The membrane-bound sorbosone dehydrogenase of Gluconacetobacter liquefaciens is a pyrroloquinoline quinone-dependent enzyme

Enzyme and Microbial Technology 137 (2020) 109511

Contents lists available at ScienceDirect

Enzyme and Microbial Technology journal homepage: www.elsevier.com/locate/enzmictec

The membrane-bound sorbosone dehydrogenase of Gluconacetobacter liquefaciens is a pyrroloquinoline quinone-dependent enzyme

T

Toshiharu Yakushia,b,c,*,1, Ryota Takahashia,1, Minenosuke Matsutania,1,2, Naoya Kataokaa,b,c, Roque A. Hoursd, Yoshitaka Anoe, Osao Adachia,b, Kazunobu Matsushitaa,b,c a

Division of Agricultural Science, Graduate School of Science and Technology for Innovation, Yamaguchi University, Yamaguchi 753-8515, Japan Department of Biological Chemistry, Faculty of Agriculture, Yamaguchi University, Yamaguchi 753-8515, Japan c Research Center for Thermotolerant Microbial Resources, Yamaguchi University, Yamaguchi 753-8515, Japan d Centro de Investigación y Desarrollo en Fermentaciones Industriales (CINDEFI), Universidad Nacional de La Plata - CONICET, La Plata, Argentina e Department of Bioscience, Graduate School of Agriculture, Ehime University, Matsuyama 796-8566, Japan b

A R T I C LE I N FO

A B S T R A C T

Keywords: Acetic acid bacteria Pyrroloquinoline quinone Gluconacetobacter L-Sorbosone Sorbosone dehydrogenase 2-Keto-L-gulonic acid

Membrane-bound sorbosone dehydrogenase (SNDH) of Gluconacetobacter liquefaciens oxidizes L-sorbosone to 2keto-L-gulonic acid (2KGLA), a key intermediate in vitamin C production. We constructed recombinant Escherichia coli and Gluconobacter strains harboring plasmids carrying the sndh gene from Ga. liquefaciens strain RCTMR10 to identify the prosthetic group of SNDH. The membranes of the recombinant E. coli showed L-sorbosone oxidation activity, only after the holo-enzyme formation with pyrroloquinoline quinone (PQQ), indicating that SNDH is a PQQ-dependent enzyme. The sorbosone-oxidizing respiratory chain was thus heterologously reconstituted in the E. coli membranes. The membranes that contained SNDH showed the activity of sorbosone:ubiquinone analogue oxidoreductase. These results suggest that the natural electron acceptor for SNDH is membranous ubiquinone, and it functions as the primary dehydrogenase in the sorbosone oxidation respiratory chain in Ga. liquefaciens. A biotransformation experiment showed L-sorbosone oxidation to 2KGLA in a nearly quantitative manner. Phylogenetic analysis for prokaryotic SNDH homologues revealed that they are found only in the Proteobacteria phylum and those of the Acetobacteraceae family are clustered in a group where all members possess a transmembrane segment. A three-dimensional structure model of the SNDH constructed with an in silico fold recognition method was similar to the crystal structure of the PQQ-dependent pyranose dehydrogenase from Coprinopsis cinerea. The structural similarity suggests a reaction mechanism under which PQQ participates in L-sorbosone oxidation.

1. Introduction L-Ascorbic acid (vitamin C) is industrially produced and used in food and feed as a nutritional supplement [1]. L-Ascorbic acid was previously produced from D-sorbitol via the Reichstein method, in which D-sorbitol is converted to L-sorbose by the action of acetic acid bacterium Gluconobacter cells, where pyrroloquinoline quinone (PQQ)-

dependent glycerol dehydrogenase (GLDH) has crucial role in the catalysis [2], and then several chemical processes convert L-sorbose to Lascorbic acid via 2-keto-L-gulonic acid (2KGLA), a precursor that converts to L-ascorbic acid by lactonization [1]. Nowadays, industrial vitamin C production is based on the ability of Ketogulonicigenium vulgare to perform the biotransformation of L-sorbose into L-ascorbic acid, or to the intermediate 2KGLA, without the need of any chemical steps [1].

Abbreviations: A. calcoaceticus, Acinetobacter calcoaceticus; CcPDH, pyranose dehydrogenase of Coprinopsis cinerea; DCPIP, 2,6-dichlorophenolindophenol; E. coli, Escherichia coli; G. oxydans, Gluconobacter oxydans; Ga. liquefacuens, Gluconacetobacter liquefaciens; HEPES, 4-(2-hydroxyethyl)-1-piperazineethanesulphonic acid; Kg. vulgare, Ketogulonicigenium vulgare; 2KGLA, 2-keto-L-gulonic acid; MES, 2-(N-morpholino)ethanesulphonic acid; MOPS, 3-morpholinopropanesulfonic acid; PMS, phenazine methosulfate; PQQ, pyrroloquinoline quinone; Q, ubiquinone; Q1, 2,3-Dimethoxy-5-methyl-6-(3-methyl-2-butenyl)-1,4-benzoquinone; Q2, 2,3Dimethoxy-5-methyl-6-geranyl-1,4-benzoquinone; sGDH, soluble glucose dehydrogenase; SNDH, sorbosone dehydrogenase ⁎ Corresponding author at: Division of Agricultural Science, Graduate School of Science and Technology for Innovation, Yamaguchi University, Yamaguchi 7538515, Japan. E-mail address: [email protected] (T. Yakushi). 1 These authors contributed equally to this work. 2 Present address: NODAI Genome Research Center, Tokyo University of Agriculture, Tokyo 156-8502, Japan. https://doi.org/10.1016/j.enzmictec.2020.109511 Received 26 August 2019; Received in revised form 6 January 2020; Accepted 12 January 2020 Available online 28 January 2020 0141-0229/ © 2020 Elsevier Inc. All rights reserved.

Enzyme and Microbial Technology 137 (2020) 109511

T. Yakushi, et al.

Fig. 1. A route for 2KGLA production from D-sorbitol with the membrane-bound enzymes of various acetic acid bacteria. Arrows show a possible metabolic pathway in the production of 2KGLA. Glycerol dehydrogenase (GLDH) is commonly found in Gluconobacter spp [2,66]. Some Gluconobacter species have flavoprotein sorbose dehydrogenase (SDH) [3,4]. For simplicity, L-sorbosone is shown in the two isoforms: upper, chain form; lower, 1,5-pyranose form. Sorbosone dehydrogenase (SNDH) of Gluconacetobacter liquefaciens presumably oxidizes L-sorbosone-1,5-pyranose to produce 2-keto-Lgulono-1,5-lactone (2KGLL), which is hydrolyzed into 2-keto-L-gulonic acid (2KGLA) [5]. See the Discussion section for details. As shown in the dotted arrow, a chemical process for lactonization of 2KGLA may produce ascorbic acid. QH2, ubiquinol; Oxidase, ubiquinol oxidase.

dehydrogenase, which has been suggested to have an eight-β-bladed propeller structure [15]. These three sorbosone dehydrogenases show different structural and catalytic properties, but all enzymes possess PQQ as a redox cofactor. Enzymes described in this study are listed in Table S1. However, that of Ga. liquefaciens SNDH has not been identified yet, so the primary objective in this study is to identify the redox cofactor of SNDH. Matsumura et al. found a new PQQ-dependent pyranose dehydrogenase (CcPDH) from the basidiomycete Coprinopsis cinerea as the first recorded eukaryotic PQQ-dependent oxidoreductase [16]. CcPDH consists of three domains: the PQQ-dependent dehydrogenase, a cytochrome b domain, and a family 1 carbohydrate-binding module. Recently, the crystal structure revealed that the PQQ-dependent dehydrogenase domain of this enzyme consists of six β-propellers similar to the structure of sGDH of A. calcoaceticus [17]. Furthermore, the enzyme 2-keto-glucose dehydrogenase (2KGDH) of Pseudomonas aureofaciens, which is homologous to not only CcPDH but also SNDH, was reported to be PQQ-dependent [18]. In this study, we examined the properties of recombinant SNDH expressed in Gluconobacter and E. coli. Our experimental data indicate that Ga. liquefaciens SNDH is PQQ-dependent, and in silico analyses suggested a similar PQQ-binding mode to that of CcPDH.

However, some limited Gluconobacter species oxidize L-sorbose to Lsorbosone with a membrane-bound flavoprotein sorbose dehydrogenase (SDH) [3,4]. In addition, Gluconacetobacter liquefaciens NBRC12258 (formerly Acetobacter liquefaciens IFO12258) converts Lsorbosone to 2KGLA with a membrane-bound L-sorbosone dehydrogenase (SNDH; Fig. 1) [5]. Because Gluconacetobacter spp. do not possess SDH and Gluconobacter spp. do not SNDH, a 2KGLA production by acetic acid bacteria from D-sorbitol would be a two-step system consists of sorbosone-production and 2KGLA-production processes. Biochemical characterization of SNDH may help to develop an alternative biologically-based route to convert D-sorbitol to L-ascorbic acid. Other types of SNDH besides Ga. liquefaciens SNDH have been reported. For example, L-sorbose/L-sorbosone dehydrogenase of Kg. vulgare DSM 4025 (formerly Gluconobacter oxydans DSM 4025) is a soluble, PQQ-dependent enzyme located in the periplasm [6]. This enzyme oxidizes alcohols as well as L-sorbose and L-sorbosone, and the reaction product of sorbosone oxidation is 2KGLA. The structure resembles that of PQQ-dependent type I alcohol dehydrogenase [7,8]. Another Kg. vulgare PQQ-dependent soluble enzyme catalyzes L-sorbosone oxidation to produce both 2KGLA and L-ascorbic acid [9]. This enzyme contains a cytochrome c domain that is presumably involved in electron transfer. The primary sequence is similar to that of PQQ-dependent soluble glucose dehydrogenase (sGDH) of Acinetobacter calcoaceticus [10], which consists of a six-β-bladed propeller structure [11]. Finally, a protein homologous to membrane-bound, PQQ-dependent dehydrogenase 1, currently known as inositol dehydrogenase, of G. oxydans 621H strain oxidizes L-sorbosone to produce L-ascorbic acid [12–14]. This enzyme is related to membrane-bound, PQQ-dependent glucose

2. Materials and methods 2.1. Chemicals L-Sorbosone

2

and 2KGLA were kind gifts from DSM Nutritional

Enzyme and Microbial Technology 137 (2020) 109511

T. Yakushi, et al.

centrifugation at 9,000 × g and 4 °C for 10 min and resuspended in 10 mM 2-(N-morpholino)ethanesulphonic acid (MES) (K+, pH 6.0). The resuspended cells were sedimented by centrifugation. The pellet was resuspended in four volumes (4 mL per 1 g of wet weight cells) of 10 mM K+-MES (pH 6.0) containing 0.5 mM phenylmethylsulphonyl fluoride. The cell suspension was passed through a French pressure cell press (American Instrument, Silver Spring, MD, USA) at 1,000 kg cm−². After centrifugation at 9,000 × g at 4 °C for 10 min to remove intact cells, the supernatants were centrifuged at 100,000 × g at 4 °C for 1 h. The precipitate was resuspended in the same buffer and used as cell membranes.

Products (Basel, Switzerland). Ubiquinone-1 [Q1, 2,3-dimethoxy-5methyl-6-(3-methyl-2-butenyl)-1,4-benzoquinone] and ubiquinone-2 (Q2, 2,3-Dimethoxy-5-methyl-6-geranyl-1,4-benzoquinone) were kind gifts from Dr. Kimitoshi Sakamoto (Hirosaki University, Japan) [19]. Yeast extract was kindly supplied by Oriental Yeast (Osaka, Japan). Endonucleases and genetic engineering kits were kind gifts from Toyobo (Osaka, Japan). All other materials used were of analytical grade and obtained from commercial sources. 2.2. Microorganisms and cultivation Ga. liquefaciens strain RCTMR10, which has been deposited in NBRC (http://www.nite.go.jp/en/nbrc/index.html) as NBRC113262, was used in this study. This strain was grown in ΔP medium consisting of 20 g of glycerol, 5 g of D-glucose, 10 g of yeast extract and 10 g of Hipolypepton (Nihon Pharmaceuticals, Osaka, Japan) per litre. Gluconobacter sp. strain CHM43 [20] deposited as NBRC101659 and its ΔadhAB derivative SEI46 [21] were used in this study. Gluconobacter cells were grown in SG-G medium consisting of 10 g of sodium D-gluconate, 10 g of D-glucose, 3 g of yeast extract and 3 g of Hipolypepton per litre at 30 °C. The Escherichia coli strain DH5α was used for plasmid construction [22], whereas the E. coli strain BL21 [23] was used for protein expression. E. coli strains were grown on modified Luria–Bertani (LB) medium [24], which consisted of 10 g of Hipolypepton, 5 g of yeast extract and 5 g of NaCl per litre (pH 7.0 adjusted with NaOH). Ampicillin was used at final concentrations of 50 and 500 μg mL−1 for E. coli and Gluconobacter, respectively. Chloramphenicol was used at final concentrations of 25 μg mL−1 for E. coli.

2.5. Enzyme assays SNDH activity was measured at 25 °C by the reduction of 2,6-dichlorophenolindophenol (DCPIP) at 600 nm mediated by phenazine methosulfate (PMS) [6]. The reaction mixture consisted of 20 mM 4-(2hydroxyethyl)-1-piperazineethanesulphonic acid (HEPES) (K+, pH 7.0), 6.6 mM DCPIP, 6.0 mM PMS, membranes, and 2 mM L-sorbosone. The molecular absorption coefficient used was ε600 = 14.5 mM−1 (pH 7.0). One unit was defined as 1 μmol of substrate consumed per minute. Ubiquinone-1 [Q1, 2,3-dimethoxy-5-methyl-6-(3-methyl-2-butenyl)1,4-benzoquinone] and ubiquinone-2 [Q2, 2,3-dimethoxy-5-methyl-6geranyl-1,4-benzoquinone] reductase activities were measured at 25 °C by monitoring the decrease in absorbance at 275 nm in 20 mM K+HEPES (pH 7.0), either 50 μM Q1 or 20 μM Q2, 1 mM KCN, membranes, and 2 mM L-sorbosone. The molecular absorption coefficient used was ε275 = 12.25 mM−1 [27]. One unit was defined as 1 μmol of substrate consumed per minute. Oxidase activity was measured by a Clark-type oxygen electrode (YSI model 5300; Yellow Spring Instrument, Yellow Springs, OH, USA) at 25 °C. The electrode was calibrated by using airsaturated 20 mM K+-HEPES (pH 7.0), assuming the concentration of molecular oxygen to be 249 μM [28]. Sodium dithionite was used for calibration to reduce molecular oxygen completely. The reaction mixture of sorbosone oxidase assay contained membranes, 20 mM K+HEPES (pH 7.0) and 2 mM L-sorbosone. One unit was defined as 1 μmol of half a molecular oxygen (equivalent to oxygen atom) consumed per minute. E. coli membranes were pre-incubated with PQQ to form holo-enzyme. Prior to the enzyme assays, the membranes (10 mg mL−1) were incubated with 10 μM PQQ in the presence of 10 mM CaCl2 at 25 °C for 30 min in 10 mM K+-MES (pH 6.0).

2.3. Construction of plasmids The genomic DNA of Ga. liquefaciens strain RCTMR10 was isolated by the method of Marmur [25] with some modifications [26]. The sndh gene of Ga. liquefaciens RCTMR10, with DDBJ/EMBL/GenBank accession number LC373924, was amplified by PCR with the Herculase II fusion DNA polymerase (Stratagene, CA, USA), a pair of phosphorylated oligonucleotides TMR10-sndh-5-RI(+) (gaattctgaccggctccgcttac, in 5′ → 3′ direction, an EcoRI recognition site is underlined) and TMR10sndh-3-Bam(−) (ggatccgaaagggctgcgtcag, in 5′ → 3′ direction, a BamHI recognition site is underlined), and genomic DNA of RCTMR10. The amplified 1.4 kb DNA fragments containing the sndh gene were ligated with pT7Blue (Novagen), which had been digested with EcoRV and treated with bacterial phosphatase (Toyobo). The plasmid containing the sndh gene in the same orientation as the T7 promoter was selected and named pRT1. The plasmid pRT1 was digested with EcoRI and BamHI, then the ca. 1.4-kb DNA fragment carrying sndh was inserted into the corresponding sites of pSHO8 [26] to construct pRT5 (Fig. S1). The nucleotide sequences of the inserted DNA constructed in this study were confirmed by sequencing.

2.6. Biotransformation of L-sorbosone Five millilitres of the reaction mixture consisting of 1.0 mg mL−1 of the membranes of the BL21 strain harboring pLys and pRT1 (sndh+), 250 mM 3-Morpholinopropanesulfonic acid (MOPS) (K+, pH 7.0), and 100 mM L-sorbosone were shaken in a disposable 50 mL plastic tube with a cap that had eight holes (φ = 2 mm) at 150 rpm and 30 °C for 12 h. An aliquot (500 μL) of the reaction mixture was taken periodically, and the membranes were removed after centrifugation at 100,000 × g and 4 °C for 1 h.

2.4. Preparation of cell membranes Gluconobacter strain SEI46 (ΔadhAB) harboring the plasmid pRT5 (sndh+) or pSHO8 (control plasmid) was aerobically pre-cultivated in SG-G medium at 30 °C for 24 h. Five millilitres of the pre-culture was transferred to 500 mL of SG-G medium in a 3 L Erlenmeyer flask, and the cultivation was conducted with a rotary shaker at 30 °C for 24 h, which corresponds to the late exponential growth phase. In the case of E. coli expression, the strain BL21 (DE3) harboring pRT1 (sndh+) or pT7Blue (control plasmid) as well as pLys was pre-cultivated in modified LB medium at 30 °C. One millilitre of the pre-culture was transferred to 100 mL of modified LB medium in a 500 mL Erlenmeyer flask, and the cultivation was conducted with a rotary shaker at 30 °C for 8 h. To induce gene expression, IPTG was added to the culture at a final concentration of 1 mM, and the cultivation was continued for 4 h at 30 °C. The Gluconobacter and E. coli cells were harvested by

2.7. Analytical procedures Protein concentrations were determined by a modified version of the Lowry method with bovine serum albumin as the standard [29]. The amounts of L-sorbosone, 2KGLA, and L-ascorbic acid were determined using a high-performance liquid chromatography (HPLC) system equipped with an ion-exclusion column (RSpak KC-811, 8.0 mm I.D. × 300 mm L; Shodex, Showa Denko KK, Kawasaki, Japan). The chromatography was run by using 0.1 % (w/v) H₃PO₄ as the mobile phase at a flow rate of 0.4 mL min−¹ at 60 °C. L-Ascorbic acid was detected with a diode array detector at 210 nm, while L-sorbosone and 2KGLA were detected with a refractive index detector. Retention times 3

Enzyme and Microbial Technology 137 (2020) 109511

T. Yakushi, et al.

Fig. 2. L-Sorbosone dehydrogenase and oxidase activities in the membranes of the recombinant Gluconobacter and E. coli strains. Sorbosone dehydrogenase activity (A) and sorbosone oxidase (sorbosone-dependent oxygen consumption) activity (B) in the recombinant Gluconobacter membranes were determined with 2 mM L-sorbosone. The Gluconobacter SEI46 strains harboring either pSHO8 (control plasmid) or pRT5 (sndh+) were used. Sorbosone dehydrogenase activity (C) and sorbosone oxidase activity (D) in the recombinant E. coli membranes were determined with 2 mM L-sorbosone. Prior to the enzyme assay, the membranes (10 mg mL−1) were pre-incubated with (+) or without (−) 10 μM PQQ. The E. coli BL21 (DE3) strain harboring pLys and either pT7Blue (control plasmid) or pRT1 (sndh+) were used. Mean values with standard deviation from triplicate assay are shown.

of L-sorbosone, 2KGLA and 19.4 min, respectively.

L-ascorbic

homologues were collected and used to construct a position-specific scoring matrix. Then, the profile calculated for the query database was converted to an HMM. HMM of the query database was scanned using HMM–HMM matching against a pre-compiled database of HMMs of a known fold library. The fold library is composed of a set of experimentally determined protein structures, and their profiles have been calculated using the same approach as for the query database. Because a profile–profile comparison approach is more sensitive than sequenceprofiling methods such as PSI-BLAST, we efficiently predicted the appropriate template structure for the construction of a three-dimensional model [37]. Superimposition of the modeled structure onto the template structure (PDB Entry: 6JWF [A chain]) was performed by the MatchMaker module in UCSF Chimera [38,39]. The CcPDH protein structure was subtracted from the superimposed structure to construct the holo-SNDH structure carrying PQQ, Ca2+, and H2O. Graphical images of the holoSNDH model were produced by UCSF Chimera. Global homology of the PQQ domain in CcPDH (410 amino acids long from the 240th residue Thr to the 649th residue Arg) with fulllength SNDH was calculated by using GENETYX-MAC (ver. 18; GENETYX, Osaka, Japan).

acid were 19.0, 17.3 and

2.8. Phylogenetic analysis To retrieve nucleotide sequence data, all bacterial and archaeal genomes categorised as reference and representative genomes [30] were downloaded from the NCBI Reference Sequence (RefSeq) Database FTP website at ftp.ncbi.nlm.nih.gov/. For phylogenetic analysis, we performed a BLASTP search for all protein-coding sequences in all genomes using amino acid sequences of SNDH of Ga. liquefaciens RCTMR10 as queries. The homologous set was selected with a BLASTP filtering expectation value (e-value) ≤10−5, sequence identity ≥60 % and sequence overlap ≥70 % (Table S2). All hits were collected and aligned using MUSCLE v.3.8.31 at the amino acid sequence level and used for phylogenetic analysis [31,32]. The MEGA version 7.01 package was used to generate the phylogenetic tree to study the phylogenetic relationships using the neighbour-joining approach with 1,000 bootstrap replicates [33]. Functionally validated protein sequences used as queries for BLASTP searches were also included in the phylogenetic tree. Signal peptide sequences and transmembrane segments of SNDH homologues were predicted by using SignalP 4.1 and TMHMM 2.0, respectively [34,35].

2.10. Nucleotide sequence accession number

2.9. Structure prediction and other bioinformatic analyses

The nucleotide sequence and the predicted amino acid sequence of the sndh gene of Ga. liquefaciens RCTMR10 was deposited in DDBJ/ EMBL/GenBank under accession number LC373924.

To predict the three-dimensional structure of the SNDH protein, the Phyre2 protein fold recognition server was used [36]. The method of the Phyre2 fold recognition server is based on the comparison of a query sequence database and a pre-compiled known fold library by using a hidden Markov model (HMM). First, query sequences and their 4

Enzyme and Microbial Technology 137 (2020) 109511

T. Yakushi, et al.

3. Results

form of membrane-bound glucose dehydrogenase (mGDH) [45], we examined glucose:Q1 and glucose:Q2 reductase activities after holoenzyme formation with PQQ. A. calcoaceticus mGDH reacts with Q2 in preference of Q1 [46], which was the case for E. coli enzyme (Fig. 3B). In contrast to this, SNDH showed higher activity with Q1 than with Q2. Taken together, these results suggest that a simple sorbosone-oxidizing respiratory chain physiologically consists of SNDH, Q and ubiquinol oxidase (Fig. 1).

3.1. Heterologous expression of SNDH in Gluconobacter The predicted amino acid sequence of the sndh gene found in the draft genome of Ga. liquefaciens strain RCTMR10 showed global identity of 96.6 % to that of Ga. liquefaciens strain NBRC12258. To construct an expression plasmid for sndh, the gene from G. liquefaciens strain RCTMR10 was inserted behind the putative promoter region of the adhAB gene (PadhAB) in the plasmid pSHO8 [26], a derivative of the broad-host-range plasmid pBBR1MCS-4 [40] carrying PadhAB of G. oxydans 621H. Gluconobacter strain SEI46, which has a deletion in the adhAB gene encoding membrane-bound alcohol dehydrogenase, was used as the expression host in this study because this enzyme is one of the major membrane proteins in Gluconobacter spp., so biochemical analysis such as protein purification might be perturbed in the wildtype strain. First, we attempted to detect SNDH activity as DCPIP reductase with PMS coupling (Fig. 2). The cell membranes of the recombinant Gluconobacter strain harboring pRT5 (sndh+) showed L-sorbosone-dependent DCPIP reductase (Fig. 2A), whereas those of the control plasmid showed only marginal activity. We examined SNDH activity by performing an oxygen consumption assay. The membranes of Gluconobacter harboring pRT5 (sndh+) showed L-sorbosone oxidase activity (Fig. 2B). These results suggest that the sorbosone-oxidizing respiratory chain was heterologously reconstituted in Gluconobacter. The marginal activity in the control membranes might have been due to weak sorbosone oxidation activity in the parental strain. Indeed, the membranes of the parental strain produced small amount of 2KGLA from L-sorbosone (data not shown).

3.4. 2KGLA production with heterologous sorbosone-oxidizing respiratory chain Shinjoh et al. reported that SNDH of Ga. liquefaciens oxidizes Lsorbosone to produce 2KGLA [5]. Shinjoh's group also reported that a Gluconobacter membrane-bound, PQQ-dependent inositol dehydrogenase catalyzes L-sorbosone oxidation producing L-ascorbic acid [12,14]. We examined reaction products in our sorbosone oxidation system using the recombinant E. coli membranes. Because our L-sorbosone contained 2KGLA contaminated, even at the initial point in the control experiment, the reaction mixture contained approximately 4 mM 2KGLA (Fig. 4A). 2KGLA appeared to increase concomitantly with the decrease in sorbosone levels (Fig. 4). L-Sorbosone was oxidized to 2KGLA in a nearly quantitative manner (87 % molar yield). No Lascorbic acid was produced in our biotransformation experiment of sorbosone. 3.5. Phylogenetic analysis of SNDH It was suggested that SNDH possesses a transmembrane segment in its N terminus [5]. Moreover, as described above, the natural electron acceptor of SNDH is probably membranous Q. However, 2KGDH of P. aureofaciens is proposed to be a periplasmic soluble enzyme, the electron acceptor of which is unknown [18]. We examined SNDH homologues for the relationships between the phylogeny and the predicted subcellular localization (Fig. 5 and Table S2). Our phylogenetic analysis did not include highly variable regions, such as the N-terminal region where there is a signal peptide or transmembrane segment. Therefore, the phylogeny of the PQQ-binding catalytic domain is shown in Fig. 5. First, only the Proteobacteria phylum possesses the SNDH homologues (see the Materials and Methods section for our definition of homologues). At first glance at Fig. 5, the SNDH homologues appear to be diverged from one another independently of systematic evolution. However, SNDH of Ga. liquefaciens was located in a clade consisting of SNDH homologues of the Acetobacteraceae family, and all of them possess a predicted transmembrane segment. It is noteworthy that no other Acetobacteraceae homologues were located in other clades in this dendrogram. Because the reference and representative genomes in the NCBI RefSeq Database (ftp://ftp.ncbi.nlm.nih.gov/genomes/refseq/) consist of genome data of the limited number of bacterial and archaeal species [30], we examined SNDH homologues in the non-redundant protein databases for the Acetobacteraceae family with Protein BLAST. The SNDH homologues were found in Gluconobacter as well as in Gluconacetobacter, Acetobacter and Komagataeibacter, but the Gluconobacter species are limited to Gluconobacter frateurii and Gluconobacter japonicus; the SNDH homologue was not found in the Gluconobacter sp. CHM43 draft genome [47]. The homologous gene products were also found in the genera Belnapia, Rhodopila and Roseomonas with relatively low sequence identity (see the Materials and Methods section for our definition of the homologues). That of Rhodopila was predicted to possess a transmembrane segment, whereas those of Belnapia and Roseomonas were signal sequences. 2KGDH of P. aureofaciens was located in a clade of SNDH homologues of the genus Pseudomonas, and most of them possess a predicted signal peptide for secretion but no transmembrane segments. Because SNDH and 2KGDH show high identity with each other (63 % identity),

3.2. Prosthetic group of SNDH revealed by heterologous expression in E. coli SNDH has high sequence identity with 2KGDH of P. aureofaciens, so we hypothesized that a prosthetic group of SNDH is PQQ. Because E. coli does not produce PQQ, this expression system is useful to show whether the enzyme of interest depends on PQQ or not, if it can be functionally expressed in E. coli. The membranes of the recombinant E. coli strain harboring pRT1 (sndh+) showed higher sorbosone dehydrogenase (Fig. 2C) and oxidation (Fig. 2D) activities, which were higher than those of recombinant Gluconobacter. It was observed only when the membranes had been pre-incubated with PQQ. The very low sorbosone dehydrogenase activity in the control E. coli strain was detected even when the pre-incubation with PQQ was omitted (Fig. 2C). However, this activity does not connect to the respiratory chain, because no sorbosone oxidation activity was detected with the control membranes (Fig. 2D). These results strongly suggest that the prosthetic group of SNDH is PQQ. Because we anticipated that even Gluconobacter membranes contain high populations of apo-form SNDH, we tried holo-enzyme formation as did for E. coli membranes. Indeed, the PMS-DCPIP reductase activity was increased just twice by incubation with PQQ and Ca2+ prior to the enzyme assay. Significant populations of apo-SNDH may be due to less holo-enzyme formation in vivo or detachment of PQQ during the membrane preparation. 3.3. SNDH reduces ubiquinone upon oxidation of L-sorbosone According to the oxygen consumption assay, the sorbosone-oxidizing respiratory chain is reconstituted in Gluconobacter and E. coli. Because both of these bacterial species possess only ubiquinol oxidases as the terminal oxidase [41–43], ubiquinone (Q) is exclusively considered to be the physiological electron acceptor for SNDH [44]. The membranes of the recombinant E. coli showing the specific PMS/DCPIP reductase activity of 240 mU mg−1 indeed showed sorbosone-dependent Q1 reductase activity of 93 mU mg−1 and Q2 reductase activity of 29 mU mg−1 (Figs. 2C and 3,). Because E. coli naturally expresses apo 5

Enzyme and Microbial Technology 137 (2020) 109511

T. Yakushi, et al.

Fig. 3. Sorbosone:Q reductase activities in the membranes of the recombinant E. coli strain. (A) After holo-enzyme formation with PQQ, Q1 reductase activity in the membranes was determined with 2 mM L-sorbosone and 50 μM Q1 in the presence of 1 mM KCN at pH 7.0 by monitoring the decrease in absorbance at 275 nm. (B) Q reductase activity in the membranes was determined as the panel A, but 100 mM D-glucose (left) or 2.0 mM L-sorbosone (right) were used as substrate, and 50 μM Q1 (right gray bar) or 20 μM Q2 (dark gray bar) were also used. The E. coli BL21(DE3) strain harboring pLys and either pT7Blue (control plasmid) and pRT1 (sndh+) were used in the panel A, while only that with sndh+ was used in the panel B. Mean values with standard deviation from triplicate assay are shown.

Fig. 4. Biotransformation of L-sorbosone to 2KGLA with the membranes of the recombinant E. coli strains that express Gluconacetobacter SNDH. The cell membranes of the recombinant E. coli strains harboring pLys and either pT7Blue (control plasmid, A) or pRT1 (sndh+, B) were incubated with 100 mM L-sorbosone in 250 mM K+MOPS (pH 7.0) with shaking at 150 rpm and 30 °C for 12 h. Prior to the biotransformation, the membranes were pre-incubated with PQQ. After biotransformation, the membranes were removed by ultracentrifugation, and L-sorbosone (open circle) and 2KGLA (solid circle) in the supernatants were analyzed by HPLC. Mean values with standard deviation from triplicate biotransformation are shown.

The constructed structure of SNDH predicted by the Phyre2 server was a six-bladed β-propeller structure, which also matched the crystal CcPDH structure (Figs. 6 and S3). To confirm the plausibility of the structural model, we compared the secondary structures and positions of the functionally important residues with those of the template CcPDH structure (Fig. S4). Most β-strands in the CcPDH structure (shown as arrows in sky-blue) were reproduced in our structural model, where the β-strands are shown as reddish arrows. The 5D strand was missing in the modeled structure but found in the secondary structure prediction using a plug-in function of the Phyre2 server (shown as purple arrows). The following amino acid residues in the CcPDH structure have been suggested to be involved in PQQ and Ca2+ binding: Arg273, Arg430, Asn431, His539, His560, Trp563 (main chain), and Asn564 (main chain) for PQQ binding; Asn448, Ser449 (main chain), Leu450 (main chain), Asp451, and Glu471 for Ca2+ binding; and His363 for general base catalysis [17]. Most of them were conserved in the primary sequence and predicted structure of SNDH, i.e. Arg91, Arg266, Asn267, His344, His371, Trp374 (main chain), and Asn375 (main chain) for PQQ binding (Figs. S2, S3, and 6B); Asn285, Glu286 (main chain), Arg287 (main chain), Asp288, and Asp297 for Ca2+ binding (Figs. S2, S3, and 6C). Unlike the CcPDH structure, the His210 residue was additionally placed close enough to form hydrogen bonds with C2 carboxylic acid of PQQ (Fig. 6). Although the distance between the His209 residue and PQQ was longer than 3 Å, it is the closest His residues to the

they have most likely evolved from a common ancestor to have the different functions localizing different subcellular compartments: the cytoplasmic membrane and the periplasm. 3.6. PQQ binding in SNDH based on structure modeling in silico We attempted to construct a structure model of SNDH in silico to discuss PQQ binding in this enzyme. A structure model of SNDH was constructed using the Phyre2 fold recognition server with the normal mode (http://www.sbg.bio.ic.ac.uk/phyre2) [36]. The Phyre2 profile–profile comparison on SNDH resulted in high scores to soluble quinoprotein glucose dehydrogenase of fungus, Trichoderma reesei (25 % identity) [48], human Hedgehog-interacting protein (HHIP) (12 % or 14 % identity) [49,50], sGDH of A. calcoaceticus (18 % identity) [51] and sGDH homologues of other bacteria and archaea (Table S3) [52,53]. Although T. reesei enzyme showed high identity, no holo-enzyme structures are available. Instead, the crystal structure of the holoform of CcPDH was reported recently [17]. The global homology of the PQQ domain of CcPDH with SNDH was low: 12.2 % identity and 51.6 % similarity in the 399-amino-acid-long sequences (Fig. S2). The Cterminal regions were more similar to each other; HGSWNR, from the 371st to 376th residue, was conserved in the PQQ domain of CcPDH. We attempted to model structure using the One-to-one threading function of Phyre2. The comparison resulted in high scores 298.3, zero E-values, 100 % confidence, and 27 % identity. 6

Enzyme and Microbial Technology 137 (2020) 109511

T. Yakushi, et al.

Fig. 5. An unrooted neighbour-joining phylogenetic tree of SNDH homologues in bacteria for which genome sequences are publicly available. The phylogenetic tree was constructed using MEGA 7.01. The scale bar represents 0.05 substitutions per site. Black circle, negative for signal peptide but positive for transmembrane; black triangle, positive for signal peptide but negative for transmembrane; white triangle, double positive; white circle, double negative. Taxonomy symbols used are as follows: red circle, Alphaproteobacteria; closed red circle, Acetobacteraceae; blue triangle, Gammaproteobacteria; closed blue triangle, genus Pseudomonas; green square, Betaproteobacteria. Positions of Ga. liquefaciens SNDH (Gl_SNDH) and P. aureofaciens 2KGDH (Pa_2KGDH) are shown with red and blue letters, respectively. The detailed information on the SNDH homologues used for constructing the dendrogram is presented in Table S2. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article).

manner [55]. They cloned the gene for 2KGLA-producing enzyme SNDH by constructing a genome library of the NBRC12258 strain, but the cofactor of this enzyme remained to be clarified [5]. The recombinant E. coli strain constructed in this study revealed that SNDH is a PQQ-dependent enzyme. The membranes of the recombinant strain showed activity only after PQQ had been exogenously added. Coincidently, we succeeded in reconstituting the sorbosone-oxidizing respiratory chain in the E. coli cells. The physiological roles of sGDH and its homologous enzymes remain unknown. However, sGDH of A. calcoaceticus does not appear to

orthoquinone structure of PQQ. Either His209 or His210 presumably functions as the general base for catalysis. Thus, the modeled structure suggests how SNDH binds PQQ and Ca2+ and oxidizes sorbosone, which are similar to those under sGDH functions [11,54]. 4. Discussion Shinjoh et al. reported that Ga. liquefaciens NBRC12258 (formerly Acetobacter liquefaciens IFO12258) possesses L-sorbosone-oxidizing ability in the membranes to produce 2KGLA in a nearly stoichiometric 7

Enzyme and Microbial Technology 137 (2020) 109511

T. Yakushi, et al.

Fig. 6. Structure model of SNDH constructed in silico. (A) Structure of PQQ. Atom nomenclature is indicated. (B) Amino acids shown with thick sticks in the modeled SNDH protein within 3 Å away from the PQQ molecule (thin sticks). (C) Amino acids in the modeled SNDH protein within 3 Å away from Ca2+ and the water molecules bound to Ca2+ shown with green and red spheres, respectively. The structure of PQQ-bound SNDH was constructed using the Phyre2 server and the UCSF Chimera program as described in the Materials and Methods section. Distances shorter than 3 Å between SNDH and PQQ and between SNDH and Ca2+ detected by the UCSF Chimera program are shown with dotted line. Red, oxygen; blue, nitrogen; gold and gray, carbon. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article).

cinerea, suggesting that the physiological role of CcPDH is to donate electrons to polysaccharide-degrading enzymes rather than the electron transport chain [58]. Ga. liquefaciens SNDH reconstitutes the sorbosone oxidase respiratory chain in the recombinant E. coli and Gluconobacter

be involved in the respiratory chain [56,57]. Moreover, the physiological electron acceptor for the soluble enzyme 2KGDH in the periplasm of P. aureofaciens has not been characterized yet. Recently, CcPDH was shown to couple the action of lytic polysaccharide monooxygenase in C. 8

Enzyme and Microbial Technology 137 (2020) 109511

T. Yakushi, et al.

Promotion of Science KAKENHI Grant (17K07722 to TY; 2660068 to KM).

strains, where ubiquinol oxidases exclusively work as the terminal oxidases. Therefore, we suggest that the physiological electron acceptor for SNDH is membranous Q. Indeed, the enzyme showed Q1 reductase activity (Fig. 3). To the best of our knowledge, no reports have been published to date on PQQ-dependent dehydrogenase with a six-bladed β-propeller structure functioning in the electron transport chain. The distribution of SNDH homologues in the genus Gluconobacter was limited in G. frateurii and G. japonicus; no SNDH homologues were found in G. oxydans, including the strain DSM3054 (the synonym of IFO3292). L-Sorbosone was reported to be converted significantly to 2KGLA in resting IFO3292 cells. However, the conversion rate was much lower than those for several strains of Ga. liquefaciens (formerly A. liquefaciens) [55]. It is reasonable to conclude that the bioconversion of sorbosone to 2KGLA with the Gluconobacter cells was attributable to the cytoplasmic NAD+-dependent sorbosone dehydrogenase [4]. However, despite the fact that the draft genome of CHM43 does not contain an SNDH homologue, we detected 2KGLA production from Lsorbose with the membranes of the recombinant CHM43 strain expressing SDH. Because the CHM43 strain possesses the genes for uncharacterized orphan membrane-bound dehydrogenases, including GLF_1504, a homologue of the PQQ-dependent dehydrogenase 1 (GOX1857) [12,14], the orphan membrane-bound dehydrogenases might be responsible for the 2KGLA production. Most PQQ-dependent dehydrogenases catalyze oxidation of alcohols, including hemiacetal in aldoses [8]. PQQ-dependent alcohol dehydrogenase of acetic acid bacteria also oxidizes aldehydes as well [59,60]. The prosthetic group of aldehyde dehydrogenase of acetic acid bacteria was previously reported to be PQQ [61,62], but it is still controversial and open to debate [63,64]. Therefore, we considered that the substrate of SNDH is hemiacetal of L-sorbosone-1,5-pyranose, an isoform of L-sorbosone. Major part of L-sorbosone is in the form of 2,6-pyranose, but a significant amount of the 1,5-pyranose isoform is present in neutral solution (Fig. 1) [1]. Similar to sorbosone dehydrogenase of Kg. vulgare [65], SNDH presumably oxidizes L-sorbosone1,5-pyranose to produce 2-keto-L-gulono-1,5-pyranose (2KGLL, Fig. 1). 2KGLL would be spontaneously hydrolyzed to 2KGLA under neutral pH conditions [1]. Our structural model for PQQ-bound SNDH constructed in the Phyre2 server and the Chimera software suggests that it has a binding domain to PQQ similar to that of CcPDH. In particular, the spatial arrangements of most key amino acid residues were similar to those of CcPDH as the ligands for PQQ and Ca2+ [17]. We suggest that the His209 or His210 residue works as a general base in the catalysis. Therefore, as discussed below, we suggest that a catalytic mechanism similar to that of sGDH occurs in SNDH [11]. The His residue would function as the general base catalysis to abstract a proton from hemiacetal in L-sorbosone-1,5-pyranose. A hydride ion of the substrate would be then transferred to either carbonyl group of orthoquinone in PQQ to produce 2KGLL. The His proton would be transferred to PQQ resulting in PQQH2. Biochemical evaluation of SNDH in terms of its substrate specificity, kinetics and structural determination remains important work to be performed in the near future.

Declaration of Competing Interest All the authors declare no conflicts of interest. Acknowledgements We are grateful to Masako Shinjoh and Tatsuo Hoshino for their invaluable suggestions. We are also grateful to DSM Nutritional Products (Basel, Switzerland) for generously providing us with L-sorbosone and 2KGLA and to Kimitoshi Sakamoto (Hirosaki University, Japan) for Q1 and Q2. Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.enzmictec.2020. 109511. References [1] G. Pappenberger, H.-P. Hohmann, Industrial production of L-ascorbic acid (vitamin C) and D-isoascorbic acid, in: H. Zorn, P. Czermak (Eds.), Biotechnology of Food and Feed Additives, Springer, Berlin Heidelberg, 2014, pp. 143–188. [2] K. Matsushita, Y. Fujii, Y. Ano, H. Toyama, M. Shinjoh, N. Tomiyama, T. Miyazaki, T. Sugisawa, T. Hoshino, O. Adachi, 5-keto-D-gluconate production is catalyzed by a quinoprotein glycerol dehydrogenase, major polyol dehydrogenase, in Gluconobacter species, Appl. Environ. Microbiol. 69 (4) (2003) 1959–1966. [3] T. Sugisawa, T. Hoshino, S. Nomura, A. Fujiwara, Isolation and characterization of membrane-bound L-sorbose dehydrogenase from Gluconobacter melanogenus UV10, Agric. Biol. Chem. 55 (2) (1991) 363–370. [4] Y. Saito, Y. Ishii, H. Hayashi, Y. Imao, T. Akashi, K. Yoshikawa, Y. Noguchi, S. Soeda, M. Yoshida, M. Niwa, J. Hosoda, K. Shimomura, Cloning of genes coding for L-sorbose and L-sorbosone dehydrogenases from Gluconobacter oxydansand microbial production of 2-keto-L-gulonate, a precursor of L-ascorbic acid, in a recombinantG. oxydans strain, Appl. Environ. Microbiol. 63 (2) (1997) 454–460. [5] M. Shinjoh, N. Tomiyama, A. Asakura, T. Hoshino, Cloning and nucleotide sequencing of the membrane-bound L-sorbosone dehydrogenase gene of Acetobacter liquefaciens IFO 12258 and its expression in Gluconobacter oxydans, Appl. Environ. Microbiol. 61 (2) (1995) 413–420. [6] A. Asakura, T. Hoshino, Isolation and characterization of a new quinoprotein dehydrogenase, L-sorbose/L-sorbosone dehydrogenase, Biosci. Biotechnol. Biochem. 63 (1) (1999) 46–53. [7] X. Han, X. Xiong, D. Jiang, S. Chen, E. Huang, W. Zhang, X. Liu, Crystal structure of L-sorbose dehydrogenase, a pyrroloquinoline quinone-dependent enzyme with homodimeric assembly, from Ketogulonicigenium vulgare, Biotechnol. Lett. 36 (5) (2014) 1001–1008. [8] K. Matsushita, H. Toyama, M. Yamada, O. Adachi, Quinoproteins: structure, function, and biotechnological applications, Appl. Microbiol. Biotechnol. 58 (1) (2002) 13–22. [9] T. Miyazaki, T. Sugisawa, T. Hoshino, Pyrroloquinoline quinone-dependent dehydrogenases from Ketogulonicigenium vulgare catalyze the direct conversion of L-sorbosone to L-ascorbic acid, Appl. Environ. Microbiol. 72 (2) (2006) 1487–1495. [10] A.M. Cleton-Jansen, N. Goosen, K. Vink, P. van de Putte, Cloning, characterization and DNA sequencing of the gene encoding the Mr 50,000 quinoprotein glucose dehydrogenase from Acinetobacter calcoaceticus, Mol. Gen. Genet. 217 (2-3) (1989) 430–436. [11] A. Oubrie, H.J. Rozeboom, K.H. Kalk, A.J. Olsthoorn, J.A. Duine, B.W. Dijkstra, Structure and mechanism of soluble quinoprotein glucose dehydrogenase, EMBO J. 18 (19) (1999) 5187–5194. [12] A. Berry, C. Lee, A.F. Mayer, M. Shinjoh, Microbial Production of L-ascorbic Acid, (2004) EP 2 348113 A2. [13] C. Prust, M. Hoffmeister, H. Liesegang, A. Wiezer, W.F. Fricke, A. Ehrenreich, G. Gottschalk, U. Deppenmeier, Complete genome sequence of the acetic acid bacterium Gluconobacter oxydans, Nat. Biotechnol. 23 (2) (2005) 195–200 Epub 2005 Jan 23. [14] T. Hölscher, D. Weinert-Sepalage, H. Görisch, Identification of membrane-bound quinoprotein inositol dehydrogenase in Gluconobacter oxydans ATCC 621H, Microbiology 153 (Pt 2) (2007) 499–506. [15] G.E. Cozier, C. Anthony, Structure of the quinoprotein glucose dehydrogenase of Escherichia coli modelled on that of methanol dehydrogenase from Methylobacterium extorquens, Biochem. J. 312 (Pt 3) (1995) 679–685. [16] H. Matsumura, K. Umezawa, K. Takeda, N. Sugimoto, T. Ishida, M. Samejima, H. Ohno, M. Yoshida, K. Igarashi, N. Nakamura, Discovery of a eukaryotic pyrroloquinoline quinone-dependent oxidoreductase belonging to a new auxiliary activity family in the database of carbohydrate-active enzymes, PLoS One 9 (8) (2014) e104851.

Author contribution Toshiharu Yakushi, Design of this work, Writing- reviewing and editing; Ryota Takahashi, Experiments, Writing- original draft preparation; Minenosuke Matsutani, Bioinformatics, Writing- original draft preparation; Naoya Kataoka, Supervision; Roque A. Hours, Yoshitaka Ano, Osao Adachi, and Kazunobu Matsushita, Writing- reviewing and editing. Funding information This work was partially supported by the Japan Society for the 9

Enzyme and Microbial Technology 137 (2020) 109511

T. Yakushi, et al.

Press, London, 1994, pp. 247–301. [45] M. Ameyama, M. Nonobe, E. Shinagawa, K. Matsushita, K. Takimoto, O. Adachi, Purification and characterization of the quinoprotein D-glucose dehydrogenase apoenzyme from Escherichia coli, Agric. Biol. Chem. 50 (1) (1986) 49–57. [46] K. Matsushita, E. Shinagawa, O. Adachi, M. Ameyama, Quinoprotein d-glucose dehydrogenase in Acinetobacter calcoaceticus LMD 79.41: the membrane-bound enzyme is distinct from the soluble enzyme, FEMS Microbiol. Lett. 55 (1) (1988) 53–57. [47] N. Matsumoto, H. Hattori, M. Matsutani, C. Matayoshi, H. Toyama, N. Kataoka, T. Yakushi, K. Matsushita, A single-nucleotide insertion in a drug transporter gene induces a thermotolerance phenotype in Gluconobacter frateurii by increasing the NADPH/NADP(+) ratio via metabolic change, Appl. Environ. Microbiol. 84 (10) (2018) e00354–18. [48] A. Turbe-Doan, E. Record, V. Lombard, R. Kumar, A. Levasseur, B. Henrissat, M.L. Garron, Trichoderma reesei dehydrogenase, a pyrroloquinoline quinone-dependent member of auxiliary activity family 12 of the carbohydrate-active enzymes database: functional and structural characterization, Appl. Environ. Microbiol. 85 (24) (2019) e00964-19. [49] I. Bosanac, H.R. Maun, S.J. Scales, X. Wen, A. Lingel, J.F. Bazan, F.J. de Sauvage, S.G. Hymowitz, R.A. Lazarus, The structure of SHH in complex with HHIP reveals a recognition role for the Shh pseudo active site in signaling, Nat. Struct. Mol. Biol. 16 (7) (2009) 691–697. [50] B. Bishop, A.R. Aricescu, K. Harlos, C.A. O’Callaghan, E.Y. Jones, C. Siebold, Structural insights into hedgehog ligand sequestration by the human hedgehoginteracting protein HHIP, Nat. Struct. Mol. Biol. 16 (7) (2009) 698–703. [51] A. Oubrie, H.J. Rozeboom, B.W. Dijkstra, Active-site structure of the soluble quinoprotein glucose dehydrogenase complexed with methylhydrazine: a covalent cofactor-inhibitor complex, Proc. Natl. Acad. Sci. U.S.A. 96 (21) (1999) 11787–11791. [52] H. Sakuraba, K. Yokono, K. Yoneda, A. Watanabe, Y. Asada, T. Satomura, T. Yabutani, J. Motonaka, T. Ohshima, Catalytic properties and crystal structure of quinoprotein aldose sugar dehydrogenase from hyperthermophilic archaeon Pyrobaculum aerophilum, Arch. Biochem. Biophys. 502 (2) (2010) 81–88. [53] S.M. Southall, J.J. Doel, D.J. Richardson, A. Oubrie, Soluble aldose sugar dehydrogenase from Escherichia coli: a highly exposed active site conferring broad substrate specificity, J. Biol. Chem. 281 (41) (2006) 30650–30659. [54] A. Oubrie, Structure and mechanism of soluble glucose dehydrogenase and other PQQ-dependent enzymes, Biochim. Biophys. Acta 1647 (1) (2003) 143–151. [55] M. Shinjoh, T. Sugisawa, S. Masuda, T. Hoshino, Efficient conversion of l-sorbosone to 2-keto-L-gulonic acid by Acetobacter liquefaciens strains, J. Ferment. Bioeng. 78 (6) (1994) 476–478. [56] A.M. Cleton-Jansen, N. Goosen, T.J. Wenzel, P. van de Putte, Cloning of the gene encoding quinoprotein glucose dehydrogenase from Acinetobacter calcoaceticus: evidence for the presence of a second enzyme, J. Bacteriol. 170 (5) (1988) 2121–2125. [57] K. Matsushita, E. Shinagawa, O. Adachi, M. Ameyama, Quinoprotein D-glucose dehydrogenase of the Acinetobacter calcoaceticus respiratory chain: membranebound and soluble forms are different molecular species, Biochemistry 28 (15) (1989) 6276–6280. [58] A. Varnai, K. Umezawa, M. Yoshida, V.G.H. Eijsink, The pyrroloquinoline-quinone dependent pyranose dehydrogenase from Coprinopsis cinerea drives lytic polysaccharide monooxygenase action, Appl. Environ. Microbiol. 84 (11) (2018) e00156-18. [59] W. Kanchanarach, G. Theeragool, T. Yakushi, H. Toyama, O. Adachi, K. Matsushita, Characterization of thermotolerant Acetobacter pasteurianus strains and their quinoprotein alcohol dehydrogenases, Appl. Microbiol. Biotechnol. 85 (3) (2010) 741–751. [60] T. Yakushi, K. Matsushita, Alcohol dehydrogenase of acetic acid bacteria: structure, mode of action, and applications in biotechnology, Appl. Microbiol. Biotechnol. 86 (5) (2010) 1257–1265. [61] M. Ameyama, K. Matsushita, Y. Ohno, E. Shinagawa, O. Adachi, Existence of a novel prosthetic group, PQQ, in membrane-bound, electron transport chain-linked, primary dehydrogenases of oxidative bacteria, FEBS Lett. 130 (2) (1981) 179–183. [62] S. Gomez-Manzo, J.L. Chavez-Pacheco, M. Contreras-Zentella, M.E. Sosa-Torres, R. Arreguin-Espinosa, M. Perez de la Mora, J. Membrillo-Hernandez, J.E. Escamilla, Molecular and catalytic properties of the aldehyde dehydrogenase of Gluconacetobacter diazotrophicus, a quinoheme protein containing pyrroloquinoline quinone, cytochrome b, and cytochrome c, J. Bacteriol. 192 (21) (2010) 5718–5724. [63] H. Takemura, T. Tsuchida, F. Yoshinaga, K. Matsushita, O. Adachi, Prosthetic group of aldehyde dehydrogenase in acetic acid bacteria not pyrroloquinoline quinone, Biosci. Biotechnol. Biochem. 58 (11) (1994) 2082–2083. [64] C. Thurner, C. Vela, L. Thony-Meyer, L. Meile, M. Teuber, Biochemical and genetic characterization of the acetaldehyde dehydrogenase complex from Acetobacter europaeus, Arch. Microbiol. 168 (2) (1997) 81–91. [65] A. Asakura, T. Tatsuo Hoshino, S. Ojima, M. Shinjoh, N. Tomiyama, Alcohol/aldehyde Dehydrogenase, (1996) US 6730503 B1. [66] M. Matsutani, T. Yakushi, Pyrroloquinoline quinone-dependent dehydrogenases of acetic acid bacteria, Appl. Microbiol. Biotechnol. 102 (22) (2018) 9531–9540.

[17] K. Takeda, T. Ishida, M. Yoshida, M. Samejima, H. Ohno, K. Igarashi, N. Nakamura, Crystal structure of the catalytic and cytochrome b domains in a eukaryotic pyrroloquinoline quinone-dependent dehydrogenase, Appl. Environ. Microbiol. 85 (24) (2019) e01692-19. [18] K. Umezawa, K. Takeda, T. Ishida, N. Sunagawa, A. Makabe, K. Isobe, K. Koba, H. Ohno, M. Samejima, N. Nakamura, K. Igarashi, M. Yoshida, A novel pyrroloquinoline quinone-dependent 2-keto-D-glucose dehydrogenase from Pseudomonas aureofaciens, J. Bacteriol. 197 (8) (2015) 1322–1329. [19] K. Sakamoto, H. Miyoshi, K. Matsushita, M. Nakagawa, J. Ikeda, M. Ohshima, O. Adachi, T. Akagi, H. Iwamura, Comparison of the structural features of ubiquinone reduction sites between glucose dehydrogenase in Escherichia coli and bovine heart mitochondrial complex I, Eur. J. Biochem. 237 (1) (1996) 128–135. [20] D. Moonmangmee, O. Adachi, Y. Ano, E. Shinagawa, H. Toyama, G. Theeragool, N. Lotong, K. Matsushita, Isolation and characterization of thermotolerant Gluconobacter strains catalyzing oxidative fermentation at higher temperatures, Biosci. Biotechnol. Biochem. 64 (11) (2000) 2306–2315. [21] T. Yakushi, K. Komatsu, M. Matsutani, N. Kataoka, A.S. Vangnai, H. Toyama, O. Adachi, K. Matsushita, Improved heterologous expression of the membranebound quinoprotein quinate dehydrogenase from Gluconobacter oxydans, Protein Expr. Purif. 145 (2018) 100–107. [22] D. Hanahan, Studies on transformation of Escherichia coli with plasmids, J. Mol. Biol. 166 (4) (1983) 557–580. [23] F.W. Studier, B.A. Moffatt, Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes, J. Mol. Biol. 189 (1) (1986) 113–130. [24] J. Sambrook, D.W. Russel, Molecular Cloning: a Laboratory Manual, 3rd ed., Cold SpringHarbor Laboratory Press, Cold Spring Harbor,NY, 2001. [25] J. Marmur, A procedure for the isolation of deoxyribonucleic acid from micro-organisms, J. Mol. Biol. 3 (2) (1961) 208–218. [26] S. Kawai, M. Goda-Tsutsumi, T. Yakushi, K. Kano, K. Matsushita, Heterologous overexpression and characterization of a flavoprotein-cytochrome c complex fructose dehydrogenase of Gluconobacter japonicus NBRC3260, Appl. Environ. Microbiol. 79 (5) (2013) 1654–1660. [27] E.R. Redfearn, Isolation and determination of ubiquinone, Methods Enzymol 10 (1967) 381–384. [28] P. Mitchell, J. Moyle, R. Mitchell, Measurement of translocation of H+/O in mitochondria and submitochondrial vesicles, Methods Enzymol 55 (1979) 627–640. [29] J.R. Dulley, P.A. Grieve, A simple technique for eliminating interference by detergents in the Lowry method of protein determination, Anal. Biochem. 64 (1) (1975) 136–141. [30] T. Tatusova, S. Ciufo, B. Fedorov, K. O’Neill, I. Tolstoy, RefSeq microbial genomes database: new representation and annotation strategy, Nucleic Acids Res. 42 (Database issue) (2014) D553–9. [31] R.C. Edgar, MUSCLE: multiple sequence alignment with high accuracy and high throughput, Nucleic Acids Res. 32 (5) (2004) 1792–1797. [32] R.C. Edgar, MUSCLE: a multiple sequence alignment method with reduced time and space complexity, BMC Bioinformatics 5 (113) (2004) 113. [33] S. Kumar, G. Stecher, K. Tamura, MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets, Mol. Biol. Evol. 33 (7) (2016) 1870–1874. [34] T.N. Petersen, S. Brunak, G. von Heijne, H. Nielsen, SignalP 4.0: discriminating signal peptides from transmembrane regions, Nat. Methods 8 (10) (2011) 785–786. [35] A. Krogh, B. Larsson, G. von Heijne, E.L. Sonnhammer, Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes, J. Mol. Biol. 305 (3) (2001) 567–580. [36] L.A. Kelley, S. Mezulis, C.M. Yates, M.N. Wass, M.J. Sternberg, The Phyre2 web portal for protein modeling, prediction and analysis, Nat protocols 10 (6) (2015) 845–858. [37] S.F. Altschul, T.L. Madden, A.A. Schaffer, J. Zhang, Z. Zhang, W. Miller, D.J. Lipman, Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25 (17) (1997) 3389–3402. [38] E.F. Pettersen, T.D. Goddard, C.C. Huang, G.S. Couch, D.M. Greenblatt, E.C. Meng, T.E. Ferrin, UCSF Chimera–a visualization system for exploratory research and analysis, J. Comput. Chem. 25 (13) (2004) 1605–1612. [39] E.C. Meng, E.F. Pettersen, G.S. Couch, C.C. Huang, T.E. Ferrin, Tools for integrated sequence-structure analysis with UCSF Chimera, BMC Bioinformatics 7 (2006) 339. [40] M.E. Kovach, P.H. Elzer, D.S. Hill, G.T. Robertson, M.A. Farris, R.M. Roop 2nd, K.M. Peterson, Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes, Gene. 166 (1) (1995) 175–176. [41] M. Matsutani, K. Fukushima, C. Kayama, M. Arimitsu, H. Hirakawa, H. Toyama, O. Adachi, T. Yakushi, K. Matsushita, Replacement of a terminal cytochrome c oxidase by ubiquinol oxidase during the evolution of acetic acid bacteria, Biochim. Biophys. Acta 1837 (10) (2014) 1810–1820. [42] W.J. Ingledew, R.K. Poole, The respiratory chains of Escherichia coli, Microbiol. Rev. 48 (3) (1984) 222–271. [43] J. Dassa, H. Fsihi, C. Marck, M. Dion, M. Kieffer-Bontemps, P.L. Boquet, A new oxygen-regulated operon in Escherichia coli comprises the genes for a putative third cytochrome oxidase and for pH 2.5 acid phosphatase (appA), Mol. Gen. Genet. 229 (3) (1991) 341–352. [44] K. Matsushita, H. Toyama, O. Adachi, Respiratory chains and bioenergetics of acetic acid bacteria, in: A.H. Rose, D.W. Tempest (Eds.), Adv Microb Physiol, Academic

10