- Email: [email protected]
The microbial community in a 2,4-dinitrophenol-digesting reactor as revealed by 16S rDNA gene analysis
Of Broscu NCf, ANI) Vol. 96. No. I. 70 75. 2003
.fOl KNAI
BIOI,M;IVI
t.f
The Microbial Community in a 2,4-Dinitrophenol-Digesting Reactor as Revealed by 16s rDNA Gene Analysis NOBUTADA
KIMURA,‘* YUKIKO SHINOZAKI,‘TAE AND YOSHITAKA YONEZAWAj
HO LEE,’
Institute for Biological Resources and Functions, Nationul Institute qfildvanced industrial Science and Technology (A/ST). AIST Tsukuba Central 6, I-I-I Higashi, fiukuba. Ibaraki 305-8566, Japan,‘Institute qfilpplied Biochemistq tiniversiw of Tsukuba. I-I Tennodai, Eukuba. Ibaraki 305-0006. Japan,’ and Reseurch Center,for Chemical Risk Management, National Institute qf‘ddvanced Industrial Science and Technoloal (AIST). AIST fiukuba West. 16-I Onogawa, Tsukuba, lbaraki 3058569. Japan’ Received IO Fehruar) 2003/Accepted 7 April 2003
The microbial community of a 2,4-dinitrophenol-digesting reactor was investigated using different molecular biological techniques based on 16s rDNA gene sequences. A PCR-denaturing gradient gel electrophoresis (DGGE) analysis of the bacterial community in the reactor showed that one strong and five minor bands were observed in the DGGE profile. The results of excising and sequencing DGGE bands suggested that members of Rhodococcus, Nocardioides, and Nitrospira species were present in the reactor. Partial sequencing of cloned 16s rDNAs revealed diversity among the six main divisions - the a, 6 subclasses of Proteobacteria, Nitrospira, Cytophagal FlexibacterlBacteroides, Verrucomicrobia, and Actinobacteria - in the reactor. Two cloned sequence types were not closely afftliated with any described bacterial divisions. The isolation and phylogenetic analysis of 2,4-DNP-degrading bacteria from the reactor revealed that isolated strains were classified into two types of bacteria having different 16s rDNA sequences. One of these strain types was identified as a relative of Rhodococcus koreensis, and the other was identified as a relative of Nocardioides simplex FJ21-A. [Key words:
2,4-dinitrophenol, Nocardioides,
Rhodococcus]
Nitrophenol compounds are important for their use in medicines, dyes, explosives, and as preservatives in pesticides. Because of their widespread use, nitrophenol compounds occur as contaminants in industrial effluents, and therefore enter natural waters. 2,4-Dinitrophenol (2,4-DNP) is well known as an “uncoupler” compound (1). 2,4-DNP can cross membranes in its protonated form, acting as an H’ carrier, and dissipate the electrochemical gradient across cell membranes, thus uncoupling the oxidative phosphorylation pathway without blocking oxygen consumption (2). Therefore, the ability of 2,4-DNP to function as a respiratory uncoupler is described as toxic to microorganisms (3). Consequently, the U.S. Environmental Protection Agency lists 2,4-DNP on its “Priority Pollutants List”, and recommends restricting its concentrations in natural waters (4). Generally, microbial degradation in reactors has been used as a tool for the treatment of 2,4-DNP-contaminated wastewater (5-8). However, it takes a long time for microorganisms to degrade this compound in reactors (9). Knowledge about the microbial community in 2,4-DNP-digesting reactors is useful for establishing the operational conditions needed to eliminate this pollutant efficiently. Furthermore, we are interested in the microbial community in toxic compound-digesting reactors. The purpose of this work was to
investigate the microbial community in a 2,4-DNP-digesting reactor through analysis of 16s rDNA sequences by combined application of different molecular techniques. MATERIALS The laboratory
reactor
AND METHODS process
Seed materials were ob-
tained from the wastewater treatment plant reactor of a dye-producing plant in Wakayama prefecture, Japan. The reactor was acclimated to 2,4-DNP in a laboratory reactor unit composed of a 3-1 aeration tank, which was in operation for over 15 years. The ingredients in the feed were 0.27 mM 2,4-DNP, 3.0 mM KH,PO,, 17.6 mM Na,HPO,, 0.13 mM CaCI,.2H,O, 0.20 mM MgSO,, 7Hz0, and 0.71 mM Urea. The pH of the feed was adjusted to 7.0. The dilution rate was kept constant at I.5 I per day; thus, the hydraulic residence time was I.5 d. The concentration of 2,4-DNP in the aeration tank was measuredby a spectrophotometer,using culture supernatant diluted with 0.1 N NaOH, and the absorbance at 410 nm was determined. The reactor had almost completely digested the 2,4-DNP within 12 h after the 2,4-DNP feeding began; the concentration of 2,4-DNP fell below the detection limit (< 1 PM). The reactor samplesfor DNA extraction were collected when the concentration of 2,4-DNP was 0.05 mM. DNA extraction from reactor samples Total DNA was extracted from the reactor samples by the following method. Fifty ml of sludge was added to a 50-ml polypropylene round-bottomed tube (Iwaki, Tokyo), washed with TES buffer (20mM Tris-HCI [pH 8.01 and 100 mM EDTA [pH 8.01, 50 mM NaCI), and resus-
* Corresponding author. e-mail: [email protected] phone: +81-(0)29-861-8767 fax: +81-(0)29-86 I-6587
pended in I ml of the same buffer. To this sample, I g of beads 70
Vor.. 96.2003
THE MICROBIAL
(0.1 O-O. 11-mm diameter; El. Braun Biotech International, Melsungen, Germany) was addled, and the mixture was beaten three times for 10 min each time, using a bead beater (B. Braun Biotech International) at 2000 rpm. Then, 2 mg of lysozyme per ml were added, and the samples were then incubated for 30min at 37°C. Subsequently, 50 pg of proteinase K per ml and 0.2 ml of 10% SDS were added, followed by incubation for 1 h at 30°C and an additional 10 min at 65°C. DNA was obtained from the lysate using standard phenol-chloroform extraction and ethanol precipitation procedures (10). RNA was removed by incubating the aqueous solution with 5 U of DNase-free RNase (Toyobo, Tokyo) for 30 min at 37°C. The extracted DNA was finally dissolved in 50 ul of distilled water. The concentration of extracted DNA was confirmed by visualization on an agarose gel (1% agarose, 1 xTrisacetate-EDTA [TAE], 40mM Tris, 40 mM acetic acid, 1 mM EDTA, pH 8.0) and by staining with 5 pg/ml ethidium bromide. PCR amplification of 16s rRNA genes from reactor DNA PCR amplification was performed using a 9700 thermal cycler (PE Biosystems Japan, Tok.yo). The PCR mixture contained 0.5 pM of each primer, 200 uM of each deoxynucleotide triphosphate, 10x reaction buffer, 2.5 U of Ex Taq DNA polymerase (Takara, Tokyo), and DNase- and RNase-free filter-sterilized water (Sigma-Aldrich Chemie, St. Louis, USA) to achieve a final volume of 50 ~1. For construction of the 16s rDNA clone library, the 16s rRNA genes from the reactor DNA were amplified by PCR using primers corresponding to bases 8-27 (5’-AGAGTTTGATCCTGG CTCAG-3’) and 1542-l 525 (5’-AAGGAGGTGATCCAGCC-3’) (Escherichiu coli numbering) (11). PCR was performed under the following conditions: initial denaturation at 94°C for 3 min; 25 cycles of 94°C for 1 min, 50°C for 1 min, and 72°C for 2 min; and a final extension at 72°C for 10 min. For analysis of the 16s rDNA clone library, the 16s rRNA genes were amplified by PCR using Ml3 primers. PCR was performed under the following conditions: initial denaturation at 94°C for 5 mitt; 25 cycles of 94°C for 1 min, 60°C for 1 mitt, and 72’C for 3 min; and a final extension step at 72°C for 10 min. For denaturing gel electrophoresis (DGGE) analysis, touchdown PCR was performed under the conditions described previously with PCR primers F968GC (5’-CGCCCGGGG CGCGCCCCGGGCGGGGCGGGGGCACGGGGGAACGCGA AGAACCTTAC-3’) and R1401 (5’~CGGTGTGTACAAGACCC3’) (12). PCR products were run on an agarose gel (2% agarose, I xTAE) and stained with 5 l&ml ethidium bromide. A positive control with purified genomic DNA and a negative control without added DNA were included in all PCR reactions. DGGE analysis DGGE analysis was performed using the Dcode System (Bio-Rad, Tokyo). PCR samples were loaded onto 10% (wt/vol) polyacrylamide gels in 1 x TAE and run for 2.5 h at I50 V by using a linear denaturation gradient ranging from 40% to 65%. After the electrophoresis, the gels were soaked in a 50 ugiml ethidium bromide solution for 15 min then photographed on a UV transillumination table. For sequence determination of DGGE bands, small gel pieces were excised from the acrylamide gel and DNA was eluted overnight :at 37°C in a sterile tube containing 5 pl of Tris-EDTA buffer (pH 7.5). The elutant was centrifuged briefly to pelletize the acrylamide fragments. Two pl of the supernatant was used as a template for a re-amplification PCR using the F968GC and R1401 primers and the reaction conditions described above. The PCR products were then cloned into a TA cloning vector pCR’ 2.1 (Invitrogen, Carlsbad, CA, USA), and the plasmid constructed was subjected to sequence reactions. Construction of the 16s rDNA clone library Amplified 16s rDNA fragments were cloned into the TA cloning vector. Ligation and transformation into E. coli INVa’ competent cells were carried out according to the manufacturer’s protocol. Determination of nucleotide sequences and phylogenetic analysis Plasmid templates for DNA sequencing were prepared
COMMUNITY
IN 2,4-DNP-DIGESTmG
REACTOR
71
using a QIAGEN mini-kit (Qiagen, Hilden, Germany). The sequences were processed using a model 373 Stretch PE Biosystems automated sequencer (PE Biosystems). To detect potential chimerit artifacts in the partial sequences of the 3’ end and the 5’ end, partial sequences around 500 bases long were examined with the CHECK-CHIMERA tool of the Ribosomal Database Project (13, 14). Database searches were conducted using the BLAST program with the GenBank Database. The sequences determined in this study and those retrieved from the databases were aligned using Clustal W, ver. 1.8 (15). The alignments were refined by visual inspection. A neighbor-joining tree (16) was constructed using the njplot software in Clustal W, ver. 1.8. Nucleotide positions at which any sequence had a gap or an ambiguous base were not included in the calculations. Clones that had similar (
RESULTS DGGE analysis of the reactor microbial community DGGE of partial 16s rDNA fragments (433 bp) that were PCR amplified from sample DNA was conducted to analyze the bacterial community in the reactor (Fig. 1). This analysis by DGGE revealed that one strong and five minor bands were observed in the DGGE profile. Excision, re-amplification, and cloning of the major DNA band, and a comparison of the DGGE profile of the sample with the DGGE profile of the individual clones was performed (data not shown). Two well-represented clone types, which produced a band that co-migrated with the intensely stained DGGE band (Fig. 1A) in the community DNA, were identified. Sequencing of the clones showed that it was closely related to sequences of Rhodococcus koreensis (GenBank accession no. AF124342) (97% identity, 433 bp) and Nocardioides simplex FJ21-A (94% identity, 433 bp). In addition, one clone type, which produced a band that co-migrated with the band
72
KIMURA E’l’ Al
J. ~IOSCI.
-
+N.mowovienso (~F155152,wx) +R.hyremis (AF124342,97%) N.srm&xFJ21-A (U27&%.94%)
FIG. I. DGGE separation patterns (A) and a schematic representation (B) of the 16s rDNA fragments obtained after PCR of DNA extracts from a 2,4-DNP-digesting reactor. The GenBank, EMBL, and DDBJ accession numbers and identity with the sequences of the close relatives are given in parentheses.
(Fig. IS) in the community DNA, was identified. Sequencing of the clone showed it was closely related to sequences of Nitrospira moscoviensis (GenBank AF 155 152) (97% identity). Sequence analysis of the cloned 16s rDNA library Thirty-seven clones were partially sequenced to investigate the relationships among the environmental clones. Approximately 600 bp, extending from position 8 to position 600 with reference to the E. coli 16s rDNA sequence, were sequenced. The average length of these sequences was 687 bp, ranging from 496 to 741 bases. The similarity values of the clone sequences to the database sequences ranged from 87% to 99%. The distribution of the 37 clones into the bacterial divisions and the phylogenetic positions are given in Fig. 2 and Table 1, respectively. Some of the clones had sequences highly homologous to the 16s rDNA sequence anaTABLE Taxonomic group (number of OTUs) (3)
lyzed, differing from it by less than 1%. We assumed that such slight dissimilarity would probably not justify the delinition of a separate species (19), and therefore combined clones with < 1% dissimilarity into the same OTU. We found sequences belonging to six of the currently recognized bacterial divisions. The largest number (21 clones; 59.5%) in one division belonged to the Actinobacteriu lineage. The minor groups in the library represented the a subclass of Proteobacteria (8.1% of total clones), the CytophagalFlexibacterlBacteroides (8.1%). Verrucomicrobia (8.1%) Nitrospira group (5.4%). and 6 subclass ot Proteobacteria (5.4%). In the Actinobacteriu class, three OTUs were observed in the clone library. Among these OTUs, one was identified to be a close (99% similarity) relative of R. koreensis (GenBank AF124342), which was previously isolated as a 2,4-DNP-degrading bacterium (20). Furthermore, one OTU was identified to be a relative (94% similarity) of N. simplex FJ2 1-A (GenBank U27856), which was previously isolated as a picric acid as well as a 2,CDNP-degrading bacterium (21), and the other was identified to be a relative (89% similarity) of Sphaerobacter thermophilus (GenBank AJ420142). Two OTUs were found in the c1 subclass of Proteobacteria in the clone library. One OTU (NKT191) was identitied to be a close (99% similarity) relative of Nitrobactor sp. (GenBank L 11662), and the other (NKT2 13) was identilied to be a relative of the Blastchloris sulfoviridis strain GNl (GenBank AB033757), which is known to be a phototrophic bacterium (22). We observed two OTUs in the CytophagalFlexibacterl Bacteroides class from the clone library. One OTU (NKT202) was identified to be a relative (92% similarity) of Flavobacterium ferrugineum (GenBank M62798), and the other (NKT192) to be a relative (87% similarity) of Cytophaga sp. T-561 (GenBank AB073591). In addition, we observed one OTU (NKT207) in the Nitrospira group, which, at 98% similarity, was most similar to Nitrospira moscoviensis (GenBank AF155 152) (23). Furthermore, we observed one OTU (NKT2 10) in the 6 subclass of Proteobacteria, which was identified to be a relative (89% similarity) of Geobacter sulfurreducens (GenBank Ull3928). Based on the results of the 16s rDNA library analysis, we estimated that there was diversity in the
1. Phylogenetic distribution of the 16s rDNA PCR clones examined at the division level OTU”
NKT198 NKTZO 1 NKT196 a-Proteobacteria (2) NKT213 NKTlYl CFB group (2) NKT202 NKT192 NKT193 Verrucomicrobia (2) NKT205 S-Proteobacteria (1) NKT210 Nitrospira ( 1) NKT207 Unclassitible (2) NKT23 1 NKT238 a OTU, Operational taxonomic unit. Actinobacteriu
t%lOl hc,
Number of clones 11 IO I 2
I 2
I 2 I 2 2 1 1
Closest relative R. koreensis (AFI 24342) N. .sitnplex FJ2 I -A (U27859) S thermophilus (AJ420 142) B. sulfbviridis GN 1 (AB033757) Nitrobactor sp. (L11662) F,ferrugineum (M62798) Cyiophugu sp. T-561 (AB073591) Uncultured Verrucomicrobia bacterium (AF35 12 15) Uncultured Verrucomicrobia bacterium (AF46565 1) G sulfurreducens (U113928) N. moscoviensis SBR1015 (AF155152) Uncultured sludge bacterium (AF234733) Llncultured bacterium mle-48 (AF280867)
Homology (“/I 99 94 88 93 99
92 87 95 91 89 98 94 96
THE MICROBIAL
VOL. 96,2003
935
COMMUNITY
IN 2,4-DNP-DIGESTING
REACTOR
-
NKT192
1
Cyrophaga
73
sp. T-561
(ABO73591) CFB
Flavobacterium
VP
ferrugneum
(M62798)
Nibwpimgroup
L.N~trospwa
moscoviensrs
SBRlOlS
(AF15.5152)
3! Ve-microbia group
I
58
rNKT238
I
lhmhrcd
lrn
bacterium mlea
r--Un;wed
(AF280867)
sludge bacterium
S14 (AF234733)
NKT210
8 -PMteobaet& Geobacter loo0 I
sulfurreducens
(U I 13928)
NKT198 Rhodococcus
LrnTrn’
koreensis
(AF124342)
ACti?WhUi&
Nocardioldes
simplex
FJ21-A
(U278.56)
NKTl% 990
I
I
Sphaerobacrer Aqufex
thermophllus pyrophilus
(AJ420142)
(Mt33548,
outgroup)
FIG. 2. Neighbor-joining tree representing the phylogenetic relationships of 16s rDNA sequences from 2,4-DNP-digesting reactor samples and various closely related clones and isolate sequences obtained from BLAST searches. The scale indicates genetic distance. NKT represents the clones.
phylotypes of the bacterial members within the reactor. The remaining four OTUs (13.5% of total clones) were closely related to uncultured bacteria from other environmental libraries. Among these remaining OTUs, the sequence of two OTUs, NKT193 and NKT205 were similar to the published sequences of two Verrucomicrobia bacteria
with GetBank accession nos. AF35 12 15 and AF46565 1, respectively. Two cloned sequence types (NKT231 and 238) were not closely affiliated with any described bacterial divisions. Isolation of 2,4-DNP-degrading bacteria from the reactor To further characterize the bacterial community
74
KlMllKA
L’I AI
detected by the molecular method, we attempted to isolate 2,4-DNP-degrading bacteria from the reactor. Approximately two hundred strains were isolated from the reactor and their phylogenetic properties were examined. As a result, all isolated strains were classified into one of two types having different 16s rDNA sequences. One representative strain, strain D32, was identified as a relative of/L’. simplex based on the 16s rDNA sequences. Strain D32 had 99% 16s rDNA sequence similarity to the sequence of clone NKT201, which was the most abundant clone in the 16s rDNA library. Furthermore, strain E22 was identified as a relative of R. koreensis based on the 16s rDNA sequences. Strain E22 which had 99% 16s rDNA sequence similarity to that of clone NKT198, was the second-most abundant clone in the 16s rDNA library. Furthermore, strains D32 and E22 had 16s rDNA sequences identical to the sequences of the major band in the DGGE profile. DlSCUSSlON Phylogenetic analysis using the clone sequences suggested that there was microbial diversity among the six main divisions, Actinohacteria, the ct and 6 subclasses of the Proteobacteriu, the CytophagalFIexihacterlBacteroides group, Verrucomicrobia, and Nitrospira, in the reactor (Fig. 2 and Table 1). The bacteria in the reactor appeared to be comprised of Rhodococcus and Nocardioides species on the basis of our results. The results obtained by DGGE analysis corresponded to those of clone sequencing analysis. Furthermore, two types of 2,4-DNP-degrading bacteria, belonging to the genera Rhodococcus and Nocurdioides, were isolated from this reactor. Several studies on the microorganisms that degrade 2,4-DNP have been reported (2428). With one exception, only Actinohucteriu have been reported to degrade 2,4-DNP. One possible explanation for this is that Actinobucteria are likely to tolerate the uncoupling property of 2,4-DNP because of their thick cell envelope (29), and cofactor F,,,, which is involved with the metabolite of 2,4-DNP, has been described only in archaea. cyanobacteria, and Actinohucteriu (30, 3 1). Accordingly. these bacterial species may play a role in the degradation of 2,4-DNP in this reactor. The results of 16s rDNAs clone analysis revealed that there were clone sequences similar to the 16s rDNA sequences of N. moscoviensis and Nitrobactor sp. known as nitrite-oxidizing bacteria (32, 33). It has been found that nitrite is released into the culture fluid as a by-product during 2,4-DNP degradation. Therefore, there is a possibility that these nitrite-oxidizing bacteria play a role in the transformation of nitrite to nitrate. Furthermore, based on the fact that the ingredients in the feed included urea as a nitrogen source, there is a possibility that an ammonia oxidation pathway was present in the reactor. On the basis of these results, the composition of the microbial community in the reactor was being driven by two factors; 2,4-DNP and urea. The role of other bacteria in the reactor is unclear. However, these bacteria may be able to tolerate the toxicity of 2,4DNP. Two cloned sequence types were not closely affiliated with any described bacterial divisions (Fig. 2 and Table 1).
2 2”T/ 2 ::c 1s.
,c-‘.--,,y
G
F$ IO9 ‘ZY / m 5 3 /’ E c’ Go&. 0 5
IO
IS
20
Prediction line for the clones
25
30
3s
40
45
50
5s
60
Number of clones sequenced PIG. 3. Cumulative operational taxonomic units represented h) 16s rDNA libraq clones obtained from the 2,4-DNP-digesting reactor. The plots were fitted to a parabolic equation Y=AX/(B+X) with a=23.6 and h= 17.2.
Furthermore, the maximum similarity of four clones to known sequences was below 90%. Because of the difficulties in translating rDNA similarity values into nomenclatural divergence, it was suggested that similarity values to known sequences below 95% be regarded as evidence of the discovery of a novel species (34). Therefore, there may have been unidentified bacteria in the reactor. The 2,4-DNP digesting reactor contained bacteria exhibiting at least 13 different 16s rDNA sequences. From the cumulative number of different sequences plotted against the number of clones, we could estimate the expected numbers of phylotypes by using the method of Sekiguchi et al. (35) (Fig. 3). According to the calculations, the possible total number ot sequences was estimated to be approximately 24 for the reactor. In this study, we investigated the microbial community in a 2,4-DNP-digesting reactor by using two different techniques to eliminate technical bias: cloning-assisted analysis and DGGE of amplified 16s rDNA gene fragments. Isolated 2,4-DNP-degrading strains, D32 and E23, had 16s rDNA sequences corresponding to the sequences in the DGGE band and the 16s DNA clone sequence. On the basis of these results, we could detect a member of the microbial community in the reactor by using the 16s rDNA sequence. However, 16s rDNA sequence fragments of Rhodococcus sp. and Nocardioides sp. were found by DGGE analysis to have co-migrated. A possible explanation is that these fragments were not identical, but had similar sequences. Although the DGGE method proved to be excellent for distinguishing close relatives, the co-migration of a few nonidentical fragments was reported (36). This is a possible reason why the number of bands on the DGGE gel did not reflect the number of different sequences in the 16s rDNA clone library. Therefore, we believe that unknown genotypes and phenotypes, which would only be detectable using more refined technologies, may have been present in the reactor. ACKNOWLEDGMENTS We vided Suwa, of this
greatly appreciate the excellent technical assistance proby Tomoko Kimura. We would also like to thank Yuichi Yasutoshi Matsui, and Fumio Yamaguchi for their support work.
THE MICROBIAL
VOL. 96.2003
REFERENCES 1. Hanstein, W. G.: Uncoupling of oxidative phosphorylation. Biochem. Biophys. Acta, 456, 129-148 (1976). 2. Alberts, B., Bray, D., Lewis, L., Raff, M., Roberts, K., and Watson, J. D.: Molecular biology of the cell, 2nd ed. Garland, New York (1989). 3. Bruhn, C., Lenke, H., and Knackmuss, H. J.: Nitrosubstituted aromatic compounds as a nitrogen source for bacteria. Appl. Environ. Microbial., 53,208-210 (1987). 4. Keith, L. H. and Telliard, W. A.: Priority pollutants. 1. A perspective view. Environ. Sci. Technol., 13,416423 (1979). 5. Gisi, D., Stucki, G., and Hanselmann, W.: Biodegradation of the pesticide 4,6-dinitro-ortho-cresol by microorganisms in batch cultures and in fixed-bed column reactors. Appl. Microbiol. Biotechnol., 48441448 (1997). 6. Hess, T. F., Schmidt, ,S.K., Silverstein, J., and Howe, B.: Supplement substrate enhancement of 2,4-dinitrophenol mineralization by a bacterial consortium. Appl. Environ. Microbiol., 56, 1551-1558 (1990). 7. Xing, X. H., Inoue, T., Tanji, Y., and Unno, H.: Enhanced microbial adaptation to p-nitrophenol using activated sludge retained in porous carrier particles and simultaneous removal of nitrite released from degradation of p-nitrophenol. J. Biosci. Bioeng., 87, 372-377 (1999). 8. Xing, X. H., Shiragami, N., and Usami, S.: Simultaneous removal of carbonaceous and nitrogenous substances in wastewater by a continuous-flow fluidized-bed bioreactor. J. Chem. Eng., Jpn., 28, 5~25-530 (1996). 9. Takahara, M. (ed.): Biological treatment of waste water. Chikyusya, Tokyo (1980). (in Japanese) IO. Sambrook, J., Fritsch, E. F., and Maniatis, T.: Molecular cloning, a laboratory
REACTOR
75
89,396-399(2000). 23.
Burrell, P. C., Keller, J., and Blackall, L. L.: Microbiology of a nitrite-oxidizing bioreactor. Appl. Environ. Microbial., 64, 1878-1883
(1998).
Blasco, R., Moore, E., Wray, V., Pieper, D., Timmis, K., and Castillo, F.: 3-Nitroadipate a metabolic intermediate for mineralization of 2,4-dinitrophenol by a new strain of Rhodococcus species. J. Bacterial., 181, 149-l 52 (1999). 25. Cassidy, M. B., Lee, H., Trevors, J. T., and Zablotowicz, R.B.: Chlorophenol and nitrophenol metabolism by Sphingomonus sp. UG30. J. Ind. Microbial. Biotechnol., 23, 232241 (1999). 26. Lenke, H., Pieper, D., Bruhn, C., and Knackmuss, H. J.: Degradation of 2,4-dinitrophenol by two Rhodococcus erythlopolis strains, HL24-1 and HL24-2. Appl. Environ. Microbial., 24.
58,2928%2932(1992).
Walters, D. M., Russ, R., Knackmuss, H. J., and Rouviere, P. E.: High-density sampling of a bacterial operon using mRNA differential display. Gene, 273, 305-3 15 (2001). 28. Zablotowicz, R. M., Leung, K. T., Alber, T., Cassidy, M. B., Trevors, J. T., Lee, H., Veldhuis, L., and Hall, J. C.: Degradation of 2,4-dinitrophenol and selected nitroaromatic compounds by Sphingomonas sp. UG30. Can. J. Microbial., 45,840-848( 1999). 29. Sutcliffe, I. C.: Cell envelope composition and organization in the genus Rhodococcus. Antonie Van Leeuwenhoek., 74, 27.
49-58 30.
3 1.
32.
33.
34.
35.
55,245-256(1966).
19. Stackebrandt, E. and Goebel, B. M.: Taxonomic note: a place for DNA-DNA reassociation and 16s rRNA sequence analysis in the present species definition in bacteriology. lnt. J. Syst. Bacterial., 44, :846-849 (1994).
IN 2,4-DNP-DIGESTING
20. Yoon, J. H., Cho, Y. G., Kang, S. S., Kim, S. B., Lee, S. T., and Park, Y. H.: Rhodococcus koreensis sp. nov., a 2,4-dinitrophenol-degrading bacterium. Int. J. Syst. Evol. Microbial., 50, 1193-1201 (2000). 21. Rajan, J., Valli, K., Perkins, R. E., Sariaslan, F. S., Barns, S.M., Reysenbach, A.L., Rehm, S., Ehringer, M., and Pace, N. R.: Mineralization of 2,4,6-trinitrophenol (picric acid): characterization and phylogenetic identification of microbial strains. J. Ind. Microbial., 16, 319-324 (1996). 22. Sawayama, S., Hanada, S., and Kamagata, Y.: Isolation and characterization of phototrophic bacteria growing in lighted upflow anaerobic sludge blanket reactor. J. Biosci. Bioeng.,
(1987).
17. Kimura, N., Shinozaki, Y., Suwa, Y., and Urushigawa, Y.: Phylogenetic and phenotypic relationships of microorganisms that degrade an uncoupler compound, 2,4-dinitrophenol. J. Gen. Appl. Microbial., 46, 317-322 (2000). 18. Pfennig, N. and Lippert, K. D.: Uber das Vitamin B,,Bedtirfnis phototropher Schwefelbakterien. Arch. Mikrobiol.,
COMMIJNITY
(1998).
Daniels, L., Bakbiet, N., and Harmon, K.: Widespread distribution of a 5-deazaflavin cofactor in Actinomycetes and related bacteria. Syst. Appl. Microbial., 6, 12-I 7 (1985). Purwantini, E., Gillis, T. P., and Daniels, L.: Presence of Faz,-dependent glucose-6-phosphate dehydrogenase in Mycobacterium and Nocardia species, but absence from Streptomyces and Corynebacterium species and methanogenic Archaea. FEMS Microbial. Lett., 146, 129-l 34 (1997). Ehrich, S., Behrens, D., Lebedeva, E., Ludwig, W., and Bock, E.: A new obligately chemolithoautotrophic, nitriteoxidizing bacterium, Nitrospira moscoviensis sp. nov., and its phylogenetic relationship. Arch. Microbial., 164, 16-23 (1995). Bock, E. and Koops, H.-P.: The genus Nitrobacter and related genera, p. 2302-2309. In Balows, A., Trtiper, H. G., Dworkin, M., Harder, W., and Schleifer, K.-H. (ed.), The prokaryotes, 2nd ed. Springer-Verlag, New York (I 992). Amann, R. I., Ludwig, W., and Schleifer, K. H.: Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbial. Rev., 59, 143-169 (1995). Sekiguchi, Y., Kamagata, Y., Syutsubo, K., Ohashi, A., Harada, H., and Nakamura, K.: Phylogenetic diversity of mesophilic and thermophilic granular sludges determined by 16s rRNA gene analysis. Microbiology, 144, 2655-2665 (1998).
36.
Sekiguchi, H., Tomioka, N., and Nakahara, T.: A single band does not always represent single bacterial strains in denaturing gradient gel electrophoresis analysis. Biotechnol. Lett., 23, 1205-1208 (2001).
.fOl KNAI
BIOI,M;IVI
t.f
The Microbial Community in a 2,4-Dinitrophenol-Digesting Reactor as Revealed by 16s rDNA Gene Analysis NOBUTADA
KIMURA,‘* YUKIKO SHINOZAKI,‘TAE AND YOSHITAKA YONEZAWAj
HO LEE,’
Institute for Biological Resources and Functions, Nationul Institute qfildvanced industrial Science and Technology (A/ST). AIST Tsukuba Central 6, I-I-I Higashi, fiukuba. Ibaraki 305-8566, Japan,‘Institute qfilpplied Biochemistq tiniversiw of Tsukuba. I-I Tennodai, Eukuba. Ibaraki 305-0006. Japan,’ and Reseurch Center,for Chemical Risk Management, National Institute qf‘ddvanced Industrial Science and Technoloal (AIST). AIST fiukuba West. 16-I Onogawa, Tsukuba, lbaraki 3058569. Japan’ Received IO Fehruar) 2003/Accepted 7 April 2003
The microbial community of a 2,4-dinitrophenol-digesting reactor was investigated using different molecular biological techniques based on 16s rDNA gene sequences. A PCR-denaturing gradient gel electrophoresis (DGGE) analysis of the bacterial community in the reactor showed that one strong and five minor bands were observed in the DGGE profile. The results of excising and sequencing DGGE bands suggested that members of Rhodococcus, Nocardioides, and Nitrospira species were present in the reactor. Partial sequencing of cloned 16s rDNAs revealed diversity among the six main divisions - the a, 6 subclasses of Proteobacteria, Nitrospira, Cytophagal FlexibacterlBacteroides, Verrucomicrobia, and Actinobacteria - in the reactor. Two cloned sequence types were not closely afftliated with any described bacterial divisions. The isolation and phylogenetic analysis of 2,4-DNP-degrading bacteria from the reactor revealed that isolated strains were classified into two types of bacteria having different 16s rDNA sequences. One of these strain types was identified as a relative of Rhodococcus koreensis, and the other was identified as a relative of Nocardioides simplex FJ21-A. [Key words:
2,4-dinitrophenol, Nocardioides,
Rhodococcus]
Nitrophenol compounds are important for their use in medicines, dyes, explosives, and as preservatives in pesticides. Because of their widespread use, nitrophenol compounds occur as contaminants in industrial effluents, and therefore enter natural waters. 2,4-Dinitrophenol (2,4-DNP) is well known as an “uncoupler” compound (1). 2,4-DNP can cross membranes in its protonated form, acting as an H’ carrier, and dissipate the electrochemical gradient across cell membranes, thus uncoupling the oxidative phosphorylation pathway without blocking oxygen consumption (2). Therefore, the ability of 2,4-DNP to function as a respiratory uncoupler is described as toxic to microorganisms (3). Consequently, the U.S. Environmental Protection Agency lists 2,4-DNP on its “Priority Pollutants List”, and recommends restricting its concentrations in natural waters (4). Generally, microbial degradation in reactors has been used as a tool for the treatment of 2,4-DNP-contaminated wastewater (5-8). However, it takes a long time for microorganisms to degrade this compound in reactors (9). Knowledge about the microbial community in 2,4-DNP-digesting reactors is useful for establishing the operational conditions needed to eliminate this pollutant efficiently. Furthermore, we are interested in the microbial community in toxic compound-digesting reactors. The purpose of this work was to
investigate the microbial community in a 2,4-DNP-digesting reactor through analysis of 16s rDNA sequences by combined application of different molecular techniques. MATERIALS The laboratory
reactor
AND METHODS process
Seed materials were ob-
tained from the wastewater treatment plant reactor of a dye-producing plant in Wakayama prefecture, Japan. The reactor was acclimated to 2,4-DNP in a laboratory reactor unit composed of a 3-1 aeration tank, which was in operation for over 15 years. The ingredients in the feed were 0.27 mM 2,4-DNP, 3.0 mM KH,PO,, 17.6 mM Na,HPO,, 0.13 mM CaCI,.2H,O, 0.20 mM MgSO,, 7Hz0, and 0.71 mM Urea. The pH of the feed was adjusted to 7.0. The dilution rate was kept constant at I.5 I per day; thus, the hydraulic residence time was I.5 d. The concentration of 2,4-DNP in the aeration tank was measuredby a spectrophotometer,using culture supernatant diluted with 0.1 N NaOH, and the absorbance at 410 nm was determined. The reactor had almost completely digested the 2,4-DNP within 12 h after the 2,4-DNP feeding began; the concentration of 2,4-DNP fell below the detection limit (< 1 PM). The reactor samplesfor DNA extraction were collected when the concentration of 2,4-DNP was 0.05 mM. DNA extraction from reactor samples Total DNA was extracted from the reactor samples by the following method. Fifty ml of sludge was added to a 50-ml polypropylene round-bottomed tube (Iwaki, Tokyo), washed with TES buffer (20mM Tris-HCI [pH 8.01 and 100 mM EDTA [pH 8.01, 50 mM NaCI), and resus-
* Corresponding author. e-mail: [email protected] phone: +81-(0)29-861-8767 fax: +81-(0)29-86 I-6587
pended in I ml of the same buffer. To this sample, I g of beads 70
Vor.. 96.2003
THE MICROBIAL
(0.1 O-O. 11-mm diameter; El. Braun Biotech International, Melsungen, Germany) was addled, and the mixture was beaten three times for 10 min each time, using a bead beater (B. Braun Biotech International) at 2000 rpm. Then, 2 mg of lysozyme per ml were added, and the samples were then incubated for 30min at 37°C. Subsequently, 50 pg of proteinase K per ml and 0.2 ml of 10% SDS were added, followed by incubation for 1 h at 30°C and an additional 10 min at 65°C. DNA was obtained from the lysate using standard phenol-chloroform extraction and ethanol precipitation procedures (10). RNA was removed by incubating the aqueous solution with 5 U of DNase-free RNase (Toyobo, Tokyo) for 30 min at 37°C. The extracted DNA was finally dissolved in 50 ul of distilled water. The concentration of extracted DNA was confirmed by visualization on an agarose gel (1% agarose, 1 xTrisacetate-EDTA [TAE], 40mM Tris, 40 mM acetic acid, 1 mM EDTA, pH 8.0) and by staining with 5 pg/ml ethidium bromide. PCR amplification of 16s rRNA genes from reactor DNA PCR amplification was performed using a 9700 thermal cycler (PE Biosystems Japan, Tok.yo). The PCR mixture contained 0.5 pM of each primer, 200 uM of each deoxynucleotide triphosphate, 10x reaction buffer, 2.5 U of Ex Taq DNA polymerase (Takara, Tokyo), and DNase- and RNase-free filter-sterilized water (Sigma-Aldrich Chemie, St. Louis, USA) to achieve a final volume of 50 ~1. For construction of the 16s rDNA clone library, the 16s rRNA genes from the reactor DNA were amplified by PCR using primers corresponding to bases 8-27 (5’-AGAGTTTGATCCTGG CTCAG-3’) and 1542-l 525 (5’-AAGGAGGTGATCCAGCC-3’) (Escherichiu coli numbering) (11). PCR was performed under the following conditions: initial denaturation at 94°C for 3 min; 25 cycles of 94°C for 1 min, 50°C for 1 min, and 72°C for 2 min; and a final extension at 72°C for 10 min. For analysis of the 16s rDNA clone library, the 16s rRNA genes were amplified by PCR using Ml3 primers. PCR was performed under the following conditions: initial denaturation at 94°C for 5 mitt; 25 cycles of 94°C for 1 min, 60°C for 1 mitt, and 72’C for 3 min; and a final extension step at 72°C for 10 min. For denaturing gel electrophoresis (DGGE) analysis, touchdown PCR was performed under the conditions described previously with PCR primers F968GC (5’-CGCCCGGGG CGCGCCCCGGGCGGGGCGGGGGCACGGGGGAACGCGA AGAACCTTAC-3’) and R1401 (5’~CGGTGTGTACAAGACCC3’) (12). PCR products were run on an agarose gel (2% agarose, I xTAE) and stained with 5 l&ml ethidium bromide. A positive control with purified genomic DNA and a negative control without added DNA were included in all PCR reactions. DGGE analysis DGGE analysis was performed using the Dcode System (Bio-Rad, Tokyo). PCR samples were loaded onto 10% (wt/vol) polyacrylamide gels in 1 x TAE and run for 2.5 h at I50 V by using a linear denaturation gradient ranging from 40% to 65%. After the electrophoresis, the gels were soaked in a 50 ugiml ethidium bromide solution for 15 min then photographed on a UV transillumination table. For sequence determination of DGGE bands, small gel pieces were excised from the acrylamide gel and DNA was eluted overnight :at 37°C in a sterile tube containing 5 pl of Tris-EDTA buffer (pH 7.5). The elutant was centrifuged briefly to pelletize the acrylamide fragments. Two pl of the supernatant was used as a template for a re-amplification PCR using the F968GC and R1401 primers and the reaction conditions described above. The PCR products were then cloned into a TA cloning vector pCR’ 2.1 (Invitrogen, Carlsbad, CA, USA), and the plasmid constructed was subjected to sequence reactions. Construction of the 16s rDNA clone library Amplified 16s rDNA fragments were cloned into the TA cloning vector. Ligation and transformation into E. coli INVa’ competent cells were carried out according to the manufacturer’s protocol. Determination of nucleotide sequences and phylogenetic analysis Plasmid templates for DNA sequencing were prepared
COMMUNITY
IN 2,4-DNP-DIGESTmG
REACTOR
71
using a QIAGEN mini-kit (Qiagen, Hilden, Germany). The sequences were processed using a model 373 Stretch PE Biosystems automated sequencer (PE Biosystems). To detect potential chimerit artifacts in the partial sequences of the 3’ end and the 5’ end, partial sequences around 500 bases long were examined with the CHECK-CHIMERA tool of the Ribosomal Database Project (13, 14). Database searches were conducted using the BLAST program with the GenBank Database. The sequences determined in this study and those retrieved from the databases were aligned using Clustal W, ver. 1.8 (15). The alignments were refined by visual inspection. A neighbor-joining tree (16) was constructed using the njplot software in Clustal W, ver. 1.8. Nucleotide positions at which any sequence had a gap or an ambiguous base were not included in the calculations. Clones that had similar (
RESULTS DGGE analysis of the reactor microbial community DGGE of partial 16s rDNA fragments (433 bp) that were PCR amplified from sample DNA was conducted to analyze the bacterial community in the reactor (Fig. 1). This analysis by DGGE revealed that one strong and five minor bands were observed in the DGGE profile. Excision, re-amplification, and cloning of the major DNA band, and a comparison of the DGGE profile of the sample with the DGGE profile of the individual clones was performed (data not shown). Two well-represented clone types, which produced a band that co-migrated with the intensely stained DGGE band (Fig. 1A) in the community DNA, were identified. Sequencing of the clones showed that it was closely related to sequences of Rhodococcus koreensis (GenBank accession no. AF124342) (97% identity, 433 bp) and Nocardioides simplex FJ21-A (94% identity, 433 bp). In addition, one clone type, which produced a band that co-migrated with the band
72
KIMURA E’l’ Al
J. ~IOSCI.
-
+N.mowovienso (~F155152,wx) +R.hyremis (AF124342,97%) N.srm&xFJ21-A (U27&%.94%)
FIG. I. DGGE separation patterns (A) and a schematic representation (B) of the 16s rDNA fragments obtained after PCR of DNA extracts from a 2,4-DNP-digesting reactor. The GenBank, EMBL, and DDBJ accession numbers and identity with the sequences of the close relatives are given in parentheses.
(Fig. IS) in the community DNA, was identified. Sequencing of the clone showed it was closely related to sequences of Nitrospira moscoviensis (GenBank AF 155 152) (97% identity). Sequence analysis of the cloned 16s rDNA library Thirty-seven clones were partially sequenced to investigate the relationships among the environmental clones. Approximately 600 bp, extending from position 8 to position 600 with reference to the E. coli 16s rDNA sequence, were sequenced. The average length of these sequences was 687 bp, ranging from 496 to 741 bases. The similarity values of the clone sequences to the database sequences ranged from 87% to 99%. The distribution of the 37 clones into the bacterial divisions and the phylogenetic positions are given in Fig. 2 and Table 1, respectively. Some of the clones had sequences highly homologous to the 16s rDNA sequence anaTABLE Taxonomic group (number of OTUs) (3)
lyzed, differing from it by less than 1%. We assumed that such slight dissimilarity would probably not justify the delinition of a separate species (19), and therefore combined clones with < 1% dissimilarity into the same OTU. We found sequences belonging to six of the currently recognized bacterial divisions. The largest number (21 clones; 59.5%) in one division belonged to the Actinobacteriu lineage. The minor groups in the library represented the a subclass of Proteobacteria (8.1% of total clones), the CytophagalFlexibacterlBacteroides (8.1%). Verrucomicrobia (8.1%) Nitrospira group (5.4%). and 6 subclass ot Proteobacteria (5.4%). In the Actinobacteriu class, three OTUs were observed in the clone library. Among these OTUs, one was identified to be a close (99% similarity) relative of R. koreensis (GenBank AF124342), which was previously isolated as a 2,4-DNP-degrading bacterium (20). Furthermore, one OTU was identified to be a relative (94% similarity) of N. simplex FJ2 1-A (GenBank U27856), which was previously isolated as a picric acid as well as a 2,CDNP-degrading bacterium (21), and the other was identified to be a relative (89% similarity) of Sphaerobacter thermophilus (GenBank AJ420142). Two OTUs were found in the c1 subclass of Proteobacteria in the clone library. One OTU (NKT191) was identitied to be a close (99% similarity) relative of Nitrobactor sp. (GenBank L 11662), and the other (NKT2 13) was identilied to be a relative of the Blastchloris sulfoviridis strain GNl (GenBank AB033757), which is known to be a phototrophic bacterium (22). We observed two OTUs in the CytophagalFlexibacterl Bacteroides class from the clone library. One OTU (NKT202) was identified to be a relative (92% similarity) of Flavobacterium ferrugineum (GenBank M62798), and the other (NKT192) to be a relative (87% similarity) of Cytophaga sp. T-561 (GenBank AB073591). In addition, we observed one OTU (NKT207) in the Nitrospira group, which, at 98% similarity, was most similar to Nitrospira moscoviensis (GenBank AF155 152) (23). Furthermore, we observed one OTU (NKT2 10) in the 6 subclass of Proteobacteria, which was identified to be a relative (89% similarity) of Geobacter sulfurreducens (GenBank Ull3928). Based on the results of the 16s rDNA library analysis, we estimated that there was diversity in the
1. Phylogenetic distribution of the 16s rDNA PCR clones examined at the division level OTU”
NKT198 NKTZO 1 NKT196 a-Proteobacteria (2) NKT213 NKTlYl CFB group (2) NKT202 NKT192 NKT193 Verrucomicrobia (2) NKT205 S-Proteobacteria (1) NKT210 Nitrospira ( 1) NKT207 Unclassitible (2) NKT23 1 NKT238 a OTU, Operational taxonomic unit. Actinobacteriu
t%lOl hc,
Number of clones 11 IO I 2
I 2
I 2 I 2 2 1 1
Closest relative R. koreensis (AFI 24342) N. .sitnplex FJ2 I -A (U27859) S thermophilus (AJ420 142) B. sulfbviridis GN 1 (AB033757) Nitrobactor sp. (L11662) F,ferrugineum (M62798) Cyiophugu sp. T-561 (AB073591) Uncultured Verrucomicrobia bacterium (AF35 12 15) Uncultured Verrucomicrobia bacterium (AF46565 1) G sulfurreducens (U113928) N. moscoviensis SBR1015 (AF155152) Uncultured sludge bacterium (AF234733) Llncultured bacterium mle-48 (AF280867)
Homology (“/I 99 94 88 93 99
92 87 95 91 89 98 94 96
THE MICROBIAL
VOL. 96,2003
935
COMMUNITY
IN 2,4-DNP-DIGESTING
REACTOR
-
NKT192
1
Cyrophaga
73
sp. T-561
(ABO73591) CFB
Flavobacterium
VP
ferrugneum
(M62798)
Nibwpimgroup
L.N~trospwa
moscoviensrs
SBRlOlS
(AF15.5152)
3! Ve-microbia group
I
58
rNKT238
I
lhmhrcd
lrn
bacterium mlea
r--Un;wed
(AF280867)
sludge bacterium
S14 (AF234733)
NKT210
8 -PMteobaet& Geobacter loo0 I
sulfurreducens
(U I 13928)
NKT198 Rhodococcus
LrnTrn’
koreensis
(AF124342)
ACti?WhUi&
Nocardioldes
simplex
FJ21-A
(U278.56)
NKTl% 990
I
I
Sphaerobacrer Aqufex
thermophllus pyrophilus
(AJ420142)
(Mt33548,
outgroup)
FIG. 2. Neighbor-joining tree representing the phylogenetic relationships of 16s rDNA sequences from 2,4-DNP-digesting reactor samples and various closely related clones and isolate sequences obtained from BLAST searches. The scale indicates genetic distance. NKT represents the clones.
phylotypes of the bacterial members within the reactor. The remaining four OTUs (13.5% of total clones) were closely related to uncultured bacteria from other environmental libraries. Among these remaining OTUs, the sequence of two OTUs, NKT193 and NKT205 were similar to the published sequences of two Verrucomicrobia bacteria
with GetBank accession nos. AF35 12 15 and AF46565 1, respectively. Two cloned sequence types (NKT231 and 238) were not closely affiliated with any described bacterial divisions. Isolation of 2,4-DNP-degrading bacteria from the reactor To further characterize the bacterial community
74
KlMllKA
L’I AI
detected by the molecular method, we attempted to isolate 2,4-DNP-degrading bacteria from the reactor. Approximately two hundred strains were isolated from the reactor and their phylogenetic properties were examined. As a result, all isolated strains were classified into one of two types having different 16s rDNA sequences. One representative strain, strain D32, was identified as a relative of/L’. simplex based on the 16s rDNA sequences. Strain D32 had 99% 16s rDNA sequence similarity to the sequence of clone NKT201, which was the most abundant clone in the 16s rDNA library. Furthermore, strain E22 was identified as a relative of R. koreensis based on the 16s rDNA sequences. Strain E22 which had 99% 16s rDNA sequence similarity to that of clone NKT198, was the second-most abundant clone in the 16s rDNA library. Furthermore, strains D32 and E22 had 16s rDNA sequences identical to the sequences of the major band in the DGGE profile. DlSCUSSlON Phylogenetic analysis using the clone sequences suggested that there was microbial diversity among the six main divisions, Actinohacteria, the ct and 6 subclasses of the Proteobacteriu, the CytophagalFIexihacterlBacteroides group, Verrucomicrobia, and Nitrospira, in the reactor (Fig. 2 and Table 1). The bacteria in the reactor appeared to be comprised of Rhodococcus and Nocardioides species on the basis of our results. The results obtained by DGGE analysis corresponded to those of clone sequencing analysis. Furthermore, two types of 2,4-DNP-degrading bacteria, belonging to the genera Rhodococcus and Nocurdioides, were isolated from this reactor. Several studies on the microorganisms that degrade 2,4-DNP have been reported (2428). With one exception, only Actinohucteriu have been reported to degrade 2,4-DNP. One possible explanation for this is that Actinobucteria are likely to tolerate the uncoupling property of 2,4-DNP because of their thick cell envelope (29), and cofactor F,,,, which is involved with the metabolite of 2,4-DNP, has been described only in archaea. cyanobacteria, and Actinohucteriu (30, 3 1). Accordingly. these bacterial species may play a role in the degradation of 2,4-DNP in this reactor. The results of 16s rDNAs clone analysis revealed that there were clone sequences similar to the 16s rDNA sequences of N. moscoviensis and Nitrobactor sp. known as nitrite-oxidizing bacteria (32, 33). It has been found that nitrite is released into the culture fluid as a by-product during 2,4-DNP degradation. Therefore, there is a possibility that these nitrite-oxidizing bacteria play a role in the transformation of nitrite to nitrate. Furthermore, based on the fact that the ingredients in the feed included urea as a nitrogen source, there is a possibility that an ammonia oxidation pathway was present in the reactor. On the basis of these results, the composition of the microbial community in the reactor was being driven by two factors; 2,4-DNP and urea. The role of other bacteria in the reactor is unclear. However, these bacteria may be able to tolerate the toxicity of 2,4DNP. Two cloned sequence types were not closely affiliated with any described bacterial divisions (Fig. 2 and Table 1).
2 2”T/ 2 ::c 1s.
,c-‘.--,,y
G
F$ IO9 ‘ZY / m 5 3 /’ E c’ Go&. 0 5
IO
IS
20
Prediction line for the clones
25
30
3s
40
45
50
5s
60
Number of clones sequenced PIG. 3. Cumulative operational taxonomic units represented h) 16s rDNA libraq clones obtained from the 2,4-DNP-digesting reactor. The plots were fitted to a parabolic equation Y=AX/(B+X) with a=23.6 and h= 17.2.
Furthermore, the maximum similarity of four clones to known sequences was below 90%. Because of the difficulties in translating rDNA similarity values into nomenclatural divergence, it was suggested that similarity values to known sequences below 95% be regarded as evidence of the discovery of a novel species (34). Therefore, there may have been unidentified bacteria in the reactor. The 2,4-DNP digesting reactor contained bacteria exhibiting at least 13 different 16s rDNA sequences. From the cumulative number of different sequences plotted against the number of clones, we could estimate the expected numbers of phylotypes by using the method of Sekiguchi et al. (35) (Fig. 3). According to the calculations, the possible total number ot sequences was estimated to be approximately 24 for the reactor. In this study, we investigated the microbial community in a 2,4-DNP-digesting reactor by using two different techniques to eliminate technical bias: cloning-assisted analysis and DGGE of amplified 16s rDNA gene fragments. Isolated 2,4-DNP-degrading strains, D32 and E23, had 16s rDNA sequences corresponding to the sequences in the DGGE band and the 16s DNA clone sequence. On the basis of these results, we could detect a member of the microbial community in the reactor by using the 16s rDNA sequence. However, 16s rDNA sequence fragments of Rhodococcus sp. and Nocardioides sp. were found by DGGE analysis to have co-migrated. A possible explanation is that these fragments were not identical, but had similar sequences. Although the DGGE method proved to be excellent for distinguishing close relatives, the co-migration of a few nonidentical fragments was reported (36). This is a possible reason why the number of bands on the DGGE gel did not reflect the number of different sequences in the 16s rDNA clone library. Therefore, we believe that unknown genotypes and phenotypes, which would only be detectable using more refined technologies, may have been present in the reactor. ACKNOWLEDGMENTS We vided Suwa, of this
greatly appreciate the excellent technical assistance proby Tomoko Kimura. We would also like to thank Yuichi Yasutoshi Matsui, and Fumio Yamaguchi for their support work.
THE MICROBIAL
VOL. 96.2003
REFERENCES 1. Hanstein, W. G.: Uncoupling of oxidative phosphorylation. Biochem. Biophys. Acta, 456, 129-148 (1976). 2. Alberts, B., Bray, D., Lewis, L., Raff, M., Roberts, K., and Watson, J. D.: Molecular biology of the cell, 2nd ed. Garland, New York (1989). 3. Bruhn, C., Lenke, H., and Knackmuss, H. J.: Nitrosubstituted aromatic compounds as a nitrogen source for bacteria. Appl. Environ. Microbial., 53,208-210 (1987). 4. Keith, L. H. and Telliard, W. A.: Priority pollutants. 1. A perspective view. Environ. Sci. Technol., 13,416423 (1979). 5. Gisi, D., Stucki, G., and Hanselmann, W.: Biodegradation of the pesticide 4,6-dinitro-ortho-cresol by microorganisms in batch cultures and in fixed-bed column reactors. Appl. Microbiol. Biotechnol., 48441448 (1997). 6. Hess, T. F., Schmidt, ,S.K., Silverstein, J., and Howe, B.: Supplement substrate enhancement of 2,4-dinitrophenol mineralization by a bacterial consortium. Appl. Environ. Microbiol., 56, 1551-1558 (1990). 7. Xing, X. H., Inoue, T., Tanji, Y., and Unno, H.: Enhanced microbial adaptation to p-nitrophenol using activated sludge retained in porous carrier particles and simultaneous removal of nitrite released from degradation of p-nitrophenol. J. Biosci. Bioeng., 87, 372-377 (1999). 8. Xing, X. H., Shiragami, N., and Usami, S.: Simultaneous removal of carbonaceous and nitrogenous substances in wastewater by a continuous-flow fluidized-bed bioreactor. J. Chem. Eng., Jpn., 28, 5~25-530 (1996). 9. Takahara, M. (ed.): Biological treatment of waste water. Chikyusya, Tokyo (1980). (in Japanese) IO. Sambrook, J., Fritsch, E. F., and Maniatis, T.: Molecular cloning, a laboratory
REACTOR
75
89,396-399(2000). 23.
Burrell, P. C., Keller, J., and Blackall, L. L.: Microbiology of a nitrite-oxidizing bioreactor. Appl. Environ. Microbial., 64, 1878-1883
(1998).
Blasco, R., Moore, E., Wray, V., Pieper, D., Timmis, K., and Castillo, F.: 3-Nitroadipate a metabolic intermediate for mineralization of 2,4-dinitrophenol by a new strain of Rhodococcus species. J. Bacterial., 181, 149-l 52 (1999). 25. Cassidy, M. B., Lee, H., Trevors, J. T., and Zablotowicz, R.B.: Chlorophenol and nitrophenol metabolism by Sphingomonus sp. UG30. J. Ind. Microbial. Biotechnol., 23, 232241 (1999). 26. Lenke, H., Pieper, D., Bruhn, C., and Knackmuss, H. J.: Degradation of 2,4-dinitrophenol by two Rhodococcus erythlopolis strains, HL24-1 and HL24-2. Appl. Environ. Microbial., 24.
58,2928%2932(1992).
Walters, D. M., Russ, R., Knackmuss, H. J., and Rouviere, P. E.: High-density sampling of a bacterial operon using mRNA differential display. Gene, 273, 305-3 15 (2001). 28. Zablotowicz, R. M., Leung, K. T., Alber, T., Cassidy, M. B., Trevors, J. T., Lee, H., Veldhuis, L., and Hall, J. C.: Degradation of 2,4-dinitrophenol and selected nitroaromatic compounds by Sphingomonas sp. UG30. Can. J. Microbial., 45,840-848( 1999). 29. Sutcliffe, I. C.: Cell envelope composition and organization in the genus Rhodococcus. Antonie Van Leeuwenhoek., 74, 27.
49-58 30.
3 1.
32.
33.
34.
35.
55,245-256(1966).
19. Stackebrandt, E. and Goebel, B. M.: Taxonomic note: a place for DNA-DNA reassociation and 16s rRNA sequence analysis in the present species definition in bacteriology. lnt. J. Syst. Bacterial., 44, :846-849 (1994).
IN 2,4-DNP-DIGESTING
20. Yoon, J. H., Cho, Y. G., Kang, S. S., Kim, S. B., Lee, S. T., and Park, Y. H.: Rhodococcus koreensis sp. nov., a 2,4-dinitrophenol-degrading bacterium. Int. J. Syst. Evol. Microbial., 50, 1193-1201 (2000). 21. Rajan, J., Valli, K., Perkins, R. E., Sariaslan, F. S., Barns, S.M., Reysenbach, A.L., Rehm, S., Ehringer, M., and Pace, N. R.: Mineralization of 2,4,6-trinitrophenol (picric acid): characterization and phylogenetic identification of microbial strains. J. Ind. Microbial., 16, 319-324 (1996). 22. Sawayama, S., Hanada, S., and Kamagata, Y.: Isolation and characterization of phototrophic bacteria growing in lighted upflow anaerobic sludge blanket reactor. J. Biosci. Bioeng.,
(1987).
17. Kimura, N., Shinozaki, Y., Suwa, Y., and Urushigawa, Y.: Phylogenetic and phenotypic relationships of microorganisms that degrade an uncoupler compound, 2,4-dinitrophenol. J. Gen. Appl. Microbial., 46, 317-322 (2000). 18. Pfennig, N. and Lippert, K. D.: Uber das Vitamin B,,Bedtirfnis phototropher Schwefelbakterien. Arch. Mikrobiol.,
COMMIJNITY
(1998).
Daniels, L., Bakbiet, N., and Harmon, K.: Widespread distribution of a 5-deazaflavin cofactor in Actinomycetes and related bacteria. Syst. Appl. Microbial., 6, 12-I 7 (1985). Purwantini, E., Gillis, T. P., and Daniels, L.: Presence of Faz,-dependent glucose-6-phosphate dehydrogenase in Mycobacterium and Nocardia species, but absence from Streptomyces and Corynebacterium species and methanogenic Archaea. FEMS Microbial. Lett., 146, 129-l 34 (1997). Ehrich, S., Behrens, D., Lebedeva, E., Ludwig, W., and Bock, E.: A new obligately chemolithoautotrophic, nitriteoxidizing bacterium, Nitrospira moscoviensis sp. nov., and its phylogenetic relationship. Arch. Microbial., 164, 16-23 (1995). Bock, E. and Koops, H.-P.: The genus Nitrobacter and related genera, p. 2302-2309. In Balows, A., Trtiper, H. G., Dworkin, M., Harder, W., and Schleifer, K.-H. (ed.), The prokaryotes, 2nd ed. Springer-Verlag, New York (I 992). Amann, R. I., Ludwig, W., and Schleifer, K. H.: Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbial. Rev., 59, 143-169 (1995). Sekiguchi, Y., Kamagata, Y., Syutsubo, K., Ohashi, A., Harada, H., and Nakamura, K.: Phylogenetic diversity of mesophilic and thermophilic granular sludges determined by 16s rRNA gene analysis. Microbiology, 144, 2655-2665 (1998).
36.
Sekiguchi, H., Tomioka, N., and Nakahara, T.: A single band does not always represent single bacterial strains in denaturing gradient gel electrophoresis analysis. Biotechnol. Lett., 23, 1205-1208 (2001).