The mGlu5 metabotropic glutamate receptor is expressed in zones of active neurogenesis of the embryonic and postnatal brain

Developmental Brain Research 150 (2004) 17 – 22 www.elsevier.com/locate/devbrainres

Research report

The mGlu5 metabotropic glutamate receptor is expressed in zones of active neurogenesis of the embryonic and postnatal brain V.D. Di Giorgi Gerevini a,*, A. Caruso a,1, I. Cappuccio a, L. Ricci Vitiani b, S. Romeo c, C. Della Rocca c, R. Gradini c,d, D. Melchiorri a, F. Nicoletti a,d a

Departments of Human Physiology and Pharmacology, University of Rome ‘‘La Sapienza’’, Piazzale Aldo Moro 5, 00195 Rome, Italy b Istituto Superiore di Sanita`, Rome, Italy c Experimental Medicine and Pathology, University of Rome ‘‘La Sapienza’’, Italy d I.N.M. Neuromed, Pozzilli, Italy Accepted 19 February 2004 Available online 9 April 2004

Abstract Metabotropic glutamate (mGlu) receptors have been implicated in the regulation of developmental plasticity. Here, we examined the expression of mGlu1a – b, -2, -3, -4a – b, and -5a receptor subtypes from embryonic day 12 (E12) to the early and late postnatal life. While all transcripts (with the exception of mGlu4 mRNA) were detected prenatally, only the mGlu5 receptor protein was found in detectable amounts in the embryonic brain. Immunohistochemical analysis showed that the mGlu5 receptor was mainly expressed by cells surrounding the ventricles at E15, whereas it was more diffusely expressed at E18. In the postnatal life, besides its classical expression sites, the mGlu5 receptor was found in zones of active neurogenesis such as the external granular layer (EGL) of the cerebellar cortex and the subventricular zone. In these regions, the presence of actively proliferating progenitor cells was detected by BrdU staining. No other subtype (among those we have examined) was found to be expressed in regions enriched of BrdU+ cells. These data suggest a role for mGlu5 receptors in the early brain development and in basic cellular processes such as proliferation and/or differentiation. D 2004 Elsevier B.V. All rights reserved. Keywords: Prenatal expression; Development; Cell proliferation; External granular layer; Subventricular zone

1. Introduction Metabotropic glutamate (mGlu) receptors belong to a Gprotein-coupled receptor superfamily including GABA B receptors, calcium (Ca2 +) sensing receptors, some taste receptors, and pheromone receptors. There are at least eight subtypes of mGlu receptors [35,36], classified into three groups based on their sequence homology, pharmacological properties and transduction pathways. Group I includes mGlu1 and 5 receptors, which are coupled to a Gq activating polyphosphoinositide hydrolysis. Group II and III receptors (mGlu2, -3 and mGlu4, -6, -7 and -8 receptors, respectively) are negatively coupled to adenylyl cyclase via G i /G 0 (reviewed by Refs. [9,29]). mGlu receptors are widely * Corresponding author. Tel.: +39-6-49912969; fax: +39-6-4450307. E-mail address: [email protected] (V.D. Di Giorgi Gerevini). 1 Co-first author. 0165-3806/$ - see front matter D 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.devbrainres.2004.02.003

implicated in physiology and pathology. Their physiological functions involve the generation of slow excitatory and inhibitory synaptic potentials, modulation of synaptic transmission, synaptic integration, and plasticity. They are also involved in the induction of long-term potentiation (LTP) and long-term depression (LTD), two putative electrophysiological substrates of associative learning. In addition, mGlu receptors are involved in processes of neurodegeneration/ neuroprotection. Group I mGlu receptors may either amplify or attenuate excitotoxic damage, whereas group II and III mGlu receptors exert a neuroprotective role (reviewed by Ref. [3]). Although knock out mice for mGlu receptors subtypes show no dramatic changes in brain development, a growing body of evidence supports a role for these receptors in developmental processes. Expression of mGlu receptors is developmentally regulated in different brain regions [4 – 6,10,13,17,20 – 22,24,26,28,31,33,34]. In addition, mGlu receptors have a role in cerebellar development [7,15,16,19], in the early processing of sensory information

18

V.D. Di Giorgi Gerevini et al. / Developmental Brain Research 150 (2004) 17–22

[23], and in the ocular dominance plasticity in the visual cortex [1,2,11]. Little is known on the expression and function of individual mGlu receptor subtypes during the prenatal development of the CNS. We now describe the temporal profile of mGlu receptor expression in different brain regions from embryonic day 12 (E12) to the adulthood in relation to the sites of active neurogenesis.

2. Materials and methods 2.1. RT-PCR Total RNA was extracted from the tissues (embryonic brain and adult rat cortex, hippocampus and cerebellum) with the trizol method (Sigma). Two micrograms of total RNA was then used for cDNA synthesis, using Superscript II 557 (BRL Life Tech) and an oligodT primer according to manufacturer’s instructions. The RT product was diluted to 100 Al with sterile, distilled water, and 1 Al of cDNA was employed in each subsequent PCR amplification. Amplification of mGlul-5 receptor cDNA was carried out employing the following primers: mGlu1a– b (forward: GCTGTACCTACTATGCCTTC; reverse: AGACCATGACACAGACTTGC), mGlu2 (forward: CTACAGTGATGTCTCCATCC; reverse: AAAGCCTCAATGCCTGTCTC), mGlu3 (forward: CAAGTGACTACAGAGTGCAG; reverse: CTGTCACCAATGCTCAGCTC), mGlu4a– b (forward: CCAACGAGGATGACATCAGG; reverse: CACAGGTCACGGTGCATGG), mGlu5a (forward: GTCCTTCTGTTGATCCTGTC; reverse: ATGCAGCATGGCCTCCACTC). For h-actin cDNA amplification, the primers were those described by Roelen et al. [37] which span an intron and yield products of different sizes depending on whether cDNA or genomic DNA is employed as a template (400 bp for a cDNA-derived product and 600 bp for a genomic DNA-derived amplification). Reaction conditions included an initial denaturation step (94 jC/3 min) followed by 35– 45 cycles of (94 jC/30 s; 55 jC/30 s; 72 jC/30 s). A final extension step (72 jC/10 min) concluded the reaction. PCR products (one-third of the reaction) were analyzed electrophoretically on 2% agarose gels poured and run in 1  TAE. We performed the amplification of the RNA of three different animals for each time point, the RT-PCR was repeated two times with similar results. 2.2. Western blot analysis Protein extraction from adult or fetal rat brain was performed as described by Romano et al. [32]. The cerebral cortex and cerebellum of male adult Sprague – Dawley rats (150 –200 g, b.w., Charles River, Calco, Italy) were used as reference tissues for immunoblots. Western blot analysis of mGlu1a, mGlu5, mGlu4a and mGlu2/3 receptors was carried out as described previously [38]. Briefly, 20 Ag of proteins was loaded per lane. Then the gel was blotted into a

nitrocellulose membrane. Blots were then incubated overnight with primary polyclonal antibodies (all at 1 Ag/ml), after an extensive washing with TBS—0.5% Tween. The membranes were incubated for 1 h with secondary goat antirabbit antibodies coupled to horseradish peroxidase (1:2000, GARHRP, Fisher). Finally, the reaction was revealed by enhanced chemiluminescence (ECL reagent, Amersham). We performed the experiments on three different animals for each developmental time point, and we repeated two times with no significant differences in the results obtained. The mGlu1a receptor, mGlu5, mGlu4a receptor antibodies were purchased from Upstate. The mGlu2/3 receptor antibody was purchased from Chemicon International (Temecula, CA). 2.3. Immunohistochemistry Rat brains or total embryos, three for each point, were removed and fixed in Carnoy solution. The specimens were then included in paraffin. Sagittal and coronal sections (10 Am thick) were cut at the microtome and serially attached to gelatin-coated slices. After deparaffinization and H2O2 treatment, slices were permeabilized for 30 min in TBS containing 0.2% Triton X-100. This was followed by a preincubation in TBS containing 4% NGS for 30 min. Sections were incubated overnight at 4 jC in primary antibodies in TBS. After PBS rinsing, the slices were incubated with the secondary antirabbit antibody (Vector Labs.) and subsequently with ABC elite solution (Vector Labs.). Staining was developed using DAB substrate kit for peroxidase (Vector Labs.). Finally, sections were rinsed in TBS, dehydrated in increasing concentrations of ethanol, clarified, and mounted on cover slips in a xylene-based mounting medium (DPX). Sections were viewed and photomicrographs were taken by using an Olympus IX 50 microscope equipped with a Spot camera (Spot RT camera from Diagnostic Instruments, Houston, TX). 2.4. BrdU treatment and BrdU immunohistochemistry BrdU was dissolved in saline and injected to pregnant mothers or pups (1, 10, 21 postnatal days) at the dose of 50 mg/kg. Sections obtained as described were permeabilized with 1 N HCL solution, and then were incubated with Na2B2O4 (100 mM); after this pretreatment, slices were processed and developed as described above, using a primary monoclonal antibody against BrdU (Becton Dickinson). The staining was revealed using the DAB substrate kit for peroxidase (Vector Labs.). 2.5. Double immunostaining Sections were incubated with an unmasking solution (Vector Labs.) according to the manufacturer’s protocol. Following this, the immunostaining for BrdU was performed as described in the Immunohistochemistry section.

V.D. Di Giorgi Gerevini et al. / Developmental Brain Research 150 (2004) 17–22

19

After the development of the reaction using the DAB substrate (Vector Labs.), another immunohistochemical step was performed as previously indicated for mGlu5 receptor staining, in this occasion the development was done using the VIP substrate (Vector Labs.).

3. Results 3.1. Developmental pattern of expression of mGlu receptor mRNA We examined the expression of mGlu1-5 receptor mRNA in discrete brain regions from E12 to postnatal day 21 (PND 21) by RT-PCR. mGlu1a – b and 2 receptor transcripts (391, 477 and 243 bp, respectively) were detected starting at E12, with the expression level increasing from PND1 to PND21 in the cerebral cortex and cerebellum; in the hippocampus, we found an initial increase in the expression of mGlu1a –b mRNA from PND1 to PND10, followed by a decrease at PND21. The transcript for mGlu3 receptor (530 bp) was detectable both in the prenatal and postnatal life in all the regions we examined. The mGlu4a –b receptor transcript (430 bp) was amplified at PND10 in cortex, hippocampus and cerebellum, whereas at PND21, its expression was confined to the cerebral cortex and cerebellum. We could not detect mGlu4a – b mRNA in the embryonic life. The mGlu5a receptor transcript (216 bp) was detected in all brain regions and at all developmental stages (Fig. 1). The h-actin amplificate was similar in all samples analyzed (Fig. 1).

Fig. 1. RT-PCR amplification of mGlu1 – 5 receptor transcripts at different age (from embryonic day 12 to adulthood) and in different brain region (cortex, hippocampus and cerebellum). The amplification products of mGlu1 – 5 receptors are found at 391 and 477 bp (1a and 1b), 243, 530, 430 and 216bp, respectively. The presence of a single h-actin amplimer excludes any genomic DNA contamination (see Materials and methods). The adult line refers to the cerebellum for mGlu1 and 4, cerebral cortex for mGlu2 and 3 and hippocampus for mGlu5 receptors of a 3-month-old rat. Cerebral cortex (CTX); hippocampus (Hip); cerebellum (CER); markers (M). The experiments have been performed on three animals for each time point, and the results are taken from three individual experimental determinations.

Fig. 2. Western blot analysis of mGlu1a, -2/3, -4a, -5 receptors in different brain regions at different ages. Monomeric and dimeric receptor proteins are indicated by arrows. The experiments have been performed on three animals for each time point, and the results are taken from three experimental determinations.

3.2. Developmental pattern of expression of mGlu receptor proteins We examined the expression of mGlu receptor proteins by immunoblotting and immunohistochemistry by using polyclonal anti-mGlu1a, -mGlu2/3, -mGlu4a, and -mGlu5 antibodies. Western blot analysis showed no expression of mGlu1a receptors during embryonic life. Expression was detectable at PND1 and increased with age in the cerebral cortex and cerebellum; in the hippocampus, mGlu1a receptor levels increased from PND1 to PND10 and then decreased from PND10 to PND21 (Fig. 2), as expected [5]. Expression of mGlu2/3 receptors was below the detection levels in the embryonic brain, but became substantial across the postnatal life (Fig. 2). The mGlu4a receptor protein could be only detected by Western blot analysis in the cerebellum after PND 21 (Fig. 2). The anti-mGlu5 antibody labeled two bands at the molecular weight range expected for the mGlu5 receptor monomer (130 – 145 kDa). The upper of the two bands corresponded to the mGlu5 receptors, as shown by its absence in the adult cerebral cortex of mGlu5 knockout mice (not shown). The mGlu5 receptor was the only subtype detected in the embryonic brain by immunoblotting. Postnatally, receptor expression peaked between PND1 and PND10 in the cerebral cortex, hippocampus and cerebellum, and decreased at PND21. We further characterized the expression of mGlu5 receptors in the embryonic brain by immunohistochemistry. At E15, the mGlu5 receptor was confined to the wall of the ventricular zone (Fig. 3B), which is an area of active neurogenesis, whereas it was more diffusely expressed outward the ventricular region at later stages of development (E18) (Fig. 3F and H). The pattern of mGlu5 and BrdU immunostaining was similar in adjacent tissue sections, suggest-

20

V.D. Di Giorgi Gerevini et al. / Developmental Brain Research 150 (2004) 17–22

5B). Only a faint mGlu5 receptor immunostaining was detected in the internal granular layer (IGL) of the cerebellar cortex, where differentiated granule cells, but not neuroprogenitors, are present (Fig. 4). The anatomical distribution of mGlu5 immunostaining in the postnatal life was consistent with that reported in previous studies, with high levels of expression being detected in most of the brain regions at PND10, as well as in the adult hippocampus, corpus striatum, and cerebral cortex (not shown). It is noteworthy that mGlu5 immunostaining was frequently detected in the cell nuclei (exemplified in Fig. 4). All other subtypes examined showed very low levels of expression in the embryonic brain and were not present in regions enriched of BrdU+ cells (Fig. 3C –D, staining for mGlu2/3 receptor). In the postnatal life, we found the expected expression pattern of mGlu1a, mGlu2/3 and mGlu4a receptors. For example, a strong mGlu1a receptor immunoreactivity was found in the cell bodies of cerebellar Purkinje cells at PND1, whereas the molecular layer of the cerebellar cortex was

Fig. 3. BrdU immunoreactivity in the ventricular zone (VZ) of the embryonic brain at E15 and E18 is shown in Panels A, C, E and G. mGlu5 receptor immunostaining is shown in Panels B, F and H in adjacent tissue sections. mGlu2/3 staining is shown in Panel D in adjacent tissue sections. In Panels A and B, arrows point to cells representative of positive staining for BrdU and mGlu5 receptors, respectively. Panels G and H are magnified view of the square areas in Panels E and F. Magnification in Panels C and D is 5  , in Panels A, B, E and F is 20  , in Panels G and H is 40  . All the images have been acquired using the system Spot RT camera (Diagnostic Instruments).

ing that mGlu5 receptors are expressed by proliferating progenitor cells (Fig. 3A, B, E and H). Moreover, performing a double staining in similar sections, we detected both antigens in the same groups of cells. As shown in Fig. 5A, notably not all the BrdU+ cells were immunoreactive for mGlu5. In the adult brain (3 months old), the mGlu5 receptor was still expressed in the subventricular zone enriched of BrdU+-positive cells (Fig. 4E – F). In addition, the receptor was expressed in the external granular layer (EGL) of the cerebellum at PND18, where the progenitors of granule cells were labeled by BrdU+ (Fig. 4A – D). At this developmental stage, all the cells BrdU+ were expressing mGlu5 receptors in the outer portion (Fig.

Fig. 4. BrdU staining in the external granular layer (EGL) of the cerebellar cortex at PND18 is shown in Panels A and C. BrdU immunoreactivity in the subventricular zone (SVZ) of the adult rat is shown in Panel E. mGlu5 receptor labelling in adjacent tissue sections is shown in Panels B, D and F. The arrows in Panels C, D, E and F point to BrdU and mGlu5 receptor positive cells, respectively. Panels C and D are magnified view of the squares in Panels A and B. An example of mGlu5 receptor staining in the nuclear membrane is shown at high magnification in Panel G. Arrow points to the nuclear membrane of the stained cell. Magnification in Panels A, B, E and F is 4  , in Panels C and D is 20  , in Panel G is 40  .

V.D. Di Giorgi Gerevini et al. / Developmental Brain Research 150 (2004) 17–22

Fig. 5. Colocalization of BrdU and mGlu5 receptor staining in the embryonic brain in Panel A and in the external granular layer (EGL) of the cerebellar cortex at PND18 shown in Panel B. BrdU staining is identified by the brown precipitate of DAB, whereas mGlu5 receptor staining is purple. The arrows point to BrdU and mGlu5 receptor positive cells. Magnification in Panel A is 20  , in Panel B is 40  .

decorated starting at PND10. The mGlu4a receptor was expressed across the cerebellar cortex at PND10, and was mainly present in the molecular layer in the adulthood (not shown); mGlu2/3 receptor immunoreactivity was diffused to all brain regions, reflecting the expression of mGlu3 receptors by glial cells. Remarkably, no mGlu1a, mGlu2/3 or mGlu4 immunostaining was detectable in zones of active neurogenesis identified by BrdU immunostaining also in the adult brain (not shown).

4. Discussion Although mGlu receptors are classically considered as synaptic receptors, their presence in nonneuronal cells (reviewed by Ref. [25]) outlines new aspects in the physiology of these receptors. The mGlu5 receptor in particular is expressed by dividing cells, such as hepatocytes [32] and melanocytes [12], suggesting a role for this subtype in basic aspects of cell physiology, such as proliferation and differentiation. Interestingly, mGlu5 receptor agonists enhance DNA synthesis in cultured melanocytes [12], astrocytes [8], and neural stem cells (Authors’ unpublished observation). Here we first demonstrate a high expression of mGlu5 receptors in zones of active neuro-

21

genesis both in the prenatal and postnatal brain. In the postnatal brain, neurogenesis persists in restricted brain regions, such as the SVZ of lateral ventricles (throughout life) [31] and the EGL of the cerebellar cortex (during the first 3 weeks after birth) (reviewed by Ref. [14]). In both regions, actively proliferating progenitor cells were detected by BrdU immunostaining. It is remarkable that, among the subtypes we have examined, only the mGlu5 receptor was expressed in zones of active neurogenesis by cells BrdU+. Studies carried out in recombinant cells have shown that activation of mGlu5 receptors generates oscillatory increases in intracellular calcium [18], which are typically associated with cell growth and proliferation, as occurs in fertilized oocytes (reviewed by Ref. [30]). Interestingly, activation of the mGlu1a receptor generates single-peaked calcium responses, although this receptor shares with mGlu5 the same canonical transduction pathway (i.e., the stimulation of inositol phospholipid hydrolysis) [18]. Thus, the mGlu5 receptor caters the potential to regulate early events in brain cell development occurring both in the embryonic and postnatal life. The presence of mGlu5 immunoreactivity in the cell nuclei is consistent with the recent findings that mGlu5 receptors are present in the nuclear membranes and their activation generates oscillatory increases in intranuclear calcium [27]. Whether mGlu5 receptors regulate cell proliferation through an intranuclear signaling pathway is a fascinating hypothesis that remains to be tested. The absence of mGlu1a, mGlu2/3, and mGlu4a receptor proteins in the embryonic brain and in zones of active neurogenesis supports a ‘‘synaptic function’’ of these particular subtypes, although the role of mGlu3 receptors expressed by astrocytes is not yet determined. The presence of mGlu5 receptors in the embryonic brain and in zones of active neurogenesis stimulates the search for ‘‘unconventional functions’’ of these receptors, and breaks the ground for the study of mGlu receptors in neural stem cells used for the cell replacement therapy in experimental models of neurodegenerative disorders.

References [1] M.F. Bear, S.M. Dudek, Stimulation of phosphoinositide turnover by excitatory amino acids, Ann. N. Y. Acad. Sci. 627 (1991) 42 – 56. [2] M.F. Bear, C.D. Rittenhouse, Molecular basis for induction of ocular dominance plasticity, J. Neurobiol. 41 (1) (1999 (Oct.)) 83 – 91. [3] V. Bruno, G. Battaglia, A. Copani, M. D’Onofrio, P. Di Iorio, A. De Blasi, D. Melchiorri, P.J. Flor, F. Nicoletti, Metabotropic glutamate receptor subtypes as targets for neuroprotective drugs, J. Cereb. Blood Flow Metab. 21 (9) (2001 (Sep.)) 1013 – 1033. [4] G. Casabona, A.A. Genazzani, M. Di Stefano, M.A. Sortino, F. Nicoletti, Developmental changes in the modulation of cyclic AMP formation by the metabotropic glutamate receptor agonist 1S,3R-aminocyclopentane-1,3-dicarboxylic acid in brain slices, J. Neurochem. 59 (3) (1992 (Sep.)) 1161 – 1163. [5] G. Casabona, T. Kno¨pfel, R. Kuhn, F. Gasparini, P. Baumann, M.A. Sortino, A. Copani, F. Nicoletti, Expression and coupling to poly-

22

[6]

[7]

[8]

[9]

[10]

[11]

[12]

[13]

[14] [15]

[16]

[17]

[18]

[19]

[20]

V.D. Di Giorgi Gerevini et al. / Developmental Brain Research 150 (2004) 17–22 phosphoinositide hydrolysis of group-I metabotropic glutamate receptors in early postnatal and adult rat brain, Eur. J. Neurosci. 9 (1997) 12 – 17. M.V. Catania, G.B. Landwehrmeyer, C.M. Testa, D.M. Standaert , H.B. Penney Jr., A.B. Young, Metabotropic glutamate receptors are differentially regulated during development, Neuroscience 61 (1994) 481 – 495. M.V. Catania, M. Bellomo, V. Di Giorgi-Gerevini, G. Seminara, R. Giuffrida, R. Romeo, A. De Blasi, F. Nicoletti, Endogenous activation of group-I metabotropic glutamate receptors is required for differentiation and survival of cerebellar Purkinje cells, J. Neurosci. 21 (19) (2001 (Oct. 1)) 7664 – 7673. R. Ciccarelli, F.X. Sureda, G. Casabona, P. Di Iorio, A. Caruso, F. Condorelli, D.F. Condorelli, F. Nicoletti, F. Caciagli, Opposite influence of the metabotropic glutamate receptor subtypes mGlu3 and -5 on astrocyte proliferation in culture, Glia 21 (4) (1997 (Dec.)) 390 – 398. A. De Blasi, P.J. Conn, J. Pin, F. Nicoletti, Molecular determinants of metabotropic glutamate receptor signaling, Trends Pharmacol. Sci. 22 (3) (2001 (Mar.)) 114 – 120. M.C. Defagot, M.J. Villar, M.C. Antonelli, Differential localization of metabotropic glutamate receptors during postnatal development, Dev. Neurosci. 24 (4) (2002) 272 – 282. S.M. Dudek, M.F. Bear, A biochemical correlate of the critical period for synaptic modification in the visual cortex, Science 246 (4930) (1989 (Nov. 3)) 673 – 675. C. Frati, C. Marchese, G. Fisichella, A. Copani, M.R. Nasca, M. Storto, F. Nicoletti, Expression of functional mGlu5 metabotropic glutamate receptors in human melanocytes, J. Cell. Physiol. 183 (3) (2000 (Jun)) 364 – 372. A. Furuta, L.J. Martin, Laminar segregation of the cortical plate during corticogenesis is accompanied by changes in glutamate receptor expression, J. Neurobiol. 39 (1) (1999 (Apr.)) 67 – 80. D. Goldowitz, K. Hamre, The cells and molecules that make a cerebellum, Trends Neurosci. 21 (1998) 375 – 382. K. Hashimoto, R. Ichikawa, H. Takechi, Y. Inoue, A. Aiba, K. Mishina, M. Mishina, T. Hashikawa, A. Konnert, M. Watanabe, M. Kano, Roles of glutamate receptor delta 2 subunit (GluRdelta2) and metanotropic glutamate receptor subtype 1(mGluR1) in climbing fiber synapse elimination during postnatal cerebellar development, J. Neurosci. 21 (24) (2001 (Dec. 15)) 9701 – 9712. K. Hashimoto, M. Miyata, M. Watanabe, M. Kano, Roles of phospholipase Cbeta4 in synapse elimination and plasticity in developing and mature cerebellum, Mol. Neurobiol. 23 (1) (2001 (Feb.)) 69 – 82. E.S. Jokel, E.R. Garduno, M.A. Ariano, M.S. Levine, Metabotropic glutamate receptors mGluR1alpha and mGluR2/3 display dynamic expression patterns in developing rat striatum, Dev. Neurosci. 23 (1) (2001) 1 – 6. S. Kawabata, A. Kohara, R. Tsutsumi, H. Itahana, S. Hayashibe, T. Yamaguchi, M. Okada, Diversity of calcium signaling by metabotropic glutamate receptors, J. Biol. Chem. 273 (28) (1998 (Jul. 10)) 17381 – 17385. A. Konnerth, M. Watanabe, M. Kano, Roles of glutamate receptor delta 2 subunit (GluR delta 2) and metabotropic glutamate receptor subtype 1 (mGluR1) in climbing fiber synapse elimination during postnatal cerebellar development, J. Neurosci. 21 (24) (2001 (Dec. 15)) 9701 – 9712. G. Lopez-Bendito, R. Shigemoto, R. Lujan, J.M. Juiz, Developmental changes in the localisation of the mGluR1alpha subtype of metabotropic glutamate receptors in Purkinje cells, Neuroscience 105 (2) (2001) 413 – 416.

[21] G. Lopez-Bendito, R. Shigemoto, A. Fairen, R. Lujan, Differential distribution of group I metabotropic glutamate receptors during rat cortical development, Cereb. Cortex 12 (6) (2002 (Jun)) 625 – 638. [22] Y.-M. Lu, Z. Jia, C. Janus, J.H. Henderson, R. Gerali, J.M. Wojtowicz, J.C. Roder, Mice lacking metabotropic glutamate receptor 5 show impaired learning and reduced CA1 long-term potentiation (LTP) but normal CA3 LTP, J. Neurosci. 17 (1997) 5196 – 5205. [23] A. Munoz, X.B. Liu, E.G. Jones, Development of metabotropic glutamate receptors from trigeminal nuclei to barrel cortex in postnatal mouse, J. Comp. Neurol. 409 (4) (1999 (Jul 12)) 549 – 566. [24] R. Meguro, H. Ohishi, K. Hoshino, T.P. Hicks, M. Norita, Metabotropic glutamate receptor 2/3 immunoreactivity in the developing rat cerebellar cortex, J. Comp. Neurol. 410 (2) (1999 (Jul 26)) 243 – 255. [25] V. Neugebauer, Peripheral metabotropic glutamate receptors: fight the pain where it hurts, Trends Neurosci. 24 (10) (2001 (Oct.)) 550 – 552. [26] F. Nicoletti, J.T. Wroblewski, A. Novelli, H. Alho, A. Guidotti, E. Costa, The activation of inositol phospholipid hydrolysis as a signal transducing system for excitatory amino acids in primary cultures of cerebellar granule cells, J. Neurosci. 6 (1986) 1905 – 1911. [27] K.L. O’Malley, Y.J. Jong, Y. Gonchar, A. Burkhalter, C. Romano, Activation of metabotropic glutamate receptor mGlu5 on nuclear membranes mediates intranuclear Ca2+ changes in heterologous cell types and neurons, J. Biol. Chem. 278 (30) (2003 (Jul 25)) 28210 – 28219. [28] A. Palucha, P. Branski, B. Kroczka, J. Wieronska, A. Pilc, Developmental changes in the modulation of cyclic AMP accumulation by activation of metabotropic glutamate receptors, Pol. J. Pharmacol. 53 (5) (2001 (Sep – Oct.)) 481 – 486. [29] J.-P. Pin, R. Duvoisin, The metabotropic glutamate receptors: structure and functions, Neuropharmacology 34 (1995) 1 – 26. [30] R.S. Prather, Basic mechanisms of fertilization and parthenogenesis in pigs, Reprod. Suppl. 58 (2001) 105 – 112. [31] B.A. Reynolds, S. Weiss, Clonal and population analyses demonstrate that an EGF-responsive mammalian embryonic CNS precursor is a stem cell, Dev. Biol. 175 (1996) 1 – 13. [32] C. Romano, A. Van den Pol, K.L. O’Malley, Enhanced early developmental expression of the metabotropic glutamate receptor mGluR5 in rat brain: protein, mRNA splice variants, and regional distribution, J. Comp. Neurol. 367 (1996) 403 – 412. [33] M. Storto, U. de Grazia, T. Knopfel, P.L. Canonico, A. Copani, P. Richelmi, F. Nicoletti, M. Vairetti, Selective blockade of mGlu5 metabotropic glutamate receptors protects rat hepatocytes against hypoxic damage, Hepatology 31 (3) (2000 (Mar.)) 649 – 655. [34] A. Valerio, P. Rizzonelli, M. Paterlini, G. Moretto, T. Knopfel, R. Kuhn, M. Memo, P. Spano, mGluR5 metabotropic glutamate receptor distribution in rat and human spinal cord: a developmental study, Neurosci. Res. 28 (1) (1997 (May)) 49 – 57. [35] A.N. van den Pol, L. Kogelman, P. Ghosh, P. Liljelund, C. Blackstone, Developmental regulation of the hypothalamic metabotropic glutamate receptor mGluR1, J. Neurosci. 14 (6) (1994 (Jun)) 3816 – 3834. [36] A.N. van den Pol, K. Obrietan, V. Cao, P.Q. Trombley, Embryonic hypothalamic expression of functional glutamate receptors, Neuroscience 67 (2) (1995 (Jul)) 419 – 439. [37] B.A. Roelen, H.Y. Lin, V. Knezevic, E. Freund, C.L. Mummery, Expression of TGF-beta s and their receptors during implantation and organogenesis of the mouse embryo, Dev. Biol. 166 (1994) 716 – 728. [38] A. Poli, R. Lucchi, M. Storto, P. De Paolis, S. Notari, F. Nicoletti, G. Casabona, Predominant expression of group-II metabotropic glutamate receptors in the goldfish brain, Brain Res. 10 (1999) 142 – 145.