- Email: [email protected]
CREB signaling pathway is involved in atrazine induced hippocampal neurotoxicity in Sprague Dawley rats
Ecotoxicology and Environmental Safety 170 (2019) 673–681
Contents lists available at ScienceDirect
Ecotoxicology and Environmental Safety journal homepage: www.elsevier.com/locate/ecoenv
The MEK/ERK/CREB signaling pathway is involved in atrazine induced hippocampal neurotoxicity in Sprague Dawley rats
T
Jianan Lia, Xueting Lia, Haoran Bib, Baixiang Lia,
⁎
a b
Department of Toxicology, College of Public Health, Harbin Medical University, 157 Baojian Road, Nan Gang District, Harbin 150081, China Department of Epidemiology, College of Public Health, Harbin Medical University, 157 Baojian Road, Nan Gang District, Harbin 150081, China
ARTICLE INFO
ABSTRACT
Keywords: Atrazine Hippocampus Neurotoxicity MEK/ERK/CREB signaling pathway
Atrazine (ATR) is a commonly used artificial synthetic herbicide world-wide, which has been implicated as a potential threat to human health. Previous studies have demonstrated that exposure to ATR affects hippocampus-dependent learning and memory in rodents, but the exact molecular mechanism remains to be elucidated. In this study, we investigated the effect of ATR on the hippocampus of postnatal day 35 male Sprague Dawley (SD) rats administered doses of either 10 or 100 mg/kg body weight (BW)/day of ATR for a period of 30 days. A Morris water maze (MWM) test revealed that ATR treatment impaired memory performance in the spatial probe test, especially amongst the high-dose group. Moreover, analysis by electron microscopy showed that hippocampal neuron ultrastructure in the dentate gyrus (DG) and cornu ammonis 1 (CA1) sub-regions was impaired in the ATR-treated groups. Finally, a downregulation in the mRNA and protein expression levels of members of the MEK/ERK/CREB pathway and downstream factors brain-derived neurotrophic factor (BDNF) and Zif268 was observed in hippocampal tissue following ATR treatment. Taken together, these results suggest that developmental exposure to ATR is able to induce functional and morphological lesions in the hippocampus of SD rats, and that the MEK/ERK/CREB signaling pathway may be involved in this process.
1. Introduction Atrazine (6-chloro-N-ethyl-N′-(1-methylethyl)-1,3,5-triazine-2,4diamine, ATR) is a form of chlorotriazine herbicide, which has been extensively utilized world-wide. ATR is able to selectively kill a variety of weeds, functioning by disrupting the electron transport chain in the chloroplast, thereby inhibiting photosynthesis (Eldridge et al., 1999). Due to the widespread application of ATR, it is considered an environmental contaminant. It has been detected in both the atmosphere and groundwater, and is even detectable in food and drinking water (Meffe and de Bustamante, 2014; Gammon et al., 2005; Wang et al., 2012). Of particular concern, persistent ATR and its metabolites have also been found in human bodies (Bouvier et al., 2006). Despite its prevalence, the deleterious effects of ATR exposure on humans are still unclear. Epidemiological studies have demonstrated that exposure to ATR may impact reproductive and developmental processes (Jowa and Howd, 2011). Furthermore, a large number of animal studies have
indicated that ATR can have adverse effects on the endocrine, reproductive and developing central nervous systems (CNS) (Abarikwu et al., 2010; Foradori et al., 2011; Bardullas et al., 2011). In addition, numerous studies using both behavioral and biochemical methods have suggested that ATR may act as a dopaminergic system toxin (Bardullas et al., 2011; Rodríguez et al., 2013). Recently, neurobehavioral studies have found that ATR may also affect hippocampus-dependent learning and memory in rodents. Bardullas et al. showed that male SD rats exposed to ATR at a dose of 10 mg/kg BW displayed more errors in a learning and memory task (Bardullas et al., 2011). Similar findings were also observed in a Y-maze spontaneous alternation test amongst male Wistar rats exposed to ATR at a dose of 300 mg/kg BW for 7 days (Kale et al., 2018). Additionally, Lin et al. found that male C57BL/6 mice exposed to 25 mg/kg BW of ATR for 10 days showed diminished performance in a novel object recognition (NOR) task (Lin et al., 2013). Despite ATR having been proven to affect hippocampus-dependent learning and memory
Abbreviations: ATR, Atrazine; PND, Postnatal day; CNS, Central nervous system; MEK1/2, Mitogen-activated protein kinase kinase 1/2; ERK1/2, Extracellular signal-regulated kinase 1/2; cAMP, Cyclic adenosine monophosphate; CREB, cAMP response element-binding protein; BDNF, Brain derived neurotrophic factor; IEG, Immediate early gene; zif268, Zinc finger protein 225; MWM, Morris water maze; RT-PCR, Reverse transcription-polymerase Chain reaction; PBS, Phosphate buffered solution; TBST, Tris-buffered saline with Tween 20 ⁎ Corresponding author. E-mail address: [email protected] (B. Li). https://doi.org/10.1016/j.ecoenv.2018.12.038 Received 25 September 2018; Received in revised form 10 December 2018; Accepted 12 December 2018 0147-6513/ © 2018 Elsevier Inc. All rights reserved.
Ecotoxicology and Environmental Safety 170 (2019) 673–681
J. Li et al.
functions, especially during development, the underlying mechanisms remain poorly understood. The hippocampus plays a critical role in learning and memory. In particular, hippocampal synaptic plasticity is crucial for the conversion of short-term information into long-term memories (Waltereit and Weller, 2003). Activation of the mitogen activated protein kinase (MAPK) signaling pathway, whose members include the extracellular signal-regulated kinase 1/2 (ERK1/2), has been shown to be a key molecular mechanism underlying hippocampal synaptic plasticity (Selcher et al., 1999). In order to initiate synaptic plasticity, ERK1/2 must first be phosphorylated by mitogen-activated protein kinase 1/2 (MEK1/2), after which it exerts a cascade of effects by phosphorylating the cAMP response element-binding protein (CREB) (Grewal et al., 2000). Phosphorylated CREB (p-CREB) mediates the induction of several immediate early genes (IEGs), which regulate hippocampal synaptic plasticity (Treisman, 1996). Interestingly, recent studies have demonstrated that exposure to ATR may affect ERK1/2 and its downstream signaling pathway elements in the Leydig and granulosa cells of rats (Fa et al., 2013; Karmaus and Zacharewski, 2015; Pogrmic-Majkic et al., 2016). In the present study, we examined rats during a critical CNS developmental period in order to characterize the hippocampal neurotoxicity induced by ATR at different dosages. We firstly detected hippocampal defects using a MWM test and electron microscopy. Additionally, we used neurochemical methods to demonstrate that ATR influences the MEK/ERK/CREB signaling pathway and its downstream pathway members, which are known to be involved in hippocampal learning and memory. The results of this study will inform future investigations into the adverse effects of ATR on the hippocampus at molecular level.
Fig. 1. Body weight of each group on different weeks. Each point represents the mean ± S.E.M, twenty rats per group.
test, following the protocol previously described by Vorhees et al (Vorhees and Williams, 2006). The maze consisted of a circular black tank (180 cm in diameter and 58 cm deep) filled with water (about 50 cm deep) at a temperature of 19–22 °C. Extra-maze cues were placed surrounding the apparatus. The water tank was divided into four equal quadrants: north-west, north-east, south-west, and south-east. A circular platform (10 cm in diameter) was located approximately 2 cm below the water surface in the north-east quadrant. The test period was divided into two phases. Phase one (place navigation test): Rats received four training sessions each day for 5 consecutive days. For each training session, rats were placed into the water facing the tank wall in a set of semi-randomly selected distal starting positions each day. The escape latency, measured as the time required for rats to reach the platform, was recorded for up to 90 s. Rats were kept on the platform for 10 s before removal. Rats that failed to find the platform within 90 s were gently guided to the platform, where they were allowed to stay for 10 s. Phase two (spatial probe test): On the day following the place navigation test, rats received a 90 s spatial probe test in which the platform was removed and the starting position was changed to a novel one. The platform crossing times, percentage of time spent in the target quadrant and the time spent in the pre-defined annulus surrounding the target were recorded over a 90 s period (Blokland et al., 2004).
2. Materials and methods 2.1. Ethics statement All experiments in the present study were approved by the Medical Ethics Committee of Harbin Medical University (Harbin, China), and all animals were treated in accordance with the Guidelines for the Care and Use Laboratory Animals established by the National Institutes of Health.
2.4. Transmission electron microscopy Rats were anesthetized by injection of sodium pentobarbital, and the hippocampus were removed and fixed in 2% glutaraldehyde in 0.01 mol/L PBS for 48 h at 4 °C. Then, fixed hippocampus were cut into 1 mm3 pieces and fixed again in a 1% osmium tetroxide solution for 2 h, dehydrated and embedded in resin. Ultrathin sections were cut, stained with lead citrate and observed with a transmission electron microscope (JEM-2100; JEOL Ltd., Tokyo, Japan).
2.2. Animals and ATR exposure Sixty male SD rats (aged 3 weeks, BW 40–50 g) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China) and housed under a 12 h inverted dark/light cycle at a constant temperature of 20–22 °C, and a relative humidity of 50%. Rats were allowed to acclimatize for 2 weeks, and were then randomly assigned to three groups (20 rats in each group): a control group (1% methyl cellulose; Sigma–Aldrich Corporation, St. Louis, MO, USA); a low-dose group (10 mg/kg BW ATR, 98% pure; Trust Chem Co., Ltd., Shanghai, China), and a high-dose group (100 mg/kg BW ATR). The rats received an oral gavage of ATR or methyl cellulose (controls) each day for a period of 30 days, and were weighed once per week. ATR dosages were selected based on the lowest observed dose leading to adverse hippocampal function in rats (Bardullas et al., 2011). On postnatal day 90 (PND 90), eight rats from each group were randomly chose for behavioral test, six rats from each group were randomly chose for transmission electron microscopy, the additional rats were euthanized by injection of pentobarbital sodium, and the hippocampus was immediately isolated and snap-frozen for the subsequent experiments.
2.5. RNA collection and reverse transcription-polymerase chain reaction (RT-PCR) analysis Total RNA was extracted from hippocampal tissue using TRIzol Reagent and reverse transcribed into cDNA using the SYBR Premix Ex Taq II Reagent Kit and gDNA Eraser, according to the manufacturer's instructions (Takara Bio, Inc., Shiga, Japan). The rat-specific primers used to examine the mRNA expression levels of MEK1/2, ERK1/2, CREB, BDNF, and Zif268 were as follows (Generay Biotech, Co., Ltd., Shanghai, China): β-actin (forward: GAGAGGGAAATCGTGCGT; reverse: GGAGGAAGAGGATGCGG); MEK1 (forward: ATCAGGAGGAGG AATGGGGTA; reverse: AACTCTGCGATTTTGGGGTCA); MEK2 (forward: TCTAGTTCCTTGGCATCAGGT; reverse: CTCATTTGTAGGGACA CGCTC); ERK1 (forward: TCAGGACCTCATGGAGACGGA; reverse: CGCAGGTGGTGTTGATAAGCAG); ERK2 (forward: ATTGGTCAGGACA AGGGCTCAG; reverse: TCAAAGGAGTCAAGAGTGGGTAAGC); CREB (forward: CCCCTGGAGTTGTTATGGCGT; reverse: ATTCTCTTGCTGCT
2.3. MWM test Spatial learning and memory abilities were measured using a MWM 674
Ecotoxicology and Environmental Safety 170 (2019) 673–681
J. Li et al.
Fig. 2. (A) Escape latency in the Morris water maze test on different training days. (B) Platform crossing times. (C) Percentage of time in the target quadrant. (D) Time spend in the pre-defined annulus surrounding the target. Each column represents the mean ± S.E.M, eight rats per group, * p < 0.05 vs. the control group, ** p < 0.01 vs. the control group.
TCCCTGTTCT); BDNF (forward: TCTACGAGACCAAGTGTAATCCCAT; reverse: GAAGTGTCTATCCTTATGAACCGC); and Zif268 (forward: TTGTCTGCTTTCTTGTCCTTC; reverse: TTCAGTCGTAGTGACCACCTT). The relative mRNA expression level of each target gene was normalized to β-actin by the following formula: ΔCT = (CTtarget − CTβ-actin); ΔΔCT = (CTtarget − CTβ-actin) treatment - (CTtarget − CTβ-actin) control. The value of 2−ΔΔCT was selected to calculate the relative expression level of each target mRNA.
polyclonal primary Ab, diluted 1:1000 in blocking buffer; ab208780; Abcam Limited), along with β-actin (anti-β-actin polyclonal Ab, diluted 1:1000 in blocking buffer; YT0099; Immuno Way Biotechnology Company). The following day, membranes were washed six times in TBST and incubated with HRP-conjugated goat anti-rabbit IgG Ab as the secondary Ab (diluted 1:5000 in blocking buffer; RS2115; ImmunoWay Biotechnology Company) for 1 h at 24–26 °C. After washing six times in TBST buffer, membranes were incubated with a commercial western blot detection kit (Beyotime Institute of Biotechnology) for 1 min. The resulting immuno-reactive bands were visualized using a chemiluminescence system (Tanon-5200; Tanon Science & Technology Co., Ltd., Shanghai, China) and analyzed with ImageJ software (v 1.51; NIH, Bethesda, MD, USA).
2.6. Western blot analysis Total protein was extracted from hippocampal tissue using lysis buffer containing phenylmethane sulfonyl fluoride and phosphatase inhibitor (Beyotime Institute of Biotechnology, Shanghai, China). After incubation for 1 h at 4 °C, the mixture was centrifuged at 12,000g for 10 min at 4 °C. Lysis supernatant was collected and a commercial bicinchoninic acid protein assay kit (Beyotime Institute of Biotechnology) was used to detect the protein concentration. Total protein (80 mg) was separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (10%, or 15%) and then transferred to a polyvinylidene fluoride membrane. Membranes were blocked using 1% bovine serum albumin in Tris-buffered saline with Tween 20 (TBST) for 1 h at 24–26 °C. Membranes were then incubated overnight at 4 °C in primary antibodies (Ab) against MEK1/2 (anti-MEK1/2 polyclonal primary Ab, diluted 1:1500 in blocking buffer; YT2714; ImmunoWay Biotechnology Company, Plano, TX, USA), p-MEK1/2 (anti-p-MEK1/2 polyclonal primary Ab, diluted 1:1000 in blocking buffer; phospho Ser218/222; YP0167; ImmunoWay Biotechnology Company), ERK1/2 (anti-ERK1/2 polyclonal primary Ab, diluted 1:1500 in blocking buffer; YT1625; ImmunoWay Biotechnology Company), p-ERK1/2 (anti-p-ERK1/2 polyclonal primary Ab, diluted 1:1000 in blocking buffer; phospho Thr202/Tyr204; YP1197; Immuno Way Biotechnology Company), CREB (anti-CREB polyclonal primary Ab, diluted 1:1000 in blocking buffer; YT1097; Immuno Way Biotechnology Company), p-CREB (antip-CREB polyclonal primary Ab, diluted 1:1000 in blocking buffer; phospho Ser133; YP0075; Immuno Way Biotechnology Company), BDNF (anti-BDNF polyclonal primary Ab, diluted 1:1500 in blocking buffer; ab108319; Abcam Limited, Cambridge, UK), or Zif68 (anti-Zif68
2.7. Statistical analyses All experimental results were analyzed using SPSS 18.0 software (SPSS, Inc., Chicago, IL, USA), and are represented as the mean ± standard error of the mean (SEM). Differences of body weight and escape latency in the MWM test were analyzed with a repeated-measures two-way analysis of variance (ANOVA). Other data were analyzed with a one-way ANOVA. The Dunnett's multiple comparison test was used for pairwise comparisons. P values less than 0.05 (p < 0.05) were considered statistically significant. 3. Results 3.1. Effects of ATR exposure on BW and general physical status The rats in each group gained body weight normally with the increased weeks. No obvious toxicity was observed following ATR treatment. No significant treatment-related differences in BW and general physical status were observed during the experimental period (Fig. 1, ANOVA: group effect: F(2,57) = 0.37, p = 0.70; time effect: F(10,570) = 1912.40, p < 0.01; interaction effect between group and time: F(20,570) = 0.48, p = 0.74), as reported previously (Bardullas et al., 2011; Lin et al., 2013). 675
Ecotoxicology and Environmental Safety 170 (2019) 673–681
J. Li et al.
Fig. 3. Effects of atrazine (ATR) on the ultrastructural features in the DG subregion of the hippocampal neurons via transmission electron microscopy: control group: (A) 20,000 ×; low-dose group: (B) 20000 ×; high-dose group: (C) 20,000 ×. Effects of ATR exposure on the ultrastructural features of the hippocampal synapses via transmission electron microscopy: control group: (D) 30,000 ×; low-dose group: (E) 30,000 ×; high-dose group: (F) 30,000 ×. Six rats per group. Obvious changes are marked with different arrows; black arrows: normal karyolemma; black arrows with a white edge: fuzzy karyolemma; white arrows: normal mitochondria; white arrows with a black edge: swollen mitochondria; gray arrows: normal synaptic clefts.
3.2. Effects of ATR exposure on spatial learning and memory
in the control group was abundant and replete with mitochondria, Golgi bodies, and endoplasmic reticulum. The nuclei were clear with smooth karyolemma bilayers and chromatin hypodispersion (Fig. 3A). Conversely, in ATR-treated groups, nuclei displayed a blurred and shriveled karyolemma, as well as mitochondrial swelling, reduced cristae and vacuolar degeneration was also observed (Fig. 3B and C). There were no significant changes observed to synaptic structures amongst all groups (Fig. 3D, E and F). The effect of ATR on neuron ultrastructural features in the CA1 hippocampal sub-region are shown in Fig. 4. Changes induced by ATR in the CA1 sub-region were similar to that observed in the DG subregion. Neurons in the control group showed a normal cell morphology (Fig. 4A). However, ATR-treatment not only led to karyolemma and mitochondria degeneration but also increased the number of lysosomes in the CA1 sub-region, especially in the high-dose group (Fig. 4B and C). In addition, neurons in the control group displayed an abundance of synaptic vesicles in the presynaptic membrane and clearly defined synaptic clefts (Fig. 4D), whereas unclearly defined synaptic clefts were frequently observed in the ATR-treated groups (Fig. 4E and F).
In the place navigation test, the escape latency decreased in all groups with increased training days. The escape latency was slightly longer in the ATR-treated groups vs. the control group, but the differences were not statistically significant (Fig. 2A, ANOVA: group effect: F(2,21) = 0.42, p = 0.66; time effect: F(4,84) = 70.31, p < 0.01; interaction effect between group and time: F(8,84) = 0.27, p = 0.95). In the spatial probe test, the platform crossing times significantly decreased in both the low-dose ATR group and the high-dose ATR group, the low-dose group displaying shorter times than the high-dose group (Fig. 2B, ANOVA: F(2,21) = 10.58, p < 0.01; control vs. lowdose: p < 0.01, control vs. high-dose: p < 0.01). The percentage of time spent in the target quadrant (Fig. 2C, ANOVA: F(2,21) = 8.11, p < 0.01; control vs. low-dose: p = 0.02, control vs. high-dose: p < 0.01) and the time spent in the annulus (Fig. 2D, ANOVA: F(2,21) = 4.62, p = 0.02; control vs. low-dose: p = 0.04, control vs. high-dose: p = 0.03) were significantly lower in ATR-treated groups vs. the control group. These results suggest that exposure to ATR might impair spatial memory abilities in rats.
3.4. Effects of ATR exposure on mRNA expression levels
3.3. Effects of ATR exposure on the ultrastructural features of hippocampal neurons
The relative mRNA expression levels of MEK1/2, ERK1/2, CREB, BDNF, and Zif268 in the hippocampus following ATR treatment is displayed in Fig. 5. ATR treatment significantly decreased the level of MEK1 mRNA expression in the high-dose group (Fig. 5A, ANOVA:
The effect of ATR on neuron ultrastructural features in the DG hippocampal sub-region are shown in Fig. 3. The cytoplasm of neurons 676
Ecotoxicology and Environmental Safety 170 (2019) 673–681
J. Li et al.
Fig. 4. Effects of atrazine (ATR) on the ultrastructural features in the CA1 subregion of the hippocampal neurons via transmission electron microscopy: control group: (A) 20,000 ×; low-dose group: (B) 20000 ×; high-dose group: (C) 20,000 ×. Effects of ATR exposure on the ultrastructural features of the hippocampal synapses via transmission electron microscopy: control group: (D) 30,000 ×; low-dose group: (E) 30,000 ×; high-dose group: (F) 30,000 ×. Six rats per group. Obvious changes are marked with different arrows; black arrows: normal karyolemma; black arrows with a white edge: fuzzy karyolemma; white arrows: normal mitochondria; white arrows with a black edge: swollen mitochondria; gray arrows with a white edge: increased lysosomes; gray arrows: normal synaptic clefts; gray arrows with a black edge: unclear synaptic clefts.
F(2,15) = 37.70, p < 0.01; control vs. high-dose: p < 0.01, low-dose vs. high-dose: p < 0.01), while the level of MEK2 mRNA expression increased in low-dose group and decreased in the high-dose group (Fig. 5B, ANOVA: F(2,15) = 45.98, p < 0.01; control vs. low-dose: p = 0.03, control vs. high-dose: p < 0.01, low-dose vs. high-dose: p < 0.01). Both ERK1 (Fig. 5C, ANOVA: F(2,15) = 67.97, p < 0.01; control vs. high-dose: p < 0.01, low-dose vs. high-dose: p < 0.01) and ERK2 (Fig. 5D, ANOVA: F(2,15) = 6.52, p < 0.01; control vs. high-dose: p = 0.02, low-dose vs. high-dose: p = 0.02) mRNA expression levels reduced in the high-dose group. There were significant decreases in the levels of CREB (Fig. 5E, ANOVA: F(2,15) = 73.73, p < 0.01; control vs. low-dose: p < 0.01, control vs. high-dose: p < 0.01, low-dose vs. high-dose: p < 0.01) and BDNF (Fig. 5F, ANOVA: F(2,15) = 92.00, p < 0.01; control vs. low-dose: p < 0.01, control vs. high-dose: p < 0.01, low-dose vs. high-dose: p < 0.01) mRNA expression in the ATR-treated groups. There were no significant differences in the level of Zif268 mRNA expression vs. the control group (Fig. 5G, ANOVA: F(2,15) = 0.79, p = 0.47).
the hippocampus are shown in Fig. 6. ATR treatment significantly decreased the levels of MEK1/2 (Fig. 6A, ANOVA: F(2,15) = 56.83, p < 0.01; control vs. low-dose: p < 0.01, control vs. high-dose: p < 0.01, low-dose vs. highdose: p < 0.01) and p-MEK1/2 (Fig. 6B, ANOVA: F(2,15) = 175.70, p < 0.01; control vs. low-dose: p < 0.01, control vs. high-dose: p < 0.01, low-dose vs. high-dose: p < 0.01) protein expression in the ATR-treated groups. There were no significant differences in the levels of ERK1/2 protein expression (Fig. 6C, ANOVA: F(2,15) = 0.78, p = 0.48), however, the levels of p-ERK1/2 protein expression reduced in ATR-treated groups vs. the control group (Fig. 6D, ANOVA: F(2,15) = 57.43, p < 0.01; control vs. lowdose: p < 0.01, control vs. high-dose: p < 0.01, low-dose vs. high-dose: p < 0.01). We observed a significant decrease in the levels of CREB (Fig. 6E, ANOVA: F(2,15) = 29.42, p < 0.01; control vs. low-dose: p < 0.01, control vs. high-dose: p < 0.01) and p-CREB (Fig. 6F, ANOVA: F(2,15) = 123.40, p < 0.01; control vs. low-dose: p = 0.04, control vs. highdose: p < 0.01, low-dose vs. high-dose: p < 0.01) protein expression in the treatment groups. The levels of BDNF (Fig. 6G, ANOVA: F(2,15) = 31.62, p < 0.01; control vs. high-dose: p < 0.01, low-dose vs. high-dose: p < 0.01) protein expression reduced in the high-dose group. ATR treatment significantly decreased the level of Zif268 protein expression in the ATR-treated groups (Fig. 6H, ANOVA: F(2,15) = 95.92, p < 0.01; control vs. low-dose: p < 0.01, control vs. high-dose: p < 0.01, low-dose vs. highdose: p < 0.01).
3.5. Effects of ATR exposure on protein expression levels The relative protein expression levels of MEK1/2, p-MEK1/2, ERK1/2, p-ERK1/2, CREB, p-CREB, BDNF, and Zif268 following ATR treatment in
677
Ecotoxicology and Environmental Safety 170 (2019) 673–681
J. Li et al.
Fig. 5. Effects of ATR exposure on mRNA expression levels in the hippocampus were measured with reverse transcription -PCR. (A) MEK1, (B) MEK2, (C) ERK1, (D) ERK2, (E) CREB, (F) BDNF and (G) Zif268. Expression levels were standardized to β-actin. Each column represents the mean ± S.E.M, six rats per group, * p < 0.05 vs. the control group, ** p < 0.01 vs. the control group. # Significant difference between ATR-treated groups.
4. Discussion
decreased spatial memory ability in a dose-dependent manner. Interestingly, the average platform crossing time of the low-dose group was lower than the high-dose group. Indeed, although platform crossing time is a parameter commonly used to measure spatial memory abilities, it has several limitations, including being influenced by the size of the platform, water tank properties and even the tracing software used (Vorhees and Williams, 2006). Thus, the percentage of time spent in the target quadrant and the time spent in the target annulus may serve as more reliable measures of spatial memory ability. Our results of the spatial probe test demonstrate that ATR treatment may affect spatial memory abilities, especially in the high-dose group. These results are also in agreement with previous studies, which suggest that exposure to ATR impairs performance in other hippocampus-dependent learning and memory tasks in rodents, such as the NOR and Y-maze (Bardullas et al., 2011; Kale et al., 2018; Lin et al., 2013). In mammals, the hippocampus is the key brain region responsible for encoding and consolidating information, transforming short-term memory into long term memory. Anatomically, the CA1 and DG regions of hippocampus are critical for spatial learning and memory (Kesner et al., 2004; Nakazawa et al., 2004; Bartsch et al., 2010). A previous study demonstrated that exposure to ATR at a dose of 100 µg/kg BW reduced the total number of neurons with perikaryal swelling and astrocytic formations in the DG area of female mice (Giusi et al., 2006). In this study, analysis by transmission electron microscopy suggested that ATR treatment induces the degeneration of mitochondria and nuclei in
ATR has been previously suggested to affect hippocampus-dependent learning and memory in rodents, but the underlying mechanism is still unclear. In the present study, we found that developmental exposure to ATR influences hippocampus-dependent learning and memory functions in male SD rats. Moreover, we showed that neuron ultrastructure in the DG and CA1 hippocampal regions was also impaired following ATR treatment. Concomitant with these observations, we found that ATR treatment resulted in a decrease in the expression of the MEK/ERK/CREB signaling pathway in the hippocampus, as well as a decrease in the expression of the critical downstream factors BDNF and Zif268. We first tested for any adverse effect of ATR on learning and memory with a MWM test, which is used to assess hippocampal spatial learning and memory abilities in rodents (Vorhees and Williams, 2006). In the place navigation test, the escape latency – or time spent locating the hidden platform – is a critical parameter reflecting the spatial learning abilities of the subject (Duva et al., 1997). Here, we found that the MWM escape latency was not affected by ATR treatment, thus indicating that the spatial learning abilities of rats may not be sensitive to developmental exposure to ATR. Using the spatial probe test, we selected three parameters reflecting spatial memory abilities. When measuring the percentage of time spent in the target quadrant, and the time spent in the target annulus, we found that ATR treatment 678
Ecotoxicology and Environmental Safety 170 (2019) 673–681
J. Li et al.
Fig. 6. Effects of atrazine (ATR) exposure on protein expression levels in the hippocampus were measured using western blot analysis. (A) MEK1/2, (B) p-MEK1/2, (C) ERK1/2, (D) p-ERK1/2, (E) CREB, (F) p-CREB, (G) BDNF and (H) Zif268. Expression levels were standardized to β-actin. Each column represents the mean ± S.E.M, six rats per group, * p < 0.05 as compared with the control group, ** p < 0.01 as compared with the control group. # Significant difference between ATR-treated groups.
neurons of both the DG and CA1 areas. In the present study, in addition to mitochondrial and nuclear defects, we also observed an increased number of lysosomes and unclear synaptic clefts in CA1 neurons following ATR treatment. Lysosomes are critical regulators of cellular homeostasis, and perform multiple functions such as the degradation of macromolecules and nutrient recycling (Ferguson, 2018). Mitochondria support diverse cellular functions such as the formation of reactive oxygen species, ATP generation and apoptosis (Erpapazoglou et al., 2017). Notably, mitochondrial and lysosomal dysfunction is a common theme in neurodegenerative disease, including Alzheimer’s and Parkinson’s disease (de la Monte et al., 2000; Cannon et al., 2009; Gowrishankar et al., 2015; Blazquez-Llorca et al., 2017). We therefore hypothesized that the observed ultrastructural defects in different hippocampal sub-regions may be related to the deficits in learning and memory induced by ATR. Other pesticides, such as paraquat and parathion, have also been observed to cause similar hippocampal deficits in rats (Chen et al., 2010; Canales-Aguirre et al., 2012). It is generally accepted that hippocampus-dependent synaptic plasticity is the foundation of learning and memory. The cellular process of long-term memory formation, known as long term potentiation (LTP), is a well described series of cellular events involved in hippocampus-dependent synaptic plasticity (Kullmann and Lamsa, 2007). Previous studies have shown that the ERK1/2 signaling pathway plays a
key role in hippocampal LTP. Specifically, phosphorylation of ERK1/2 is a critical event in LTP induction (Selcher et al., 1999). In this study, we found that the mRNA levels of ERK1/2 were both decreased with high-doses of ATR, whereas no significant differences in the protein levels of ERK1/2 were seen. However, the protein levels of p-ERK1/2 were reduced in a dose-dependent manner. ERK1/2 can be phosphorylated directly by the immediate upstream kinases MEK1/2, with the activation of MEK1/2 also being phosphorylation-dependent via mitogen-activated protein kinase kinases, such as the RAF proteins (Raman et al., 2007). Here, we also found that the mRNA levels of MEK1/2 decreased with high-doses of ATR, with MEK1/2 and p-MEK1/ 2 protein levels also reduced, especially in the high-dose group. Thus, we are able to infer that the MEK/ERK cascade may be involved in ATRinduced hippocampal dysfunction. The transcription factor CREB has been extensively studied for its role in hippocampus-dependent learning and memory (West et al., 2002; Lonze and Ginty, 2002). Previous research has demonstrated that the phosphorylation of CREB at Ser133, performed by the ERK1/2 signaling pathway, initiates a cascade of transcriptional changes required for LTP in the hippocampus (Wu et al., 2001). As expected, we observed a decrease in the mRNA and protein levels of CREB following ATR treatment, along with a decrease in the protein level of p-CREB in the high-dose ATR-treated group. 679
Ecotoxicology and Environmental Safety 170 (2019) 673–681
J. Li et al.
We also observed changes to other factors involved in the CREB pathway in our ATR treatment paradigm. BDNF belongs to the family of neurotrophins, and is understood to be a critical factor in neuronal survival, differentiation, synapse formation and LTP regulation, in the hippocampus as well as other brain regions (Park and Poo, 2013). The IEG Zif268 is associated with the regulation of the persistence of protein synthesis in hippocampal LTP (Bozon et al., 2003). Both BDNF and Zif268 production are dependent on ERK1/2-mediated phosphorylation of CREB (Bozon et al., 2003; Jeon et al., 2011). In this study, we found that the mRNA and protein levels of BDNF were both reduced following ATR treatment. Interestingly, we observed that the level of Zif268 protein was decreased following ATR treatment, yet there was no significant difference in the mRNA expression level of Zif268 amongst all groups. The quantitative relationship between the level of mRNA and its encoded protein is complex, and can be influenced, amongst other things, by the rate of translation and protein degradation (de Sousa Abreu et al., 2009). Our results therefore indicated that ATR may interfere in the process of translation and/or protein degradation in the hippocampus of rats, which led to the differential expression levels of Zif268 mRNA and protein.
Blazquez-Llorca, L., Valero-Freitag, S., Rodrigues, E.F., Merchán-Pérez, Á., Rodríguez, J.R., Dorostkar, M.M., DeFelipe, J., Herms, J., 2017. High plasticity of axonal pathology in Alzheimer's disease mouse models. Acta Neuropathol. Commun. 5, 14. https://doi.org/10.1186/s40478-017-0415-y. Blokland, A., Geraerts, E., Been, M., 2004. A detailed analysis of rats' spatial memory in a probe trial of a Morris task. Behav. Brain Res. 154, 71–75. https://doi.org/10.1016/j. bbr.2004.01.022. Bouvier, G., Blanchard, O., Momas, I., Seta, N., 2006. Pesticide exposure of non-occupationally exposed subjects compared to some occupational exposure: a French pilot study. Sci. Total Environ. 366, 74–91. https://doi.org/10.1016/j.scitotenv.2005.08. 016. Bozon, B., Kelly, A., Josselyn, S.A., Silva, A.J., Davis, S., Laroche, S., 2003. MAPK, CREB and zif268 are all required for the consolidation of recognition memory. Philos. Trans. R. Soc. Lond. B Biol. Sci. 358, 805–814. https://doi.org/10.1098/rstb.2002. 1224. Canales-Aguirre, A.A., Gomez-Pinedo, U.A., Luquin, S., Ramírez-Herrera, M.A., MendozaMagaña, M.L., Feria-Velasco, A., 2012. Curcumin protects against the oxidative damage induced by the pesticide parathion in the hippocampus of the rat brain. Nutr. Neurosci. 15, 62–69. https://doi.org/10.1179/1476830511Y.0000000034. Cannon, J.R., Tapias, V., Na, H.M., Honick, A.S., Drolet, R.E., Greenamyre, J.T., 2009. A highly reproducible rotenone model of Parkinson's disease. Neurobiol. Dis. 34, 279–290. https://doi.org/10.1016/j.nbd.2009.01.016. Chen, Q., Niu, Y., Zhang, R., Guo, H., Gao, Y., Li, Y., Liu, R., 2010. The toxic influence of paraquat on hippocampus of mice: involvement of oxidative stress. Neurotoxicology 31, 310–316. https://doi.org/10.1016/j.neuro.2010.02.006. Duva, C.A., Floresco, S.B., Wunderlich, G.R., Lao, T.L., Pinel, J.P., Phillips, A.G., 1997. Disruption of spatial but not object-recognition memory by neurotoxic lesions of the dorsal hippocampus in rats. Behav. Neurosci. 111, 1184–1196. https://doi.org/10. 1037//0735-7044.111.6.1184. Eldridge, J.C., Wetzel, L.T., Stevens, J.T., Simpkins, J.W., 1999. The mammary tumor response in triazine-treated female rats: a threshold-mediated interaction with strain and species-specific reproductive senescence. Steroids 64, 672–678. https://doi.org/ 10.1016/S0039-128X(99)00051-3. Erpapazoglou, Z., Mouton-Liger, F., Corti, O., 2017. From dysfunctional endoplasmic reticulum-mitochondria coupling to neurodegeneration. Neurochem. Int. 109, 171–183. https://doi.org/10.1016/j.neuint.2017.03.021. Fa, S., Pogrmic-Majkic, K., Samardzija, D., Glisic, B., Kaisarevic, S., Kovacevic, R., Andric, N., 2013. Involvement of ERK1/2 signaling pathway in atrazine action on FSH-stimulated LHR and CYP19A1 expression in rat granulosa cells. Toxicol. Appl. Pharmacol. 270, 1–8. https://doi.org/10.1016/j.taap.2013.03.031. Ferguson, S.M., 2018. Neuronal lysosomes. Neurosci. Lett. https://doi.org/10.1016/j. neulet.2018.04.005. Foradori, C.D., Hinds, L.R., Quihuis, A.M., Lacagnina, A.F., Breckenridge, C.B., Handa, R.J., 2011. The differential effect of atrazine on luteinizing hormone release in adrenalectomized adult female Wistar rats. Biol. Reprod. 85, 684–689. https://doi. org/10.1095/biolreprod.111.092452. Gammon, D.W., Aldous, C.N., Carr, W.C., Sanborn, J.R., Pfeifer, K.F., 2005. A risk assessment of atrazine use in California: human health and ecological aspects. Pest Manag. Sci. 61, 331–355. https://doi.org/10.1002/ps.1000. Giusi, G., Facciolo, R.M., Canonaco, M., Alleva, E., Belloni, V., Dessi'-Fulgheri, F., Santucci, D., 2006. The endocrine disruptor atrazine accounts for a dimorphic somatostatinergic neuronal expression pattern in mice. Toxicol. Sci. 89, 257–264. https://doi.org/10.1093/toxsci/kfj012. Gowrishankar, S., Yuan, P., Wu, Y., Schrag, M., Paradise, S., Grutzendler, J., De Camilli, P., Ferguson, S.M., 2015. Massive accumulation of luminal protease-deficient axonal lysosomes at Alzheimer's disease amyloid plaques. Proc. Natl. Acad. Sci. USA 112, E3699–3708. https://doi.org/10.1073/pnas.1510329112. Grewal, S.S., Fass, D.M., Yao, H., Ellig, C.L., Goodman, R.H., Stork, P.J., 2000. Calcium and cAMP signals differentially regulate cAMP-responsive element-binding protein function via a Rap1-extracellular signal-regulated kinase pathway. J. Biol. Chem. 275, 34433–34441. https://doi.org/10.1074/jbc.M004728200. Jeon, S.J., Rhee, S.Y., Seo, J.E., Bak, H.R., Lee, S.H., Ryu, J.H., Cheong, J.H., Shin, C.Y., Kim, G.H., Lee, Y.S., Ko, K.H., 2011. Oroxylin A increases BDNF production by activation of MAPK-CREB pathway in rat primary cortical neuronal culture. Neurosci. Res. 69, 214–222. https://doi.org/10.1016/j.neures.2010.11.008. Jowa, L., Howd, R., 2011. Should atrazine and related chlorotriazines be considered carcinogenic for human health risk assessment. J. Environ. Sci. Health C. Environ. Carcinog. Ecotoxicol. Rev. 29, 91–144. https://doi.org/10.1080/10590501.2011. 577681. Kale, O.E., Oyesola, T.O., Raji, F.S., 2018. Celecoxib, a cyclooxygenase-2 inhibitor, offers chemoprevention against reproductive and neurobehavioural abnormalities induced by atrazine in male Wistar rats. Environ. Toxicol. Pharmacol. 58, 84–97. https://doi. org/10.1016/j.etap.2017.12.026. Karmaus, A.L., Zacharewski, T.R., 2015. Atrazine-mediated disruption of steroidogenesis in BLTK1 murine leydig cells. Toxicol. Sci. 148, 544–554. https://doi.org/10.1093/ toxsci/kfv204. Kesner, R.P., Lee, I., Gilbert, P., 2004. A behavioral assessment of hippocampal function based on a subregional analysis. Rev. Neurosci. 15, 333–351. https://doi.org/10. 1515/REVNEURO.2004.15.5.333. Kullmann, D.M., Lamsa, K.P., 2007. Long-term synaptic plasticity in hippocampal interneurons. Nat. Rev. Neurosci. 8, 687–699. https://doi.org/10.1038/nrn2207. Lin, Z., Dodd, C.A., Filipov, N.M., 2013. Short-term atrazine exposure causes behavioral deficits and disrupts monoaminergic systems in male C57BL/6 mice. Neurotoxicol. Teratol. 39, 26–35. https://doi.org/10.1016/j.ntt.2013.06.002. Lonze, B.E., Ginty, D.D., 2002. Function and regulation of CREB family transcription factors in the nervous system. Neuron 35, 605–623. https://doi.org/10.1016/S0896-
5. Conclusions In the present study, we demonstrate that developmental exposure to ATR impairs hippocampus-dependent learning and memory in male SD rats. Moreover, ATR treatment is able to induce ultrastructural changes in the hippocampus. At the molecular level, ATR-treatment reduces the levels of protein and mRNA amongst members of the MEK/ ERK/CREB signaling pathway, as well as the downstream factors BDNF and Zif268. Downregulation of this signaling pathway may be related to the functional and morphological lesions induced by ATR in the hippocampus of rats. This study represents a preliminary description of the molecular changes to the MEK/ERK/CREB signaling pathway following ATR treatment. However, the precise mechanism underlying ATR-induced hippocampal neurotoxicity requires further investigation, such as in vitro or slices. CRediT authorship contribution statement Jianan Li: Investigation, Visualization, Writing - original draft, Writing - review & editing. Xueting Li: Data curation, Formal analysis, Writing - review & editing. Haoran Bi: Data curation, Formal analysis, Writing - review & editing. Baixiang Li: Funding acquisition, Project administration, Supervision, Validation, Writing - review & editing. Acknowledgments This work was supported by the National Natural Science Foundation of China (grant number: 81273109). Conflicts of interest The authors declare no conflict of interest. References Abarikwu, S.O., Adesiyan, A.C., Oyeloja, T.O., Oyeyemi, M.O., Farombi, E.O., 2010. Changes in sperm characteristics and induction of oxidative stress in the testis and epididymis of experimental rats by a herbicide, atrazine. Arch. Environ. Contam. Toxicol. 58, 874–882. https://doi.org/10.1007/s00244-009-9371-2. Bardullas, U., Giordano, M., Rodríguez, V.M., 2011. Chronic atrazine exposure causes disruption of the spontaneous locomotor activity and alters the striatal dopaminergic system of the male Sprague-Dawley rat. Neurotoxicol. Teratol. 33, 263–272. https:// doi.org/10.1016/j.ntt.2010.09.001. Bartsch, T., Schönfeld, R., Müller, F.J., Alfke, K., Leplow, B., Aldenhoff, J., Deuschl, G., Koch, J.M., 2010. Focal lesions of human hippocampal CA1 neurons in transient global amnesia impair place memory. Science 328, 1412–1415. https://doi.org/10. 1126/science.1188160.
680
Ecotoxicology and Environmental Safety 170 (2019) 673–681
J. Li et al. 6273(02)00828-0. Meffe, R., de Bustamante, I., 2014. Emerging organic contaminants in surface water and groundwater: a first overview of the situation in Italy. Sci. Total Environ. 481, 280–295. https://doi.org/10.1016/j.scitotenv.2014.02.053. de la Monte, S.M., Luong, T., Neely, T.R., Robinson, D., Wands, J.R., 2000. Mitochondrial DNA damage as a mechanism of cell loss in Alzheimer's disease. Lab. Invest. 80, 1323–1335. https://doi.org/10.1038/labinvest.3780140. Nakazawa, K., McHugh, T.J., Wilson, M.A., Tonegawa, S., 2004. NMDA receptors, place cells and hippocampal spatial memory. Nat. Rev. Neurosci. 5, 361–372. https://doi. org/10.1038/nrn1385. Park, H., Poo, M.M., 2013. Neurotrophin regulation of neural circuit development and function. Nat. Rev. Neurosci. 14, 7–23. https://doi.org/10.1038/nrn3379. Pogrmic-Majkic, K., Fa, S., Samardzija, D., Hrubik, J., Kaisarevic, S., Andric, N., 2016. Atrazine activates multiple signaling pathways enhancing the rapid hCG-induced androgenesis in rat Leydig cells. Toxicology 368–369, 37–45. https://doi.org/10. 1016/j.tox.2016.08.016. Raman, M., Chen, W., Cobb, M.H., 2007. Differential regulation and properties of MAPKs. Oncogene 26, 3100–3112. https://doi.org/10.1038/sj.onc.1210392. Rodríguez, V.M., Limón-Pacheco, J.H., Mendoza-Trejo, M.S., González-Gallardo, A., Hernández-Plata, I., Giordano, M., 2013. Repeated exposure to the herbicide atrazine alters locomotor activity and the nigrostriatal dopaminergic system of the albino rat. Neurotoxicology 34, 82–94. https://doi.org/10.1016/j.neuro.2012.10.012. Selcher, J.C., Atkins, C.M., Trzaskos, J.M., Paylor, R., Sweatt, J.D., 1999. A necessity for
MAP kinase activation in mammalian spatial learning. Learn. Mem. 6, 478–490. https://doi.org/10.1101/lm.6.5.478. de Sousa Abreu, R., Penalva, L.O., Marcotte, E.M., Vogel, C., 2009. Global signatures of protein and mRNA expression levels. Mol. Biosyst. 5, 1512–1526. https://doi.org/10. 1039/b908315d. Treisman, R., 1996. Regulation of transcription by MAP kinase cascades. Curr. Opin. Cell Biol. 8, 205–215. https://doi.org/10.1016/S0955-0674(96)80067-6. Vorhees, C.V., Williams, M.T., 2006. Morris water maze: procedures for assessing spatial and related forms of learning and memory. Nat. Protoc. 1, 848–858. https://doi.org/ 10.1038/nprot.2006.116. Waltereit, R., Weller, M., 2003. Signaling from cAMP/PKA to MAPK and synaptic plasticity. Mol. Neurobiol. 27, 99–106. https://doi.org/10.1385/MN:27:1:99. Wang, J., Du, Z., Yu, W., Qu, S., 2012. Detection of seven pesticides in cucumbers using hollow fibre-based liquid-phase microextraction and ultra-high pressure liquid chromatography coupled to tandem mass spectrometry. J. Chromatogr. A 1247, 10–17. https://doi.org/10.1016/j.chroma.2012.05.040. West, A.E., Griffith, E.C., Greenberg, M.E., 2002. Regulation of transcription factors by neuronal activity. Nat. Rev. Neurosci. 3, 921–931. https://doi.org/10.1038/nrn987. Wu, G.Y., Deisseroth, K., Tsien, R.W., 2001. Activity-dependent CREB phosphorylation: convergence of a fast, sensitive calmodulin kinase pathway and a slow, less sensitive mitogen-activated protein kinase pathway. Proc. Natl. Acad. Sci. USA 98, 2808–2813. https://doi.org/10.1073/pnas.051634198.
681
Contents lists available at ScienceDirect
Ecotoxicology and Environmental Safety journal homepage: www.elsevier.com/locate/ecoenv
The MEK/ERK/CREB signaling pathway is involved in atrazine induced hippocampal neurotoxicity in Sprague Dawley rats
T
Jianan Lia, Xueting Lia, Haoran Bib, Baixiang Lia,
⁎
a b
Department of Toxicology, College of Public Health, Harbin Medical University, 157 Baojian Road, Nan Gang District, Harbin 150081, China Department of Epidemiology, College of Public Health, Harbin Medical University, 157 Baojian Road, Nan Gang District, Harbin 150081, China
ARTICLE INFO
ABSTRACT
Keywords: Atrazine Hippocampus Neurotoxicity MEK/ERK/CREB signaling pathway
Atrazine (ATR) is a commonly used artificial synthetic herbicide world-wide, which has been implicated as a potential threat to human health. Previous studies have demonstrated that exposure to ATR affects hippocampus-dependent learning and memory in rodents, but the exact molecular mechanism remains to be elucidated. In this study, we investigated the effect of ATR on the hippocampus of postnatal day 35 male Sprague Dawley (SD) rats administered doses of either 10 or 100 mg/kg body weight (BW)/day of ATR for a period of 30 days. A Morris water maze (MWM) test revealed that ATR treatment impaired memory performance in the spatial probe test, especially amongst the high-dose group. Moreover, analysis by electron microscopy showed that hippocampal neuron ultrastructure in the dentate gyrus (DG) and cornu ammonis 1 (CA1) sub-regions was impaired in the ATR-treated groups. Finally, a downregulation in the mRNA and protein expression levels of members of the MEK/ERK/CREB pathway and downstream factors brain-derived neurotrophic factor (BDNF) and Zif268 was observed in hippocampal tissue following ATR treatment. Taken together, these results suggest that developmental exposure to ATR is able to induce functional and morphological lesions in the hippocampus of SD rats, and that the MEK/ERK/CREB signaling pathway may be involved in this process.
1. Introduction Atrazine (6-chloro-N-ethyl-N′-(1-methylethyl)-1,3,5-triazine-2,4diamine, ATR) is a form of chlorotriazine herbicide, which has been extensively utilized world-wide. ATR is able to selectively kill a variety of weeds, functioning by disrupting the electron transport chain in the chloroplast, thereby inhibiting photosynthesis (Eldridge et al., 1999). Due to the widespread application of ATR, it is considered an environmental contaminant. It has been detected in both the atmosphere and groundwater, and is even detectable in food and drinking water (Meffe and de Bustamante, 2014; Gammon et al., 2005; Wang et al., 2012). Of particular concern, persistent ATR and its metabolites have also been found in human bodies (Bouvier et al., 2006). Despite its prevalence, the deleterious effects of ATR exposure on humans are still unclear. Epidemiological studies have demonstrated that exposure to ATR may impact reproductive and developmental processes (Jowa and Howd, 2011). Furthermore, a large number of animal studies have
indicated that ATR can have adverse effects on the endocrine, reproductive and developing central nervous systems (CNS) (Abarikwu et al., 2010; Foradori et al., 2011; Bardullas et al., 2011). In addition, numerous studies using both behavioral and biochemical methods have suggested that ATR may act as a dopaminergic system toxin (Bardullas et al., 2011; Rodríguez et al., 2013). Recently, neurobehavioral studies have found that ATR may also affect hippocampus-dependent learning and memory in rodents. Bardullas et al. showed that male SD rats exposed to ATR at a dose of 10 mg/kg BW displayed more errors in a learning and memory task (Bardullas et al., 2011). Similar findings were also observed in a Y-maze spontaneous alternation test amongst male Wistar rats exposed to ATR at a dose of 300 mg/kg BW for 7 days (Kale et al., 2018). Additionally, Lin et al. found that male C57BL/6 mice exposed to 25 mg/kg BW of ATR for 10 days showed diminished performance in a novel object recognition (NOR) task (Lin et al., 2013). Despite ATR having been proven to affect hippocampus-dependent learning and memory
Abbreviations: ATR, Atrazine; PND, Postnatal day; CNS, Central nervous system; MEK1/2, Mitogen-activated protein kinase kinase 1/2; ERK1/2, Extracellular signal-regulated kinase 1/2; cAMP, Cyclic adenosine monophosphate; CREB, cAMP response element-binding protein; BDNF, Brain derived neurotrophic factor; IEG, Immediate early gene; zif268, Zinc finger protein 225; MWM, Morris water maze; RT-PCR, Reverse transcription-polymerase Chain reaction; PBS, Phosphate buffered solution; TBST, Tris-buffered saline with Tween 20 ⁎ Corresponding author. E-mail address: [email protected] (B. Li). https://doi.org/10.1016/j.ecoenv.2018.12.038 Received 25 September 2018; Received in revised form 10 December 2018; Accepted 12 December 2018 0147-6513/ © 2018 Elsevier Inc. All rights reserved.
Ecotoxicology and Environmental Safety 170 (2019) 673–681
J. Li et al.
functions, especially during development, the underlying mechanisms remain poorly understood. The hippocampus plays a critical role in learning and memory. In particular, hippocampal synaptic plasticity is crucial for the conversion of short-term information into long-term memories (Waltereit and Weller, 2003). Activation of the mitogen activated protein kinase (MAPK) signaling pathway, whose members include the extracellular signal-regulated kinase 1/2 (ERK1/2), has been shown to be a key molecular mechanism underlying hippocampal synaptic plasticity (Selcher et al., 1999). In order to initiate synaptic plasticity, ERK1/2 must first be phosphorylated by mitogen-activated protein kinase 1/2 (MEK1/2), after which it exerts a cascade of effects by phosphorylating the cAMP response element-binding protein (CREB) (Grewal et al., 2000). Phosphorylated CREB (p-CREB) mediates the induction of several immediate early genes (IEGs), which regulate hippocampal synaptic plasticity (Treisman, 1996). Interestingly, recent studies have demonstrated that exposure to ATR may affect ERK1/2 and its downstream signaling pathway elements in the Leydig and granulosa cells of rats (Fa et al., 2013; Karmaus and Zacharewski, 2015; Pogrmic-Majkic et al., 2016). In the present study, we examined rats during a critical CNS developmental period in order to characterize the hippocampal neurotoxicity induced by ATR at different dosages. We firstly detected hippocampal defects using a MWM test and electron microscopy. Additionally, we used neurochemical methods to demonstrate that ATR influences the MEK/ERK/CREB signaling pathway and its downstream pathway members, which are known to be involved in hippocampal learning and memory. The results of this study will inform future investigations into the adverse effects of ATR on the hippocampus at molecular level.
Fig. 1. Body weight of each group on different weeks. Each point represents the mean ± S.E.M, twenty rats per group.
test, following the protocol previously described by Vorhees et al (Vorhees and Williams, 2006). The maze consisted of a circular black tank (180 cm in diameter and 58 cm deep) filled with water (about 50 cm deep) at a temperature of 19–22 °C. Extra-maze cues were placed surrounding the apparatus. The water tank was divided into four equal quadrants: north-west, north-east, south-west, and south-east. A circular platform (10 cm in diameter) was located approximately 2 cm below the water surface in the north-east quadrant. The test period was divided into two phases. Phase one (place navigation test): Rats received four training sessions each day for 5 consecutive days. For each training session, rats were placed into the water facing the tank wall in a set of semi-randomly selected distal starting positions each day. The escape latency, measured as the time required for rats to reach the platform, was recorded for up to 90 s. Rats were kept on the platform for 10 s before removal. Rats that failed to find the platform within 90 s were gently guided to the platform, where they were allowed to stay for 10 s. Phase two (spatial probe test): On the day following the place navigation test, rats received a 90 s spatial probe test in which the platform was removed and the starting position was changed to a novel one. The platform crossing times, percentage of time spent in the target quadrant and the time spent in the pre-defined annulus surrounding the target were recorded over a 90 s period (Blokland et al., 2004).
2. Materials and methods 2.1. Ethics statement All experiments in the present study were approved by the Medical Ethics Committee of Harbin Medical University (Harbin, China), and all animals were treated in accordance with the Guidelines for the Care and Use Laboratory Animals established by the National Institutes of Health.
2.4. Transmission electron microscopy Rats were anesthetized by injection of sodium pentobarbital, and the hippocampus were removed and fixed in 2% glutaraldehyde in 0.01 mol/L PBS for 48 h at 4 °C. Then, fixed hippocampus were cut into 1 mm3 pieces and fixed again in a 1% osmium tetroxide solution for 2 h, dehydrated and embedded in resin. Ultrathin sections were cut, stained with lead citrate and observed with a transmission electron microscope (JEM-2100; JEOL Ltd., Tokyo, Japan).
2.2. Animals and ATR exposure Sixty male SD rats (aged 3 weeks, BW 40–50 g) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China) and housed under a 12 h inverted dark/light cycle at a constant temperature of 20–22 °C, and a relative humidity of 50%. Rats were allowed to acclimatize for 2 weeks, and were then randomly assigned to three groups (20 rats in each group): a control group (1% methyl cellulose; Sigma–Aldrich Corporation, St. Louis, MO, USA); a low-dose group (10 mg/kg BW ATR, 98% pure; Trust Chem Co., Ltd., Shanghai, China), and a high-dose group (100 mg/kg BW ATR). The rats received an oral gavage of ATR or methyl cellulose (controls) each day for a period of 30 days, and were weighed once per week. ATR dosages were selected based on the lowest observed dose leading to adverse hippocampal function in rats (Bardullas et al., 2011). On postnatal day 90 (PND 90), eight rats from each group were randomly chose for behavioral test, six rats from each group were randomly chose for transmission electron microscopy, the additional rats were euthanized by injection of pentobarbital sodium, and the hippocampus was immediately isolated and snap-frozen for the subsequent experiments.
2.5. RNA collection and reverse transcription-polymerase chain reaction (RT-PCR) analysis Total RNA was extracted from hippocampal tissue using TRIzol Reagent and reverse transcribed into cDNA using the SYBR Premix Ex Taq II Reagent Kit and gDNA Eraser, according to the manufacturer's instructions (Takara Bio, Inc., Shiga, Japan). The rat-specific primers used to examine the mRNA expression levels of MEK1/2, ERK1/2, CREB, BDNF, and Zif268 were as follows (Generay Biotech, Co., Ltd., Shanghai, China): β-actin (forward: GAGAGGGAAATCGTGCGT; reverse: GGAGGAAGAGGATGCGG); MEK1 (forward: ATCAGGAGGAGG AATGGGGTA; reverse: AACTCTGCGATTTTGGGGTCA); MEK2 (forward: TCTAGTTCCTTGGCATCAGGT; reverse: CTCATTTGTAGGGACA CGCTC); ERK1 (forward: TCAGGACCTCATGGAGACGGA; reverse: CGCAGGTGGTGTTGATAAGCAG); ERK2 (forward: ATTGGTCAGGACA AGGGCTCAG; reverse: TCAAAGGAGTCAAGAGTGGGTAAGC); CREB (forward: CCCCTGGAGTTGTTATGGCGT; reverse: ATTCTCTTGCTGCT
2.3. MWM test Spatial learning and memory abilities were measured using a MWM 674
Ecotoxicology and Environmental Safety 170 (2019) 673–681
J. Li et al.
Fig. 2. (A) Escape latency in the Morris water maze test on different training days. (B) Platform crossing times. (C) Percentage of time in the target quadrant. (D) Time spend in the pre-defined annulus surrounding the target. Each column represents the mean ± S.E.M, eight rats per group, * p < 0.05 vs. the control group, ** p < 0.01 vs. the control group.
TCCCTGTTCT); BDNF (forward: TCTACGAGACCAAGTGTAATCCCAT; reverse: GAAGTGTCTATCCTTATGAACCGC); and Zif268 (forward: TTGTCTGCTTTCTTGTCCTTC; reverse: TTCAGTCGTAGTGACCACCTT). The relative mRNA expression level of each target gene was normalized to β-actin by the following formula: ΔCT = (CTtarget − CTβ-actin); ΔΔCT = (CTtarget − CTβ-actin) treatment - (CTtarget − CTβ-actin) control. The value of 2−ΔΔCT was selected to calculate the relative expression level of each target mRNA.
polyclonal primary Ab, diluted 1:1000 in blocking buffer; ab208780; Abcam Limited), along with β-actin (anti-β-actin polyclonal Ab, diluted 1:1000 in blocking buffer; YT0099; Immuno Way Biotechnology Company). The following day, membranes were washed six times in TBST and incubated with HRP-conjugated goat anti-rabbit IgG Ab as the secondary Ab (diluted 1:5000 in blocking buffer; RS2115; ImmunoWay Biotechnology Company) for 1 h at 24–26 °C. After washing six times in TBST buffer, membranes were incubated with a commercial western blot detection kit (Beyotime Institute of Biotechnology) for 1 min. The resulting immuno-reactive bands were visualized using a chemiluminescence system (Tanon-5200; Tanon Science & Technology Co., Ltd., Shanghai, China) and analyzed with ImageJ software (v 1.51; NIH, Bethesda, MD, USA).
2.6. Western blot analysis Total protein was extracted from hippocampal tissue using lysis buffer containing phenylmethane sulfonyl fluoride and phosphatase inhibitor (Beyotime Institute of Biotechnology, Shanghai, China). After incubation for 1 h at 4 °C, the mixture was centrifuged at 12,000g for 10 min at 4 °C. Lysis supernatant was collected and a commercial bicinchoninic acid protein assay kit (Beyotime Institute of Biotechnology) was used to detect the protein concentration. Total protein (80 mg) was separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (10%, or 15%) and then transferred to a polyvinylidene fluoride membrane. Membranes were blocked using 1% bovine serum albumin in Tris-buffered saline with Tween 20 (TBST) for 1 h at 24–26 °C. Membranes were then incubated overnight at 4 °C in primary antibodies (Ab) against MEK1/2 (anti-MEK1/2 polyclonal primary Ab, diluted 1:1500 in blocking buffer; YT2714; ImmunoWay Biotechnology Company, Plano, TX, USA), p-MEK1/2 (anti-p-MEK1/2 polyclonal primary Ab, diluted 1:1000 in blocking buffer; phospho Ser218/222; YP0167; ImmunoWay Biotechnology Company), ERK1/2 (anti-ERK1/2 polyclonal primary Ab, diluted 1:1500 in blocking buffer; YT1625; ImmunoWay Biotechnology Company), p-ERK1/2 (anti-p-ERK1/2 polyclonal primary Ab, diluted 1:1000 in blocking buffer; phospho Thr202/Tyr204; YP1197; Immuno Way Biotechnology Company), CREB (anti-CREB polyclonal primary Ab, diluted 1:1000 in blocking buffer; YT1097; Immuno Way Biotechnology Company), p-CREB (antip-CREB polyclonal primary Ab, diluted 1:1000 in blocking buffer; phospho Ser133; YP0075; Immuno Way Biotechnology Company), BDNF (anti-BDNF polyclonal primary Ab, diluted 1:1500 in blocking buffer; ab108319; Abcam Limited, Cambridge, UK), or Zif68 (anti-Zif68
2.7. Statistical analyses All experimental results were analyzed using SPSS 18.0 software (SPSS, Inc., Chicago, IL, USA), and are represented as the mean ± standard error of the mean (SEM). Differences of body weight and escape latency in the MWM test were analyzed with a repeated-measures two-way analysis of variance (ANOVA). Other data were analyzed with a one-way ANOVA. The Dunnett's multiple comparison test was used for pairwise comparisons. P values less than 0.05 (p < 0.05) were considered statistically significant. 3. Results 3.1. Effects of ATR exposure on BW and general physical status The rats in each group gained body weight normally with the increased weeks. No obvious toxicity was observed following ATR treatment. No significant treatment-related differences in BW and general physical status were observed during the experimental period (Fig. 1, ANOVA: group effect: F(2,57) = 0.37, p = 0.70; time effect: F(10,570) = 1912.40, p < 0.01; interaction effect between group and time: F(20,570) = 0.48, p = 0.74), as reported previously (Bardullas et al., 2011; Lin et al., 2013). 675
Ecotoxicology and Environmental Safety 170 (2019) 673–681
J. Li et al.
Fig. 3. Effects of atrazine (ATR) on the ultrastructural features in the DG subregion of the hippocampal neurons via transmission electron microscopy: control group: (A) 20,000 ×; low-dose group: (B) 20000 ×; high-dose group: (C) 20,000 ×. Effects of ATR exposure on the ultrastructural features of the hippocampal synapses via transmission electron microscopy: control group: (D) 30,000 ×; low-dose group: (E) 30,000 ×; high-dose group: (F) 30,000 ×. Six rats per group. Obvious changes are marked with different arrows; black arrows: normal karyolemma; black arrows with a white edge: fuzzy karyolemma; white arrows: normal mitochondria; white arrows with a black edge: swollen mitochondria; gray arrows: normal synaptic clefts.
3.2. Effects of ATR exposure on spatial learning and memory
in the control group was abundant and replete with mitochondria, Golgi bodies, and endoplasmic reticulum. The nuclei were clear with smooth karyolemma bilayers and chromatin hypodispersion (Fig. 3A). Conversely, in ATR-treated groups, nuclei displayed a blurred and shriveled karyolemma, as well as mitochondrial swelling, reduced cristae and vacuolar degeneration was also observed (Fig. 3B and C). There were no significant changes observed to synaptic structures amongst all groups (Fig. 3D, E and F). The effect of ATR on neuron ultrastructural features in the CA1 hippocampal sub-region are shown in Fig. 4. Changes induced by ATR in the CA1 sub-region were similar to that observed in the DG subregion. Neurons in the control group showed a normal cell morphology (Fig. 4A). However, ATR-treatment not only led to karyolemma and mitochondria degeneration but also increased the number of lysosomes in the CA1 sub-region, especially in the high-dose group (Fig. 4B and C). In addition, neurons in the control group displayed an abundance of synaptic vesicles in the presynaptic membrane and clearly defined synaptic clefts (Fig. 4D), whereas unclearly defined synaptic clefts were frequently observed in the ATR-treated groups (Fig. 4E and F).
In the place navigation test, the escape latency decreased in all groups with increased training days. The escape latency was slightly longer in the ATR-treated groups vs. the control group, but the differences were not statistically significant (Fig. 2A, ANOVA: group effect: F(2,21) = 0.42, p = 0.66; time effect: F(4,84) = 70.31, p < 0.01; interaction effect between group and time: F(8,84) = 0.27, p = 0.95). In the spatial probe test, the platform crossing times significantly decreased in both the low-dose ATR group and the high-dose ATR group, the low-dose group displaying shorter times than the high-dose group (Fig. 2B, ANOVA: F(2,21) = 10.58, p < 0.01; control vs. lowdose: p < 0.01, control vs. high-dose: p < 0.01). The percentage of time spent in the target quadrant (Fig. 2C, ANOVA: F(2,21) = 8.11, p < 0.01; control vs. low-dose: p = 0.02, control vs. high-dose: p < 0.01) and the time spent in the annulus (Fig. 2D, ANOVA: F(2,21) = 4.62, p = 0.02; control vs. low-dose: p = 0.04, control vs. high-dose: p = 0.03) were significantly lower in ATR-treated groups vs. the control group. These results suggest that exposure to ATR might impair spatial memory abilities in rats.
3.4. Effects of ATR exposure on mRNA expression levels
3.3. Effects of ATR exposure on the ultrastructural features of hippocampal neurons
The relative mRNA expression levels of MEK1/2, ERK1/2, CREB, BDNF, and Zif268 in the hippocampus following ATR treatment is displayed in Fig. 5. ATR treatment significantly decreased the level of MEK1 mRNA expression in the high-dose group (Fig. 5A, ANOVA:
The effect of ATR on neuron ultrastructural features in the DG hippocampal sub-region are shown in Fig. 3. The cytoplasm of neurons 676
Ecotoxicology and Environmental Safety 170 (2019) 673–681
J. Li et al.
Fig. 4. Effects of atrazine (ATR) on the ultrastructural features in the CA1 subregion of the hippocampal neurons via transmission electron microscopy: control group: (A) 20,000 ×; low-dose group: (B) 20000 ×; high-dose group: (C) 20,000 ×. Effects of ATR exposure on the ultrastructural features of the hippocampal synapses via transmission electron microscopy: control group: (D) 30,000 ×; low-dose group: (E) 30,000 ×; high-dose group: (F) 30,000 ×. Six rats per group. Obvious changes are marked with different arrows; black arrows: normal karyolemma; black arrows with a white edge: fuzzy karyolemma; white arrows: normal mitochondria; white arrows with a black edge: swollen mitochondria; gray arrows with a white edge: increased lysosomes; gray arrows: normal synaptic clefts; gray arrows with a black edge: unclear synaptic clefts.
F(2,15) = 37.70, p < 0.01; control vs. high-dose: p < 0.01, low-dose vs. high-dose: p < 0.01), while the level of MEK2 mRNA expression increased in low-dose group and decreased in the high-dose group (Fig. 5B, ANOVA: F(2,15) = 45.98, p < 0.01; control vs. low-dose: p = 0.03, control vs. high-dose: p < 0.01, low-dose vs. high-dose: p < 0.01). Both ERK1 (Fig. 5C, ANOVA: F(2,15) = 67.97, p < 0.01; control vs. high-dose: p < 0.01, low-dose vs. high-dose: p < 0.01) and ERK2 (Fig. 5D, ANOVA: F(2,15) = 6.52, p < 0.01; control vs. high-dose: p = 0.02, low-dose vs. high-dose: p = 0.02) mRNA expression levels reduced in the high-dose group. There were significant decreases in the levels of CREB (Fig. 5E, ANOVA: F(2,15) = 73.73, p < 0.01; control vs. low-dose: p < 0.01, control vs. high-dose: p < 0.01, low-dose vs. high-dose: p < 0.01) and BDNF (Fig. 5F, ANOVA: F(2,15) = 92.00, p < 0.01; control vs. low-dose: p < 0.01, control vs. high-dose: p < 0.01, low-dose vs. high-dose: p < 0.01) mRNA expression in the ATR-treated groups. There were no significant differences in the level of Zif268 mRNA expression vs. the control group (Fig. 5G, ANOVA: F(2,15) = 0.79, p = 0.47).
the hippocampus are shown in Fig. 6. ATR treatment significantly decreased the levels of MEK1/2 (Fig. 6A, ANOVA: F(2,15) = 56.83, p < 0.01; control vs. low-dose: p < 0.01, control vs. high-dose: p < 0.01, low-dose vs. highdose: p < 0.01) and p-MEK1/2 (Fig. 6B, ANOVA: F(2,15) = 175.70, p < 0.01; control vs. low-dose: p < 0.01, control vs. high-dose: p < 0.01, low-dose vs. high-dose: p < 0.01) protein expression in the ATR-treated groups. There were no significant differences in the levels of ERK1/2 protein expression (Fig. 6C, ANOVA: F(2,15) = 0.78, p = 0.48), however, the levels of p-ERK1/2 protein expression reduced in ATR-treated groups vs. the control group (Fig. 6D, ANOVA: F(2,15) = 57.43, p < 0.01; control vs. lowdose: p < 0.01, control vs. high-dose: p < 0.01, low-dose vs. high-dose: p < 0.01). We observed a significant decrease in the levels of CREB (Fig. 6E, ANOVA: F(2,15) = 29.42, p < 0.01; control vs. low-dose: p < 0.01, control vs. high-dose: p < 0.01) and p-CREB (Fig. 6F, ANOVA: F(2,15) = 123.40, p < 0.01; control vs. low-dose: p = 0.04, control vs. highdose: p < 0.01, low-dose vs. high-dose: p < 0.01) protein expression in the treatment groups. The levels of BDNF (Fig. 6G, ANOVA: F(2,15) = 31.62, p < 0.01; control vs. high-dose: p < 0.01, low-dose vs. high-dose: p < 0.01) protein expression reduced in the high-dose group. ATR treatment significantly decreased the level of Zif268 protein expression in the ATR-treated groups (Fig. 6H, ANOVA: F(2,15) = 95.92, p < 0.01; control vs. low-dose: p < 0.01, control vs. high-dose: p < 0.01, low-dose vs. highdose: p < 0.01).
3.5. Effects of ATR exposure on protein expression levels The relative protein expression levels of MEK1/2, p-MEK1/2, ERK1/2, p-ERK1/2, CREB, p-CREB, BDNF, and Zif268 following ATR treatment in
677
Ecotoxicology and Environmental Safety 170 (2019) 673–681
J. Li et al.
Fig. 5. Effects of ATR exposure on mRNA expression levels in the hippocampus were measured with reverse transcription -PCR. (A) MEK1, (B) MEK2, (C) ERK1, (D) ERK2, (E) CREB, (F) BDNF and (G) Zif268. Expression levels were standardized to β-actin. Each column represents the mean ± S.E.M, six rats per group, * p < 0.05 vs. the control group, ** p < 0.01 vs. the control group. # Significant difference between ATR-treated groups.
4. Discussion
decreased spatial memory ability in a dose-dependent manner. Interestingly, the average platform crossing time of the low-dose group was lower than the high-dose group. Indeed, although platform crossing time is a parameter commonly used to measure spatial memory abilities, it has several limitations, including being influenced by the size of the platform, water tank properties and even the tracing software used (Vorhees and Williams, 2006). Thus, the percentage of time spent in the target quadrant and the time spent in the target annulus may serve as more reliable measures of spatial memory ability. Our results of the spatial probe test demonstrate that ATR treatment may affect spatial memory abilities, especially in the high-dose group. These results are also in agreement with previous studies, which suggest that exposure to ATR impairs performance in other hippocampus-dependent learning and memory tasks in rodents, such as the NOR and Y-maze (Bardullas et al., 2011; Kale et al., 2018; Lin et al., 2013). In mammals, the hippocampus is the key brain region responsible for encoding and consolidating information, transforming short-term memory into long term memory. Anatomically, the CA1 and DG regions of hippocampus are critical for spatial learning and memory (Kesner et al., 2004; Nakazawa et al., 2004; Bartsch et al., 2010). A previous study demonstrated that exposure to ATR at a dose of 100 µg/kg BW reduced the total number of neurons with perikaryal swelling and astrocytic formations in the DG area of female mice (Giusi et al., 2006). In this study, analysis by transmission electron microscopy suggested that ATR treatment induces the degeneration of mitochondria and nuclei in
ATR has been previously suggested to affect hippocampus-dependent learning and memory in rodents, but the underlying mechanism is still unclear. In the present study, we found that developmental exposure to ATR influences hippocampus-dependent learning and memory functions in male SD rats. Moreover, we showed that neuron ultrastructure in the DG and CA1 hippocampal regions was also impaired following ATR treatment. Concomitant with these observations, we found that ATR treatment resulted in a decrease in the expression of the MEK/ERK/CREB signaling pathway in the hippocampus, as well as a decrease in the expression of the critical downstream factors BDNF and Zif268. We first tested for any adverse effect of ATR on learning and memory with a MWM test, which is used to assess hippocampal spatial learning and memory abilities in rodents (Vorhees and Williams, 2006). In the place navigation test, the escape latency – or time spent locating the hidden platform – is a critical parameter reflecting the spatial learning abilities of the subject (Duva et al., 1997). Here, we found that the MWM escape latency was not affected by ATR treatment, thus indicating that the spatial learning abilities of rats may not be sensitive to developmental exposure to ATR. Using the spatial probe test, we selected three parameters reflecting spatial memory abilities. When measuring the percentage of time spent in the target quadrant, and the time spent in the target annulus, we found that ATR treatment 678
Ecotoxicology and Environmental Safety 170 (2019) 673–681
J. Li et al.
Fig. 6. Effects of atrazine (ATR) exposure on protein expression levels in the hippocampus were measured using western blot analysis. (A) MEK1/2, (B) p-MEK1/2, (C) ERK1/2, (D) p-ERK1/2, (E) CREB, (F) p-CREB, (G) BDNF and (H) Zif268. Expression levels were standardized to β-actin. Each column represents the mean ± S.E.M, six rats per group, * p < 0.05 as compared with the control group, ** p < 0.01 as compared with the control group. # Significant difference between ATR-treated groups.
neurons of both the DG and CA1 areas. In the present study, in addition to mitochondrial and nuclear defects, we also observed an increased number of lysosomes and unclear synaptic clefts in CA1 neurons following ATR treatment. Lysosomes are critical regulators of cellular homeostasis, and perform multiple functions such as the degradation of macromolecules and nutrient recycling (Ferguson, 2018). Mitochondria support diverse cellular functions such as the formation of reactive oxygen species, ATP generation and apoptosis (Erpapazoglou et al., 2017). Notably, mitochondrial and lysosomal dysfunction is a common theme in neurodegenerative disease, including Alzheimer’s and Parkinson’s disease (de la Monte et al., 2000; Cannon et al., 2009; Gowrishankar et al., 2015; Blazquez-Llorca et al., 2017). We therefore hypothesized that the observed ultrastructural defects in different hippocampal sub-regions may be related to the deficits in learning and memory induced by ATR. Other pesticides, such as paraquat and parathion, have also been observed to cause similar hippocampal deficits in rats (Chen et al., 2010; Canales-Aguirre et al., 2012). It is generally accepted that hippocampus-dependent synaptic plasticity is the foundation of learning and memory. The cellular process of long-term memory formation, known as long term potentiation (LTP), is a well described series of cellular events involved in hippocampus-dependent synaptic plasticity (Kullmann and Lamsa, 2007). Previous studies have shown that the ERK1/2 signaling pathway plays a
key role in hippocampal LTP. Specifically, phosphorylation of ERK1/2 is a critical event in LTP induction (Selcher et al., 1999). In this study, we found that the mRNA levels of ERK1/2 were both decreased with high-doses of ATR, whereas no significant differences in the protein levels of ERK1/2 were seen. However, the protein levels of p-ERK1/2 were reduced in a dose-dependent manner. ERK1/2 can be phosphorylated directly by the immediate upstream kinases MEK1/2, with the activation of MEK1/2 also being phosphorylation-dependent via mitogen-activated protein kinase kinases, such as the RAF proteins (Raman et al., 2007). Here, we also found that the mRNA levels of MEK1/2 decreased with high-doses of ATR, with MEK1/2 and p-MEK1/ 2 protein levels also reduced, especially in the high-dose group. Thus, we are able to infer that the MEK/ERK cascade may be involved in ATRinduced hippocampal dysfunction. The transcription factor CREB has been extensively studied for its role in hippocampus-dependent learning and memory (West et al., 2002; Lonze and Ginty, 2002). Previous research has demonstrated that the phosphorylation of CREB at Ser133, performed by the ERK1/2 signaling pathway, initiates a cascade of transcriptional changes required for LTP in the hippocampus (Wu et al., 2001). As expected, we observed a decrease in the mRNA and protein levels of CREB following ATR treatment, along with a decrease in the protein level of p-CREB in the high-dose ATR-treated group. 679
Ecotoxicology and Environmental Safety 170 (2019) 673–681
J. Li et al.
We also observed changes to other factors involved in the CREB pathway in our ATR treatment paradigm. BDNF belongs to the family of neurotrophins, and is understood to be a critical factor in neuronal survival, differentiation, synapse formation and LTP regulation, in the hippocampus as well as other brain regions (Park and Poo, 2013). The IEG Zif268 is associated with the regulation of the persistence of protein synthesis in hippocampal LTP (Bozon et al., 2003). Both BDNF and Zif268 production are dependent on ERK1/2-mediated phosphorylation of CREB (Bozon et al., 2003; Jeon et al., 2011). In this study, we found that the mRNA and protein levels of BDNF were both reduced following ATR treatment. Interestingly, we observed that the level of Zif268 protein was decreased following ATR treatment, yet there was no significant difference in the mRNA expression level of Zif268 amongst all groups. The quantitative relationship between the level of mRNA and its encoded protein is complex, and can be influenced, amongst other things, by the rate of translation and protein degradation (de Sousa Abreu et al., 2009). Our results therefore indicated that ATR may interfere in the process of translation and/or protein degradation in the hippocampus of rats, which led to the differential expression levels of Zif268 mRNA and protein.
Blazquez-Llorca, L., Valero-Freitag, S., Rodrigues, E.F., Merchán-Pérez, Á., Rodríguez, J.R., Dorostkar, M.M., DeFelipe, J., Herms, J., 2017. High plasticity of axonal pathology in Alzheimer's disease mouse models. Acta Neuropathol. Commun. 5, 14. https://doi.org/10.1186/s40478-017-0415-y. Blokland, A., Geraerts, E., Been, M., 2004. A detailed analysis of rats' spatial memory in a probe trial of a Morris task. Behav. Brain Res. 154, 71–75. https://doi.org/10.1016/j. bbr.2004.01.022. Bouvier, G., Blanchard, O., Momas, I., Seta, N., 2006. Pesticide exposure of non-occupationally exposed subjects compared to some occupational exposure: a French pilot study. Sci. Total Environ. 366, 74–91. https://doi.org/10.1016/j.scitotenv.2005.08. 016. Bozon, B., Kelly, A., Josselyn, S.A., Silva, A.J., Davis, S., Laroche, S., 2003. MAPK, CREB and zif268 are all required for the consolidation of recognition memory. Philos. Trans. R. Soc. Lond. B Biol. Sci. 358, 805–814. https://doi.org/10.1098/rstb.2002. 1224. Canales-Aguirre, A.A., Gomez-Pinedo, U.A., Luquin, S., Ramírez-Herrera, M.A., MendozaMagaña, M.L., Feria-Velasco, A., 2012. Curcumin protects against the oxidative damage induced by the pesticide parathion in the hippocampus of the rat brain. Nutr. Neurosci. 15, 62–69. https://doi.org/10.1179/1476830511Y.0000000034. Cannon, J.R., Tapias, V., Na, H.M., Honick, A.S., Drolet, R.E., Greenamyre, J.T., 2009. A highly reproducible rotenone model of Parkinson's disease. Neurobiol. Dis. 34, 279–290. https://doi.org/10.1016/j.nbd.2009.01.016. Chen, Q., Niu, Y., Zhang, R., Guo, H., Gao, Y., Li, Y., Liu, R., 2010. The toxic influence of paraquat on hippocampus of mice: involvement of oxidative stress. Neurotoxicology 31, 310–316. https://doi.org/10.1016/j.neuro.2010.02.006. Duva, C.A., Floresco, S.B., Wunderlich, G.R., Lao, T.L., Pinel, J.P., Phillips, A.G., 1997. Disruption of spatial but not object-recognition memory by neurotoxic lesions of the dorsal hippocampus in rats. Behav. Neurosci. 111, 1184–1196. https://doi.org/10. 1037//0735-7044.111.6.1184. Eldridge, J.C., Wetzel, L.T., Stevens, J.T., Simpkins, J.W., 1999. The mammary tumor response in triazine-treated female rats: a threshold-mediated interaction with strain and species-specific reproductive senescence. Steroids 64, 672–678. https://doi.org/ 10.1016/S0039-128X(99)00051-3. Erpapazoglou, Z., Mouton-Liger, F., Corti, O., 2017. From dysfunctional endoplasmic reticulum-mitochondria coupling to neurodegeneration. Neurochem. Int. 109, 171–183. https://doi.org/10.1016/j.neuint.2017.03.021. Fa, S., Pogrmic-Majkic, K., Samardzija, D., Glisic, B., Kaisarevic, S., Kovacevic, R., Andric, N., 2013. Involvement of ERK1/2 signaling pathway in atrazine action on FSH-stimulated LHR and CYP19A1 expression in rat granulosa cells. Toxicol. Appl. Pharmacol. 270, 1–8. https://doi.org/10.1016/j.taap.2013.03.031. Ferguson, S.M., 2018. Neuronal lysosomes. Neurosci. Lett. https://doi.org/10.1016/j. neulet.2018.04.005. Foradori, C.D., Hinds, L.R., Quihuis, A.M., Lacagnina, A.F., Breckenridge, C.B., Handa, R.J., 2011. The differential effect of atrazine on luteinizing hormone release in adrenalectomized adult female Wistar rats. Biol. Reprod. 85, 684–689. https://doi. org/10.1095/biolreprod.111.092452. Gammon, D.W., Aldous, C.N., Carr, W.C., Sanborn, J.R., Pfeifer, K.F., 2005. A risk assessment of atrazine use in California: human health and ecological aspects. Pest Manag. Sci. 61, 331–355. https://doi.org/10.1002/ps.1000. Giusi, G., Facciolo, R.M., Canonaco, M., Alleva, E., Belloni, V., Dessi'-Fulgheri, F., Santucci, D., 2006. The endocrine disruptor atrazine accounts for a dimorphic somatostatinergic neuronal expression pattern in mice. Toxicol. Sci. 89, 257–264. https://doi.org/10.1093/toxsci/kfj012. Gowrishankar, S., Yuan, P., Wu, Y., Schrag, M., Paradise, S., Grutzendler, J., De Camilli, P., Ferguson, S.M., 2015. Massive accumulation of luminal protease-deficient axonal lysosomes at Alzheimer's disease amyloid plaques. Proc. Natl. Acad. Sci. USA 112, E3699–3708. https://doi.org/10.1073/pnas.1510329112. Grewal, S.S., Fass, D.M., Yao, H., Ellig, C.L., Goodman, R.H., Stork, P.J., 2000. Calcium and cAMP signals differentially regulate cAMP-responsive element-binding protein function via a Rap1-extracellular signal-regulated kinase pathway. J. Biol. Chem. 275, 34433–34441. https://doi.org/10.1074/jbc.M004728200. Jeon, S.J., Rhee, S.Y., Seo, J.E., Bak, H.R., Lee, S.H., Ryu, J.H., Cheong, J.H., Shin, C.Y., Kim, G.H., Lee, Y.S., Ko, K.H., 2011. Oroxylin A increases BDNF production by activation of MAPK-CREB pathway in rat primary cortical neuronal culture. Neurosci. Res. 69, 214–222. https://doi.org/10.1016/j.neures.2010.11.008. Jowa, L., Howd, R., 2011. Should atrazine and related chlorotriazines be considered carcinogenic for human health risk assessment. J. Environ. Sci. Health C. Environ. Carcinog. Ecotoxicol. Rev. 29, 91–144. https://doi.org/10.1080/10590501.2011. 577681. Kale, O.E., Oyesola, T.O., Raji, F.S., 2018. Celecoxib, a cyclooxygenase-2 inhibitor, offers chemoprevention against reproductive and neurobehavioural abnormalities induced by atrazine in male Wistar rats. Environ. Toxicol. Pharmacol. 58, 84–97. https://doi. org/10.1016/j.etap.2017.12.026. Karmaus, A.L., Zacharewski, T.R., 2015. Atrazine-mediated disruption of steroidogenesis in BLTK1 murine leydig cells. Toxicol. Sci. 148, 544–554. https://doi.org/10.1093/ toxsci/kfv204. Kesner, R.P., Lee, I., Gilbert, P., 2004. A behavioral assessment of hippocampal function based on a subregional analysis. Rev. Neurosci. 15, 333–351. https://doi.org/10. 1515/REVNEURO.2004.15.5.333. Kullmann, D.M., Lamsa, K.P., 2007. Long-term synaptic plasticity in hippocampal interneurons. Nat. Rev. Neurosci. 8, 687–699. https://doi.org/10.1038/nrn2207. Lin, Z., Dodd, C.A., Filipov, N.M., 2013. Short-term atrazine exposure causes behavioral deficits and disrupts monoaminergic systems in male C57BL/6 mice. Neurotoxicol. Teratol. 39, 26–35. https://doi.org/10.1016/j.ntt.2013.06.002. Lonze, B.E., Ginty, D.D., 2002. Function and regulation of CREB family transcription factors in the nervous system. Neuron 35, 605–623. https://doi.org/10.1016/S0896-
5. Conclusions In the present study, we demonstrate that developmental exposure to ATR impairs hippocampus-dependent learning and memory in male SD rats. Moreover, ATR treatment is able to induce ultrastructural changes in the hippocampus. At the molecular level, ATR-treatment reduces the levels of protein and mRNA amongst members of the MEK/ ERK/CREB signaling pathway, as well as the downstream factors BDNF and Zif268. Downregulation of this signaling pathway may be related to the functional and morphological lesions induced by ATR in the hippocampus of rats. This study represents a preliminary description of the molecular changes to the MEK/ERK/CREB signaling pathway following ATR treatment. However, the precise mechanism underlying ATR-induced hippocampal neurotoxicity requires further investigation, such as in vitro or slices. CRediT authorship contribution statement Jianan Li: Investigation, Visualization, Writing - original draft, Writing - review & editing. Xueting Li: Data curation, Formal analysis, Writing - review & editing. Haoran Bi: Data curation, Formal analysis, Writing - review & editing. Baixiang Li: Funding acquisition, Project administration, Supervision, Validation, Writing - review & editing. Acknowledgments This work was supported by the National Natural Science Foundation of China (grant number: 81273109). Conflicts of interest The authors declare no conflict of interest. References Abarikwu, S.O., Adesiyan, A.C., Oyeloja, T.O., Oyeyemi, M.O., Farombi, E.O., 2010. Changes in sperm characteristics and induction of oxidative stress in the testis and epididymis of experimental rats by a herbicide, atrazine. Arch. Environ. Contam. Toxicol. 58, 874–882. https://doi.org/10.1007/s00244-009-9371-2. Bardullas, U., Giordano, M., Rodríguez, V.M., 2011. Chronic atrazine exposure causes disruption of the spontaneous locomotor activity and alters the striatal dopaminergic system of the male Sprague-Dawley rat. Neurotoxicol. Teratol. 33, 263–272. https:// doi.org/10.1016/j.ntt.2010.09.001. Bartsch, T., Schönfeld, R., Müller, F.J., Alfke, K., Leplow, B., Aldenhoff, J., Deuschl, G., Koch, J.M., 2010. Focal lesions of human hippocampal CA1 neurons in transient global amnesia impair place memory. Science 328, 1412–1415. https://doi.org/10. 1126/science.1188160.
680
Ecotoxicology and Environmental Safety 170 (2019) 673–681
J. Li et al. 6273(02)00828-0. Meffe, R., de Bustamante, I., 2014. Emerging organic contaminants in surface water and groundwater: a first overview of the situation in Italy. Sci. Total Environ. 481, 280–295. https://doi.org/10.1016/j.scitotenv.2014.02.053. de la Monte, S.M., Luong, T., Neely, T.R., Robinson, D., Wands, J.R., 2000. Mitochondrial DNA damage as a mechanism of cell loss in Alzheimer's disease. Lab. Invest. 80, 1323–1335. https://doi.org/10.1038/labinvest.3780140. Nakazawa, K., McHugh, T.J., Wilson, M.A., Tonegawa, S., 2004. NMDA receptors, place cells and hippocampal spatial memory. Nat. Rev. Neurosci. 5, 361–372. https://doi. org/10.1038/nrn1385. Park, H., Poo, M.M., 2013. Neurotrophin regulation of neural circuit development and function. Nat. Rev. Neurosci. 14, 7–23. https://doi.org/10.1038/nrn3379. Pogrmic-Majkic, K., Fa, S., Samardzija, D., Hrubik, J., Kaisarevic, S., Andric, N., 2016. Atrazine activates multiple signaling pathways enhancing the rapid hCG-induced androgenesis in rat Leydig cells. Toxicology 368–369, 37–45. https://doi.org/10. 1016/j.tox.2016.08.016. Raman, M., Chen, W., Cobb, M.H., 2007. Differential regulation and properties of MAPKs. Oncogene 26, 3100–3112. https://doi.org/10.1038/sj.onc.1210392. Rodríguez, V.M., Limón-Pacheco, J.H., Mendoza-Trejo, M.S., González-Gallardo, A., Hernández-Plata, I., Giordano, M., 2013. Repeated exposure to the herbicide atrazine alters locomotor activity and the nigrostriatal dopaminergic system of the albino rat. Neurotoxicology 34, 82–94. https://doi.org/10.1016/j.neuro.2012.10.012. Selcher, J.C., Atkins, C.M., Trzaskos, J.M., Paylor, R., Sweatt, J.D., 1999. A necessity for
MAP kinase activation in mammalian spatial learning. Learn. Mem. 6, 478–490. https://doi.org/10.1101/lm.6.5.478. de Sousa Abreu, R., Penalva, L.O., Marcotte, E.M., Vogel, C., 2009. Global signatures of protein and mRNA expression levels. Mol. Biosyst. 5, 1512–1526. https://doi.org/10. 1039/b908315d. Treisman, R., 1996. Regulation of transcription by MAP kinase cascades. Curr. Opin. Cell Biol. 8, 205–215. https://doi.org/10.1016/S0955-0674(96)80067-6. Vorhees, C.V., Williams, M.T., 2006. Morris water maze: procedures for assessing spatial and related forms of learning and memory. Nat. Protoc. 1, 848–858. https://doi.org/ 10.1038/nprot.2006.116. Waltereit, R., Weller, M., 2003. Signaling from cAMP/PKA to MAPK and synaptic plasticity. Mol. Neurobiol. 27, 99–106. https://doi.org/10.1385/MN:27:1:99. Wang, J., Du, Z., Yu, W., Qu, S., 2012. Detection of seven pesticides in cucumbers using hollow fibre-based liquid-phase microextraction and ultra-high pressure liquid chromatography coupled to tandem mass spectrometry. J. Chromatogr. A 1247, 10–17. https://doi.org/10.1016/j.chroma.2012.05.040. West, A.E., Griffith, E.C., Greenberg, M.E., 2002. Regulation of transcription factors by neuronal activity. Nat. Rev. Neurosci. 3, 921–931. https://doi.org/10.1038/nrn987. Wu, G.Y., Deisseroth, K., Tsien, R.W., 2001. Activity-dependent CREB phosphorylation: convergence of a fast, sensitive calmodulin kinase pathway and a slow, less sensitive mitogen-activated protein kinase pathway. Proc. Natl. Acad. Sci. USA 98, 2808–2813. https://doi.org/10.1073/pnas.051634198.
681