The modifying effects of fish oil on fasting ghrelin mRNA expression in weaned rats

Gene 507 (2012) 44–49

Contents lists available at SciVerse ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

The modifying effects of fish oil on fasting ghrelin mRNA expression in weaned rats Atoosa Saidpour a, Masoud Kimiagar b, Saleh Zahediasl c,⁎, Asghar Ghasemi c, Mohamadreza Vafa d, Alireza Abadi e, Maryamsadat Daneshpour f, Maryam Zarkesh f a

Cellular and Molecular Nutrition Dep, Shahid Beheshti University of Medical Sciences, Tehran, Iran Dep Clinical Nutrition & Dietetics, Shahid Beheshti University of Medical Sciences, Tehran, Iran Endocrine Research Center, Research Institute for Endocrine Sciences, Shahid Beheshti University of Medical Sciences, Tehran, Iran d School of Public Health, Tehran University of Medical Sciences, Iran e Dep Statistic, Shahid Beheshti University of Medical Sciences, Tehran, Iran f Obesity Research Center, Research Institute for Endocrine Sciences, Shahid Beheshti University of Medical Sciences, Tehran, Iran b c

a r t i c l e

i n f o

Article history: Accepted 12 July 2012 Available online 25 July 2012 Keywords: Fish oil Olive oil Acyl ghrelin Total ghrelin mRNA expression

a b s t r a c t Ghrelin expression and secretion seem to be influenced by the fat content of the diet. However, data on the probable adverse effect of high fat diet (HFD) with different dietary fats and saturation level of fatty acids is inconclusive. This study aimed at investigating the effects of HFDs on fasting total and acyl-ghrelin plasma levels, gastric fundus and duodenum ghrelin mRNA expressions. Weaned Wistar rats (n=50) were randomly divided to five groups of HFDs with fish oil (HF-F), olive oil (HF-O), soy oil (HF-S), butter (HF-B) and the controls. After 8 weeks, blood samples were collected. While the animals were fasting for 24 h, their blood and tissue samples were obtained. Plasma parameters of total and acyl ghrelin and ghrelin mRNA expression level in stomach and duodenum were measured. The HF-B fed group had lower fasting plasma acyl ghrelin level than the control, HF-F and HF-O groups (P b 0.05); furthermore, the HF-F group had significantly higher acyl ghrelin level than the HF-S one (P b 0.05). After feeding, all the groups, except for the HF-B one, had a significantly lower plasma acyl ghrelin levels (P b 0.05), compared with the fasting state. Ghrelin mRNA expression levels in the gastric fundus and duodenum were significantly lower in the HF-B as compared to the control group. Furthermore, the HF-F group had significantly higher mRNA level in the duodenum, in comparison with the HF-B and HF-S groups. As HF-F and HF-O diets had the highest stimulatory effect on fasting ghrelin expression and plasma level, consumption of these dietary oils can play an important role in ghrelin regulation, which might affect feeding behavior and energy intake. © 2012 Elsevier B.V. All rights reserved.

1. Introduction Ghrelin, known as an orexigenic peptide, is a 28-amino acid peptide with a unique fatty acid modification on its N terminal (Kirchner et al., 2010). Octanoyl modification of acyl ghrelin seems

Abbreviations: AIN93-G, The American Institute of Nutrition Rodent Diets -Growth purified diet; TBHQ, Tert-butylhydroquinone; ELIZA, enzyme-linked immunosorbent assay (ELISA); EDTA, ethylenediaminetetraacetic acid; PCR, polymerase chain reaction; cDNA, DNA complementary to RNA; Ct, The threshold cycle; (HSD), Tukey's honestly significant difference; ANOVA, analysis of variance; n-3 PUFA, ω-3 poly unsaturated fatty acid (PUFA); MUFA, mono saturated fatty acid (MUFA); SFA, saturated fatty acid (SFA); GI hormones, Gastrointestinal hormones; HFD, High Fat Diets; HF-F, high fat diet with fish oil; HF-O, high fat diet with olive oil; HF-S, high fat diet with soy oil; HF-B, high fat diet with butter. ⁎ Corresponding author at: Tehran, Iran, PO Box 19195–4763. Tel.: +98 2122432513; fax: +98 2122402463. E-mail addresses: [email protected] (A. Saidpour), [email protected] (M. Kimiagar), [email protected] (S. Zahediasl), [email protected] (A. Ghasemi), [email protected] (M. Vafa), [email protected] (A. Abadi), [email protected] (M. Daneshpour), [email protected] (M. Zarkesh). 0378-1119/$ – see front matter. © 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.gene.2012.07.015

to be required for all biological functions of ghrelin, in vivo and is the only form which can stimulate food intake (Hosoda et al., 2000; Kojima et al., 1999). The ghrelin gene encodes a precursor protein, preproghrelin, from which ghrelin and other potentially active peptides are derived by alternative mRNA splicing and/or proteolytic processing (Seim et al., 2010). Ghrelin was originally isolated from stomach and had the highest levels of ghrelin gene expression; however, it has been also expressed at lower amounts in the small intestine and has been detected at very low levels in other tissues including the liver, pancreas and the pituitary (Kojima et al., 1999). It is documented that some nutrients can influence mRNA expression and secretion of gastrointestinal (GI) hormones and can regulate food intake in interaction with the nervous system (Kojima et al., 1999). Among gastrointestinal hormones affecting food intake and energy balance, ghrelin plays an essential role (De Vriese et al., 2010; Huawei et al., 2007). Ghrelin has been identified as an endogenous ligand of the growth hormone secretagogue receptor (GHS-R) and it has been recently found that it can be implicated in long term energy homeostasis and acute meal initiation (Moran et al., 2005). Although the fasting state and its duration also have important effects on

A. Saidpour et al. / Gene 507 (2012) 44–49

ghrelin secretion and expression, they have been rarely investigated (Moesgaard et al., 2004; Sanchez et al., 2004). The metabolic effects of dietary fats vary based on fat content, fatty acid composition, duration of intervention and individual differences (German and Dillard, 2004). In rodents, a chronic exposure to high fat diets (HFD) leads to a positive energy balance, obesity and reduction of ghrelin synthesis and its secretion from the stomach (Lee et al., 2002). Data reveals that HFDs containing polyunsaturated omega-3 (ω-3 PUFA) fatty acids exert beneficial effects on energy homeostasis, insulin sensitivity and obesity; all of which are indicators of a ghrelin action (Flachs et al., 2006). Despite consistent findings regarding the reducing effect of HFD on ghrelin, a direct comparison of the effects of different HFDs based on a main fatty acid subtype in ghrelin expression and secretion during the growing period has not been documented yet. In a previous study of ours, it was shown that based on main fatty acid subtype, HFDs were associated with fasting plasma des-acyl ghrelin (another circulating form of ghrelin) concentrations, weight gain, food intake, insulin concentration and insulin resistance (Saidpour et al., 2011). It has been also suggested that developmental stages play a critical role in energy homeostasis, body weight gain and hormonal status in humans (Chiras, 2011). In this study, the effects of HFDs with different types of fat and their fatty acid composition were investigated on body weight, energy intake, fasting and fed plasma ghrelin concentrations and gastric fundus and duodenum ghrelin expression in growing rats.

2. Material and methods 2.1. Dietary manipulation Diets were prepared by mixing appropriate portions of three commercial chows based on The American Institute of Nutrition Rodent Diets-Growth purified diet (AIN93-G) (Reeves, 1997): Carbohydrate (corn starch, dextrinized corn starch, sucrose; Dyets Inc, USA); protein (98.5 % casein hydrolisate and 1.5%L-cystine; choline Bitartrate, Dyets Inc, USA); lipids (fish and olive oils were generous gifts from the Nooshdarooye Darya Institute; soy oil was purchased from Ladan Institute and butter was locally obtained); fiber (cellulose, Dyets Inc, USA) and vitamin mix, mineral mix; Tert-butylhydroquinone (Dyets Inc, USA) to provide a balanced diet. The compositions of the experimental diets are given in Table 1. The diets were stored at −20 °C.

45

2.2. Experimental design Weaned male Wistar rats (n = 50, Pasteur Institute, Iran), 4 week old (weighing 35.2 ± 2.5 g) were used in this study. The animals were allowed 1 week of acclimatization in a standard environment (22 °C, 50% humidity and 12-h light/dark cycle) and had ad libitum access to the standard diet and tap water. Rats were randomly divided to five groups (n = 10 per group). Each dietary group received an equal calorie count (3.89 kcal/g food weight) of one of the four HFDs, based on AIN93-G (Reeves, 1997): HFDs with soy oil (HF-S); fish oil (HF-F); with olive oil (HF-O) and with butter (HF-B). The standard diet (controls) was the same as the AIN93-G Growth Purified Diet and soy oil was used as a dietary fat source. Animals were fed ad libitum every two days and their individual food intakes and body weights were recorded once a week on Saturdays, at 9:00 am. The body weight and food intake was measured by digital scale with 0.01 accuracy. Blood samples were collected at 4:00 pm in freely fed status and again 24 h after fasting. All experiments were carried out in accordance with the protocols approved by the local ethics committee of the Research Institute for Endocrine Sciences of Shahid Behesti University of Medical Sciences. 2.3. Plasma ghrelin assays Total plasma ghrelin level was measured using an enzyme-linked immunosorbent assay (ELISA) method (USCN Life Science Inc. Wuhan, China). Assay sensitivity was 15.6 pg/ml and the intra- and inter-assay coefficients of variation were 4.8% and 8.1 %, respectively. Plasma des-acyl ghrelin was also measured by the ELISA assay (Mitsubishi Kagaku Iatron, Inc) and the intra and inter-assay coefficients of variation were 5.2% and 9.1 %, respectively. Acyl ghrelin was measured by subtracting total ghrelin from des-acyl ghrelin. 2.4. Obtaining tissue and blood samples After 8 weeks of feeding, before and 24 h after fasting, following a light anesthesia with CO , blood samples were collected from the retro-orbital veins into polypropylene tubes containing sodium EDTA (1-mg/ml blood) and aprotinin (500-unit/ml blood, Bayer); they were then centrifuged for 15 min (3000 ×g at 4 °C) and plasma was stored at − 70 °C for further measurements. Tissue samples collected from the gastric fundus and the duodenum were dipped in liquid nitrogen and stored at − 70 °C for further real-time PCR analysis. The data collection was carried out in winter. 2.5. Real-time quantitative PCR

Table 1 Composition of the diets. Standard dieta

Experimental dietsb

Ingredients

g/kg (%)

g/kg (%)

Corn starch Casein hydrolysate (95%) Dextrinized corn starch Sucrose Vegetable and butter or fish oil Fiber Mineral mix (AIN93-G) Vitamin mix (AIN93-G) L-Cystine Choline Bitartrate (41.1% choline) Tert-butylhydroquinone Totals (g/kg) Diet % kcal/kg Kcal/g

397.49 (39.7) 200 (20) 132 (13.2) 100 (10) 70 (7) 50(5) 35 (3.5) 10 (1) 3 (0.3) 2.5 (0.25) 0.01 (0.001) 1000 (100)

214.92 (21.4) 145.87 (14.5) 71.37 (7.13) 50.07 (5) 216 (21.6) 247.24 (24.7) 35 (3.5) 10 (1) 3 (0.3) 2.5 (0.25) 0.01 (0.001) 1000 (100)

3890 3.89

3890 3.89

a Standard diet (SD) based on The American Institute of Nutrition Rodent Diets (Growth purified diet) with soy oil. b High fat diets (HFD) with soy, fish, olive oils or butter.

Total RNA was extracted from the 50 gastric fundus and 50 duodenum samples using the RNX-Plus solution kit (Fermentase, Cinagen Co. Iran) according to the manufacturer's instructions. For the synthesis of cDNA, 1 μl of total RNA was reverse transcribed using a RevertAid M-MuLV reverse transcriptase and random hexamer primers. For the ghrelin gene real-time PCR, primers were chosen from ghrelin gene using Genrunner Software, version 3.05. The primer pairs were ghrelin F: 5′ CAGAGGAGGAGCTGGAAATCA 3′, ghrelin R:5′ TGCTGGTACTGAGCTCCTGAC A3′, and β-actin F: 5′ TCTTTAATGTCACGCACGATT 3′, β-actin R: 5′ TCACCCACATGTGCCCAT 3′. To establish the efficiency of primers, five-fold serial dilutions of a cDNA which contained transcripts from both ghrelin and β-actin (1, 1/5, 1/25, 1/125 and 1/625) were prepared and the efficiency was obtained as 0.9. For real-time PCR, a master mix of 20 μL containing 12.5 μL SYBR Green PCR Master Mix, 1 μL forward primer (300 nM), 1 μL reverse primer (300 nM), and 8.5 μL water, was

46

A. Saidpour et al. / Gene 507 (2012) 44–49

prepared to perform the real-time PCR. Two micro liters of the standard curve dilutions or cDNA were added to the PCR Master Mix for obtaining a final volume of 25 μL. The PCR protocol was used on the Rotor-Gene 3000 real-time PCR machine (Corbett Research, Sydney, Australia) with initial denaturation (3 min at 95 °C) and then a two-step amplification program (15 s at 95 °C followed by 60 s at 62 °C) was repeated 40 times. Real-time quantification was monitored by measuring the fluorescence activity. Dissociation was performed by slowly heating the samples from 60 to 95 °C and continuous recording of the decrease in SYBR green fluorescence. The threshold cycle (Ct) which is defined as the cycle at which an increase in fluorescence above a defined baseline can first be detected was determined for each sample. ghrelin mRNA levels were estimated on the basis of PCR efficiency and Ct deviation of an unknown sample versus a control according to the equation proposed (Pfaffl, 2001) for this analysis. Β-Actin was chosen as a reference gene and the results were expressed as the ghrelin gene mRNA ratio to β‐Actin. Each PCR run included no template control and replicates of control and experimental samples. For inter assay control, the runs were performed in triplicate.

(p b 0.05). The animals receiving HF-B were heavier than those consuming HF-O and HF-F diets (p b 0.05); on the other hand, final weights of these groups were lower than those of the HF-S group (P b 0 05).

2.6. Statistical analysis

The animals fed with control, HF-F and HF-O diets showed higher plasma acyl ghrelin concentrations than the animals fed with the HF-B diet after 24 h of fasting (p b 0.05) (Fig. 1). Meanwhile, fasting plasma acyl ghrelin levels in the HF-S diet was lower than those in the control and HF-F diet groups, (p b 0.05). The control diet, HF-F and HF-O diets increased fasting total ghrelin levels compared with the HF-B diet (p b 0.05). Furthermore, the HF-S group had lower fasting total ghrelin concentration than the control and HF-F diet groups (p b 0.05). The plasma total and acyl ghrelin levels were elevated by fasting, in all the diets studied; however, they were not significant only in the HF-B group (Fig. 1). In the fed state, the total and acyl ghrelin plasma concentrations of the groups were not significantly different (Fig. 1).

Statistical analysis was performed using SPSS 16.0 (Chicago, IL, USA) software. The Kolmogorov–Smirnov test was applied to determine the normality of data distribution for parametric tests. The dependent variables of body weight and food intake were analyzed by between factors repeated measure. One-way ANOVA and a paired t-test were used to compare the hormone levels (acyl-ghrelin and total ghrelin). Tukey's honestly significant difference (HSD) was used for post-hoc analysis to determine differences among individual groups. Relative mRNA levels were quantified by the REST 2008V2.0.7 software package (Corbett Research, Australia), a relative expression software tool based on Pfaffl equation. p value of less than 0.05 were considered statistically significant.

3.2. Dietary effect on food intake Food intakes per day for all groups are shown in Table 2. On average, control fed animals consumed 8.2 ± 0.2 g per day compared to controls, the food intake in rats receiving HF-B and HF-S were significantly higher on days 56 and 70, respectively; this pattern continued during on the following days. Consequently, total food intake in the HF-B group was higher than those of the HF-F and HF-O groups (P b 0.05). The animals in the HF-S group demonstrated significantly higher intakes than those in the HF-F and HF-O groups during days 56 to 77 (P b 0.05). Furthermore, the total intake of HF-S group was significantly higher than the HF-F and HF-O groups. 3.3. Plasma total and acylated ghrelin levels

3.4. Ghrelin mRNA expression level in gastric fundus and duodenum 3. Results 3.1. Body weight Body weight changes for all the groups are shown in Table 2. Control rats gained an average of 41.8 g body weight in the first 2 weeks and then the weekly weight gain fell linearly to below 9 g up to the 8th week. High fat butter receiving animals showed the significantly highest weight gain in comparison with other groups, except for the HF-S group. The resulting final weights in the HF-B and HF-S groups were higher than those of the control group Table 2 Daily food intake and body weight in dietary groups based on rats age (day). Weight and intake

During the fasting period, ghrelin mRNA expression in the gastric fundus and duodenum of rats, fed with HF-B (in both tissues) and HF-S (only in stomach), were significantly (p b 0.05) lower than those observed in the group with the control diet (Fig. 2). Expression in the duodenum and stomach of HF-B was significantly (p b 0.05) 0.1 and 0.2 fold lower than the control group, respectively; however, in the stomach of the HF-S group, this value was significant (p b 0.05) and was 0.1 fold lower than that of the control group. Ghrelin mRNA expression in the duodenum of HF-F diet group was significantly (pb 0.05) higher than the HF-B and HF-S groups (12.1 and 6.2 fold, respectively). Although, ghrelin mRNA expression in the stomach of the HF-B and HF-S groups was 4.6 and 6 fold lower than the HF-F one, respectively, differences were not significant (Fig. 2).

Dietary groups SD

Weight (g) 21th 35.5 ± 0.8 35 th 77.3 ± 3.1 42 th 87.8 ± 2.5 49th 92 ± 1.6 Food intake (g/d) 28th 4.9 ± 0.2 49th 7.5 ± 0.3 56th 8.4 ± 0.2 70 9.4 ± 0.2⁎⁎†

HF-B

HF-S

35.6 ± 0.9 35.2 ± 0.9 81.2 ± 2.5 82.3 ± 2.5 97.4 ± 2.3⁎ 92 ± 2⁎ ⁎ 106.7 ± 2 102.7 ± 1.4⁎

4.6 ± 0.2 9 ± 0.4 10 ± 0.4⁎ 11.6 ± 0.3

4.7 ± 0.1 8.1 ± 0.2 9.7 ± 0.2 12 ± 0.2⁎

HF-F

HF-O

35.3 ± 0.9 36.1 ± 1 79.4 ± 2.4⁎⁎ 77.3 ± 2.6 86.5 ± 3.2⁎⁎ 88 ± 2.8⁎⁎† 93.7 ± 3.2⁎⁎† 92.4 ± 2.5⁎⁎†

4.9 ± 0.2 7.2 ± 0.5⁎⁎ 8.3 ± 0.5⁎⁎† 9.7 ± 0.6⁎⁎†

4.9 ± 0.1 7.1 ± 0.4⁎⁎ 8 ± 0.3⁎⁎† 9.6 ± 0.4⁎⁎†

Rats (n = 10) were given isocaloric meals containing soy oil (SD), high fat diets (HFDs) with butter (HF-B), soy oil (HF-S), olive oil (HF-O) and fish oil (HF-F) for 8 week. Mean ± S.E. and significant differences between groups are indicated as: * pb 0.05 groups vs. SD diet; ** p b 0.05 groups' vs. HF-B diet; † p b 0.05 groups' vs. HF-S diet.

4. Discussion The results of this study showed that the ghrelin synthesis and plasma level respond to dietary fats as well as to the fatty acid composition. Fasting acyl ghrelin and total ghrelin significantly increased in the HF-F and HF-O groups. Considering that HF-F, HF-O, HF-B and HF-S contain mainly ω-3 poly unsaturated fatty acid (PUFA), mono saturated fatty acid (MUFA), saturated fatty acid (SFA) and ω-6 PUFA, respectively, the findings of this study indicated the inhibitory or stimulatory effect of fatty acid saturation on the fasting total and acyl- ghrelin levels. A number of previous studies have reported that HFDs (mostly based on soy oil, corn oil or lard) decrease total ghrelin concentration in the fasting state (Beck et al., 2002; Lee et al., 2002; Mori et al., 2007). Therefore, it appears that ghrelin secretion dependent on the saturation level of the fatty acids. Although the exact factor that can regulate ghrelin

A. Saidpour et al. / Gene 507 (2012) 44–49

A

80

B

Feeding Fasting

Feeding Fasting

350

Total-ghrelin(pg/ml)

Acylghrelin(pg/ml)

70

400

47

60 50 40 30 20 10

300 250 200 150 100 50

0

0 control

HF-S

HF-B

HF-O

HF-F

Dietary Groups

control

HF-S

HF-B

HF-O

HF-F

Dietary Groups

Fig. 1. Acyl-ghrelin (A) and total ghrelin (B) plasma levels between dietary groups. Rats (n = 10) were given isocaloric meals in five groups of standard Diet (Control), high fat diets (HFDs) with butter (HF-B), with soy oil (HF-S), with olive oil. (HF-O) and with fish oil (HF-F) for 8 weeks. Mean ± S.E and significant differences between groups are: * P b 0.05 groups vs. SD diet; ** p b 0.05 groups vs. HF-B diet; † p b 0.05 groups vs. HF-S diet; ‡p b 0.05 vs. fasting.

Gene Expression Ratio (Relation to Contol Diet)

secretion and expression in the fasting state has not been established (Li et al., 2009), the key regulator of plasma ghrelin level is food intake (English et al., 2002; Votruba et al., 2009) which can affect the energy balance in the long term, as well (Wren et al., 2001). In this study, fasting acyl ghrelin plasma levels were lower in the HF-B and HF-S groups with higher food intake and weight gain during 8 weeks of the growing period; this finding, is in agreement with a previous report showing that HFD causes overeating in rats and mice (Lindqvist et al., 2005). Nevertheless, the HF-B and HF-S groups which had lower acyl ghrelin, should have had lower food intake as well as body weight. The findings cannot be explained based on the results of this study; however, has been concluded that ghrelin and insulin play an effective role in body weight regulation (Jucker et al., 1999). An inverse association between adiposity and insulin resistance has been also reported in adults and children (Steinberger and Daniels, 2003). Moreover, it was previously shown that groups with HF-B and HF-S diets had higher plasma insulin levels and insulin resistance in comparison with HF-F or HF-O groups (Saidpour et al., 2011). Therefore, calorie intake or weight gain increment of these dietary groups may be related to insulin resistance, as apparently the results of HF-B and HF-S on ghrelin secretion and energy intake were not in agreement; this finding needs to be further explored.

1.8 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0

S

D HF-B

S

D HF-F

S

D HF-O

S

D HF-S

High dietary fats

Fig. 2. Ghrelin mRNA expression in the stomach(S) and duodenum (D) tissues detected in rats with different high fat diets (HFD) in response to fasting. Ghrelin mRNA in tissues measured by Real-time PCR. Mean ± S.E. and significant differences between groups are: * p b 0.05 groups vs. SD diet; ** p b 0.05 groups vs. HFB diet; † p b 0.05 groups vs. HF-S diet. HF-B, high fat diet with Butter; HF-S, high fat diet with Soy oil; HF-O, high fat diet with olive oil; HF-F; high fat diet with Fish oil.

An unexpected finding seen in the control group was that despite its higher carbohydrate percentage of the diet, the group had significantly higher fasting acyl and total ghrelin, compared with some of the HFDs (HF-B and HF-S). Meanwhile, the effect of control diet on fasting ghrelin secretion was relatively similar to that in HFDs with fish oil and olive oil. Some previous studies have shown that carbohydrate-rich meals induce a greater and more rapid suppression of postprandial ghrelin levels compared with protein and fat containing diets (Erdmann et al., 2003; Monteleone et al., 2003). This unexpected finding might be due to the age of the animals used in this study. In humans, it has been shown that some hormones have different secretory patterns during the growth period (Chiras, 2011). In this study, after 24 h of fasting, the expression of ghrelin was significantly reduced in the stomach and duodenum in the group with HF-B diet as well as in the stomach of the HF-S group which was similar to plasma concentrations. Somewhat similar to the present findings, previous studies have shown that HFDs (based on soy oil or lard) could decrease plasma ghrelin levels and ghrelin expression in the stomach of rats (Huawei et al., 2007; Vallejo-Cremades et al., 2004). In the present study a relationship was demonstrated between ghrelin release and mRNA expression after 24 h of fasting; although another study failed to show this association during 18-h of fasting (Moesgaard et al., 2004); a time period of 24-h seems to be necessary for an association between expression and release. The expression of fasting ghrelin mRNA significantly increased in the duodenum of HF-F diet in comparison with the HF-B, and HF-S diet groups. The relatively high expression of ghrelin in the duodenum was somehow interesting because it has not been reported before; it also indicates that duodenum may contribute to the plasma ghrelin plasma levels, too, at least in certain conditions. Changes in the ghrelin expression in the fundus and the duodenum may represent a physiological adaptation to the energy balance (Inui et al., 2004; Kraemer and Castracane, 2007; Teresa Vallejo-Cremades et al., 2005), which is supported by the present finding that fasting plasma ghrelin levels were significantly lower in animals with higher food intake and body weight (HF-B and HF-S groups). The results of the present study indicate that in fed state, total and acyl ghrelin levels in the control, HF-F and HFO groups were lower than the HF-B and HF-S groups. Some previous reports have shown different ghrelin levels in fed state (Moesgaard et al., 2004; Sánchez et al., 2010; Vallejo-Cremades et al., 2004). Lee et al. have reported that feeding the animals with HFD (with beef tallow) can reduce ghrelin secretion (Lee et al., 2002), a finding somehow different to data presented in this study; it is not possible to pin point the reasons for such differences, nevertheless, it is worth mentioning that in addition to the differences in the components of the diet, Lee et al. have

48

A. Saidpour et al. / Gene 507 (2012) 44–49

performed their study in adult Sprague Dawley rats, while the animals used in our study were growing Wistar rats. It has been shown that hormonal response in growing children can be different from adults (Chiras, 2011) and this might be true in rats as well; of course this needs to be established. Also the standard diet used by Lee et al. was AIN76A while in this study AIN-93G was used which contains different sources of carbohydrate, protein and fat (Reeves, 1997). It has been demonstrated that casein containing diets can suppress ghrelin level faster in comparison to water and gluten (Luhovyy et al., 2007). It should also be pointed out that the condition of the sample collection can affect the plasma ghrelin concentration (Drazen et al., 2006). The suppressed secretion of the findings reported by Lee et al. was in a fasting–refeeding state while the samples obtained in present study were during a freely fed state. Comparison of the ghrelin secretion in fasting and fed states presents a kind of contradiction. In fasting state plasma ghrelin levels in HF-B and HF-S are lower compared to the other groups, while in the fed state they are higher. This could suggest that this might be a compensatory mechanism to prevent weight reduction. In the HF-F and HF-O groups energy intake was lower compared to the other HFD groups, leading to the lower weight observed in these groups. Weight loss can increase fasting plasma ghrelin concentration (Cummings et al., 2002). In a recent report the flexibility of plasma ghrelin levels under different conditions of fasting and feeding and the involved mechanisms have been highlighted (Kentish et al., 2012). Contradictory reports have however been documented on the impact of dietary fats on body weight and the satiety effect. The differences between the findings may be related to the variation in the fatty acid saturation levels. As some studies have indicated that PUFA has the strongest effect on satiety (Feltrin et al., 2008; Lichtenstein and Schwab, 2000) or diets high in n-3 PUFAs tend to suppress weight gain to a great extent (Buettner et al., 2006; Hill et al., 1993). Furthermore, it has been reported that long chain ω-3 PUFAs found in fish oil are more effective for regulating weight gain and metabolism than ω-6 PUFAs or SFA (Mathai et al., 2004). Another study demonstrated that soy oil HFD in obese rats could increase weight and food intake (Angeloni et al., 2004). One study however failed to show any obvious effects of dietary fish oil on body weight, although this group showed a decrease in epididymal adipose tissue (Rustan et al., 1993); these differences may be attributed to the design of the study since, in this study, fish oil was used as a fat composition of the diet while Rustan et al. used it as a supplement (Rustan et al., 1993). The satiety effect of PUFA and the weight control which follows may be related to acyl ghrelin hormone modulation (Feltrin et al., 2008; Lawton et al., 2000). In the fed status, it was found that acyl ghrelin level was lower in the HF-F and HF-O groups, suggesting that ghrelin levels in these groups were more successfully suppressed than in HF-B or HF-S diet users. In this study fasting plasma acyl ghrelin of HF-B and HF-S were lower, compared with the standard diet. Although fasting plasma ghrelin of the HF-F and HF-O were not different compared with standard diet, comparison of the last two groups with HF-B and HF-S shows significant differences. Fasting acyl ghrelin in the HF-F and HF-O groups showed that despite the higher fat intakes in these groups, ghrelin secretion was not altered. This shows the suitability of these kinds of fats in the diet. Although it is difficult to determine the mechanism of differences between secretory pattern of fasting acyl ghrelin of the groups, nevertheless comparing the findings of high fat diet groups with the standard diet suggest that this is due to inhibitory effects of HF-B and HF-S diets, which further emphasizes that different types of oils in the diet can have different impacts on ghrelin secretion, as suggested by other reports (Ettore et al., 2012). Considering the results of this study, no differences in food intake and weight gain were found between the HF-F and HF-O (containing ω-3 PUFA and MUFA, respectively) consuming groups. Furthermore, the MUFA containing diet significantly suppressed the food intake

and weight gain compared with the HF-B and HFS groups containing SFA and ω-6 PUFA, respectively. These findings are partially compatible with some previous studies; Flint et al. reported that fat rich breakfast containing PUFA and MUFA do not have different satiety effects in healthy overweight men (Flint et al., 2003). Furthermore, Strik et al. reported no evidence of different post-ingestion satiety between high fat breakfast with PUFA and MUFA in lean subjects (Wren et al., 2001). It was also shown that MUFA (olive oil) could decrease the level of satiety and subsequent energy intake more than SFA (Piers et al., 2002). Nevertheless, Kamphuis et al. stated that MUFA had a more satiating effect, compared to PUFA (Kamphuis et al., 2001); Lawton et al. found that PUFA can control appetite better than MUFA (Lawton et al., 2000). The exact causes of these differences in the findings are not clear and further investigations are required. As far as the present study is concerned these differences may be related to the fact that the saturation level of fatty acids influenced the rate of the absorption of fat from the gastrointestinal tract (Small, 1991) and SFAs were less efficiently absorbed and oxidized than unsaturated fatty acids (MUFA or PUFA), in rats (Bernard et al., 1987; Leyton et al., 1987). In summary, the present study showed that high fat diets with soy oil and butter did not increase fasting acyl ghrelin concentration of rats compared with high fat diets containing fish oil and olive oil, these results in accordance with food intake and weight gain changes observed in these groups. In addition, fasting mRNA expression in duodenum was only modified by the fish oil high fat diet. It is possible to conclude that some dietary oils such as fish oil may be useful for controlling calorie and food intakes and, as a result, in controlling body weight. Acknowledgments We are indebted to Dr. Mehdi Hedayati for his advice on the laboratory procedures, and to Ms. N. Shiva for language editing of the manuscript. This work was supported by the grants from the Research Institute for food and Nutrition Sciences (n. 313) and the Endocrine Research Center, Research Institute for Endocrine Sciences (n. 291), Shahid Beheshti University of Medical Sciences, Tehran, Iran. References Angeloni, S.V., et al., 2004. Characterization of the Rhesus monkey ghrelin gene and factors influencing ghrelin gene expression and fasting plasma levels. Endocrinology 145, 2197–2205. Beck, B., Musse, N., Stricker-Krongrad, A., 2002. Ghrelin, macronutrient intake and dietary preferences in Long–Evans rats. Biochem. Biophys. Res. Commun. 292, 1031–1035. Bernard, A., Echinard, B., Carlier, H., 1987. Differential intestinal absorption of two fatty acid isomers: elaidic and oleic acids. Am. J. Physiol. Gastrointest. Liver Physiol. 253, G751–G759. Buettner, R., et al., 2006. Defining high-fat-diet rat models: metabolic and molecular effects of different fat types. J. Mol. Endocrinol. 36, 485–501. Chiras, D.D., 2011. Human biology, 7th ed. Jones and Bartlett Publishers, Udbury, Mass. Cummings, D.E., et al., 2002. Plasma ghrelin levels after diet-induced weight loss or gastric bypass surgery. N. Engl. J. Med. 346, 1623–1630. De Vriese, C., Perret, J., Delporte, C., 2010. Focus on the short- and long-term effects of ghrelin on energy homeostasis. Nutrition 26, 579–584. Drazen, D.L., Vahl, T.P., D'Alessio, D.A., Seeley, R.J., Woods, S.C., 2006. Effects of a fixed meal pattern on ghrelin secretion: evidence for a learned response independent of nutrient status. Endocrinology 147, 23–30. English, P.J., Ghatei, M.A., Malik, I.A., Bloom, S.R., Wilding, J.P.H., 2002. Food fails to suppress gherkin levels in obese humans. J. Clin. Endocrinol. Metab. 87, 2984–2987. Erdmann, J., Lippl, F., Schusdziarra, V., 2003. Differential effect of protein and fat on plasma gherkin levels in man. Regul. Pept. 116, 101–107. Ettore, V., et al., 2012. Immunohistochemical and immunological detection of ghrelin and leptin in rainbow trout Oncorhynchus mykiss and murray cod Maccullochella peelii peelii as affected by different dietary fatty acids. Microsc. Res. Tech. 75, 771–780. Feltrin, K.L., et al., 2008. Comparative effects of intraduodenal infusions of lauric and oleic acids on antropyloroduodenal motility, plasma cholecystokinin and peptide YY, appetite, and energy intake in healthy men. Am. J. Clin. Nutr. 87, 1181–1187. Flachs, P., et al., 2006. Polyunsaturated fatty acids of marine origin induce adiponectin in mice fed a high-fat diet. Diabetologia 49, 394–397. Flint, A., Helt, B., Raben, A., Toubro, S., Astrup, A., 2003. Effects of different dietary fat types on postprandial appetite and energy expenditure. Obes. Res. 11, 1449–1455.

A. Saidpour et al. / Gene 507 (2012) 44–49 German, J.B., Dillard, C.J., 2004. Saturated fats: what dietary intake? Am. J. Clin. Nutr. 80, 550–559. Hill, J., Peters, J., Lin, D., Yakubu, F., Greene, H., Swift, L., 1993. Lipid accumulation and body fat distribution is influenced by type of dietary fat fed to rats. Int. J. Obes. Relat. Metab. Disord. 17 (4), 223–236. Hosoda, H., Kojima, M., Matsuo, H., Kangawa, K., 2000. Ghrelin and des-acyl ghrelin: two major forms of rat ghrelin peptide in gastrointestinal tissue. Biochem. Biophys. Res. Commun. 279, 909–913. Huawei, Z., Jingdong, Y., Defa, L., Xuan, Z., Xilong, L., 2007. Tryptophan enhances ghrelin expression and secretion associated with increased food intake and weight gain in weanling pigs. Domest. Anim. Endocrinol. 33, 47–61. Inui, A., et al., 2004. Ghrelin, appetite, and gastric motility: the emerging role of the stomach as an endocrine organ. FASEB J. 18, 439–456. Jucker, B.M., Cline, G.W., Barucci, N., Shulman, G.I., 1999. Differential effects of safflower oil versus fish oil feeding on insulin-stimulated glycogen synthesis, glycolysis, and pyruvate dehydrogenase flux in skeletal muscle: a 13C nuclear magnetic resonance study. Diabetes 48, 134–140. Kamphuis, M., Westerterp-Plantenga, M., Saris, W., 2001. Fat-specific satiety in humans for fat high in linoleic acid vs fat high in oleic acid. Eur. J. Clin. Nutr. 55, 499–508. Kentish, S., et al., 2012. Diet-induced adaptation of vagal afferent function. J. Physiol. 590, 209–221. Kirchner, H., Tong, J., Tschop, M.H., Pfluger, P.T., 2010. Ghrelin and PYY in the regulation of energy balance and metabolism: lessons from mouse mutants. Am. J. Physiol. Endocrinol. Metab. 298, E909–E919. Kojima, M., Hosoda, H., Date, Y., Nakazato, M., Matsuo, H., Kangawa, K., 1999. Ghrelin is a growth hormone-releasing acylated peptide from stomach. Nature 402, 656–660. Kraemer, R.R., Castracane, V.D., 2007. Exercise and humoral mediators of peripheral energy balance: ghrelin and adiponectin. Exp. Biol. Med. 232, 184–194. Lawton, C., Delargy, H., Brockman, J., Smith, F., Blundell, J., 2000. The degree of saturation of fatty acids influences post-ingestive satiety. Br. J. Nutr. 83, 473–482. Lee, H.-M., Wang, G., Englander, E.W., Kojima, M., Greeley Jr., G.H., 2002. Ghrelin, a new gastrointestinal endocrine peptide that stimulates insulin secretion: enteric distribution, ontogeny, influence of endocrine, and dietary manipulations. Endocrinology 143, 185–190. Leyton, J., Drury, P., Crawford, M., 1987. Differential oxidation of saturated and unsaturated fatty acids in vivo in the rat. Br. J. Nutr. 57 (3), 383–393. Li, R.Y., et al., 2009. Influence of visceral adiposity on ghrelin secretion and expression in rats during fasting. J. Mol. Endocrinol. 42, 67–74. Lichtenstein, A.H., Schwab, U.S., 2000. Relationship of dietary fat to glucose metabolism. Atherosclerosis 150, 227–243. Lindqvist, A., de la Cour, C.D., Stegmark, A., Håkanson, R., Erlanson-Albertsson, C., 2005. Overeating of palatable food is associated with blunted leptin and ghrelin responses. Regul. Pept. 130, 123–132. Luhovyy, B.L., Akhavan, T., Anderson, G.H., 2007. Whey proteins in the regulation of food intake and satiety. J. Am. Coll. Nutr. 26, 704S–712S. Mathai, M., et al., 2004. Does prenatal ω-3 polyunsaturated fatty acid deficiency increase appetite signaling? Obes. Res. 12 (11), 1886–1894.

49

Moesgaard, S.G., Ahrén, B., Carr, R.D., Gram, D.X., Brand, C.L., Sundler, F., 2004. Effects of high-fat feeding and fasting on ghrelin expression in the mouse stomach. Regul. Pept. 120, 261–267. Monteleone, P., Bencivenga, R., Longobardi, N., Serritella, C., Maj, M., 2003. Differential responses of circulating ghrelin to high-fat or high-carbohydrate meal in healthy women. J. Clin. Endocrinol. Metab. 88, 5510–5514. Moran, L.J., Luscombe-Marsh, N.D., Noakes, M., Wittert, G.A., Keogh, J.B., Clifton, P.M., 2005. The Satiating effect of dietary protein is unrelated to postprandial ghrelin secretion. J. Clin. Endocrinol. Metab. 90, 5205–5211. Mori, T., Kondo, H., Hase, T., Tokimitsu, I., Murase, T., 2007. Dietary fish oil upregulates intestinal lipid metabolism and reduces body weight gain in C57BL/6J mice. J. Nutr. 137, 2629–2634. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids. Res. 29, e45. Piers, L., Walker, K., Stoney, R., Soares, M., O'Dea, K., 2002. The influence of the type of dietary fat on postprandial fat oxidation rates: monounsaturated (olive oil) vs saturated fat (cream). Int. J. Obes. Relat. Metab. Disord. 26 (6), 814–821. Reeves, P.G., 1997. Components of the AIN-93 diets as improvements in the AIN-76A diet. J. Nutr. 127, 838S–841S. Rustan, A.C., Hustvedt, B.E., Drevon, C.A., 1993. Dietary supplementation of very longchain n-3 fatty acids decreases whole body lipid utilization in the rat. J. Lipid Res. 34, 1299–1309. Saidpour, A., et al., 2011. Fish oil and olive oil can modify insulin resistance and plasma desacyl-ghrelin in rats. J. Res. Med. Sci. 16, 863–871. Sanchez, J., Oliver, P., Palou, A., Pico, C., 2004. The inhibition of gastric ghrelin production by food intake in rats is dependent on the type of macronutrient. Endocrinology 145, 5049–5055. Sánchez, J., Cladera, M.M., Llopis, M., Palou, A., Picó, C., 2010. The different satiating capacity of CHO and fats can be mediated by different effects on leptin and ghrelin systems. Behav. Brain Res. 213, 183–188. Seim, I., Amorim, L., Walpole, C., Carter, S., Chopin, L.K., Herington, A.C., 2010. Ghrelin gene-related peptides: multifunctional endocrine/autocrine modulators in health and disease. Clin. Exp. Pharmacol. Physiol. 37, 125–131. Small, D., 1991. The effects of glyceride structure on absorption and metabolism. Annu. Rev. Nutr. 11, 413–434. Steinberger, J., Daniels, S.R., 2003. Obesity, insulin resistance, diabetes, and cardiovascular risk in children. Circulation 107, 1448–1453. Teresa Vallejo-Cremades, M., Gómez de Segura, I.A., Gómez-García, L., Pérez-Vicente, J., De Miguel, E., 2005. A high-protein dietary treatment to intestinally hypotrophic rats induces gherkin mRNA content and serum peptide level changes. Clin. Nutr. 24, 904–912. Vallejo-Cremades, M.T., et al., 2004. Enriched protein diet-modified ghrelin expression and secretion in rats. Regul. Pept. 121, 113–119. Votruba, S.B., Kirchner, H., Tschop, M., Salbe, A.D., Krakoff, J., 2009. Morning ghrelin concentrations are not affected by short-term overfeeding and do not predict ad libitum food intake in humans. Am. J. Clin. Nutr. 89, 801–806. Wren, A.M., et al., 2001. Ghrelin enhances appetite and increases food intake in humans. J. Clin. Endocrinol. Metab. 86, 5992–5995.