- Email: [email protected]
The Mechanism of Trans-activation of theMDR1Gene by Human T-Cell Leukemia Virus
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS ARTICLE NO.
249, 397–404 (1998)
RC989142
The Mechanism of Trans-activation of the MDR1 Gene by Human T-Cell Leukemia Virus Alan Lau,* Timothy W. Gant,† and Alan J. Cann‡,1 *Wellcome/CRC Institute, Tennis Court Road, Cambridge, CB2 1QR, United Kingdom; and †MRC Toxicology Unit, and ‡Department of Microbiology and Immunology, University of Leicester, Leicester LE1 9HN, United Kingdom
Received June 29, 1998
Overexpression of P-glycoprotein (P-gp), the protein product of the multidrug resistance gene (MDR1), confers a drug resistant phenotype on cells. We have recently demonstrated that the MDR1 promoter is transcriptionally activated by the HTLV-I tax protein, providing an explanation for the development of drug resistance in HTLV-I infections. Here we report that HTLV-I mediated MDR1 activation is dependent on the presence of an NF-IL6-binding site located between base pairs 0148 and 0141 relative to the transcription start site. This finding opens up the possibility of moderating P-gp expression through interference with NFIL6 binding to its trans recognition element and subsequent repression of MDR1 transcription. q 1998 Academic Press
The multiple drug resistance phenotype (MDR) results in broad spectrum resistance to chemotherapy and is a major problem in the chemotherapy of many human malignancies (1). There are several known mechanisms by which an MDR phenotype may arise in cells, but one of the best characterised results from the overexpression of P-glycoprotein (P-gp) (1,2). P-gp is the protein product of the MDR gene family. In humans, the MDR gene family has two members; however, only MDR1 is able to confer a MDR phenotype in transfection analysis (3, 4, 5). P-gp confers a MDR phenotype by pumping a wide spectrum of chemotherapeutic agents (including anthracyclines, vinca alkaloids, epipodophylline and dactinomycins) from the plasma membrane thus preventing their entrance into the cytoplasm. The result is lower intracellular drug concentrations and reduced drug efficacy. Increased transcription of the MDR1 gene has been demonstrated under a number of conditions of involving chemical and physical stress (6, 7). In cells selected in vitro for a 1 Corresponding author. Fax: /44 (0)116 252 5030. E-mail: nna@ le.ac.uk.
multidrug resistance phenotype there is an increased transcription rate in addition to MDR1 gene amplification (8). However, in human maligancies MDR1 gene amplification has not been consistently observed, suggesting that altered regulation is primarily responsible for MDR1 overexpression in these situations. Increased promoter activity is also observed in cells transfected with the MDR1 promoter driving a reporter gene when the cells are exposed to anticancer agents (9). Recently we have shown the enhancement of MDR1-associated drug resistance in freshly isolated PBMCs from HTLVI infected patients (10). Preliminary studies indicated that drug resistance may be induced through the transcriptional up-regulation of MDR1 by the HTLV-I tax trans-activator protein (10,11). Worldwide, 10-20 million people are estimated to be infected with human T-cell leukaemia virus (HTLV) (12). Infection is associated with at least two distinct disease syndromes: adult T-cell leukaemia (ATL), an aggressive T-cell malignancy which occurs worldwide in populations where HTLV-I infection is endemic, and HTLV Associated Myelopathy (HAM) (13). The pathogenesis of these conditions remains unclear. Treatment of ATL patients has traditionally consisted of combination chemotherapy but this approach has limited clinical benefit. Four generations of combination chemotherapy have shown an increase in remission rates from 11 to 42%, but a corresponding improvement in overall or disease-free survival time has not occurred (14,15). Similarly other novel treatments, including bone marrow transplantation, total body irradiation and treatment with interferons b and g, have failed to show clinical improvement. Limited clinical improvement in some patients have been reported using deoxycoformycin (DCF), an adenosine deaminase inhibitor (16), MST-16, a topoisomerase II inhibitor (17), and anti-Tac antibodies (18). Improved remission rates have recently been reported in small studies combining a-interferon and AZT (19, 20). In the present report we describe a genetic analysis of the MDR1 gene promoter which demonstrates that
397
0006-291X/98 $25.00 Copyright q 1998 by Academic Press All rights of reproduction in any form reserved.
AID
BBRC 9142
/
695b$$$201
08-01-98 16:17:16
bbrcg
AP: BBRC
Vol. 249, No. 2, 1998
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
transactivation of this gene by the tax protein critically depends on the presence of an NF-IL6-binding site located between base pairs -148 and -141 relative to the transcription start site. NF-IL6, also known as CCAAT/ enhancer binding protein b (C/EBPb) (21), is a member of the basic-region leucine zipper (bZip) family of proteins known to be activated by the tax protein (22). The bZip proteins are important elements in the transcription factor network, linking individual transactivators such as jun, fos and CREB/ATF via protein-protein interactions to the basal transcriptional machinery. In addition to HTLV, other viral transactivating proteins are known to activate transcription via bZip factors, including NF-IL6. These include the hepatitis B virus X protein (23) and adenovirus E1A protein (24). These observations raise the possibility of new and alternative chemotherapeutic approaches to HTLV-associated diseases, and suggest that other more common virus infections may play an important role in tumour pathology. MATERIALS AND METHODS Cell culture. COS cells (25) were maintained in DMEM medium (Gibco) supplemented with 10% calf serum (Gibco) at 377C, 5% CO2 in a humidified atmosphere. Plasmids. pRK7-tax (26) expresses the HTLV-I tax protein but not the rex protein from the huCMV immediate early promoter. pMDR(/)CAT contains the 1kb PstI-PstI promoter region (0439 to /543) surrounding the transcription start site of the human MDR1 gene derived from plasmid pMDR-P3 (27). The SV40 virus promoter and origin of replication were excised from pSV2CAT (ATCC #37155, positions 1–328) and replaced with the MDR1 fragment in tandem with the CAT gene. Exonuclease-III nested deletions of the MDR1 promoter. All enzymes were purchased from GibcoBRL. 5* and 3* nested deletions of the MDR1 promoter were made by exonuclease-III treatment of the MDR1 promoter in pMDR-P3. 6mg of pMDR-P3 were digested with restriction enzymes BamHI and KpnI (5* promoter deletions) or BssHII and SphI (3* promoter deletions). The DNA was then digested with 455 u exonuclease-III at 307C in exonuclease-III buffer (0.5 M Tris-HCl pH 8.0, 50 mM MgCl2, 100 mg/ml tRNA) for 4 minutes, with 1/10th volume aliquots being removed every 20 seconds. Reactions were immediately stopped by the addition of phenol and the purified by phenol:chloroform extraction. Each purified plasmid DNA aliquot was then blunt-ended by treatment with mung bean nuclease and religated. Deletions were screened by DNA sequencing. Appropriate 5* and 3* MDR1 deletions were selected and subcloned back into pMDR(/)CAT upstream of the CAT gene. 5* MDR1 promoter deletions were named 5*MDR(0x), where x Å the position relative to the transcription start site (/1). 3* MDR1 promoter deletions were named 3*MDR(/x), where x Å the position relative to the transcriptional start site (/1). The nucleotide sequence of the MDR1 promoter insert was fully determined in all clones and no errors were observed. Site-directed mutagenesis of putative MDR1 promoter regulatory elements. Site-directed mutagenesis of the MDR1 promoter was performed using the following oligonucleotide primers: CCCAAGTATTCAGCTGATG (AP1); CAACCTGCCTCACAGTTTCTCG (NF-IL6); GTCAATCCTTATTTGGAGCAGTCATC (SP1).
The known transcription factor binding sites are underlined and the mutated nucleotides shown in bold font. These mutations were known to abolish regulatory element activity, as described previously for AP1 (28, 29), NF-IL6 (30, 31) and SP1 (32, 33). Site-directed mutagenesis of putative AP1, NF-IL6 and SP1 sites in the MDR1 promoter was performed based on the method of Kunkel (34). Briefly, the MDR1 promoter was subcloned from the pMDR-P3 into M13mp19 RF DNA (GibcoBRL). The resulting clone was designated M13-5*MDR1 and transformed into E. coli CJ236. Single stranded DNA templates containing uracil were obtained and mutant AP1, NF-IL6 and SP1 oligonucleotides primers annealed. Oligonucleotide primers were the extended using T7 polymerase (Amersham Life Sciences) and phage plaques obtained by transformation into E. coli JM109 cells. Clones were screened for appropriate mutations by DNA sequencing. Appropriate MDR1 mutants were then subcloned back into the pMDR(/)CAT reporter gene plasmid upstream of the CAT gene. The nucleotide sequence of the MDR1 promoter insert was fully determined in all clones and no errors were observed. Transactivation of the MDR1 promoter by HTLV-I tax. Electroporation of COS cells and chloramphenicol acetyl transferase (CAT) assays were performed as previously described (35) except 3 1 106 COS cells were electroporated at 250 V, 960 mF with 25 mg of total plasmid DNA (12.5 mg of each plasmid co-electroporated). 48 hours after electroporation, cells were harvested and cell extracts obtained by freeze-thaw lysis. All assays were normalized based on total protein concentration using the Bio-Rad protein assay kit. Equivalent amounts of cell lysate were incubated with 4 mM acetyl-CoA (Sigma) and 0.05 mCi [14C]chloramphenicol (ICN) at 377C for 16-18 hours. Reactions were extracted with ethyl acetate then acetylated products resolved by thin layer chromatography and quantified by scintillation counting. Negative controls performed for every assay included pRK7-tax alone, pMDR(0)CAT (MDR1 promoter fragment opposed to the CAT gene) and each deletion/mutant construct alone. None of these controls showed any significant CAT activity, i.e., above the background level seen with cells alone ((10) and data not shown).
RESULTS 5* Deletion Analysis of the MDR1 Promoter A set of 7 exonuclease III deletion mutants retaining from 0310 to 014 nucleotides of sequence upstream of the promoter start site were selected for analysis. COS cells were co-electroporated with 12.5mg of each of the deleted reporter plasmids plus 12.5 mg of pRK7-tax as described in Materials and Methods. Each experiment was repeated 3 times and the mean CAT activity relative to the intact MDR1 promoter in pMDR(/)CAT is shown in figure 1. Promoter deletion mutants retaining at least 0262 nucleotides upstream of the transcription start site were not significantly affected in their ability to be transactivated by the tax protein. However, a deletion mutant containing 0217 nucleotides upstream of the transcription start site showed an increase to 119% of the activity of the intact MDR1 promoter, indicating that a negative transcriptional regulatory element located between positions 0262 and 0217 relative to the transcription start site had been removed. However, the most striking observation from this dataset is the sudden reduction in relative promoter activity to 46% when the deleted region extends to 0118 nucleotides upstream of the transcription start site. This correlates
398
AID
BBRC 9142
/
695b$$$201
08-01-98 16:17:16
bbrcg
AP: BBRC
Vol. 249, No. 2, 1998
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. Exonuclease deletion analysis of 5* sequences in the MDR1 promoter.Progressive 5* promoter deletion mutants in the reporter vector pMDR(/)CAT were constructed and co-electroporated into COS cells with the HTLV-I tax-expressing plasmid pRK7-tax as described in Materials and Methods. The graph (top panel) shows the mean CAT activity from three independent experiments relative to the intact MDR1 promoter in pMDR(/)CAT. The lower panel of the figure shows the same data in summary form.
with the removal of an NF-IL6 (C/EBPb)-binding site located between base pairs 0148 and 0141 relative to the transcription start site (see ‘‘Site-Directed Mutagenesis of Individual Promoter Elements’’ below). Deletions involving residues down to 014 nucleotides from the transcription start site show a further small decline in transactivation (down to 33% of the intact promoter), but no further sudden reductions in activity. 3* Deletion Analysis of the MDR1 Promoter A further set of 7 exonuclease III deletion mutants retaining from /39 to /347 nucleotides of MDR1 se-
quence downstream of the promoter start site were also selected for analysis. COS cells were co-electroporated with 12.5 mg of each of the deleted reporter plasmids plus 12.5 mg of pRK7-tax as described in Materials and Methods. Each experiment was repeated 3 times and the mean CAT activity relative to the intact MDR1 promoter in pMDR(/)CAT is shown in figure 2. These experiments did not reveal any clear pattern of reduced promoter activity, indicating that there are no crucial response elements for tax transactivation located downstream of the transcription start site in the MDR1 promoter.
399
AID
BBRC 9142
/
695b$$$201
08-01-98 16:17:16
bbrcg
AP: BBRC
Vol. 249, No. 2, 1998
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. Exonuclease deletion analysis of 3* sequences in the MDR1 promoter.Progressive 3* promoter deletion mutants in the reporter vector pMDR(/)CAT were constructed and co-electroporated into COS cells with the HTLV-I tax-expressing plasmid pRK7-tax as described in Materials and Methods. The graph (top panel) shows the mean CAT activity from three independent experiments relative to the intact MDR1 promoter in pMDR(/)CAT. The lower panel of the figure shows the same data in summary form.
Site-Directed Mutagenesis of Individual Promoter Elements Based on the above data, site-directed mutagenesis of individual promoter elements was performed as described in Materials and Methods. COS cells were coelectroporated with 12.5 mg of each of the mutated reporter plasmids plus 12.5 mg of pRK7-tax as described in Materials and Methods. Each experiment was repeated twice and the mean CAT activity relative to the intact MDR1 promoter in pMDR(/)CAT is shown in figure 3.
Mutating the AP1 binding site located at 0234 relative to the transcription start site (TGATTCAGrGTATTCAG) did not adversely affect the relative ability of the tax protein to transactivate the promoter (107 { 25% intact promoter activity). Similarly, mutating the SP1 binding site located at 0110 relative to the transcription start site (GGGCCGGGrTTATTTGG) did not greatly affect transactivation of the promoter (109 { 26% intact promoter activity). In contrast, ablation of the NF-IL6 (C/EBPb) binding site located at 0148 to the transcription start site (TTTCGCAGrCCTCACAG) caused a reduction in transactivation to 47 { 7% that
400
AID
BBRC 9142
/
695b$$$201
08-01-98 16:17:16
bbrcg
AP: BBRC
Vol. 249, No. 2, 1998
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 3. Site-directed mutagenesis of the MDR1 promoter.Oligonucleotide-directed mutants of selected sites in the reporter vector pMDR(/)CAT were constructed and co-electroporated into COS cells with the HTLV-I tax-expressing plasmid pRK7-tax as described in Materials and Methods. The graph (top panel) shows the mean CAT activity from two independent experiments relative to the intact MDR1 promoter in pMDR(/)CAT. The lower panel of the figure shows the same data in summary form.
of the intact promoter. This correlates almost exactly with the results obtained when this motif is removed by progressive 5* deletions, indicating that this site is the major factor for influencing transactivation of the MDR1 promoter by tax. DISCUSSION P-gp expression on ATL cells has been reported previously (36, 37, 38) using immunoblotting and a monoclonal antibody (C219). C219 has affinity for both the MDR1 and MDR2 gene products and therefore it is not
conclusive that the expression seen previouslly of ATL cells is from the resistance conferring MDR1 gene. However, the report by Kuwazuru et al (37) also showed P-gp-like photoaffinity drug labelling and MDR1 RNA in cells from a single ATL patient after clinical relapse, suggesting that the P-gp overexpressed was from the MDR1 gene. These reports did not correlate P-gp expression with cellular drug resistance activity and did not include appropriate controls from nonHTLV infected subjects. P-gp has subsequently been found to be expressed at low levels on normal lymphocytes (39, 40, 41). Hence, the actual enhancement of
401
AID
BBRC 9142
/
695b$$$201
08-01-98 16:17:16
bbrcg
AP: BBRC
Vol. 249, No. 2, 1998
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
P-gp expression in ATL cells over normal lymphocyte cell populations was unclear. We addressed this question in a study of P-gp expression and activity in lymphocytes from HTLV-I-infected subjects and non-infected controls and showed that the mechanism of P-gp expression in HTLV-I-infected subjects is due to transcriptional activation in trans (transactivation) by the tax protein (10). Trans-activation of MDR1 in HTLV-I transformed cell lines was also suggested by Chuang et al (11). The HTLV-I trans-activator protein, tax, is a 40 kDa non-structural nuclear protein encoded by a doubly spiced sub-genomic viral mRNA (13). The tax protein is a positive transactivator of both viral and cellular transcription and is thought to be the main cause of cellular transformation, due to aberrant expression of a large range of heterologous cellular genes. The mechanism of tax transactivation is indirect, mediating enhanced transcription through interactions with cellular transcription factors rather than by direct binding to DNA. Such transcription factors include the cAMP-responsive element binding protein/activating transcription factor (CREB/ATF), NF-kB and serum response factor (SRF) families (22). HTLV-I tax up-regulates c-fos (42) and HTLV-infected cells show increased AP1 binding activity (43). In this report, we have investigated the molecular mechanism by which the tax protein leads to overexpression of the MDR1 gene. Although the assays in this report were performed in COS cells, similar transactivation of MDR1 occurs in T-cells ((10) plus additional data not shown). Using exonuclease III deletion analysis of the MDR1 promoter driving expression of a CAT reporter gene co-transfected with a tax expression vector, we found that a deletion mutant containing 0217 nucleotides upstream of the transcription start site showed a modest increase in promoter activity to 119% of the activity of the intact MDR1 promoter, indicating a possible negative transcriptional regulatory element located between positions 0262 and 0217 relative to the transcription start site. Inspection of this region revealed a number of potential transcription factor binding sites which could cause this effect, including a CCAAT box at 0238 and an AP1 binding site at 0234 but this was not further investigated. However, the most striking observation from the 5* deletion mutants is the sudden reduction in relative promoter activity to 46% when the deleted region extends to 0118 nucleotides upstream of the transcription start site. This correlates with the removal of an NF-IL6 (C/EBPb)-binding site located between base pairs 0148 and 0141 relative to the transcription start site. Deletions involving further residues down to 014 nucleotides from the transcription start site show a further small decline in transactivation (down to 33% of the intact promoter), but no further sudden reductions in activity. Thus the presence of the NF-IL6 bind-
ing site appears to be critical for transactivation of the human MDR1 promoter by tax and this was further investigated by site-directed mutagenesis of this promoter element (see below). Progressive exonuclease III deletion analysis of 3* sequences downstream of the transcription start site in the MDR1 promoter was carried out because of previous reports that sequences downstream of the start site nucleotides are essential for proper initiation of transcription (44, 45). However, our experiments did not reveal any clear pattern of reduced promoter activity (figure 2). There is a possible suggestion of the presence of a negative regulatory element located between nucleotides /39 and /108, but this was not further investigated. Our conclusion is that there are no crucial elements for tax transactivation of the MDR1 gene located downstream of the transcription start site. To further investigate the above observations, we carried out oligonucleotide-directed mutagenesis of selected promoter elements (figure 3). Mutations were introduced into transcription factor binding sites identified by analysis of the MDR1 promoter sequence and from the results of the deletion analysis described above. All mutations were chosen to cause minimal disruption to the overall structure of the promoter while having been shown previously to eliminate binding of the respective transcription factors (see Materials and Methods). Alteration of an AP1 binding site located at 0234 relative to the transcription start site did not greatly affect the relative ability of the tax protein to transactivate the promoter (107 { 25% intact promoter activity). Similarly, mutating the SP1 binding site located at 0110 relative to the transcription start site did not adversely affect transactivation of the promoter (109 { 26% intact promoter activity). There is a previous report of a six-fold increase in the basal activity of the MDR1 promoter when this sequence is mutated (46). However, our data suggest that the negative regulatory effect of this region would seem to apply to basal promoter activity but not to transactivation by tax. The influence of a further G-rich sequence located at 061 to 043 to which both SP1 and EGR-1 bind specifically and deletion of which was reported to reduce basal promoter activity five-fold (46) was not examined. However, deletion analysis of this region did not reveal any significant reduction in promoter activity (figure 1). Therefore we conclude that interactions with AP1 or SP1 are not the major mechanism involved in tax transactivation of the MDR1 gene as revealed by the CAT reporter assay. This was unexpected since tax is known to be able to stimulate transcription from a range of other promoters by interacting with both of these factors (13). In contrast, destruction of the NF-IL6 (C/EBPb) binding site located at 0148 to the transcription start site caused a reduction in transactivation to 47% that of the intact promoter, indicating that this site is im-
402
AID
BBRC 9142
/
695b$$$201
08-01-98 16:17:16
bbrcg
AP: BBRC
Vol. 249, No. 2, 1998
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
portant for transactivation of the MDR1 promoter by tax (figure 3). NF-IL6 (or C/EBP-b), a bZIP motif-containing member of the C/EBP (CCAAT enhancer binding protein) family of transcription factors involved in regulating cytokine IL-6 transcription (21), has been associated with transactivation of MDR1 promoter (47, 48). This suggests a possible mechanism for transactivation of MDR1 by tax, since the tax protein is capable of modulating transcription factors through interactions with the basic domain of bZIP proteins, increasing dimerisation and DNA binding affinities (13). A similar mechanism is likely to occur with NF-IL6, whereby associations with tax via the bZIP domain may lead to increased active NF-IL6 dimers and up-regulation of MDR1 transcription, overexpression of P-gp and development of the MDR phenotype. Tax has been shown to be able to modulate G-CSF expression (49) and the human prointerleukin-1b gene (50) via interactions with NF-IL6. Of the possible mechanisms of transactivation of the MDR1 promoter by the HTLV tax protein, we have observed no evidence that AP1 or SP1 interactions are involved. Rather, interaction of tax with NFIL6 is the key event in upregulation of MDR1 expression by tax. The data presented in this paper reveal the molecular mechanism by which the HTLV-I tax protein transactivates the MDR1 gene and clarifies the involvement of HTLV infection in the induction of multiple drug resistance phenotypes. Moreover, these data raise the possibility that other virus infections may also lead to tumours with multiple drug-resistant phenotypes by the same molecular mechanism. For example, it has recently been shown that the hepatitis B virus X protein interacts with bZip proteins and enhances transcriptional activation by NF-IL6 (23). It is possible that other virus-encoded trans-acting factors may have similar influences, for example the adenovirus E1A protein and herpes simplex ICP0/ICP4 proteins, which have complex mechanisms of action. We are currently investigating whether these common virus infections are indeed able to interact with the human MDR1 promoter in a similar or analogous way to the HTLV-I tax protein, since this would have serious implications for tumour pathogenesis in a very large number of infected individuals. ACKNOWLEDGMENTS This work was funded in part by MRC grant G9622810. We are grateful to Konstantinos Kaltsas for making p3*MDR(/347).
REFERENCES 1. Gottesman, M., and Pastan, I. (1993) Annu. Rev. Biochem. 63, 385–427. 2. Endicott, J. A., and Ling, V. (1989) Annu. Rev. Biochem. 58, 137– 171.
3. Gros, P., Fallows, D. A., Croop, J. M., and Housman, D. E. (1986) Mol. Cell. Biol. 6, 3785–3790. 4. Sugimoto, Y., and Tsuruo, T. (1987) Cancer Res. 47, 2620–2625. 5. Ueda, K., Cardarelli, C., Gottesman, M. M., and Pastan, T. (1987) Proc. Natl. Acad. Sci. USA 84, 3004–3008. 6. Chin, K., Tanaka, S., Darlington, G., Pastan, I., and Gottesman, M. M. (1990) J. Biol. Chem. 265, 221–226. 7. Uchiumi, T., Kohno, K., Tanimura, H., Matsuo, K., Sato, S., Uchida, Y., and Kuwano, M. (1993) FEBS Letts. 326, 11–16. 8. Morrow, C. S., Chiu, J., and Cowan, K. H. (1992) J. Biol. Chem. 267, 10544–10550. 9. Kohno, K., Sato, S., Takano, H., Matsuo, K., and Kuwano, M. (1989) Biochem. Biophys. Research. Commun. 165, 1415–1421. 10. Lau, A., Nightingale, S., Taylor, G. P., Gant, T. W., and Cann, A. J. (1998) Blood 91, 2467–2474. 11. Chuang, S., Doong, S., Lin, M., and Cheng, A. (1997) Biochem. Biophys. Research. Commun. 238, 482–486. 12. De The´, G., and Bomford, R. (1993) AIDS Res. Hum. Ret. 9, 381– 386. 13. Cann, A., and Chen, I. (1996) in Fields Virology, pp.1501–1527, Raven Press, New York. 14. Minato, K., Araki, K., and Hanada, S. (1991) Int. J. Hematol. 54, 179. 15. Shimoyama, M. (1992) Treatments of Patients with Adult T-Cell Leukemia/Lymphoma. Japan Scientific Societies Press, Tokyo. 16. Dearden, C., Matutes, E., and Catovsky, D. (1991) Brit. J. Cancer 64, 903–906. 17. Ohno, R., Masaoka, T., Shirakawa, S., Sakamoto, S., Hirano, M., Hanada, S., Yasunaga, K., Yokomaku, S., Mitomo, Y., Nagai, K., Yamada, K., and Furue, H. (1993) Cancer 71, 2217–2221. 18. Waldmann, T. A., White, J. D., Goldman, C. K., Top, L., Grant, A., Bamford, R., Roessler, E., Horak, I. D., Zaknoen, S., and Kasten-Sportes, C. (1993) Blood 82, 1701–1712. 19. Gill, P. S., Harrington, W., Kaplan, M. H., Ribeiro, R. C., Bennett, J. M., Liebman, H. A., BernsteinSinger, M., Espina, B. M., Cabral, L., Allen, S., Kornblau, S., Pike, M. C., and Levine, A. M. (1995) New Engl. J. Med. 332, 1744–1748. 20. Hermine, O., Bouscary, D., Gessain, A., Turlure, P., Leblond, V., Franck, N., Buzyn, V., A., Rio, B., Macintyre, E., Dreyfus, F., and Bazarbachi, A. (1995) New Engl. J. Med. 332, 1749–1751. 21. Akira, S., Isshiki, H., Sugita, T., Tanabe, O., Kinoshita, S., Nishio, Y., Nakajima, T., Hirano, T., and Kishimoto, T. (1990) EMBO J. 9, 1897–1906. 22. Wagner, S., and Green, M. R. (1993) Science 262, 395–399. 23. Barnabas, S., Hai, T., and Andrisani, O. M. (1997) J. Biol. Chem. 272, 20684–20690. 24. Spergel, J. M., Hsu, W., Akira, S., Thimmappaya, B., Kishimoto, T., and Chen-Kiang, S. (1992) J. Virol. 66, 1021–1030. 25. Gluzman, Y. (1981) Cell 23, 175–182. 26. Chlichlia, K., Moldenhauer, G., Daniel, P. T., Busslinger, M., Gazzolo, L., Schirrmacher, V., and Khazaie, K. (1995) Oncogene 10, 269–277. 27. Ueda, K., Pastan, I., and Gottesman, M. (1987) J. Biol. Chem. 262, 17432–17436. 28. Lee, M. E., Dhadly, M. S., Temizer, D. H., Clifford, J. A., Yoshizumi, M., and Quertermous, T. (1991) J. Biol. Chem. 266, 19034– 19039. 29. Nagamoto-Combs, K., Piech, K. M., Best, J. A., Sun, B., and William, A. T. (1997) J. Biol. Chem. 272, 6051–6058. 30. Zhang, Y., and Rom, W. N. (1993) Mol. Cell. Biol. 13, 3831–3827. 31. Zhang, Y., Broser, M., and Rom, W. N. (1994) Proc. Natl. Acad. Sci. USA 91, 2225–2229.
403
AID
BBRC 9142
/
695b$$$201
08-01-98 16:17:16
bbrcg
AP: BBRC
Vol. 249, No. 2, 1998
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
32. Neish, A. S., Khachigian, L. M., Park, A., Baichwal, V. R., and Collins, T. (1995) J. Biol. Chem. 270, 28903–28909. 33. Madsen, C. S., Hershey, J. C., Hautmann, M. B., White, S. L., and Owens, G. K. (1997) J. Biol. Chem. 272, 6332–6340. 34. Kunkel, T. A. (1985) Proc. Natl. Acad. Sci. USA 82, 488–492. 35. Cann, A. J., Koyanagi, Y., and Chen, I. S. Y. (1988) Oncogene 3, 123–128. 36. Kato, S., Nishimura, J., Muta, K., Yufu, Y., Nawata, H., and Ideguchi, H. (1990) Lancet 336, 573. 37. Kuwazuru, Y., Hanada, S., Furukawa, T., Yoshimura, A., Sumizawa, T., Utsunomiya, A., Ishibashi, K., Saito, T., Uozumi, K., Maruyama, M., Ishizawa, M., Arima, T., and Akiyama, S. (1990) Blood 76, 2065–2071. 38. Su, I. J., Chang, I. C., and Cheng, A. L. (1991) Ann.Oncol. 2, 151–155. 39. Gupta, S., Kim, C. H., Tsuruo, T., and Gollapudi, S. (1992) J. Clin. Immunol. 12, 451–458. 40. Gupta, S., Tsuruo, T., and Gollapudi, S. (1992) Adv. Exp. Med. Biol. 323, 39–47. 41. Damiani, D., Michieli, M., Michelutti, A., Geromin, A., Ras-
42. 43. 44. 45.
46. 47. 48. 49. 50.
padori, D., Fanin, R., Savignano, C., Giacca, M., Pileri, S., Mallardi, F., and Baccarani, M. (1993) Haematologica 78, 12–17. Alexandre, C., and Verrier, B. (1991) Oncogene 6, 543–551. Fujii, M., Niki, T., Mori, T., Matsuda, M., Nomura, N., and Seiki, M. (1991) Oncogene 6, 1023–1029. Cornwell, M. M. (1990) Cell Growth Diff. 1, 607–615. Madden, M. J., Morrow, C. S., Nakagawa, M., Goldsmith, M. E., Fairchild, C. R., and Cowan, K. H. (1993) J. Biol. Chem. 268, 8290–8297. Cornwell, M. M., and Smith, D. E. (1993) J. Biol. Chem. 268, 19505–19511. Combates, N., Rzepka, R., Chen, Y., and Cohen, D. (1994) J. Biol. Chem. 269, 29715–29719. Combates, N. J., Kwon, P. O., Rzepka, R. W., and Cohen, D. (1997) Cell Growth Diff. 8, 213–219. Himes, S., Coles, L., Katsikeros, R., Lang, R., and Shannon, M. (1993) Oncogene 8, 3189–3197. Tsukada, J., Misago, M., Serino, Y., Ogawa, R., Murakami, S., Nakanishi, M., Tonai, S., Kominato, Y., Morimoto, I., Auron, P. E., and Eto, S. (1997) Blood 90, 3142–3153.
404
AID
BBRC 9142
/
695b$$$201
08-01-98 16:17:16
bbrcg
AP: BBRC
249, 397–404 (1998)
RC989142
The Mechanism of Trans-activation of the MDR1 Gene by Human T-Cell Leukemia Virus Alan Lau,* Timothy W. Gant,† and Alan J. Cann‡,1 *Wellcome/CRC Institute, Tennis Court Road, Cambridge, CB2 1QR, United Kingdom; and †MRC Toxicology Unit, and ‡Department of Microbiology and Immunology, University of Leicester, Leicester LE1 9HN, United Kingdom
Received June 29, 1998
Overexpression of P-glycoprotein (P-gp), the protein product of the multidrug resistance gene (MDR1), confers a drug resistant phenotype on cells. We have recently demonstrated that the MDR1 promoter is transcriptionally activated by the HTLV-I tax protein, providing an explanation for the development of drug resistance in HTLV-I infections. Here we report that HTLV-I mediated MDR1 activation is dependent on the presence of an NF-IL6-binding site located between base pairs 0148 and 0141 relative to the transcription start site. This finding opens up the possibility of moderating P-gp expression through interference with NFIL6 binding to its trans recognition element and subsequent repression of MDR1 transcription. q 1998 Academic Press
The multiple drug resistance phenotype (MDR) results in broad spectrum resistance to chemotherapy and is a major problem in the chemotherapy of many human malignancies (1). There are several known mechanisms by which an MDR phenotype may arise in cells, but one of the best characterised results from the overexpression of P-glycoprotein (P-gp) (1,2). P-gp is the protein product of the MDR gene family. In humans, the MDR gene family has two members; however, only MDR1 is able to confer a MDR phenotype in transfection analysis (3, 4, 5). P-gp confers a MDR phenotype by pumping a wide spectrum of chemotherapeutic agents (including anthracyclines, vinca alkaloids, epipodophylline and dactinomycins) from the plasma membrane thus preventing their entrance into the cytoplasm. The result is lower intracellular drug concentrations and reduced drug efficacy. Increased transcription of the MDR1 gene has been demonstrated under a number of conditions of involving chemical and physical stress (6, 7). In cells selected in vitro for a 1 Corresponding author. Fax: /44 (0)116 252 5030. E-mail: nna@ le.ac.uk.
multidrug resistance phenotype there is an increased transcription rate in addition to MDR1 gene amplification (8). However, in human maligancies MDR1 gene amplification has not been consistently observed, suggesting that altered regulation is primarily responsible for MDR1 overexpression in these situations. Increased promoter activity is also observed in cells transfected with the MDR1 promoter driving a reporter gene when the cells are exposed to anticancer agents (9). Recently we have shown the enhancement of MDR1-associated drug resistance in freshly isolated PBMCs from HTLVI infected patients (10). Preliminary studies indicated that drug resistance may be induced through the transcriptional up-regulation of MDR1 by the HTLV-I tax trans-activator protein (10,11). Worldwide, 10-20 million people are estimated to be infected with human T-cell leukaemia virus (HTLV) (12). Infection is associated with at least two distinct disease syndromes: adult T-cell leukaemia (ATL), an aggressive T-cell malignancy which occurs worldwide in populations where HTLV-I infection is endemic, and HTLV Associated Myelopathy (HAM) (13). The pathogenesis of these conditions remains unclear. Treatment of ATL patients has traditionally consisted of combination chemotherapy but this approach has limited clinical benefit. Four generations of combination chemotherapy have shown an increase in remission rates from 11 to 42%, but a corresponding improvement in overall or disease-free survival time has not occurred (14,15). Similarly other novel treatments, including bone marrow transplantation, total body irradiation and treatment with interferons b and g, have failed to show clinical improvement. Limited clinical improvement in some patients have been reported using deoxycoformycin (DCF), an adenosine deaminase inhibitor (16), MST-16, a topoisomerase II inhibitor (17), and anti-Tac antibodies (18). Improved remission rates have recently been reported in small studies combining a-interferon and AZT (19, 20). In the present report we describe a genetic analysis of the MDR1 gene promoter which demonstrates that
397
0006-291X/98 $25.00 Copyright q 1998 by Academic Press All rights of reproduction in any form reserved.
AID
BBRC 9142
/
695b$$$201
08-01-98 16:17:16
bbrcg
AP: BBRC
Vol. 249, No. 2, 1998
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
transactivation of this gene by the tax protein critically depends on the presence of an NF-IL6-binding site located between base pairs -148 and -141 relative to the transcription start site. NF-IL6, also known as CCAAT/ enhancer binding protein b (C/EBPb) (21), is a member of the basic-region leucine zipper (bZip) family of proteins known to be activated by the tax protein (22). The bZip proteins are important elements in the transcription factor network, linking individual transactivators such as jun, fos and CREB/ATF via protein-protein interactions to the basal transcriptional machinery. In addition to HTLV, other viral transactivating proteins are known to activate transcription via bZip factors, including NF-IL6. These include the hepatitis B virus X protein (23) and adenovirus E1A protein (24). These observations raise the possibility of new and alternative chemotherapeutic approaches to HTLV-associated diseases, and suggest that other more common virus infections may play an important role in tumour pathology. MATERIALS AND METHODS Cell culture. COS cells (25) were maintained in DMEM medium (Gibco) supplemented with 10% calf serum (Gibco) at 377C, 5% CO2 in a humidified atmosphere. Plasmids. pRK7-tax (26) expresses the HTLV-I tax protein but not the rex protein from the huCMV immediate early promoter. pMDR(/)CAT contains the 1kb PstI-PstI promoter region (0439 to /543) surrounding the transcription start site of the human MDR1 gene derived from plasmid pMDR-P3 (27). The SV40 virus promoter and origin of replication were excised from pSV2CAT (ATCC #37155, positions 1–328) and replaced with the MDR1 fragment in tandem with the CAT gene. Exonuclease-III nested deletions of the MDR1 promoter. All enzymes were purchased from GibcoBRL. 5* and 3* nested deletions of the MDR1 promoter were made by exonuclease-III treatment of the MDR1 promoter in pMDR-P3. 6mg of pMDR-P3 were digested with restriction enzymes BamHI and KpnI (5* promoter deletions) or BssHII and SphI (3* promoter deletions). The DNA was then digested with 455 u exonuclease-III at 307C in exonuclease-III buffer (0.5 M Tris-HCl pH 8.0, 50 mM MgCl2, 100 mg/ml tRNA) for 4 minutes, with 1/10th volume aliquots being removed every 20 seconds. Reactions were immediately stopped by the addition of phenol and the purified by phenol:chloroform extraction. Each purified plasmid DNA aliquot was then blunt-ended by treatment with mung bean nuclease and religated. Deletions were screened by DNA sequencing. Appropriate 5* and 3* MDR1 deletions were selected and subcloned back into pMDR(/)CAT upstream of the CAT gene. 5* MDR1 promoter deletions were named 5*MDR(0x), where x Å the position relative to the transcription start site (/1). 3* MDR1 promoter deletions were named 3*MDR(/x), where x Å the position relative to the transcriptional start site (/1). The nucleotide sequence of the MDR1 promoter insert was fully determined in all clones and no errors were observed. Site-directed mutagenesis of putative MDR1 promoter regulatory elements. Site-directed mutagenesis of the MDR1 promoter was performed using the following oligonucleotide primers: CCCAAGTATTCAGCTGATG (AP1); CAACCTGCCTCACAGTTTCTCG (NF-IL6); GTCAATCCTTATTTGGAGCAGTCATC (SP1).
The known transcription factor binding sites are underlined and the mutated nucleotides shown in bold font. These mutations were known to abolish regulatory element activity, as described previously for AP1 (28, 29), NF-IL6 (30, 31) and SP1 (32, 33). Site-directed mutagenesis of putative AP1, NF-IL6 and SP1 sites in the MDR1 promoter was performed based on the method of Kunkel (34). Briefly, the MDR1 promoter was subcloned from the pMDR-P3 into M13mp19 RF DNA (GibcoBRL). The resulting clone was designated M13-5*MDR1 and transformed into E. coli CJ236. Single stranded DNA templates containing uracil were obtained and mutant AP1, NF-IL6 and SP1 oligonucleotides primers annealed. Oligonucleotide primers were the extended using T7 polymerase (Amersham Life Sciences) and phage plaques obtained by transformation into E. coli JM109 cells. Clones were screened for appropriate mutations by DNA sequencing. Appropriate MDR1 mutants were then subcloned back into the pMDR(/)CAT reporter gene plasmid upstream of the CAT gene. The nucleotide sequence of the MDR1 promoter insert was fully determined in all clones and no errors were observed. Transactivation of the MDR1 promoter by HTLV-I tax. Electroporation of COS cells and chloramphenicol acetyl transferase (CAT) assays were performed as previously described (35) except 3 1 106 COS cells were electroporated at 250 V, 960 mF with 25 mg of total plasmid DNA (12.5 mg of each plasmid co-electroporated). 48 hours after electroporation, cells were harvested and cell extracts obtained by freeze-thaw lysis. All assays were normalized based on total protein concentration using the Bio-Rad protein assay kit. Equivalent amounts of cell lysate were incubated with 4 mM acetyl-CoA (Sigma) and 0.05 mCi [14C]chloramphenicol (ICN) at 377C for 16-18 hours. Reactions were extracted with ethyl acetate then acetylated products resolved by thin layer chromatography and quantified by scintillation counting. Negative controls performed for every assay included pRK7-tax alone, pMDR(0)CAT (MDR1 promoter fragment opposed to the CAT gene) and each deletion/mutant construct alone. None of these controls showed any significant CAT activity, i.e., above the background level seen with cells alone ((10) and data not shown).
RESULTS 5* Deletion Analysis of the MDR1 Promoter A set of 7 exonuclease III deletion mutants retaining from 0310 to 014 nucleotides of sequence upstream of the promoter start site were selected for analysis. COS cells were co-electroporated with 12.5mg of each of the deleted reporter plasmids plus 12.5 mg of pRK7-tax as described in Materials and Methods. Each experiment was repeated 3 times and the mean CAT activity relative to the intact MDR1 promoter in pMDR(/)CAT is shown in figure 1. Promoter deletion mutants retaining at least 0262 nucleotides upstream of the transcription start site were not significantly affected in their ability to be transactivated by the tax protein. However, a deletion mutant containing 0217 nucleotides upstream of the transcription start site showed an increase to 119% of the activity of the intact MDR1 promoter, indicating that a negative transcriptional regulatory element located between positions 0262 and 0217 relative to the transcription start site had been removed. However, the most striking observation from this dataset is the sudden reduction in relative promoter activity to 46% when the deleted region extends to 0118 nucleotides upstream of the transcription start site. This correlates
398
AID
BBRC 9142
/
695b$$$201
08-01-98 16:17:16
bbrcg
AP: BBRC
Vol. 249, No. 2, 1998
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. Exonuclease deletion analysis of 5* sequences in the MDR1 promoter.Progressive 5* promoter deletion mutants in the reporter vector pMDR(/)CAT were constructed and co-electroporated into COS cells with the HTLV-I tax-expressing plasmid pRK7-tax as described in Materials and Methods. The graph (top panel) shows the mean CAT activity from three independent experiments relative to the intact MDR1 promoter in pMDR(/)CAT. The lower panel of the figure shows the same data in summary form.
with the removal of an NF-IL6 (C/EBPb)-binding site located between base pairs 0148 and 0141 relative to the transcription start site (see ‘‘Site-Directed Mutagenesis of Individual Promoter Elements’’ below). Deletions involving residues down to 014 nucleotides from the transcription start site show a further small decline in transactivation (down to 33% of the intact promoter), but no further sudden reductions in activity. 3* Deletion Analysis of the MDR1 Promoter A further set of 7 exonuclease III deletion mutants retaining from /39 to /347 nucleotides of MDR1 se-
quence downstream of the promoter start site were also selected for analysis. COS cells were co-electroporated with 12.5 mg of each of the deleted reporter plasmids plus 12.5 mg of pRK7-tax as described in Materials and Methods. Each experiment was repeated 3 times and the mean CAT activity relative to the intact MDR1 promoter in pMDR(/)CAT is shown in figure 2. These experiments did not reveal any clear pattern of reduced promoter activity, indicating that there are no crucial response elements for tax transactivation located downstream of the transcription start site in the MDR1 promoter.
399
AID
BBRC 9142
/
695b$$$201
08-01-98 16:17:16
bbrcg
AP: BBRC
Vol. 249, No. 2, 1998
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. Exonuclease deletion analysis of 3* sequences in the MDR1 promoter.Progressive 3* promoter deletion mutants in the reporter vector pMDR(/)CAT were constructed and co-electroporated into COS cells with the HTLV-I tax-expressing plasmid pRK7-tax as described in Materials and Methods. The graph (top panel) shows the mean CAT activity from three independent experiments relative to the intact MDR1 promoter in pMDR(/)CAT. The lower panel of the figure shows the same data in summary form.
Site-Directed Mutagenesis of Individual Promoter Elements Based on the above data, site-directed mutagenesis of individual promoter elements was performed as described in Materials and Methods. COS cells were coelectroporated with 12.5 mg of each of the mutated reporter plasmids plus 12.5 mg of pRK7-tax as described in Materials and Methods. Each experiment was repeated twice and the mean CAT activity relative to the intact MDR1 promoter in pMDR(/)CAT is shown in figure 3.
Mutating the AP1 binding site located at 0234 relative to the transcription start site (TGATTCAGrGTATTCAG) did not adversely affect the relative ability of the tax protein to transactivate the promoter (107 { 25% intact promoter activity). Similarly, mutating the SP1 binding site located at 0110 relative to the transcription start site (GGGCCGGGrTTATTTGG) did not greatly affect transactivation of the promoter (109 { 26% intact promoter activity). In contrast, ablation of the NF-IL6 (C/EBPb) binding site located at 0148 to the transcription start site (TTTCGCAGrCCTCACAG) caused a reduction in transactivation to 47 { 7% that
400
AID
BBRC 9142
/
695b$$$201
08-01-98 16:17:16
bbrcg
AP: BBRC
Vol. 249, No. 2, 1998
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 3. Site-directed mutagenesis of the MDR1 promoter.Oligonucleotide-directed mutants of selected sites in the reporter vector pMDR(/)CAT were constructed and co-electroporated into COS cells with the HTLV-I tax-expressing plasmid pRK7-tax as described in Materials and Methods. The graph (top panel) shows the mean CAT activity from two independent experiments relative to the intact MDR1 promoter in pMDR(/)CAT. The lower panel of the figure shows the same data in summary form.
of the intact promoter. This correlates almost exactly with the results obtained when this motif is removed by progressive 5* deletions, indicating that this site is the major factor for influencing transactivation of the MDR1 promoter by tax. DISCUSSION P-gp expression on ATL cells has been reported previously (36, 37, 38) using immunoblotting and a monoclonal antibody (C219). C219 has affinity for both the MDR1 and MDR2 gene products and therefore it is not
conclusive that the expression seen previouslly of ATL cells is from the resistance conferring MDR1 gene. However, the report by Kuwazuru et al (37) also showed P-gp-like photoaffinity drug labelling and MDR1 RNA in cells from a single ATL patient after clinical relapse, suggesting that the P-gp overexpressed was from the MDR1 gene. These reports did not correlate P-gp expression with cellular drug resistance activity and did not include appropriate controls from nonHTLV infected subjects. P-gp has subsequently been found to be expressed at low levels on normal lymphocytes (39, 40, 41). Hence, the actual enhancement of
401
AID
BBRC 9142
/
695b$$$201
08-01-98 16:17:16
bbrcg
AP: BBRC
Vol. 249, No. 2, 1998
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
P-gp expression in ATL cells over normal lymphocyte cell populations was unclear. We addressed this question in a study of P-gp expression and activity in lymphocytes from HTLV-I-infected subjects and non-infected controls and showed that the mechanism of P-gp expression in HTLV-I-infected subjects is due to transcriptional activation in trans (transactivation) by the tax protein (10). Trans-activation of MDR1 in HTLV-I transformed cell lines was also suggested by Chuang et al (11). The HTLV-I trans-activator protein, tax, is a 40 kDa non-structural nuclear protein encoded by a doubly spiced sub-genomic viral mRNA (13). The tax protein is a positive transactivator of both viral and cellular transcription and is thought to be the main cause of cellular transformation, due to aberrant expression of a large range of heterologous cellular genes. The mechanism of tax transactivation is indirect, mediating enhanced transcription through interactions with cellular transcription factors rather than by direct binding to DNA. Such transcription factors include the cAMP-responsive element binding protein/activating transcription factor (CREB/ATF), NF-kB and serum response factor (SRF) families (22). HTLV-I tax up-regulates c-fos (42) and HTLV-infected cells show increased AP1 binding activity (43). In this report, we have investigated the molecular mechanism by which the tax protein leads to overexpression of the MDR1 gene. Although the assays in this report were performed in COS cells, similar transactivation of MDR1 occurs in T-cells ((10) plus additional data not shown). Using exonuclease III deletion analysis of the MDR1 promoter driving expression of a CAT reporter gene co-transfected with a tax expression vector, we found that a deletion mutant containing 0217 nucleotides upstream of the transcription start site showed a modest increase in promoter activity to 119% of the activity of the intact MDR1 promoter, indicating a possible negative transcriptional regulatory element located between positions 0262 and 0217 relative to the transcription start site. Inspection of this region revealed a number of potential transcription factor binding sites which could cause this effect, including a CCAAT box at 0238 and an AP1 binding site at 0234 but this was not further investigated. However, the most striking observation from the 5* deletion mutants is the sudden reduction in relative promoter activity to 46% when the deleted region extends to 0118 nucleotides upstream of the transcription start site. This correlates with the removal of an NF-IL6 (C/EBPb)-binding site located between base pairs 0148 and 0141 relative to the transcription start site. Deletions involving further residues down to 014 nucleotides from the transcription start site show a further small decline in transactivation (down to 33% of the intact promoter), but no further sudden reductions in activity. Thus the presence of the NF-IL6 bind-
ing site appears to be critical for transactivation of the human MDR1 promoter by tax and this was further investigated by site-directed mutagenesis of this promoter element (see below). Progressive exonuclease III deletion analysis of 3* sequences downstream of the transcription start site in the MDR1 promoter was carried out because of previous reports that sequences downstream of the start site nucleotides are essential for proper initiation of transcription (44, 45). However, our experiments did not reveal any clear pattern of reduced promoter activity (figure 2). There is a possible suggestion of the presence of a negative regulatory element located between nucleotides /39 and /108, but this was not further investigated. Our conclusion is that there are no crucial elements for tax transactivation of the MDR1 gene located downstream of the transcription start site. To further investigate the above observations, we carried out oligonucleotide-directed mutagenesis of selected promoter elements (figure 3). Mutations were introduced into transcription factor binding sites identified by analysis of the MDR1 promoter sequence and from the results of the deletion analysis described above. All mutations were chosen to cause minimal disruption to the overall structure of the promoter while having been shown previously to eliminate binding of the respective transcription factors (see Materials and Methods). Alteration of an AP1 binding site located at 0234 relative to the transcription start site did not greatly affect the relative ability of the tax protein to transactivate the promoter (107 { 25% intact promoter activity). Similarly, mutating the SP1 binding site located at 0110 relative to the transcription start site did not adversely affect transactivation of the promoter (109 { 26% intact promoter activity). There is a previous report of a six-fold increase in the basal activity of the MDR1 promoter when this sequence is mutated (46). However, our data suggest that the negative regulatory effect of this region would seem to apply to basal promoter activity but not to transactivation by tax. The influence of a further G-rich sequence located at 061 to 043 to which both SP1 and EGR-1 bind specifically and deletion of which was reported to reduce basal promoter activity five-fold (46) was not examined. However, deletion analysis of this region did not reveal any significant reduction in promoter activity (figure 1). Therefore we conclude that interactions with AP1 or SP1 are not the major mechanism involved in tax transactivation of the MDR1 gene as revealed by the CAT reporter assay. This was unexpected since tax is known to be able to stimulate transcription from a range of other promoters by interacting with both of these factors (13). In contrast, destruction of the NF-IL6 (C/EBPb) binding site located at 0148 to the transcription start site caused a reduction in transactivation to 47% that of the intact promoter, indicating that this site is im-
402
AID
BBRC 9142
/
695b$$$201
08-01-98 16:17:16
bbrcg
AP: BBRC
Vol. 249, No. 2, 1998
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
portant for transactivation of the MDR1 promoter by tax (figure 3). NF-IL6 (or C/EBP-b), a bZIP motif-containing member of the C/EBP (CCAAT enhancer binding protein) family of transcription factors involved in regulating cytokine IL-6 transcription (21), has been associated with transactivation of MDR1 promoter (47, 48). This suggests a possible mechanism for transactivation of MDR1 by tax, since the tax protein is capable of modulating transcription factors through interactions with the basic domain of bZIP proteins, increasing dimerisation and DNA binding affinities (13). A similar mechanism is likely to occur with NF-IL6, whereby associations with tax via the bZIP domain may lead to increased active NF-IL6 dimers and up-regulation of MDR1 transcription, overexpression of P-gp and development of the MDR phenotype. Tax has been shown to be able to modulate G-CSF expression (49) and the human prointerleukin-1b gene (50) via interactions with NF-IL6. Of the possible mechanisms of transactivation of the MDR1 promoter by the HTLV tax protein, we have observed no evidence that AP1 or SP1 interactions are involved. Rather, interaction of tax with NFIL6 is the key event in upregulation of MDR1 expression by tax. The data presented in this paper reveal the molecular mechanism by which the HTLV-I tax protein transactivates the MDR1 gene and clarifies the involvement of HTLV infection in the induction of multiple drug resistance phenotypes. Moreover, these data raise the possibility that other virus infections may also lead to tumours with multiple drug-resistant phenotypes by the same molecular mechanism. For example, it has recently been shown that the hepatitis B virus X protein interacts with bZip proteins and enhances transcriptional activation by NF-IL6 (23). It is possible that other virus-encoded trans-acting factors may have similar influences, for example the adenovirus E1A protein and herpes simplex ICP0/ICP4 proteins, which have complex mechanisms of action. We are currently investigating whether these common virus infections are indeed able to interact with the human MDR1 promoter in a similar or analogous way to the HTLV-I tax protein, since this would have serious implications for tumour pathogenesis in a very large number of infected individuals. ACKNOWLEDGMENTS This work was funded in part by MRC grant G9622810. We are grateful to Konstantinos Kaltsas for making p3*MDR(/347).
REFERENCES 1. Gottesman, M., and Pastan, I. (1993) Annu. Rev. Biochem. 63, 385–427. 2. Endicott, J. A., and Ling, V. (1989) Annu. Rev. Biochem. 58, 137– 171.
3. Gros, P., Fallows, D. A., Croop, J. M., and Housman, D. E. (1986) Mol. Cell. Biol. 6, 3785–3790. 4. Sugimoto, Y., and Tsuruo, T. (1987) Cancer Res. 47, 2620–2625. 5. Ueda, K., Cardarelli, C., Gottesman, M. M., and Pastan, T. (1987) Proc. Natl. Acad. Sci. USA 84, 3004–3008. 6. Chin, K., Tanaka, S., Darlington, G., Pastan, I., and Gottesman, M. M. (1990) J. Biol. Chem. 265, 221–226. 7. Uchiumi, T., Kohno, K., Tanimura, H., Matsuo, K., Sato, S., Uchida, Y., and Kuwano, M. (1993) FEBS Letts. 326, 11–16. 8. Morrow, C. S., Chiu, J., and Cowan, K. H. (1992) J. Biol. Chem. 267, 10544–10550. 9. Kohno, K., Sato, S., Takano, H., Matsuo, K., and Kuwano, M. (1989) Biochem. Biophys. Research. Commun. 165, 1415–1421. 10. Lau, A., Nightingale, S., Taylor, G. P., Gant, T. W., and Cann, A. J. (1998) Blood 91, 2467–2474. 11. Chuang, S., Doong, S., Lin, M., and Cheng, A. (1997) Biochem. Biophys. Research. Commun. 238, 482–486. 12. De The´, G., and Bomford, R. (1993) AIDS Res. Hum. Ret. 9, 381– 386. 13. Cann, A., and Chen, I. (1996) in Fields Virology, pp.1501–1527, Raven Press, New York. 14. Minato, K., Araki, K., and Hanada, S. (1991) Int. J. Hematol. 54, 179. 15. Shimoyama, M. (1992) Treatments of Patients with Adult T-Cell Leukemia/Lymphoma. Japan Scientific Societies Press, Tokyo. 16. Dearden, C., Matutes, E., and Catovsky, D. (1991) Brit. J. Cancer 64, 903–906. 17. Ohno, R., Masaoka, T., Shirakawa, S., Sakamoto, S., Hirano, M., Hanada, S., Yasunaga, K., Yokomaku, S., Mitomo, Y., Nagai, K., Yamada, K., and Furue, H. (1993) Cancer 71, 2217–2221. 18. Waldmann, T. A., White, J. D., Goldman, C. K., Top, L., Grant, A., Bamford, R., Roessler, E., Horak, I. D., Zaknoen, S., and Kasten-Sportes, C. (1993) Blood 82, 1701–1712. 19. Gill, P. S., Harrington, W., Kaplan, M. H., Ribeiro, R. C., Bennett, J. M., Liebman, H. A., BernsteinSinger, M., Espina, B. M., Cabral, L., Allen, S., Kornblau, S., Pike, M. C., and Levine, A. M. (1995) New Engl. J. Med. 332, 1744–1748. 20. Hermine, O., Bouscary, D., Gessain, A., Turlure, P., Leblond, V., Franck, N., Buzyn, V., A., Rio, B., Macintyre, E., Dreyfus, F., and Bazarbachi, A. (1995) New Engl. J. Med. 332, 1749–1751. 21. Akira, S., Isshiki, H., Sugita, T., Tanabe, O., Kinoshita, S., Nishio, Y., Nakajima, T., Hirano, T., and Kishimoto, T. (1990) EMBO J. 9, 1897–1906. 22. Wagner, S., and Green, M. R. (1993) Science 262, 395–399. 23. Barnabas, S., Hai, T., and Andrisani, O. M. (1997) J. Biol. Chem. 272, 20684–20690. 24. Spergel, J. M., Hsu, W., Akira, S., Thimmappaya, B., Kishimoto, T., and Chen-Kiang, S. (1992) J. Virol. 66, 1021–1030. 25. Gluzman, Y. (1981) Cell 23, 175–182. 26. Chlichlia, K., Moldenhauer, G., Daniel, P. T., Busslinger, M., Gazzolo, L., Schirrmacher, V., and Khazaie, K. (1995) Oncogene 10, 269–277. 27. Ueda, K., Pastan, I., and Gottesman, M. (1987) J. Biol. Chem. 262, 17432–17436. 28. Lee, M. E., Dhadly, M. S., Temizer, D. H., Clifford, J. A., Yoshizumi, M., and Quertermous, T. (1991) J. Biol. Chem. 266, 19034– 19039. 29. Nagamoto-Combs, K., Piech, K. M., Best, J. A., Sun, B., and William, A. T. (1997) J. Biol. Chem. 272, 6051–6058. 30. Zhang, Y., and Rom, W. N. (1993) Mol. Cell. Biol. 13, 3831–3827. 31. Zhang, Y., Broser, M., and Rom, W. N. (1994) Proc. Natl. Acad. Sci. USA 91, 2225–2229.
403
AID
BBRC 9142
/
695b$$$201
08-01-98 16:17:16
bbrcg
AP: BBRC
Vol. 249, No. 2, 1998
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
32. Neish, A. S., Khachigian, L. M., Park, A., Baichwal, V. R., and Collins, T. (1995) J. Biol. Chem. 270, 28903–28909. 33. Madsen, C. S., Hershey, J. C., Hautmann, M. B., White, S. L., and Owens, G. K. (1997) J. Biol. Chem. 272, 6332–6340. 34. Kunkel, T. A. (1985) Proc. Natl. Acad. Sci. USA 82, 488–492. 35. Cann, A. J., Koyanagi, Y., and Chen, I. S. Y. (1988) Oncogene 3, 123–128. 36. Kato, S., Nishimura, J., Muta, K., Yufu, Y., Nawata, H., and Ideguchi, H. (1990) Lancet 336, 573. 37. Kuwazuru, Y., Hanada, S., Furukawa, T., Yoshimura, A., Sumizawa, T., Utsunomiya, A., Ishibashi, K., Saito, T., Uozumi, K., Maruyama, M., Ishizawa, M., Arima, T., and Akiyama, S. (1990) Blood 76, 2065–2071. 38. Su, I. J., Chang, I. C., and Cheng, A. L. (1991) Ann.Oncol. 2, 151–155. 39. Gupta, S., Kim, C. H., Tsuruo, T., and Gollapudi, S. (1992) J. Clin. Immunol. 12, 451–458. 40. Gupta, S., Tsuruo, T., and Gollapudi, S. (1992) Adv. Exp. Med. Biol. 323, 39–47. 41. Damiani, D., Michieli, M., Michelutti, A., Geromin, A., Ras-
42. 43. 44. 45.
46. 47. 48. 49. 50.
padori, D., Fanin, R., Savignano, C., Giacca, M., Pileri, S., Mallardi, F., and Baccarani, M. (1993) Haematologica 78, 12–17. Alexandre, C., and Verrier, B. (1991) Oncogene 6, 543–551. Fujii, M., Niki, T., Mori, T., Matsuda, M., Nomura, N., and Seiki, M. (1991) Oncogene 6, 1023–1029. Cornwell, M. M. (1990) Cell Growth Diff. 1, 607–615. Madden, M. J., Morrow, C. S., Nakagawa, M., Goldsmith, M. E., Fairchild, C. R., and Cowan, K. H. (1993) J. Biol. Chem. 268, 8290–8297. Cornwell, M. M., and Smith, D. E. (1993) J. Biol. Chem. 268, 19505–19511. Combates, N., Rzepka, R., Chen, Y., and Cohen, D. (1994) J. Biol. Chem. 269, 29715–29719. Combates, N. J., Kwon, P. O., Rzepka, R. W., and Cohen, D. (1997) Cell Growth Diff. 8, 213–219. Himes, S., Coles, L., Katsikeros, R., Lang, R., and Shannon, M. (1993) Oncogene 8, 3189–3197. Tsukada, J., Misago, M., Serino, Y., Ogawa, R., Murakami, S., Nakanishi, M., Tonai, S., Kominato, Y., Morimoto, I., Auron, P. E., and Eto, S. (1997) Blood 90, 3142–3153.
404
AID
BBRC 9142
/
695b$$$201
08-01-98 16:17:16
bbrcg
AP: BBRC