time PCR revealed that the MCP-8 gene was expressed predominantly in spleen, moderately in liver, blood, brain, gill, intestine, skin, and weakly expressed in kidney, muscle and eye. After a challenge with Streptococcus agalactiae, the gene was induced significantly (p < 0.05) in intestine, kidney, spleen and liver. Furthermore, we identified five single nucleotide polymorphisms (SNPs) in the MCP-8 gene and found that three SNPs were significantly associated (p < 0.05) with resistance against S. agalactiae. However, we found no association between four SNPs and growth traits (p > 0.05). These results suggest that the MCP-8 gene play an important role in the resistance to S. agalactiae in tilapia. The SNP markers in the MCP-8 gene associated with the resistance to the bacterial pathogen may facilitate selection of tilapia resistant to the bacterial disease. © 2014 Elsevier Ltd. All rights reserved.
Keywords: Mast cell protease SNP Streptococcus agalactiae Tilapia
1. Introduction Tilapia is the common name for a group of cichlid fish native to North Africa and the Middle East [1,2]. Tilapia is the third most important aquaculture fish species in the world. Selective breeding for growth traits started in 1980s, leading to a substantial improvement in growth performance [3]. Diseases are the major bottleneck for sustainable and profitable aquaculture [4]. Streptococcus agalactiae (S. agalactiae) is one of the causative agents associated with warm-water streptococcosis, which causes massive mortality in aquaculture [5]. The emergence of this disease in tilapia farms usually occurs during high temperature season, which causes tilapia to be more susceptible towards streptococcosis [6]. Interactions between fish and pathogens, that may be harmless under natural conditions, often result in serious disease outbreak in aquaculture systems. Moreover, there are not many effective approaches in conventional breeding for resistance against this disease. Marker-assisted breeding for disease-
* Corresponding author. Temasek Life Sciences Laboratory, 1 Research Link, National University of Singapore, Singapore 117604, Singapore. Tel.: þ65 68727405; fax: þ65 68727007. E-mail address: [email protected] (G.H. Yue). 1 Equal contribution. http://dx.doi.org/10.1016/j.fsi.2014.07.019 1050-4648/© 2014 Elsevier Ltd. All rights reserved.
resistance traits is believed to be an effective method for preventing disease outbreak [7e9]. DNA markers associated with disease resistance are essential in marker-assisted breeding for accelerating genetic improvement for disease resistance. Single nucleotide polymorphisms (SNPs) markers are the markers of choice for many genetic studies because they are abundant in genomes, and can be genotyped by many methods [10]. SNPs in immune genes may be related to the resistance of hosts against pathogens [11e13]. However, DNA markers associated with disease resistance were only identified in a few aquaculture species, such as salmon [14], rainbow trout [15], Asian seabass [16], Japanese flounder [7] and Penaeus chinesis [17]. Therefore, to perform marker-assisted breeding for disease resistance in fish, it is essential to study more immune related candidate genes and to examine whether the polymorphisms in these genes are associated with disease resistance. Mast cells are resident cells in several types of tissues and contain many granules rich in histamine and heparin. Mast cells are well known for their role in allergic and anaphylactic reactions, as well as their involvement in innate and acquired immunity, as well as inflammatory disease [18,19]. Mast cell proteases are major components in secretory granules of these mature mast cells. Many of them are stored in membrane-enclosed intracellular granules until liberated by degranulating stimuli, which includes crosslinking of high affinity IgE receptor F(c)εRI by IgE bound to
332
G.H. Fu et al. / Fish & Shellfish Immunology 40 (2014) 331e336
multivalent allergen [20]. Mast cell protease dependent proteolysis is critical to host defense against invading pathogens [21]. It also participates in beneficial functions, most with regards to their role in innate immune response against parasitic infestations, bacterial infections and down-regulation of adaptive immunity [20,22,23]. However, limited information regarding mast cell proteases in fish is available. The purposes of this study were to characterize the mast cell protease 8 gene and to examine whether SNPs in the gene were associated with the resistance to the pathogen infection in tilapia. We identified the cDNA of the MCP-8 gene in tilapia and analyzed its genomic structure and expression profiles in normal individuals and individuals challenged with S. agalactiae at different time-points. We also identified SNPs in the MCP-8 gene, and detected significant associations between SNPs in the MCP-8 gene and resistance to S. agalactiae in tilapia. This study will provide new insight on the immunity function of MCP-8 in tilapia and supply DNA markers for disease-resistant selection in tilapia breeding programs. 2. Materials and methods 2.1. Fishes and ethics statement Tilapia individuals were cultured in a fish farm in Singapore. Four hundred forty-five individuals of tilapia at the age of 75 days posthatch (dph) with an average body weight of 25.00 ± 2.68 g were used. The fishes were transported to a large tank containing 500 L freshwater located in the animal house of our institute three weeks before the commencement of the experiment. The fishes were maintained in the large tank, and were fed twice daily with pellet feed (Biomar, Nersac, France). All handling of fishes was conducted in accordance with the guidelines on the care and use of animals for scientific purposes set up by the Institutional Animal Care and Use Committee (IACUC) of the Temasek Life Sciences Laboratory, Singapore. The IACUC has specially approved this study within the project “Breeding of Tilapia” (approval number TLL (F)12-004). 2.2. Identification of the MCP-8 cDNA and genomic DNA sequences The cDNA sequence (Genbank no. XM_005478749) of the MCP-8 gene of tilapia was downloaded from NCBI database. Genomic DNA sequence was derived from the assembled Nile tilapia genome sequence by blasting the cDNA sequence against the genome sequence of the Nile tilapia available at (http://www.ensembl.org/ Oreochromis_niloticus/blastview). The sequence was used to design primers (details see Table 1) for confirming the cDNA and genomic DNA sequences, identifying of SNPs of genomic DNA and analyzing mRNA expression, respectively. The primer pairs MCP8G-F1R1 and MCP-8G-F2R1 was used in confirming the cDNA,
Table 1 Primers used for characterizing the MCP-8 gene in tilapia. Name
Primer sequence
Ta Product Purpose (oC) length (bp)
MCP-8RT-F1 MCP-8RT-R1 b-actin F1 b-actin R1 MCP-8G1-F1
CGGGTTAGCTGTTGGCATTGT AAGCAAGCAGAGAAAACCACTTCA TGACCCAGATCATGTTCGAGAC GTGGTGGTGAAGGAGTAGCC TCACCTCGACACTCCTACAAACAC
55
198
qRT-PCR
60
253
qRT-PCR
55
1275
Genomic DNA
MCP-8G1-R1 ACAAAGCAAGCAGAGAAAACCACT MCP-8G1-F2 ATGCTCGGTCTGCAGAAAATCCTG 55
1167
SNP detection
MCP-8G1-R1 ACAAAGCAAGCAGAGAAAACCACT
genomic DNA sequencing and in detecting SNPs in the MCP-8 gene, respectively. 2.3. RNA extraction, cDNA synthesis and quantitative real-time RTPCR In order to determine the tissue specific expression of MCP-8 mRNA, total RNA from five individuals was isolated from various tissues including spleen, blood, brain, gill, intestine, liver, skin, kidney, muscle and eye. To determine the temperate expression profile in liver, spleen, kidney and intestine after challenging with S. agalactiae bacteria, we used quantitative real-time PCR (qRT-PCR) with the primer pair MCP-8RT-F1R1 (Table 1) to analyze the mRNA distribution in these samples. b-actin (Primers b-actin F1 and R1, sequences see Table 1) was used as the reference gene based on previous demonstration of its stability [24]. PCR amplification was done in a total volume of 20 ml containing 1 MaximaTM SYBR Green qPCR Master Mix (Fermentas, PA, USA), 0.2 ml (10 mM) of each primer and 1 ml template cDNA. The cycling conditions consisted of an initial, single cycle of 10 min at 95 C followed by 40 cycles of 15 s at 95 C, 30 s at 56 C and 20 s at 72 C. PCRs were performed in triplicates. The transcription level of MCP-8 was analyzed using DDCT method [25]. 2.4. Bacterial challenge and sampling 2.4.1. Bacterial strains and culture conditions S. agalactiae strain ATCC® 624™ (ATTC, VA, USA) was grown in brain-heart infusion broth (Oxoid, Hampshire, UK) in a shaking incubator at 37 C for 24 h. The concentration of the incubated bacterium determined was 1.0 108 CFU/ml. 2.4.2. Bacterial challenge and sampling for studying gene regulation Fifty-six disease-free fish weighing 25.0 ± 0.2 g were used in this experiment. In the challenge experiment, each fish was injected intraperitoneally with 0.1 ml of S. agalactiae of 106 CFU/ml. Then the fish were placed into a tank containing fresh water at 28 C. Sampling was performed 1, 3, 6, 12, 24, 48 and 72 h after challenge, with four fishes sampled in each time point. Fishes without any challenge were used as control. Liver, spleen, kidney and intestine were sampled and kept in liquid nitrogen for total RNA extraction. This was because the spleen and kidney are systemic immune organs while the intestine is one of the important mucosal immune organs and liver is the detoxification organ in fish. 2.4.3. Bacterial challenge and sampling for SNP analysis Three hundred and eighty four disease-free fish weighing 25.8 ± 0.75 g were use in this experiment. Tilapias were challenged by immersion exposure with approximately 105 viable bacteria ml1 tank water for 2 h in a 0.15-ton tank. Dissolved oxygen levels (ca. 5e7 ml/L) were maintained throughout the exposure procedure. After an exposure period of 2 h, the fish were removed and placed into their respective aquaria and maintained at 28 C in fresh water. Mortalities were recorded for 14 days after infection. The dead fish were removed and recorded daily. The fin clips of all the dead fish were collected and preserved in 75% ethanol. We observed over a 14-day period, and collected fins from the surviving fish as resistant individuals against S. agalactiae disease. DNA was extracted with the method described by Yue and Orban [26]. 2.5. Identification and genotyping of SNPs in the MCP-8 gene To identify SNPs in the MCP-8 gene, one pair of primers (MCP8G-F2 and R1, See Table 1) were designed using PrimerSelect
G.H. Fu et al. / Fish & Shellfish Immunology 40 (2014) 331e336
(DNAstar, WI, USA) to amplify the genomic DNA of tilapia. PCR was conducted using the following program: 3 min at 94 C followed by 36 cycles of 30 s at 94 C, 30 s at 55 C and 1.5 min at 72 C and final step at 72 C for 6 min. The genotyping of 5 SNPs was conducted by directly sequencing the PCR products in both directions with the primers MCP-8G-F2, R1 and BigDye chemicals (ABI, CA, USA) using an ABI 3730xl sequencer (ABI, CA, USA). SNP genotypes were analyzed by using the software Sequencher (Genecodes, MA, USA). The marker genotypes were deposited in our database of marker genotypes of tilapia for later analysis of associations between markers and traits. 2.6. Analysis of the associations of the SNPs in MCP-8 gene with the resistance against S. agalactiae In order to examine whether the SNPs in MCP-8 were associated with resistance towards streptococcosis agalactiae, we collected fin clips from 214 individuals susceptible to the disease and 170 individuals resistant to the disease for genotyping of MCP-8. We genotyped the surviving and dead individuals after challenging tilapia with S. agalactiae by PCR amplication and direct sequencing the genomic sequences of the MCP-8 gene as described above. The Statistical Program for Social Science (SPSS) (SPSS Inc., Chicago, IL, USA) version 1.0 was used for data analysis. The genotype frequency and allele frequency were compared in the susceptible and resistant individuals collected. 2.7. Analysis of the association of the SNPs in the MCP-8 gene with growth traits A population including 270 individuals was used for analyzing associations between growth traits and SNPs in the MCP-8 gene. Fish were raised in the marine fish facility of Temasek Life Science laboratory. Individuals were raised communally in big tanks and maintained on strict feeding regimes until 140 dph. Body weight, standard length and total length data were measured at 140 dph. Fulton's condition factor K (KTL and SKL) was calculated based on BW, TL and SL. Fin clips were sampled from each individual, and stored in 100% ethanol for subsequent DNA extraction with the method described by Yue and Orban [26]. All individuals were genotyped by PCR amplification and sequencing the genomic DNA of the MCP-8 gene as described above. Allele frequency for all of the SNPs was statistically assessed using Haploview software package [27] (version 4.2; http://www.broad.mit.edu/mpg/haploview). Association between MCP-8 SNPs and quantitative traits were analyzed with SPSS 19.0 program.
333
MCP-8 gene contained a 768 bp open reading frame (ORF) that translated into a putative peptide of 255 amino acid residues. The amino acid sequence showed a similarity of 50e73% with that of the mouse, dogs, human and Maylandia zebra [28e30]. The genomic sequence of MCP-8 gene from the transcriptional start site to the transcriptional end site was 1167 bp. It comprised of five exons (58, 151, 133, 259, 167 bp, respectively) and four introns (78, 97, 128, 96 bp, respectively) (Fig. 1). 3.2. Expression pattern of the MCP-8 gene in normal individuals The expression of the MCP-8 gene was detected in all ten tissues of normal individuals using qRT-PCR, including spleen, blood, brain, gill, intestine, liver, skin, kidney, muscle and eye (Fig. 2). The expression level of the MCP-8 gene in the eye was defined as 1. The expression levels in other tissues were presented as a ratio to the expression in the eye. The spleen displayed the most abundant expression levels, with over 164.8-fold when compared with the eye. It is then followed by blood (24.5), brain (24.5), gill (16.7), intestine (16.5), liver (15.5), skin (8.3), kidney (2.7) and muscle (1.7). 3.3. Expression profiles of the MCP-8 gene after a challenge with S. agalactiae The MCP-8 gene was induced in different time-points in liver, spleen, kidney and intestine (Fig. 3) after a challenge with the bacteria. It was significantly up-regulated post S. agalactiae infection and reached the highest expression level at 3 h (97.8-fold, p < 0.05) in the intestine, and then mRNA level reduced to normal level at other time-points. In liver, MCP-8 expression peaked at 3 h (12.8-fold, p < 0.05) post S. agalactiae challenge, with significant difference compared with the control (p < 0.05). In the spleen, the expression of the MCP-8 gene was significantly up-regulated post S. agalactiae infection and reached the highest level at 24 h (21.4fold, p < 0.05), with significant difference compared with the control (p < 0.05). In kidney, the expression of MCP-8 peaked at 48 h (48.5-fold, p < 0.05) with significant difference compared with the control (p < 0.05). In a period of 48 h after the S. agalactiae challenge, the highest expression of the MCP-8 gene was seen in intestine, followed by kidney, spleen and liver. 3.4. Identification of SNPs in the MCP-8 gene Five SNPs were identified in the MCP-8 gene in 10 individuals from different mass crosses. SNP1 g.318 C > T was located in intron 2. SNP2 g.483 G > A and SNP3 g.489 G > C were located in exon 3.
2.8. Mapping the MCP-8 gene to the genome of tilapia The cDNA sequence of the MCP-8 gene was blasted against the assembled genome sequence of tilapia (http://www.ensembl.org/ Oreochromis_niloticus/blastview). The hit with the lowest E value was regarded as the position of the gene in the tilapia genome. The scaffold containing the MCP-8 gene was derived and scanned for genes located near the MCP-8 gene using web-based software GENSCAN (http://genes.mit.edu/GENSCAN.html). 3. Results 3.1. Sequence of cDNA and genomic DNA of the MCP-8 gene We identified the cDNA (Genbank no. XM_005478749) and genomic sequences of the MCP-8 gene by using bioinformatic tools. We further confirmed the cDNA and genomic DNA sequences of MCP-8 gene using PCR and sequencing. The full-length cDNA of the
Fig. 1. Exoneintron structure of the MCP-8 gene and positions of known SNP in tilapia. The 1167 bp genomic sequence, intron/exon structure, five SNPs positions of the MCP-8 gene are presented.
334
G.H. Fu et al. / Fish & Shellfish Immunology 40 (2014) 331e336
survival individuals were used to examine whether the SNPs in the MCP-8 gene were associated with the resistance to S. agalactiae. The genotype distributions and allele frequencies of the SNPs in the MCP-8 gene in susceptible and resistant groups of tilapia are shown in Table 2. The results showed that there were significant differences in the SNP genotype distributions and allele frequencies in the SNP1 and SNP2 (p < 0.05) between susceptible and resistant groups. However, both SNP4 and SNP5 have no significant differences between SNP genotypes and alleles distributions (p > 0.05). In contrast, SNP3 has significant difference in genotype distributions, but no difference in allele frequencies (Table 2.) 3.6. Association between SNPs in the MCP-8 gene and growth traits
Fig. 2. Expressions of the MCP-8 gene in different tissues of tilapia. The transcripts of the gene were measured by qRT-PCR. The tissues, including liver, brain, spleen, kidney, gill, eye, intestine, muscle and heart were collected from five individuals tilapia. **: p < 0.01.
In the population where the growth traits of 270 individuals were measured at 140 dph, the five SNPs were polymorphic. The analyses of associations between SNP markers and growth traits revealed that four SNPs were not significantly associated with growth traits. The SNP3 was associated with body weight (Supplementary Table 1).
SNP4 g.664 C > T and SNP5 g.801 C > T were located in exon 4 (Fig. 1). In the alleles (A and G) detected in SNP2, the A to G transversion caused the amino acid Glutamine (Gln/Q) change to Arginine (Arg/R) in the polypeptide sequence. In the alleles (C and G) detected in SNP3, the C to G transversion caused the amino acid Alanine (Ala/A) change to Glycine (Gly/G) in the polypeptide sequence. The remaining three SNPs did not change amino acid sequences in the gene.
3.7. Mapping the MCP-8 gene to the genome of tilapia
3.5. Associations between SNPs in the MCP-8 gene and resistance against S. agalactiae
4. Discussion
After the challenge with S. agalactiae, tilapia exhibited various signs and lesions resembling streptococcosis such as skin or visceral organs hemorrhage, peritonitis and ascites. Fourteen days after the challenge with S. agalactiae, among the 384 individuals, 214 individuals were dead and 170 survived, indicating a death rate of 55.73%. High mortality was seen in the first 48 h after the challenge with the S. agalactiae. All 214 dead individuals and 170
Fig. 3. Relative expression levels of the MCP-8 gene in tilapia challenged with S. agalactiae. The expression of the MCP-8 gene was determined in liver, kidney, spleen and intestine using qRT-PCR. The samples were analyzed at 1 h, 3 h, 6 h, 12 h, 24 h, 48 h and 72 h post-treatment. Expression of b-actin was used as an internal control. Each experiment was performed at least in triplicate. Data are shown as mean ± SE (n ¼ 4). **: p < 0.01.
Using an in-silico mapping method, we mapped the MCP-8 gene to the linkage group 23 of the genome of the Nile tilapia. Near to the linkage location of the MCP-8 gene, we detected some other immune-related genes, including galectin-3-binding protein, kallikrein-11, granzyme K and granzyme B and duodenase-1 in the Scaffold GL831234.1 in the Ensembl Nile tilapia version 75.1 (Orenil1.0).
S. agalactiae is a cause of streptococcosis in many mammalian and fish species. To date, streptococcosis is recognized as a major infectious disease causing significant economic loss in aquaculture. In this study, hybrid tilapia challenged via immersion with S. agalactiae exhibited various signs and lesions resembling streptococcosis such as skin or visceral organs hemorrhage, peritonitis and ascites, suggesting that septicemia conditions occured [31]. Our immersion challenge study showed a high mortality within the first 48 h, and an overall mortality rate of 55.7% in hybrid tilapia. Similar results were reported by others. For example, in Nile and red tilapia, the mortality rate was 40%e58% after an immersion challenge with S. agalactiae for over 10 days [32,33]. Rodkhum et al. reported a mortality of 60% in Nile tilapia when exposed to S. agalactiae [34]. Rapid mortalities occurred after exposure to Streptococcus spp. were also reported from other experimentally infected fish [35,36]. All these data support that S. agalactiae is a serious bacterial pathogen to tilapia, causing high mortality. In this study, we identified the full-length cDNA of the MCP-8 gene with an ORF of 768 bp encoding 255 amino acid residues. It showed an amino acid sequence similarity of 50e73% with that of mouse, dogs, human and Maylandia zebra [28e30]. The low amino acid similarity of the MCP-8 gene in different species suggests a rapid evolution of this gene. Usually, immune-related genes are under positive selection [37], thus evolving more rapidly than other genes. The tilapia MCP-8 gene consisted of five exons and four introns. The genomic structure of the MCP-8 gene was similar in different vertebrate species, such as the mouse [38]. In mammals, mast cell proteinases have been extensively studied [23]. Many studies showed that mast cell proteases may account for many of the effects ascribed to mast cells and are currently emerging as promising candidates for treatment of mast cell driven diseases. Recent studies have highlighted the important
G.H. Fu et al. / Fish & Shellfish Immunology 40 (2014) 331e336
335
Table 2 The allele and genotype distributions of five SNPs in the MCP-8 gene in tilapia susceptible and resistant to Streptococcus agalactiae. SNP
SNP1 CC (N ¼ 58) CT (N ¼ 118) TT (N ¼ 202) SNP2 AA (n ¼ 96) AG (n ¼ 144) GG (n ¼ 116) SNP3 CC (n ¼ 116) CG (n ¼ 162) GG (n ¼ 100) SNP4 CC (n ¼ 48) CT (n ¼ 150) TT (n ¼ 172) SNP5 CC (n ¼ 54) CT (n ¼ 152) TT (n ¼ 178)
Genotype (individual no.)
X2
Allele frequency (%.)
Susceptible
Resistant
X2
Allele
Susceptible
Resistant
26 58 126
32 60 76
8.06 (p < 0.05)
C T
110 310
124 212
19.95 (p < 0.005)
60 82 48
36 62 68
11.32 (p < 0.005)
A G
202 178
134 198
21.83 (p < 0.005)
72 96 44
44 66 56
3.13 (p > 0.05)
C G
240 184
154 178
14.11 (p < 0.005)
22 90 90
26 60 82
3.44 (p > 0.05)
C T
134 270
112 224
0.01 (p > 0.05)
28 90 96
26 62 82
1.16 (p > 0.05)
C T
146 282
114 226
0.05 (p > 0.05)
p < 0.05 is considered to be statistically significant.
role that mast cells play in the protection against infection with a variety of pathogens [39]. However, in fish, not much is known about the functions of genes encoding mast cell proteinases. In this study, MCP-8 mRNA was detected in all tested tissues, including spleen, blood, brain, gill, intestine, liver, skin, kidney, muscle and eye in normal tilapia, suggesting diverse roles of the gene in tilapia. The relatively higher expression levels in immune-related organs (i.e. spleen, liver) suggest that the MCP-8 gene is involved in immune system in tilapia. However, in mouse, MCP-8 mRNA could not be detected in liver, intestine, lung or ears [28]. The specific expression patterns of the gene in different species suggest different functions of the MCP-8 gene in fish and land animals. In order to elucidate some functions of the MCP-8 gene in tilapia in response to a challenge with a bacterial pathogen S. agalactiae, we determined the expression levels of the MCP-8 gene after a challenge with S. agalactiae in four tissues of tilapia, including liver, spleen, kidney and intestine. We found that the expression levels in all four tissues increased 3 h after the challenge with the S. agalactiae by an intraperitoneal injection, further supporting that the MCP-8 gene plays an important role in the innate immune response against bacterial pathogens. We found that the increase of the expression of the MCP-8 gene at 3 h post challenge was much more substantial in liver and intestine than in spleen and kidney. The strongest responses of the MCP-8 gene in spleen and kidney were much later than those in the liver and intestine. The quick response of the MCP-8 genes in intestine and its later response in spleen and kidney are understandable. In this study, the fishes were challenged with S. agalactiae by an intraperitoneal injection. The first organ that contacted the bacteria is most likely the intestine, thus the first induced mucosal immune response starts there, and then followed by the response of systemic immune organs, such as, spleen and kidney. However, it is difficult to understand why the response of the MCP-8 in liver started so early (i.e. 3 h after the challenge). We speculate that the S. agalactiae can invade in liver very quickly. However, further detailed study is required to examine this speculation. SNPs associated with disease resistance could be used in marker-assisted selection to accelerate the genetic improvement [8]. In this study, we identified five SNPs in the MCP-8 gene in tilapia. For the first time, we detected significant associations between three SNPs and the resistance to S. agalactiae in tilapia. We
found that genotype distributions and allele frequencies of SNP1, SNP2 and SNP3 in MCP-8 were significantly different in dead and surviving tilapia after a challenge with the bacterial pathogen S. agalactiae. The SNPs significantly associated with the resistance to S. agalactiae may be used in selection of tilapia resistant to S. agalactiae. We noted that SNP2 and SNP3 detected in MCP-8 changed the sequences of amino acids. However, with our current data, we were not able to know whether these significant associations were due to the mutations in SNP2 and SNP3 or other genes linked to the MCP-8 gene. Therefore, to examine this, it is essential to further study. By using in-silico mapping, we mapped the MCP-8 gene on LG 23 of the tilapia genome. Near to the linkage location of MCP-8 there are other immune-related genes, including galectin-3binding protein, kallikrein-11, granzyme K and granzyme B and duodenase-1. Thus, by QTL mapping in segregating families using more DNA markers on the LG23, it is possible to examine whether the resistance to the bacterial pathogen was caused by the mutations in SNP2 and SNPs in the MCP-8 gene or by linked genes on the LG 23. Certainly, association mapping in populations with a large number of survival and dead individuals after a challenge with S. agalactiae, it is also possible to dissect the phenotypic variation of resistance to S. agalactiae. In this study, we found no significant correlations between four of the five SNPs in the MCP-8 gene and growth traits in tilapia. In Asian seabass, the SNPs in the LECT2 gene associated with resistance to the big belly disease was not associated with growth [16]. It is generally believed that disease resistance was negatively correlated with growth performances [40]. However, a few recent studies showed positive correlations between disease resistance and growth performances in some species. For example, in Atlantic halibut, the interrelationship between growth and resistance to Vibrio anguillarum disease was seen [41]. In Atlantic salmon, a positive correlation between the survival in the Vibrio salmonicida challenge and growth rate were reported [42]. In rainbow trout, significant positive correlations were found for end body weight and resistance to the infectious hematopoietic necrosis (IHN) virus and for early body weight and resistance to bacterial cold water disease (BCWD) [43]. In this study, only the SNP3 in the MCP-8 gene was associated with growth traits. It seems that whether the existence of positive associations between disease resistance and growth performances depends on the nature of diseases and genes.
336
G.H. Fu et al. / Fish & Shellfish Immunology 40 (2014) 331e336
In conclusion, we identified the MCP-8 gene in tilapia, characterized it and mapped it to the genome of tilapia. Our results suggest that the MCP-8 gene plays an important role in innate immunity and also showed that intestine and kidney were the major expression sites for MCP-8 gene. We found significant associations between three SNPs in the MCP-8 gene and resistance against the bacterial pathogen S. agalactiae. In contrast, there was no association between four SNPs in the MCP-8 gene and growth traits. These SNPs associated with resistance against the bacterial pathogen could facilitate the selection of fish resistant to S. agalactiae. Further study on whether SNPs in the MCP-8 are associated with the resistance to other bacterial and viral infections could be useful in understanding more functions of the MCP-8 gene. Acknowledgments This research is supported by the National Research Foundation, Prime Minister's Office, Singapore under its Competitive Research Program (CRP Award No. NRF-CRP002-001). We thank colleagues Mr. Huiming Liu in our group and staff members from TLL's animal house for taking care of fishes, as well as May Lee for editing English. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2014.07.019. References [1] El-Sayed A-FM. Tilapia culture. CABI; 2006. [2] Gupta MV, Acosta BO. A review of global tilapia farming practices. Aqua Asia 2004;9:7e12. [3] Galman O, Moreau J, Avtalion R. Breeding characteristics and growth performance of Philippine red tilapia. In: The second international symposium on Tilapia in aquaculture. WorldFish; 1988. p. 169. [4] Shoemaker C, Xu D, Evans J, Klesius P, Lim C, Webster C. Parasites and diseases. In: Lim C, Webster CD, editors. Tilapia: biology, culture, and nutrition. CABI; 2006. pp. 561e82. [5] Suanyuk N, Kong F, Ko D, Gilbert GL, Supamattaya K. Occurrence of rare genotypes of Streptococcus agalactiae in cultured red tilapia Oreochromis sp. and Nile tilapia O. niloticus in Thailanddrelationship to human isolates? Aquaculture 2008;284:35e40. [6] Amal M, Zamri-Saad M. Streptococcosis in tilapia (Oreochromis niloticus): a review. J Trop Agric Sci 2011;34. [7] Fuji K, Hasegawa O, Honda K, Kumasaka K, Sakamoto T, Okamoto N. Markerassisted breeding of a lymphocystis disease-resistant Japanese flounder (Paralichthys olivaceus). Aquaculture 2007;272:291e5. [8] Yue GH. Recent advances of genome mapping and marker-assisted selection in aquaculture. Fish Fish 2014;15:376e96. [9] Xu TJ, Chen SL, Ji XS, Tian YS. MHC polymorphism and disease resistance to Vibrio anguillarum in 12 selective Japanese flounder (Paralichthys olivaceus) families. Fish Shellfish Immunol 2008;25:213e21. [10] Kwok P-Y. Methods for genotyping single nucleotide polymorphisms. Annu Rev Genomics Hum 2001;2:235e58. [11] Kongchum P, Palti Y, Hallerman EM, Hulata G, David L. SNP discovery and development of genetic markers for mapping innate immune response genes in common carp (Cyprinus carpio). Fish Shellfish Immunol 2010;29: 356e61. [12] Lazarus R, Vercelli D, Palmer LJ, Klimecki WJ, Silverman EK, Richter B, et al. Single nucleotide polymorphisms in innate immunity genes: abundant variation and potential role in complex human disease. Immunol Rev 2002;190: 9e25. € der NW, Schumann RR. Single nucleotide polymorphisms of toll-like [13] Schro receptors and susceptibility to infectious disease. Lancet Infect Dis 2005;5: 156e64. [14] Gheyas A, Haley C, Guy D, Hamilton A, Tinch A, Mota-Velasco J, et al. Effect of a major QTL affecting IPN resistance on production traits in Atlantic salmon. Anim Genet 2010;41:666e8.
[15] Ozaki A, Sakamoto T, Khoo S, Nakamura K, Coimbra M, Akutsu T, et al. Quantitative trait loci (QTLs) associated with resistance/susceptibility to infectious pancreatic necrosis virus (IPNV) in rainbow trout (Oncorhynchus mykiss). Mol Genet Genomics 2001;265:23e31. [16] Fu GH, Bai ZY, Xia JH, Liu XJ, Liu F, GH Y. Characterization of the LECT2 gene and its associations with resistance to the big belly disease in Asian seabass. Fish Shellfish Immunol 2014;37:131e8. [17] Dong S, Kong J, Meng X, Zhang Q, Zhang T, Wang R. Microsatellite DNA markers associated with resistance to WSSV in Penaeus ( Fenneropenaeus) chinensis. Aquaculture 2008;282:138e41. [18] Yu Z, Guo X. Identification and mapping of disease-resistance QTLs in the eastern oyster, Crassostrea virginica Gmelin. Aquaculture 2006;254:160e70. [19] Theoharides TC, Alysandratos K-D, Angelidou A, Delivanis D-A, Sismanopoulos N, Zhang B, et al. Mast cells and inflammation. BBA-Mole Basis Dis 2012;1822:21e33. [20] Caughey GH. Mast cell proteases as protective and inflammatory mediators. Mast cell biology. Springer; 2011. pp. 212e34. [21] Gallwitz M, Enoksson M, Hellman L. Expression profile of novel members of the rat mast cell protease (rMCP)-2 and (rMCP)-8 families, and functional analyses of mouse mast cell protease (mMCP)-8. Immunogenetics 2007;59: 391e405. [22] Pejler G, Åbrink M, Ringvall M, Wernersson S. Mast cell proteases. Adv Immunol 2007;95:167e255. €nnberg E, Waern I, Wernersson S. Mast cell proteases: multifac[23] Pejler G, Ro eted regulators of inflammatory disease. Blood 2010;115:4981e90. [24] Xia JH, He XP, Bai ZY, Lin G, Yue GH. Analysis of the Asian seabass transcriptome based on expressed sequence tags. DNA Res 2011;18:513e22. [25] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2DDCT method. Methods 2001;25:402e8. [26] Yue GH, Orban L. A simple and affordable method for high-throughput DNA extraction from animal tissues for polymerase chain reaction. Electrophoresis 2005;26:3081e3. [27] Barrett JC. Haploview: visualization and analysis of SNP genotype data. Cold Spring Harb Protoc 2009;2009. pdb. ip.71. [28] Lützelschwab C, Huang MR, Kullberg MC, Aveskogh M, Hellman L. Characterization of mouse mast cell protease-8, the first member of a novel subfamily of mouse mast cell serine proteases, distinct from both the classical chymases and tryptases. Eur J Immunol 1998;28:1022e33. [29] Caughey GH, Raymond WW, Vanderslice P. Dog mast cell chymase: molecular cloning and characterization. Biochemistry 1990;29:5166e71. [30] Vanderslice P, Ballinger SM, Tam EK, Goldstein SM, Craik CS, Caughey GH. Human mast cell tryptase: multiple cDNAs and genes reveal a multigene serine protease family. Proc Natl Acad Sci 1990;87:3811e5. [31] Austin B, Austin DDA. Bacterial fish pathogens: diseases of farmed and wild fish. Springer; 2007. [32] Mian G, Godoy D, Leal C, Yuhara T, Costa G, Figueiredo H. Aspects of the natural history and virulence of S. agalactiae infection in Nile tilapia. Vet Microbiol 2009;136:180e3. [33] Ng WK, Koh CB, Sudesh K, Siti-Zahrah A. Effects of dietary organic acids on growth, nutrient digestibility and gut microflora of red hybrid tilapia, Oreochromis sp., and subsequent survival during a challenge test with Streptococcus agalactiae. Aquacult Res 2009;40:1490e500. [34] Rodkhum C, Pirarat PKN. Effect of water temperature on susceptibility to Streptococcus agalactiae serotype Ia infection in nile Tilapia (Oreochromis niloticus). Thai J Vet Med 2011;41:309e14. [35] Boomker J, Imes Jr G, Cameron C, Naude T, Schoonbee H. Trout mortalities as a result of Streptococcus infection. Am J Vet Res 1979;46:71e7. [36] Minami T. Streptococcus sp., pathogenic to cultured yellowtail, isolated from fishes for diets. Fish Pathol 1979;14. [37] Nielsen R, Bustamante C, Clark AG, Glanowski S, Sackton TB, Hubisz MJ, et al. A scan for positively selected genes in the genomes of humans and chimpanzees. Plos Biol 2005;3:e170. [38] Lunderius C, Hellman L. Characterization of the gene encoding mouse mast cell protease 8 (mMCP-8), and a comparative analysis of hematopoietic serine protease genes. Immunogenetics 2001;53:225e32. [39] Urb M, Sheppard DC. The role of mast cells in the defence against pathogens. PloS Patho 2012;8:e1002619. [40] Axford R, Bishop S, Nicholas F, Owen J. Breeding for disease resistance in farm animals. CABI publishing; 2000. [41] Imsland AK, Jonassen TM, Langston A, Hoare R, Wergeland H, FitzGerald R, et al. The interrelation of growth and disease resistance of different populations of juvenile Atlantic halibut (Hippoglossus hippoglossus L.). Aquaculture 2002;204:167e77. [42] Standal M, Gjerde B. Genetic variation in survival of Atlantic salmon during the sea-rearing period. Aquaculture 1987;66:197e207. [43] Overturf K, LaPatra S, Towner R, Campbell N, Narum S. Relationships between growth and disease resistance in rainbow trout, Oncorhynchus mykiss (Walbaum). J Fish Dis 2010;33:321e9.