- Email: [email protected]
The Molecular Basis of Vitamin D Receptor and β-Catenin Crossregulation
Molecular Cell 21, 799–809, March 17, 2006 ª2006 Elsevier Inc.
DOI 10.1016/j.molcel.2006.01.037
The Molecular Basis of Vitamin D Receptor and b-Catenin Crossregulation Salimuddin Shah,1,* Md Naimul Islam,1 Sivanesan Dakshanamurthy,1 Imran Rizvi,1 Mahadev Rao,1 Roger Herrell,1 Glendon Zinser,5 Meggan Valrance,5 Ana Aranda,2 Dino Moras,3 Anthony Norman,4 JoEllen Welsh,5 and Stephen W. Byers1,* 1 The Lombardi Comprehensive Cancer Center Georgetown University School of Medicine Washington, D.C. 20007 2 The Instituto de Investigaciones Biome´dicas Consejo Superior de Investigaciones Cientı´ficas and Universidad Auto´noma de Madrid 28029 Madrid Spain 3 IGBMC Laboratoire de Biologie et Genomique Structurales 67400 Illkirch France 4 Department of Biochemistry University of California, Riverside Riverside, California 92521 5 Department of Biological Sciences University of Notre Dame Notre Dame, Indiana 46556
The signaling/oncogenic activity of b-catenin can be repressed by activation of the vitamin D receptor (VDR). Conversely, high levels of b-catenin can potentiate the transcriptional activity of 1,25-dihydroxyvitamin D3 (1,25D). We show here that the effects of b-catenin on VDR activity are due to interaction between the activator function-2 (AF-2) domain of the VDR and C terminus of b-catenin. Acetylation of the b-catenin C terminus differentially regulates its ability to activate TCF or VDR-regulated promoters. Mutation of a specific residue in the AF-2 domain, which renders the VDR trancriptionally inactive in the context of classical coactivators, still allows interaction with b-catenin and ligand-dependent activation of VDREcontaining promoters. VDR antagonists, which block the VDRE-directed activity of the VDR and recruitment of classical coactivators, do allow VDR to interact with b-catenin, which suggests that these and perhaps other ligands would permit those functions of the VDR that involve b-catenin interaction.
breast, and prostate (for review see Giovannucci and Platz [2005]). The most active natural form of vitamin D, 1,25-dihydroxyvitamin D3 (1,25D), also inhibits cell proliferation and induces differentiation and apoptosis in a number of tumor cells; however, the use of 1,25D as a cancer chemopreventative agent in humans is limited by the accompanying hypercalcemia. Most of these effects of vitamin D depend upon its activation of the VDR. Indeed, hereditary vitamin D-dependent rickets (HVDDR) results from mutations in the VDR and is usually accompanied by hair and skin defects such as alopecia (Malloy et al., 1999). VDR is a member of a nuclear receptor subfamily, which forms heterodimers with RXR and which, like other nuclear receptors, contains an AF-2 domain that undergoes ligand-induced conformational change. Direct regulation of gene expression by VDR depends on the presence of vitamin D responsive elements (VDREs) in the promoters of target genes. However, some vitamin D-regulated genes do not contain VDREs in their promoters and are thought to be regulated indirectly. Thus, not only can vitamin D/VDR affect gene expression by binding to VDREs but it can also regulate other pathways. One such pathway that is clearly regulated this way by nuclear receptors is the wnt pathway, which affects gene expression through b-catenin. b-catenin, a multifunctional protein, is required for cell-cell adhesion and for regulation of gene expression in response to wnt signaling (for reviews see Clevers [2004], Moon et al. [2004], and Nelson and Nusse [2004]). Retinoic acid, androgen, and 1,25D acting through the appropriate nuclear receptor can transrepress b-catenin/TCF signaling (Easwaran et al., 1999; Palmer et al., 2001; Shah et al., 2003; Song et al., 2003). b-catenin can also potentiate the ligand-dependent activation of RAR, VDR, and AR-regulated promoters. In this study, we show that acetylation of the b-catenin C terminus differentially regulates the ability of b-catenin to activate TCF and VDR-regulated promoters. In addition, we identify a specific residue in the AF-2 domain that renders the VDR transcriptionally inactive in the context of classical coactivators but still allows interaction with b-catenin and ligand-dependent activation of VDREcontaining promoters. Remarkably, this mutation is present in families that exhibit HVDDR without the other manifestations of vitamin D deficiency and provides an insight into the molecular basis of the differential effects of vitamin D receptor mutations on b-catenin signaling.
Introduction
Results
Vitamin D is the preventive agent of nutritional rickets, a defect in bone development due to inadequate uptake of dietary calcium. Epidemiological studies point to alterations in active vitamin D levels being responsible for the protective effects of sunlight exposure on the incidence of several cancers, including those of the colon,
The b-Catenin C Terminus Is Required for b-Catenin/VDR Interactions To study the region of b-catenin involved in its interaction with VDR, we performed mammalian two-hybrid assays by using Gal4/VDR (118–427) and a variety of VP16/ b-catenin constructs (Figure 1A). Wild-type (wt) b-catenin/VP16 significantly increased Gal4/VDR activity only in the presence of ligand, whereas C-terminal-deleted b-catenin/VP16 was unable to interact with Gal4/VDR
Summary
*Correspondence: [email protected] (S.S.); byerss@georgetown. edu (S.W.B.)
Molecular Cell 800
Figure 1. The C Terminus of b-Catenin Is Required for VDR/b-Catenin Interaction (A) b-catenin/VP16 and Gal4/VDR constructs. (B) Gal4-luciferase activity was measured in HEK293 cells transfected with the indicated plasmids and treated with 1,25D. (C) HEK293 cells were transfected with the indicated plasmids, and b-catenin detected by using anti-VP16 antibodies (3400). (D) Amino acid sequence comparison for putative acetylation motifs (bold KK represents lysines 671/72 in b-catenin). (E) Purified b-catenin C terminus, lysine-mutated 671/72L b-catenin, and histone proteins were separately mixed with p300 and C14 acetyl CoA. The reaction was stopped after 60 min, and C14 acetyl incorporation was measured. (F) Cells were transfected with full-length wt b-catenin/FLAG and lysine-mutated 671/72 b-catenin/FLAG. Twenty-four hours after transfection, cells were harvested and 400 mg of total protein was immunoprecipitated by using FLAG antibodies and acetylated b-catenin detected by Western blot. Error bars represent the SEM of three to four independent experiments.
Vitamin D Receptor and b-Catenin Interaction 801
(Figure 1B). b-catenin that contains only arm repeats 10–12 and the C terminus fused to VP16 interacted better than full-length b-catenin. Furthermore, when the arm 10–12 region was removed, the remaining C terminus was still able to interact with VDR in a ligand-dependent manner. Although it is clear that C-terminal-deleted b-catenin cannot interact with VDR, it is formally possible that this may simply be because it may not translocate to the nucleus. However, there is no difference in the distribution of any of the b-catenin proteins used in the study (Figure 1C). Acetylation of b-Catenin Lysines 671 and 672 Alters b-Catenin/VDR and b-Catenin/TCF Interaction In contrast to the role of the armadillo repeat region of b-catenin in mediating protein-protein interactions, no obvious interaction domains are present in the C-terminal region of b-catenin. Weiss et al. also found that the purified C terminus behaves as an extended unstructured peptide upon gel filtration (Daniels and Weis, 2002). However, upon analysis, we found a sequence, 670-YKKR-673, that is similar to acetylation motifs in other proteins that are regulated by acetylation (Figure 1D and Fu et al. [2004]). To test if the lysine residues in the 670-YKKR-673 motif can be acetylated, in vitro acetylation assays were performed on wt b-catenin and 671/672 (K to L) mutated b-catenin in the presence of the histone acetyl transferase p300. b-catenin acetylation by p300 decreased significantly (w70%) by mutation of lysine 671/672 (Figures 1E and 1F). These results establish that the 670-YKKR-673 motif in the C-terminal region of b-catenin is an important site for acetylation by p300 and perhaps by other histone acetyl transferases. Although the C terminus of b-catenin is not directly involved in binding to TCF, it is essential for activation of TCF-mediated transcription and, together with the N terminus, is involved in the recruitment of histone acetyl transferases such as p300 to the b-catenin/TCF complex (Shah et al., 2003). If the acetylation status of the b-catenin C terminus determines its ability to activate TCF or bind to VDR, then one would anticipate that mutation of lysines 671/672 would alter the ability of b-catenin to regulate VDR-mediated transactivation. Although interaction of the K671/672L mutant protein with the VDR was significantly reduced, it was approximately four times more active than wt b-catenin and as active as the stable S37A form in regulating the activity of the TCF-responsive reporter TOPFlash (Figures 2A and 2B). The lysine mutations did not alter the distribution or steady-state protein levels of b-catenin (Figure 2B, inset, and Figure 2C). We showed previously that p300 modestly increased the activation of a Gal4 promoter by Gal4-b-catenin but did so to a greater extent in the absence of the b-catenin C terminus (Shah et al., 2003). These data indicate that p300-mediated acetylation of the b-catenin C terminus is not necessary for and may actually inhibit b-catenin transactivation. Consistent with these data, chromatin immunoprecipitation (ChIP) assays showed that 671/ 672 (K to L)-mutated b-catenin was recruited to the TopFlash promoter construct as well as b-catenin (Figure 2D). Exogenous expression of p300 potentiated the ability of both full-length and K671/672L mutant b-catenin to activate TopFlash (Figure 2E). In contrast, p300
had little effect on the ability of wt or K671/672L-mutated b-catenin to interact with VDR (Figure 2F). Taken together, these data indicate that the acetylation status of the b-catenin C terminus differentially regulates its ability to activate TCF and to interact with VDR. 1,25D Repression of b-Catenin Signaling Is Cadherin Independent and VDR Dependent Previous studies have established the ability of 1,25D and E-cadherin to repress b-catenin signaling (Easwaran et al., 1999; Palmer et al., 2001; Shah et al., 2003). Because E-cadherin can inhibit the signaling activity of b-catenin, it is possible that the repressive effect of 1,25D is indirectly due to increased E-cadherin expression. To directly test the role of E-cadherin in mediating the effects of 1,25D, experiments were performed with SKBR-3 cells, which have a homozygous deletion of the E-cadherin gene. 1,25D repression of b-catenin signaling was equivalent in E-cadherin-positive cells and in E-cadherin-negative SKBR3 cells (Figure S1 available in the Supplemental Data with this article online). To test the role of the VDR in mediating the effects of 1,25D on b-catenin signaling, we used mammary tumor cells derived from VDR+/+ and VDR2/2 mice and measured VDR (VDRE-luc) and b-catenin (TOPFlash) reporter activities (Zinser et al., 2003). As expected, 1,25D treatment increased VDR reporter activity in VDR+/+ cells, but not in VDR2/2 cells (Figure S1). b-catenin activity was decreased in VDR+/+ cells after 1,25D treatment but was unaffected in VDR2/2 cells (Figure 3A). 1,25D-Mediated Activation of VDR Reporter Is Attenuated in b-Catenin2/2 Cells To formally test if endogenous b-catenin plays a role in VDR activation by 1,25D, we used H28 mesothelioma cells, which have a homozygous deletion of the b-catenin gene (Usami et al., 2003). H28 cells express significant levels of VDR but are only slightly responsive to 1,25D activation of the VDR reporter. However, after transfection of b-catenin, VDR activation by 1,25D was significantly increased, suggesting a role for b-catenin in the activity of VDR (Figure 3B). Additionally, 1,25D treatment was able to repress TOPFlash activity in H28 cells transfected with full-length b-catenin (Figure S2). Potentiation of VDR Reporter Activity by b-Catenin Is Dependent on the AF-2 Domain of the VDR The AF-2 domain is required for interaction with coactivators, and deletion of this domain renders VDR transcriptionally inactive on VDRE-containing promoters. The ability of 1,25D to repress b-catenin signaling is also dependent on the AF-2 domain (Shah et al., 2003). We next wanted to know if the AF-2 domain is required for b-catenin-mediated potentiation of VDR activity. b-catenin expression significantly potentiated VDREcontaining reporter activity both in control cells and in VDR-transfected cells (Figure 3C). However, the activity of AF-2-mutated VDR was unaffected. These results indicate that the b-catenin-mediated potentiation of VDR activity on a synthetic VDRE-containing reporter requires the AF-2 domain. To study the effects of b-catenin on a naturally occurring VDR responsive promoter, we used a 24-hydroxylase (CYP24) reporter construct. The effects of b-catenin on CYP24 reporter activity
Molecular Cell 802
Figure 2. Lysines 671 and 672 of the b-Catenin C Terminus Are Important for b-Catenin/VDR Interactions (A) HEK 293 cells were transfected with the indicated plasmids; treated with 1,25D 24 hr after transfection, and Gal4-luciferase activity was measured. Data are represented as relative luciferase units. (B) Activity of b-catenin wt, S37A, and (K671/72L) was measured by using TOPFlash. Inset, b-catenin levels in lysates from wt, S37A, and K671/ 72L-b-catenin-transfected cells. (C) Immunocytochemistry was performed to detect the localization of wt and K671/72L b-catenin (3400). (D) HEK293 cells were transfected with wt b-catenin/FLAG, K671/72L-mutated b-catenin/FLAG, and TOPFlash plasmids. Forty-eight hours after transfection, cells were harvested and prepared for ChIP. (E) HEK293 cells were transfected with b-catenin, K671/72L b-catenin, and p300. Twenty-four hours after transfection, luciferase activity was measured. (F) HEK293 cells were transfected with Gal4/VDRwt, b-catenin, K671/72L b-catenin, and p300. Cells were treated with 1,25D for 24 hr and luciferase activity measured. Data are represented as relative luciferase units. Error bars represent the SEM of three to four independent experiments.
were identical to the VDRE-containing reporter (Figure 3D). Taken together, these results indicate that b-catenin-mediated potentiation of VDR activity depends on the AF-2 domain of the VDR and is not promoter specific.
Discriminatory Effects of AF-2 Mutants on b-Catenin/VDR Interactions Many mutations of the VDR have been discovered in families with HVDRR. Most of these patients exhibit the dual phenotype of rickets and epidermal defects
Vitamin D Receptor and b-Catenin Interaction 803
Figure 3. b-Catenin-Mediated Potentiation of VDR Reporter Activity Is AF-2 Dependent (A) VDR+/+ or VDR2/2 mouse mammary epithelial cells were transfected with TOPFlash and renilla luciferase and treated with 1 mM 1,25D for 24 hr. Inset, b-catenin in VDR+/+ and VDR2/2 cells. (B) b-catenin null NCI-H28 cells were transfected with b-catenin and VDRE-luciferase and renilla luciferase. Twenty-four hours after transfection, cells were treated with 1,25D for another 24 hr and luciferase activity measured. (C) SKBR-3 cells were transfected with wt VDR, AF2-deleted VDR (VDR DAF-2), and S37A-mutated form of b-catenin. VDRE-luciferase activity was measured after 24 hr treatment with 1,25D. (D) Same as in (A) except with 24ahydroxyase-luciferase. Activity is expressed as relative luciferase units. Error bars represent SEM of three to four independent experiments.
such as alopecia; however, a few mutations result only in rickets (Malloy et al., 2002). To fully understand any differential effects of these mutations within the AF-2 domain (Figure 4A), we first used molecular modeling tools to identify residues that are appropriately placed to mediate the ligand-dependent interaction of VDR with b-catenin. The liganded VDR (1DB1 and 1RK3) and RXR (1FBY) structures were retrieved from the PDB database. The structure of the apo-VDR was predicted as described in the Experimental Procedures. The liganded and apo structures were superimposed by using SYBYL7.0 (Figures 4B–4D). E420 of helix-12 and K264 of helix-5 were mapped in the superimposed structures. In the predicted apo structure of the VDR, E420 and K264 are far apart, whereas in the liganded structure, both E420 and K264 interact with each other through a salt bridge to stabilize H-12 (Figures 4B and 4C) (Rochel et al., 2000). Figure S3 in the Supplemental Data presents an animation of the liganded and apo-VDR and may aid in orientation. In the presence of ligand and DRIP 205, E420 interacts with M629 and L630, and K264 interacts with H627 of DRIP 205 (Vanhooke et al., 2004). These data point to roles for E420 and K264 in mediating the conformational change underlying the ligand-dependent interaction of VDR with coactivators such as DRIP 205. To identify the AF-2 domain amino acid(s) potentially involved in VDR/b-catenin interaction, we mutated amino acids based on their involvement in polar and nonpolar interactions. Analysis of VDR crystal structures indicated that all but three of the amino acids in the AF-2 domain are involved in interhelical bonds. We first mutated L417, an amino acid that is primarily involved in
interhelical bonding to maintain the helical structure of H-12, and E420 (see above; Figures 4B–4D). Previous studies showed that mutation of VDR L417 or 420 impairs its ability to transactivate and interact with classical coactivators (Jimenez-Lara and Aranda, 1999; Malloy et al., 1999). However, both mutants are able to bind ligand and heterodimerize with RXR. We confirmed that L417S-mutated VDR could not activate a VDREcontaining promoter (Figure 5A) and showed that unlike wt VDR it was not able to interact with b-catenin in immunoprecipitaiton or mammalian two-hybrid assays (Figures 5B and 5C). In contrast, mutation of E420Q does not affect interactions with b-catenin (Figures 5B and 5C) but completely abrogates the ability of the VDR to activate VDRE-containing promoters (Malloy et al., 1999) (Figure 5A). As described above, a salt bridge between E420 and K264 maintains the liganded VDR in a closed conformation suitable for interaction of VDR with classical coactivators. As E420Q VDR can bind to b-catenin, this strongly suggests that the E420/K264 salt bridge is not necessary for VDR/b-catenin interaction. To test if K264 has a role independent of the salt bridge required for interaction with E420, we mutated K264 to A. As expected, this mutation rendered the VDR inactive on VDRE; however, unlike mutation of E420, K264A or the double mutant was unable to interact with b-catenin (Figure 5A). Similar results were obtained after mutation of K246 (H-3), which anchors classical coactivators at the opposite end of the coactivator binding pocket (data not shown). Taken together, these data suggest that naturally occurring mutations in the VDR AF-2 domain may result in the recruitment of different classes
Molecular Cell 804
porter activity (Malloy et al., 2002). Consistent with our model, b-catenin does not allow the K264A VDR to activate VDRE-containing promoters (Figure 5C). Furthermore, the ligand dependence of b-catenin/wt VDR or b-catenin/E420QVDR interaction indicates that the orientation of K264 is important for its interaction with b-catenin. Although E420 is not required for VDR/b-catenin interaction, we wondered if the neighboring E425 could fulfill this function in its absence. This proved not to be the case, as an E425Q mutation had no effect on ligand-dependent VDRE activation or on VDR/b-catenin interaction (Figures 5C and 5E). However, this mutation did result in a 3-fold increase in VDRE activation in the absence of ligand, perhaps indicating that this residue is important for corepressor binding.
Figure 4. Spatial Configuration of Amino Acids within the AF-2 Domain of VDR (A) Schematic representation of the VDR. The highlighted amino acids are L417 and E420. (B) Structure of liganded VDR (1DB1). (C) Predicted apo-VDR structure. (D) Superimposed image of liganded and apo-VDR structures.
of coactivator (e.g., b-catenin, but not DRIP205). The differential effects of mutation of E420Q and K264 on VDR/ classical coactivator and VDR/b-catenin interaction can be explained by a model in which mutation of E420 partially disrupts the closed conformation, whereas it is completely disrupted by K264 mutation. A logical extension of this hypothesis is that VDR activation by classical coactivators requires H-12 in full agonist (closed) conformation, whereas b-catenin can interact with VDR even if H-12 is in its partial agonist conformation. If this is true then, unlike classical coactivators, b-catenin should allow the E420-mutated VDR to activate VDREcontaining promoters in the presence of ligand. Figure 5D clearly demonstrates that this is the case. Similar experiments have shown that coexpression of DRIP205 and E420Q VDR cannot activate VDRE-containing re-
VDR Antagonists Allow Interaction of Wt, but Not L417S or E420Q Mutant Forms of VDR with b-Catenin Our data demonstrate that b-catenin is able to interact with and activate VDR under conditions in which other coactivators do not. Similarly, several vitamin D analogs can bind to the VDR and promote corepressor release but do not allow recruitment of classical coactivators (Carlberg, 2004). VDR activation by classical coactivators and by b-catenin is ligand dependent, thus indicating that agonist-induced release of corepressor is required for b-catenin activation of the VDR. To test the hypothesis that even though antagonist bound VDR cannot recruit typical VDR coactivators upon corepressor release it may still allow VDR interaction with b-catenin, we performed experiments with vitamin D analogs ZK159222 and TEI9647. ZK159222 contains a 25-carboxylic ester moiety in the flexible chain (Figure 6A), whereas TEI9647 shares the calcipotriol skeleton but contains a cyclic extension at the 25-position. Depending on the length and the structure of side chain extension, this class of ligand can act as a partial agonist or partial antagonist. Docking of TEI9647 (pink) in the VDR reveals that the chain extending from position 25 clashes with helix H3 and H12 and more specifically with Leu230, Val234, F422, V418, and L417 and suggests that the activation helix will not be optimally positioned (Figures 6B and 6C). The long aliphatic chain of ZK159222 (green) partially disrupts the ligand-induced close conformation of H12, but because of the position of its aliphatic chain within the hydrophobic cavity, it still allows some interaction with coactivators (20% of 1,25D), which would explain the partial agonist activity of this compound (Carlberg, 2003; Tocchini-Valentini et al., 2004). Consequently, ZK159222 and TEI9647 bind well to the VDR but do so in a way that interferes with helix-12 and does not allow it to take a position optimal for coactivator recruitment, even though they do allow corepressor release (Carlberg, 2003). We first performed VDR reporter assays to compare their activity with 1,25D and determined the dose response of inhibition by ZK159222 of 1,25D-activated VDRE reporter activity (Figures 6D and 6E). Wt VDR can interact with b-catenin when it is bound to either agonist (1,25D) or partial antagonist (ZK159222 and TEI9647; Figure 6F). Consistent with our other data, the L417S form of VDR cannot interact with b-catenin when bound to either agonist or partial antagonist. Interestingly, the E420Q mutant can interact with b-catenin only in the presence of
Vitamin D Receptor and b-Catenin Interaction 805
Figure 5. b-Catenin Can Interact with Wt and E420Q VDR, but Not with L417S or K264A VDR (A) HEK293 cells were transfected with the indicated plasmids and VDRE-luciferase reporter, treated with 1,25D for 24 hr, and luciferase activity measured. (B) b-catenin association with VDR immunoprecipitated from wt, L417S, and E420Q VDR-transfected cells. (C) HEK293 cells were transfected with the indicated plasmids and GAL4 reporter, treated with 1,25D for 24 hr, and luciferase activity measured. (D) HEK293 cells were transfected with the indicated plasmids and VDRE reporter, treated with 1,25D for 24 hr, and luciferase activity measured. (E) HEK293 cells were transfected with the indicated plasmids and VDRE reporter, treated with 1,25D for 24 hr, and luciferase activity measured. Activity is expressed as relative luciferase units. Error bars represent the SEM of three to four independent experiments.
agonist (1,25D), but not in the presence of partial antagonists. Thus, ZK159222 and TEI9647 may act synergistically with E420Q to result in an H-12 conformation that does not allow binding with b-catenin or classical coactivators. Alternatively, the failure of antagonist bound E420Q VDR to interact with b-catenin may be a result of the inability of the antagonist to allow the appropriate
conformational change necessary to release corepressors (Carlberg, 2004). Discussion Our data show that specific residues in the AF-2 domain of the VDR can discriminate between its classical
Molecular Cell 806
Figure 6. Vitamin D3 Antagonists Allow Interaction of Wt VDR with b-Catenin (A) Side chains of 1,25D, ZK159222, and TEI9647. (B) 1,25D (magenta), ZK159222 (green), and TEI9647 (pink) were docked onto the liganded VDR structure (1BD1). (C) VDR surface influenced by the side chains of ZK159222 (green) and TEI9647 (pink). (D) HEK 293 cells were transfected with VDREluciferase and renilla luciferase. Twenty-four hours after transfection, cells were treated with TEI9647 and ZK159222 (1027 M) for an additional 24 hr. (E) VDRE activity of 1,25D (100 nM) in the presence of varying concentrations of antagonist (10, 100, and 1000 nM concentration of ZK159222). (F) HEK293 cells were transfected with the indicated plasmids along with Gal4x5luciferase reporter plasmid and treated with agonist (1,25D) and antagonist (TEI9647 and ZK159222) (100 nM each) for an additional 24 hr. Luciferase activity was measured and plotted as relative light units. Error bars represent the SEM of three to four independent experiments.
activity and its ability to interact with b-catenin. HVDDR patients with a VDR mutation (E420Q/K) that allows interaction with b-catenin, but not activation of VDREcontaining genes, exhibit rickets but do not exhibit the other manifestations of vitamin D deficiency patients, such as alopecia (Malloy et al., 2002). Further experimentation is required to address if this is a causal relationship. Other experiments demonstrate that mutation of lysine residues that are acetylation targets in the b-catenin C-terminal domain differentially regulates b-catenin/TCF and b-catenin/VDR activity. 1,25D Interacts with the b-Catenin Signaling Pathway in Several Ways 1,25D inhibits the function of the b-catenin/TCF pathways and increases the expression of E-cadherin, a tu-
mor suppressor (Palmer et al., 2001; Shah et al., 2003). In other studies, we show that retinoic acid stimulates SKBR3 breast cancer cell differentiation by increasing cadherin expression (Shah et al., 2002). However, this pathway is not required for RA inhibition of b-catenin/ TCF signaling or cell proliferation. Similarly, although 1,25D can increase E-cadherin expression in a sensitive subclone of SW480 cells, our results show that cadherin expression is not absolutely required to inhibit b-catenin/TCF signaling or proliferation. Indeed, 1,25D inhibits the growth of many cells without altering cadherin expression. These data indicate that the broad effects of 1,25D on the growth and differentiation of many different epithelial cancers may be explained by its ability to differentially regulate the activity of the VDR, E-cadherin, and b-catenin/TCF pathways.
Vitamin D Receptor and b-Catenin Interaction 807
Figure 7. Hypothetical Model Depicting Open and Closed VDR Confirmations
Mutation of b-Catenin C-Terminal Lysine Residues Inhibits VDR Interactions Mutation of the acetylation target lysines 671/672 inhibited b-catenin interaction with VDR but markedly potentiated its ability to coactivate TCF-sensitive reporters. Consequently, it is possible that a form of b-catenin that cannot interact with TCF might be more available to bind to and activate VDR. Consistent with this, we found that a mutant form of b-catenin with greatly reduced TCF binding activity (mutations at 312 and 345) is significantly better at activating VDR than wt b-catenin (data not shown). Specific Residues in the AF-2 Domain of the VDR Can Discriminate between Its Classical Activity and Its Ability to Interact with b-Catenin HVDRR patients have point mutations in the ligand binding domain and/or activation function domain (AF-2) of the VDR. Some HVDDR mutations lead to rickets even though they do not affect ligand binding; however, failure to bind ligand always results in both rickets and alopecia. Activation of the VDR by ligand may be envisaged in the following steps: (1) binding of ligand to the LBD, (2) release of corepressors, (3) conformational change in H-12, and (4) recruitment of coactivators. Our data suggest a model in which the second and third steps can be visualized as a multistep process that starts with ligand binding and passes through an intermediate stage before creating a new surface for classical coactivator interaction. In this model, the intermediate change represents a stage where the AF-2 domain undergoes a conformational change that may be enough to release corepressors but which cannot yet bind to classical co-
activators. Upon ligand binding, the conformational change that allows H-12 to bind coactivators is stabilized by many electrostatic interactions, one of which is between E420 and K264. We propose that when E420 is mutated, H-12 can assume a conformation that allows interaction with b-catenin, but not with classical VDR coactivators (such as DRIP205). The structural studies of liganded VDR and our predicted structure of apo-VDR show that E420 is close to K264 in the presence of ligand but distant in its absence. Even though E420K VDR can bind ligand and presumably release corepressors, it cannot undergo the complete conformational change required for the recruitment of classical coactivators; however, this change is enough for b-catenin interaction (Figure 7). Consequently, E420Q VDR can interact with b-catenin, and the resulting complex can transactivate heterologous and VDRE-containing promoters. When b-catenin interacts with the wt VDR, it must compete with other VDR coactivators to interact with VDR. Consistent with this, our data show that b-catenin interaction with wt VDR is significantly less efficient than with the E420Q mutant form. Interestingly, antagonists, which block the VDRE-directed activity of the VDR and recruitment of classical coactivators, do allow VDR to interact with b-catenin, which strongly suggests that such antagonistic ligands (and perhaps other nonclassical ligands) would permit those functions of the VDR that involve b-catenin interaction. These data further suggest that in the development of vitamin D analogs, one should measure not only VDR activity but also VDR/b-catenin interaction and b-catenin signaling. The newly discovered role of wnt/b-catenin activity in bone development makes this even more important (Glass et al., 2005).
Molecular Cell 808
Experimental Procedures Plasmids Expression vectors for VDR, VDRDAF2, L417S and E420Q VDR, VDRE, and Gal4-VDR wt (118–427, D 166–216) were described earlier (Jimenez-Lara and Aranda, 1999; Rochel et al., 2001). b-catenin wt, S37A b-catenin, DN-b2cat/VP16 (553–781), TOPFlash, FOPFlash, renilla luciferase, Gal4-luciferase, and p300 are described in (Shah et al., 2003). 24-hydroxylase-luciferase was kindly provided by Jack Omdahl, University of New Mexico (Narvaez et al., 2003). To generate the L417S point mutation in the Gal4 background, we used the following primers: forward, 50 -AAGCTAACGCCCTCTGTG CTCGAAGTG-30 , and reverse, 50 - TTCGATTGCGGGAGACACGAG CTTCAC-30 , and for E420Q, forward, 50 -CCCCTTGTGCTCCAAGTGT TTGGCAAT-30 , and reverse, 50 -GGGGAACACGAGGTTCACAAACC GTTA-30 . To construct VP16/b-catenin, full-length b-catenin was amplified by PCR from pcDNA-b-catenin-FLAG and cloned into the pCMXVP16 vector by using 50 -GAGCTCGGATCCAGCCCGATCGGTAC CT-30 and 50 -ACTAGTGGATCCTTAGGCGTAGTCGGGGA-30 as the forward and reverse primers, respectively. VP16 b-catenin (553– 781), VP16 b-catenin (1–575), and p300 plasmids are described in Hecht et al. (2000). Lysine mutants of wt b-catenin, VP16 b-catenin (553–781) were made by using the following primers: forward, 50 -TCTGAGGACATGCCACAAGATTACATGATACGGCTT-30 , and reverse, 30 -TGAAAGCCGTATCATGTAATCTTGTGGCATGTCCT CAGT-50 , respectively. To generate VP16/b-catenin (553–664), we introduced stop codons by using: forward, 50 -CGAATGTCTTAGGACAAGCCA-30 , and reverse, 30 -TGGCTTGTCCTAAGACATTCG-50 , primers. VP16/ b-catenin (637–781) was generated from VP16/b-catenin (553–781) by removing residues 553–636. All the mutants were generated by site-directed mutagenesis using the Gene Editor system (Promega Corp., Madison, WI). pCMX-VP16 vectors were kindly provided by Ronald Evans.
Antibodies An anti-b-catenin monoclonal antibody (Transduction Labs) was used for immunocytochemistry (1:100) and Western blotting (1:500). An anti-b-catenin polyclonal antibody, SHB7 (David Rimm, Yale University, New Haven, CT), was used for immunocytochemistry (1:500) and immunoprecipitation. An anti-E-cadherin monoclonal antibody (Transduction Labs) and VE-cadherin monoclonal antibodies (Immunotech) were used for immunocytochemistry (1:100). In Western blots, we used VDR polyclonal antibodies (1:250) (Neomarker), a acetyl lysine polyclonal (1:500) (Upstate Biotech.), and a tubulin monoclonal antibodies (1:1000) (Sigma). All antibodies were diluted in 5% skim milk in phosphate-buffered saline for Western blotting or 6% normal goat serum for immunocytochemistry.
Cell Culture and Treatment SW480, SKBR-3, and HEK 293 cells are described in Shah et al. (2003). NCI-H28 cells were obtained from Dr. Robert Shoemaker, and VDR+/+ and VDR2/2 cells are described in Zinser et al. (2003). VDR+/+ and VDR2/2 cells were grown in DMEM/F-12 with 5% FBS, and NCI-H28 cells were grown in 1640 RPMI with 10% FBS. 1,a, 25-dihydroxy vitamin D3 (1,25D) was obtained from Sigma. TEI9647 is described in Mizwicki et al. (2004), and ZK 159222 was provided by Dr. Ekkehard May. To study the effects of 1,25D, TEI-9647, and ZK, cells were treated with the indicated concentration of each or with vehicle for 24 hr.
Transient Transfection and Reporter Assays Cells were seeded in 12-well plates at 1 3 105 cells per well and were transiently transfected by using FuGene 6 (Roche). Generally, 100 ng of expression vector and 150 ng TOPFlash/VDRE-luc/Gal4-luc vectors and 40 ng renilla luciferase vector as an internal control were transfected. Cells were treated with 1,25D (1 mM) for 24 hr after 24 hr of transfection. Interactions between VDR and b-catenin were studied by using the mammalian two-hybrid system (Shah et al., 2003). Cells were treated with 1,25D or antagonists after
24 hr of transfection and luciferase activity measured after an additional 24 hr. After treatment, cells were harvested and lysed in passive lysis buffer, and luciferase activity was measured by using a luminometer (LB 96v, Berthold). In Vitro Acetylation and ChIP Assays Acetylation assays were carried out as described earlier (Dornan et al., 2003). Briefly, 20 ml of reaction mixture (50 mM Tris$HCl, pH 8.0/10% glycerol [vol/vol]/0.1 mM EDTA/1 mM DTT/10 mM Na butyrate[1-14C]acetyl CoA, or 500 nM acetyl CoA [Sigma]) was incubated with 50 ng of histone protein, b-catenin, or mutated b-catenin with or without purified p300. To measure incorporation, the mixture was blotted on 3 mm Whatman filter paper and washed several times with acetone. The resulting filter paper was dried and subjected to detection of radiolabeled acetyl group by using a g counter. The results are represented as relative incorporation of 14C. ChIP was performed as previously described by using HEK-293 cells transfected with wt b-catenin, K671/72-mutated b-catenin, and TOPFlash constructs (Hulit et al., 2004). Molecular Modeling VDR crystal structures (PDB code, 1DB1) were visualized and analyzed by using SYBYL7.0 (Tripos, Inc. St. Louis). A homology model of the VDR apo structure was generated by using the program MODELLER-7v2 (Sali and Blundell, 1993; Thompson et al., 1994). Input alignment for MODELLER was obtained with ClustalW based on the sequence of the human VDR ligand binding domain (1DB1). Because there is no crystal structure of the VDR in its apo conformation, we used the retinoic acid X receptor (RXR) apo conformation (1LBD) as a template for our structural analysis. The model was refined further by the energy minimization routine of the DISCOVER module of INSIGHT II (Accelrys Inc., San Diego, CA, USA). The quality of the refined model was checked with PROCHECK and images produced by using the SYBYL7.0 and UCSF Chimera package from the Computer Graphics Laboratory, University of California, San Francisco (Goddard et al., 2005; Laskowski et al., 1993). Molecular Docking Structures of 1,25 D, ZK 159222 [butyl-(5z,7e,22e)-(1s,3r,24r)-1,3,24trihydroxy-26,27-cyclo-9,10(19),22-tetraene-25-carboxylate], TEI9647 [25-dehydro-1 a, 25-(OH)2-D3-26,23R-lactone] were constructed using SYBYL7.0. Initial geometric optimizations of these ligands were carried out by using the standard MMFF94 force field, with a 0.001 kcal/mol energy gradient convergence criterion and a distance-dependent dielectric constant employing Gasteiger charges. Additional geometric optimizations were performed by using the semiempirical method molecular orbital package (MOPAC). VDR cavity residues were identified based on the available crystal structure binding model for vitamin D ligand [5-{2-[1-(5-hydroxy1,5-dimethyl-hexyl)-7a-methyl-octahydro-inden-4-ylidene]-ethylidene}4-methylene-cyclohexane-1,3-diol] (1DB1). Molecular docking was performed by using the FlexX program of SYBYL7.0. Because of the steric clash of the extended side chains with H3 and H12, we first docked the calcipotriol skeletons into the VDR crystal structure. The ligands with extended side chains were superimposed, and the binding orientation of 1DB1 ligand and the orientation of extended side chains were manually adjusted. Supplemental Data Supplemental Data include Supplemental Experimental Procedures, Supplemental References, and two figures and can be found with this article online at http://www.molecule.org/cgi/content/full/21/6/ 799/DC1/. Acknowledgments The authors wish to acknowledge the support of National Institutes of Health grants DK058196 and U54 CA100971 (S.W.B.), the AACRBristol Myers Squibb Translational Fellowship in Colon Cancer (S.S.), and the following LCCC Core Facilities: macromolecular analysis, microscopy, and tissue culture. The authors are also grateful to A. Steinmeyer (Schering AG) for providing ZK159222 and to the reviewers of this manuscript who provided several important insights.
Vitamin D Receptor and b-Catenin Interaction 809
Received: January 30, 2005 Revised: December 12, 2005 Accepted: January 30, 2006 Published: March 16, 2006
MCF-7 Vitamin D3-resistant variant can be sensitized by TPA. J. Steroid Biochem. Mol. Biol. 84, 199–209. Nelson, W.J., and Nusse, R. (2004). Convergence of Wnt, betacatenin, and cadherin pathways. Science 303, 1483–1487.
Carlberg, C. (2003). Molecular basis of the selective activity of vitamin D analogues. J. Cell. Biochem. 88, 274–281.
Palmer, H.G., Gonzalez-Sancho, J.M., Espada, J., Berciano, M.T., Puig, I., Baulida, J., Quintanilla, M., Cano, A., de Herreros, A.G., Lafarga, M., and Munoz, A. (2001). Vitamin D(3) promotes the differentiation of colon carcinoma cells by the induction of E-cadherin and the inhibition of beta-catenin signaling. J. Cell Biol. 154, 369–387.
Carlberg, C. (2004). Ligand-mediated conformational changes of the VDR are required for gene transactivation. J. Steroid Biochem. Mol. Biol. 89–90, 227–232.
Rochel, N., Wurtz, J.M., Mitschler, A., Klaholz, B., and Moras, D. (2000). The crystal structure of the nuclear receptor for vitamin D bound to its natural ligand. Mol. Cell 5, 173–179.
Clevers, H. (2004). Wnt breakers in colon cancer. Cancer Cell 5, 5–6.
Rochel, N., Tocchini-Valentini, G., Egea, P.F., Juntunen, K., Garnier, J.M., Vihko, P., and Moras, D. (2001). Functional and structural characterization of the insertion region in the ligand binding domain of the vitamin D nuclear receptor. Eur. J. Biochem. 268, 971–979.
References
Daniels, D.L., and Weis, W.I. (2002). ICAT inhibits beta-catenin binding to Tcf/Lef-family transcription factors and the general coactivator p300 using independent structural modules. Mol. Cell 10, 573– 584. Dornan, D., Shimizu, H., Perkins, N.D., and Hupp, T.R. (2003). DNAdependent acetylation of p53 by the transcription coactivator p300. J. Biol. Chem. 278, 13431–13441. Easwaran, V., Pishvaian, M., Salimuddin, and Byers, S. (1999). Cross-regulation of beta-catenin-LEF/TCF and retinoid signaling pathways. Curr. Biol. 9, 1415–1418. Fu, M., Wang, C., Zhang, X., and Pestell, R.G. (2004). Acetylation of nuclear receptors in cellular growth and apoptosis. Biochem. Pharmacol. 68, 1199–1208.
Sali, A., and Blundell, T.L. (1993). Comparative protein modelling by satisfaction of spatial restraints. J. Mol. Biol. 234, 779–815. Shah, S., Pishvaian, M.J., Easwaran, V., Brown, P.H., and Byers, S.W. (2002). The role of cadherin, beta-catenin, and AP-1 in retinoid-regulated carcinoma cell differentiation and proliferation. J. Biol. Chem. 277, 25313–25322. Shah, S., Hecht, A., Pestell, R., and Byers, S.W. (2003). Trans-repression of beta-catenin activity by nuclear receptors. J. Biol. Chem. 278, 48137–48145.
Giovannucci, E., and Platz, E.A. (2005). Epidemiology of cancer risk: vitamin D and c. In Vitamin D, D. Feldman, J.W. Pike, and F.H. Glorieux, eds. (Burlington, MA: Elsevier Academic Press), pp. 1617– 1634.
Song, L.N., Herrell, R., Byers, S., Shah, S., Wilson, E.M., and Gelmann, E.P. (2003). Beta-catenin binds to the activation function 2 region of the androgen receptor and modulates the effects of the N-terminal domain and TIF2 on ligand-dependent transcription. Mol. Cell. Biol. 23, 1674–1687.
Glass, D.A., Bialek, P., Ahn, J.D., Starbuck, M., Patel, M.S., Clevers, H., Taketo, M.M., Long, F., McMahon, A.P., Lang, R.A., and Karsenty, G. (2005). Canonical Wnt signaling in differentiated osteoblasts controls osteoclast differentiation. Dev. Cell 8, 751–764.
Thompson, J.D., Higgins, D.G., and Gibson, T.J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680.
Goddard, T.D., Huang, C.C., and Ferrin, T.E. (2005). Software extensions to UCSF chimera for interactive visualization of large molecular assemblies. Structure 13, 473–482.
Tocchini-Valentini, G., Rochel, N., Wurtz, J.M., and Moras, D. (2004). Crystal structures of the vitamin D nuclear receptor liganded with the vitamin D side chain analogues calcipotriol and seocalcitol, receptor agonists of clinical importance. Insights into a structural basis for the switching of calcipotriol to a receptor antagonist by further side chain modification. J. Med. Chem. 47, 1956–1961.
Hecht, A., Vleminckx, K., Stemmler, M.P., Van Roy, F., and Kemler, R. (2000). The p300/CBP acetyltransferases function as transcriptional coactivators of beta-catenin in vertebrates. EMBO J. 19, 1839–1850. Hulit, J., Wang, C., Li, Z., Albanese, C., Rao, M., Di Vizio, D., Shah, S., Byers, S.W., Mahmood, R., Augenlicht, L.H., et al. (2004). Cyclin D1 genetic heterozygosity regulates colonic epithelial cell differentiation and tumor number in ApcMin mice. Mol. Cell. Biol. 24, 7598– 7611. Jimenez-Lara, A.M., and Aranda, A. (1999). Lysine 246 of the vitamin D receptor is crucial for ligand-dependent interaction with coactivators and transcriptional activity. J. Biol. Chem. 274, 13503–13510. Laskowski, R.A., Moss, D.S., and Thornton, J.M. (1993). Main-chain bond lengths and bond angles in protein structures. J. Mol. Biol. 231, 1049–1067. Malloy, P.J., Pike, J.W., and Feldman, D. (1999). The vitamin D receptor and the syndrome of hereditary 1,25-dihydroxyvitamin D-resistant rickets. Endocr. Rev. 20, 156–188. Malloy, P.J., Xu, R., Peng, L., Clark, P.A., and Feldman, D. (2002). A novel mutation in helix 12 of the vitamin D receptor impairs coactivator interaction and causes hereditary 1,25-dihydroxyvitamin D-resistant rickets without alopecia. Mol. Endocrinol. 16, 2538– 2546. Mizwicki, M.T., Keidel, D., Bula, C.M., Bishop, J.E., Zanello, L.P., Wurtz, J.M., Moras, D., and Norman, A.W. (2004). Identification of an alternative ligand-binding pocket in the nuclear vitamin D receptor and its functional importance in 1alpha,25(OH)2-vitamin D3 signaling. Proc. Natl. Acad. Sci. USA 101, 12876–12881. Moon, R.T., Kohn, A.D., De Ferrari, G.V., and Kaykas, A. (2004). WNT and beta-catenin signalling: diseases and therapies. Nat. Rev. Genet. 5, 691–701. Narvaez, C.J., Byrne, B.M., Romu, S., Valrance, M., and Welsh, J. (2003). Induction of apoptosis by 1,25-dihydroxyvitamin D3 in
Usami, N., Sekido, Y., Maeda, O., Yamamoto, K., Minna, J.D., Hasegawa, Y., Yoshioka, H., Imaizumi, M., Ueda, Y., Takahashi, M., and Shimokata, K. (2003). Beta-catenin inhibits cell growth of a malignant mesothelioma cell line, NCI-H28, with a 3p21.3 homozygous deletion. Oncogene 22, 7923–7930. Vanhooke, J.L., Benning, M.M., Bauer, C.B., Pike, J.W., and DeLuca, H.F. (2004). Molecular structure of the rat vitamin D receptor ligand binding domain complexed with 2-carbon-substituted vitamin D3 hormone analogues and a LXXLL-containing coactivator peptide. Biochemistry 43, 4101–4110. Zinser, G.M., McEleney, K., and Welsh, J. (2003). Characterization of mammary tumor cell lines from wild type and vitamin D3 receptor knockout mice. Mol. Cell. Endocrinol. 200, 67–80.
DOI 10.1016/j.molcel.2006.01.037
The Molecular Basis of Vitamin D Receptor and b-Catenin Crossregulation Salimuddin Shah,1,* Md Naimul Islam,1 Sivanesan Dakshanamurthy,1 Imran Rizvi,1 Mahadev Rao,1 Roger Herrell,1 Glendon Zinser,5 Meggan Valrance,5 Ana Aranda,2 Dino Moras,3 Anthony Norman,4 JoEllen Welsh,5 and Stephen W. Byers1,* 1 The Lombardi Comprehensive Cancer Center Georgetown University School of Medicine Washington, D.C. 20007 2 The Instituto de Investigaciones Biome´dicas Consejo Superior de Investigaciones Cientı´ficas and Universidad Auto´noma de Madrid 28029 Madrid Spain 3 IGBMC Laboratoire de Biologie et Genomique Structurales 67400 Illkirch France 4 Department of Biochemistry University of California, Riverside Riverside, California 92521 5 Department of Biological Sciences University of Notre Dame Notre Dame, Indiana 46556
The signaling/oncogenic activity of b-catenin can be repressed by activation of the vitamin D receptor (VDR). Conversely, high levels of b-catenin can potentiate the transcriptional activity of 1,25-dihydroxyvitamin D3 (1,25D). We show here that the effects of b-catenin on VDR activity are due to interaction between the activator function-2 (AF-2) domain of the VDR and C terminus of b-catenin. Acetylation of the b-catenin C terminus differentially regulates its ability to activate TCF or VDR-regulated promoters. Mutation of a specific residue in the AF-2 domain, which renders the VDR trancriptionally inactive in the context of classical coactivators, still allows interaction with b-catenin and ligand-dependent activation of VDREcontaining promoters. VDR antagonists, which block the VDRE-directed activity of the VDR and recruitment of classical coactivators, do allow VDR to interact with b-catenin, which suggests that these and perhaps other ligands would permit those functions of the VDR that involve b-catenin interaction.
breast, and prostate (for review see Giovannucci and Platz [2005]). The most active natural form of vitamin D, 1,25-dihydroxyvitamin D3 (1,25D), also inhibits cell proliferation and induces differentiation and apoptosis in a number of tumor cells; however, the use of 1,25D as a cancer chemopreventative agent in humans is limited by the accompanying hypercalcemia. Most of these effects of vitamin D depend upon its activation of the VDR. Indeed, hereditary vitamin D-dependent rickets (HVDDR) results from mutations in the VDR and is usually accompanied by hair and skin defects such as alopecia (Malloy et al., 1999). VDR is a member of a nuclear receptor subfamily, which forms heterodimers with RXR and which, like other nuclear receptors, contains an AF-2 domain that undergoes ligand-induced conformational change. Direct regulation of gene expression by VDR depends on the presence of vitamin D responsive elements (VDREs) in the promoters of target genes. However, some vitamin D-regulated genes do not contain VDREs in their promoters and are thought to be regulated indirectly. Thus, not only can vitamin D/VDR affect gene expression by binding to VDREs but it can also regulate other pathways. One such pathway that is clearly regulated this way by nuclear receptors is the wnt pathway, which affects gene expression through b-catenin. b-catenin, a multifunctional protein, is required for cell-cell adhesion and for regulation of gene expression in response to wnt signaling (for reviews see Clevers [2004], Moon et al. [2004], and Nelson and Nusse [2004]). Retinoic acid, androgen, and 1,25D acting through the appropriate nuclear receptor can transrepress b-catenin/TCF signaling (Easwaran et al., 1999; Palmer et al., 2001; Shah et al., 2003; Song et al., 2003). b-catenin can also potentiate the ligand-dependent activation of RAR, VDR, and AR-regulated promoters. In this study, we show that acetylation of the b-catenin C terminus differentially regulates the ability of b-catenin to activate TCF and VDR-regulated promoters. In addition, we identify a specific residue in the AF-2 domain that renders the VDR transcriptionally inactive in the context of classical coactivators but still allows interaction with b-catenin and ligand-dependent activation of VDREcontaining promoters. Remarkably, this mutation is present in families that exhibit HVDDR without the other manifestations of vitamin D deficiency and provides an insight into the molecular basis of the differential effects of vitamin D receptor mutations on b-catenin signaling.
Introduction
Results
Vitamin D is the preventive agent of nutritional rickets, a defect in bone development due to inadequate uptake of dietary calcium. Epidemiological studies point to alterations in active vitamin D levels being responsible for the protective effects of sunlight exposure on the incidence of several cancers, including those of the colon,
The b-Catenin C Terminus Is Required for b-Catenin/VDR Interactions To study the region of b-catenin involved in its interaction with VDR, we performed mammalian two-hybrid assays by using Gal4/VDR (118–427) and a variety of VP16/ b-catenin constructs (Figure 1A). Wild-type (wt) b-catenin/VP16 significantly increased Gal4/VDR activity only in the presence of ligand, whereas C-terminal-deleted b-catenin/VP16 was unable to interact with Gal4/VDR
Summary
*Correspondence: [email protected] (S.S.); byerss@georgetown. edu (S.W.B.)
Molecular Cell 800
Figure 1. The C Terminus of b-Catenin Is Required for VDR/b-Catenin Interaction (A) b-catenin/VP16 and Gal4/VDR constructs. (B) Gal4-luciferase activity was measured in HEK293 cells transfected with the indicated plasmids and treated with 1,25D. (C) HEK293 cells were transfected with the indicated plasmids, and b-catenin detected by using anti-VP16 antibodies (3400). (D) Amino acid sequence comparison for putative acetylation motifs (bold KK represents lysines 671/72 in b-catenin). (E) Purified b-catenin C terminus, lysine-mutated 671/72L b-catenin, and histone proteins were separately mixed with p300 and C14 acetyl CoA. The reaction was stopped after 60 min, and C14 acetyl incorporation was measured. (F) Cells were transfected with full-length wt b-catenin/FLAG and lysine-mutated 671/72 b-catenin/FLAG. Twenty-four hours after transfection, cells were harvested and 400 mg of total protein was immunoprecipitated by using FLAG antibodies and acetylated b-catenin detected by Western blot. Error bars represent the SEM of three to four independent experiments.
Vitamin D Receptor and b-Catenin Interaction 801
(Figure 1B). b-catenin that contains only arm repeats 10–12 and the C terminus fused to VP16 interacted better than full-length b-catenin. Furthermore, when the arm 10–12 region was removed, the remaining C terminus was still able to interact with VDR in a ligand-dependent manner. Although it is clear that C-terminal-deleted b-catenin cannot interact with VDR, it is formally possible that this may simply be because it may not translocate to the nucleus. However, there is no difference in the distribution of any of the b-catenin proteins used in the study (Figure 1C). Acetylation of b-Catenin Lysines 671 and 672 Alters b-Catenin/VDR and b-Catenin/TCF Interaction In contrast to the role of the armadillo repeat region of b-catenin in mediating protein-protein interactions, no obvious interaction domains are present in the C-terminal region of b-catenin. Weiss et al. also found that the purified C terminus behaves as an extended unstructured peptide upon gel filtration (Daniels and Weis, 2002). However, upon analysis, we found a sequence, 670-YKKR-673, that is similar to acetylation motifs in other proteins that are regulated by acetylation (Figure 1D and Fu et al. [2004]). To test if the lysine residues in the 670-YKKR-673 motif can be acetylated, in vitro acetylation assays were performed on wt b-catenin and 671/672 (K to L) mutated b-catenin in the presence of the histone acetyl transferase p300. b-catenin acetylation by p300 decreased significantly (w70%) by mutation of lysine 671/672 (Figures 1E and 1F). These results establish that the 670-YKKR-673 motif in the C-terminal region of b-catenin is an important site for acetylation by p300 and perhaps by other histone acetyl transferases. Although the C terminus of b-catenin is not directly involved in binding to TCF, it is essential for activation of TCF-mediated transcription and, together with the N terminus, is involved in the recruitment of histone acetyl transferases such as p300 to the b-catenin/TCF complex (Shah et al., 2003). If the acetylation status of the b-catenin C terminus determines its ability to activate TCF or bind to VDR, then one would anticipate that mutation of lysines 671/672 would alter the ability of b-catenin to regulate VDR-mediated transactivation. Although interaction of the K671/672L mutant protein with the VDR was significantly reduced, it was approximately four times more active than wt b-catenin and as active as the stable S37A form in regulating the activity of the TCF-responsive reporter TOPFlash (Figures 2A and 2B). The lysine mutations did not alter the distribution or steady-state protein levels of b-catenin (Figure 2B, inset, and Figure 2C). We showed previously that p300 modestly increased the activation of a Gal4 promoter by Gal4-b-catenin but did so to a greater extent in the absence of the b-catenin C terminus (Shah et al., 2003). These data indicate that p300-mediated acetylation of the b-catenin C terminus is not necessary for and may actually inhibit b-catenin transactivation. Consistent with these data, chromatin immunoprecipitation (ChIP) assays showed that 671/ 672 (K to L)-mutated b-catenin was recruited to the TopFlash promoter construct as well as b-catenin (Figure 2D). Exogenous expression of p300 potentiated the ability of both full-length and K671/672L mutant b-catenin to activate TopFlash (Figure 2E). In contrast, p300
had little effect on the ability of wt or K671/672L-mutated b-catenin to interact with VDR (Figure 2F). Taken together, these data indicate that the acetylation status of the b-catenin C terminus differentially regulates its ability to activate TCF and to interact with VDR. 1,25D Repression of b-Catenin Signaling Is Cadherin Independent and VDR Dependent Previous studies have established the ability of 1,25D and E-cadherin to repress b-catenin signaling (Easwaran et al., 1999; Palmer et al., 2001; Shah et al., 2003). Because E-cadherin can inhibit the signaling activity of b-catenin, it is possible that the repressive effect of 1,25D is indirectly due to increased E-cadherin expression. To directly test the role of E-cadherin in mediating the effects of 1,25D, experiments were performed with SKBR-3 cells, which have a homozygous deletion of the E-cadherin gene. 1,25D repression of b-catenin signaling was equivalent in E-cadherin-positive cells and in E-cadherin-negative SKBR3 cells (Figure S1 available in the Supplemental Data with this article online). To test the role of the VDR in mediating the effects of 1,25D on b-catenin signaling, we used mammary tumor cells derived from VDR+/+ and VDR2/2 mice and measured VDR (VDRE-luc) and b-catenin (TOPFlash) reporter activities (Zinser et al., 2003). As expected, 1,25D treatment increased VDR reporter activity in VDR+/+ cells, but not in VDR2/2 cells (Figure S1). b-catenin activity was decreased in VDR+/+ cells after 1,25D treatment but was unaffected in VDR2/2 cells (Figure 3A). 1,25D-Mediated Activation of VDR Reporter Is Attenuated in b-Catenin2/2 Cells To formally test if endogenous b-catenin plays a role in VDR activation by 1,25D, we used H28 mesothelioma cells, which have a homozygous deletion of the b-catenin gene (Usami et al., 2003). H28 cells express significant levels of VDR but are only slightly responsive to 1,25D activation of the VDR reporter. However, after transfection of b-catenin, VDR activation by 1,25D was significantly increased, suggesting a role for b-catenin in the activity of VDR (Figure 3B). Additionally, 1,25D treatment was able to repress TOPFlash activity in H28 cells transfected with full-length b-catenin (Figure S2). Potentiation of VDR Reporter Activity by b-Catenin Is Dependent on the AF-2 Domain of the VDR The AF-2 domain is required for interaction with coactivators, and deletion of this domain renders VDR transcriptionally inactive on VDRE-containing promoters. The ability of 1,25D to repress b-catenin signaling is also dependent on the AF-2 domain (Shah et al., 2003). We next wanted to know if the AF-2 domain is required for b-catenin-mediated potentiation of VDR activity. b-catenin expression significantly potentiated VDREcontaining reporter activity both in control cells and in VDR-transfected cells (Figure 3C). However, the activity of AF-2-mutated VDR was unaffected. These results indicate that the b-catenin-mediated potentiation of VDR activity on a synthetic VDRE-containing reporter requires the AF-2 domain. To study the effects of b-catenin on a naturally occurring VDR responsive promoter, we used a 24-hydroxylase (CYP24) reporter construct. The effects of b-catenin on CYP24 reporter activity
Molecular Cell 802
Figure 2. Lysines 671 and 672 of the b-Catenin C Terminus Are Important for b-Catenin/VDR Interactions (A) HEK 293 cells were transfected with the indicated plasmids; treated with 1,25D 24 hr after transfection, and Gal4-luciferase activity was measured. Data are represented as relative luciferase units. (B) Activity of b-catenin wt, S37A, and (K671/72L) was measured by using TOPFlash. Inset, b-catenin levels in lysates from wt, S37A, and K671/ 72L-b-catenin-transfected cells. (C) Immunocytochemistry was performed to detect the localization of wt and K671/72L b-catenin (3400). (D) HEK293 cells were transfected with wt b-catenin/FLAG, K671/72L-mutated b-catenin/FLAG, and TOPFlash plasmids. Forty-eight hours after transfection, cells were harvested and prepared for ChIP. (E) HEK293 cells were transfected with b-catenin, K671/72L b-catenin, and p300. Twenty-four hours after transfection, luciferase activity was measured. (F) HEK293 cells were transfected with Gal4/VDRwt, b-catenin, K671/72L b-catenin, and p300. Cells were treated with 1,25D for 24 hr and luciferase activity measured. Data are represented as relative luciferase units. Error bars represent the SEM of three to four independent experiments.
were identical to the VDRE-containing reporter (Figure 3D). Taken together, these results indicate that b-catenin-mediated potentiation of VDR activity depends on the AF-2 domain of the VDR and is not promoter specific.
Discriminatory Effects of AF-2 Mutants on b-Catenin/VDR Interactions Many mutations of the VDR have been discovered in families with HVDRR. Most of these patients exhibit the dual phenotype of rickets and epidermal defects
Vitamin D Receptor and b-Catenin Interaction 803
Figure 3. b-Catenin-Mediated Potentiation of VDR Reporter Activity Is AF-2 Dependent (A) VDR+/+ or VDR2/2 mouse mammary epithelial cells were transfected with TOPFlash and renilla luciferase and treated with 1 mM 1,25D for 24 hr. Inset, b-catenin in VDR+/+ and VDR2/2 cells. (B) b-catenin null NCI-H28 cells were transfected with b-catenin and VDRE-luciferase and renilla luciferase. Twenty-four hours after transfection, cells were treated with 1,25D for another 24 hr and luciferase activity measured. (C) SKBR-3 cells were transfected with wt VDR, AF2-deleted VDR (VDR DAF-2), and S37A-mutated form of b-catenin. VDRE-luciferase activity was measured after 24 hr treatment with 1,25D. (D) Same as in (A) except with 24ahydroxyase-luciferase. Activity is expressed as relative luciferase units. Error bars represent SEM of three to four independent experiments.
such as alopecia; however, a few mutations result only in rickets (Malloy et al., 2002). To fully understand any differential effects of these mutations within the AF-2 domain (Figure 4A), we first used molecular modeling tools to identify residues that are appropriately placed to mediate the ligand-dependent interaction of VDR with b-catenin. The liganded VDR (1DB1 and 1RK3) and RXR (1FBY) structures were retrieved from the PDB database. The structure of the apo-VDR was predicted as described in the Experimental Procedures. The liganded and apo structures were superimposed by using SYBYL7.0 (Figures 4B–4D). E420 of helix-12 and K264 of helix-5 were mapped in the superimposed structures. In the predicted apo structure of the VDR, E420 and K264 are far apart, whereas in the liganded structure, both E420 and K264 interact with each other through a salt bridge to stabilize H-12 (Figures 4B and 4C) (Rochel et al., 2000). Figure S3 in the Supplemental Data presents an animation of the liganded and apo-VDR and may aid in orientation. In the presence of ligand and DRIP 205, E420 interacts with M629 and L630, and K264 interacts with H627 of DRIP 205 (Vanhooke et al., 2004). These data point to roles for E420 and K264 in mediating the conformational change underlying the ligand-dependent interaction of VDR with coactivators such as DRIP 205. To identify the AF-2 domain amino acid(s) potentially involved in VDR/b-catenin interaction, we mutated amino acids based on their involvement in polar and nonpolar interactions. Analysis of VDR crystal structures indicated that all but three of the amino acids in the AF-2 domain are involved in interhelical bonds. We first mutated L417, an amino acid that is primarily involved in
interhelical bonding to maintain the helical structure of H-12, and E420 (see above; Figures 4B–4D). Previous studies showed that mutation of VDR L417 or 420 impairs its ability to transactivate and interact with classical coactivators (Jimenez-Lara and Aranda, 1999; Malloy et al., 1999). However, both mutants are able to bind ligand and heterodimerize with RXR. We confirmed that L417S-mutated VDR could not activate a VDREcontaining promoter (Figure 5A) and showed that unlike wt VDR it was not able to interact with b-catenin in immunoprecipitaiton or mammalian two-hybrid assays (Figures 5B and 5C). In contrast, mutation of E420Q does not affect interactions with b-catenin (Figures 5B and 5C) but completely abrogates the ability of the VDR to activate VDRE-containing promoters (Malloy et al., 1999) (Figure 5A). As described above, a salt bridge between E420 and K264 maintains the liganded VDR in a closed conformation suitable for interaction of VDR with classical coactivators. As E420Q VDR can bind to b-catenin, this strongly suggests that the E420/K264 salt bridge is not necessary for VDR/b-catenin interaction. To test if K264 has a role independent of the salt bridge required for interaction with E420, we mutated K264 to A. As expected, this mutation rendered the VDR inactive on VDRE; however, unlike mutation of E420, K264A or the double mutant was unable to interact with b-catenin (Figure 5A). Similar results were obtained after mutation of K246 (H-3), which anchors classical coactivators at the opposite end of the coactivator binding pocket (data not shown). Taken together, these data suggest that naturally occurring mutations in the VDR AF-2 domain may result in the recruitment of different classes
Molecular Cell 804
porter activity (Malloy et al., 2002). Consistent with our model, b-catenin does not allow the K264A VDR to activate VDRE-containing promoters (Figure 5C). Furthermore, the ligand dependence of b-catenin/wt VDR or b-catenin/E420QVDR interaction indicates that the orientation of K264 is important for its interaction with b-catenin. Although E420 is not required for VDR/b-catenin interaction, we wondered if the neighboring E425 could fulfill this function in its absence. This proved not to be the case, as an E425Q mutation had no effect on ligand-dependent VDRE activation or on VDR/b-catenin interaction (Figures 5C and 5E). However, this mutation did result in a 3-fold increase in VDRE activation in the absence of ligand, perhaps indicating that this residue is important for corepressor binding.
Figure 4. Spatial Configuration of Amino Acids within the AF-2 Domain of VDR (A) Schematic representation of the VDR. The highlighted amino acids are L417 and E420. (B) Structure of liganded VDR (1DB1). (C) Predicted apo-VDR structure. (D) Superimposed image of liganded and apo-VDR structures.
of coactivator (e.g., b-catenin, but not DRIP205). The differential effects of mutation of E420Q and K264 on VDR/ classical coactivator and VDR/b-catenin interaction can be explained by a model in which mutation of E420 partially disrupts the closed conformation, whereas it is completely disrupted by K264 mutation. A logical extension of this hypothesis is that VDR activation by classical coactivators requires H-12 in full agonist (closed) conformation, whereas b-catenin can interact with VDR even if H-12 is in its partial agonist conformation. If this is true then, unlike classical coactivators, b-catenin should allow the E420-mutated VDR to activate VDREcontaining promoters in the presence of ligand. Figure 5D clearly demonstrates that this is the case. Similar experiments have shown that coexpression of DRIP205 and E420Q VDR cannot activate VDRE-containing re-
VDR Antagonists Allow Interaction of Wt, but Not L417S or E420Q Mutant Forms of VDR with b-Catenin Our data demonstrate that b-catenin is able to interact with and activate VDR under conditions in which other coactivators do not. Similarly, several vitamin D analogs can bind to the VDR and promote corepressor release but do not allow recruitment of classical coactivators (Carlberg, 2004). VDR activation by classical coactivators and by b-catenin is ligand dependent, thus indicating that agonist-induced release of corepressor is required for b-catenin activation of the VDR. To test the hypothesis that even though antagonist bound VDR cannot recruit typical VDR coactivators upon corepressor release it may still allow VDR interaction with b-catenin, we performed experiments with vitamin D analogs ZK159222 and TEI9647. ZK159222 contains a 25-carboxylic ester moiety in the flexible chain (Figure 6A), whereas TEI9647 shares the calcipotriol skeleton but contains a cyclic extension at the 25-position. Depending on the length and the structure of side chain extension, this class of ligand can act as a partial agonist or partial antagonist. Docking of TEI9647 (pink) in the VDR reveals that the chain extending from position 25 clashes with helix H3 and H12 and more specifically with Leu230, Val234, F422, V418, and L417 and suggests that the activation helix will not be optimally positioned (Figures 6B and 6C). The long aliphatic chain of ZK159222 (green) partially disrupts the ligand-induced close conformation of H12, but because of the position of its aliphatic chain within the hydrophobic cavity, it still allows some interaction with coactivators (20% of 1,25D), which would explain the partial agonist activity of this compound (Carlberg, 2003; Tocchini-Valentini et al., 2004). Consequently, ZK159222 and TEI9647 bind well to the VDR but do so in a way that interferes with helix-12 and does not allow it to take a position optimal for coactivator recruitment, even though they do allow corepressor release (Carlberg, 2003). We first performed VDR reporter assays to compare their activity with 1,25D and determined the dose response of inhibition by ZK159222 of 1,25D-activated VDRE reporter activity (Figures 6D and 6E). Wt VDR can interact with b-catenin when it is bound to either agonist (1,25D) or partial antagonist (ZK159222 and TEI9647; Figure 6F). Consistent with our other data, the L417S form of VDR cannot interact with b-catenin when bound to either agonist or partial antagonist. Interestingly, the E420Q mutant can interact with b-catenin only in the presence of
Vitamin D Receptor and b-Catenin Interaction 805
Figure 5. b-Catenin Can Interact with Wt and E420Q VDR, but Not with L417S or K264A VDR (A) HEK293 cells were transfected with the indicated plasmids and VDRE-luciferase reporter, treated with 1,25D for 24 hr, and luciferase activity measured. (B) b-catenin association with VDR immunoprecipitated from wt, L417S, and E420Q VDR-transfected cells. (C) HEK293 cells were transfected with the indicated plasmids and GAL4 reporter, treated with 1,25D for 24 hr, and luciferase activity measured. (D) HEK293 cells were transfected with the indicated plasmids and VDRE reporter, treated with 1,25D for 24 hr, and luciferase activity measured. (E) HEK293 cells were transfected with the indicated plasmids and VDRE reporter, treated with 1,25D for 24 hr, and luciferase activity measured. Activity is expressed as relative luciferase units. Error bars represent the SEM of three to four independent experiments.
agonist (1,25D), but not in the presence of partial antagonists. Thus, ZK159222 and TEI9647 may act synergistically with E420Q to result in an H-12 conformation that does not allow binding with b-catenin or classical coactivators. Alternatively, the failure of antagonist bound E420Q VDR to interact with b-catenin may be a result of the inability of the antagonist to allow the appropriate
conformational change necessary to release corepressors (Carlberg, 2004). Discussion Our data show that specific residues in the AF-2 domain of the VDR can discriminate between its classical
Molecular Cell 806
Figure 6. Vitamin D3 Antagonists Allow Interaction of Wt VDR with b-Catenin (A) Side chains of 1,25D, ZK159222, and TEI9647. (B) 1,25D (magenta), ZK159222 (green), and TEI9647 (pink) were docked onto the liganded VDR structure (1BD1). (C) VDR surface influenced by the side chains of ZK159222 (green) and TEI9647 (pink). (D) HEK 293 cells were transfected with VDREluciferase and renilla luciferase. Twenty-four hours after transfection, cells were treated with TEI9647 and ZK159222 (1027 M) for an additional 24 hr. (E) VDRE activity of 1,25D (100 nM) in the presence of varying concentrations of antagonist (10, 100, and 1000 nM concentration of ZK159222). (F) HEK293 cells were transfected with the indicated plasmids along with Gal4x5luciferase reporter plasmid and treated with agonist (1,25D) and antagonist (TEI9647 and ZK159222) (100 nM each) for an additional 24 hr. Luciferase activity was measured and plotted as relative light units. Error bars represent the SEM of three to four independent experiments.
activity and its ability to interact with b-catenin. HVDDR patients with a VDR mutation (E420Q/K) that allows interaction with b-catenin, but not activation of VDREcontaining genes, exhibit rickets but do not exhibit the other manifestations of vitamin D deficiency patients, such as alopecia (Malloy et al., 2002). Further experimentation is required to address if this is a causal relationship. Other experiments demonstrate that mutation of lysine residues that are acetylation targets in the b-catenin C-terminal domain differentially regulates b-catenin/TCF and b-catenin/VDR activity. 1,25D Interacts with the b-Catenin Signaling Pathway in Several Ways 1,25D inhibits the function of the b-catenin/TCF pathways and increases the expression of E-cadherin, a tu-
mor suppressor (Palmer et al., 2001; Shah et al., 2003). In other studies, we show that retinoic acid stimulates SKBR3 breast cancer cell differentiation by increasing cadherin expression (Shah et al., 2002). However, this pathway is not required for RA inhibition of b-catenin/ TCF signaling or cell proliferation. Similarly, although 1,25D can increase E-cadherin expression in a sensitive subclone of SW480 cells, our results show that cadherin expression is not absolutely required to inhibit b-catenin/TCF signaling or proliferation. Indeed, 1,25D inhibits the growth of many cells without altering cadherin expression. These data indicate that the broad effects of 1,25D on the growth and differentiation of many different epithelial cancers may be explained by its ability to differentially regulate the activity of the VDR, E-cadherin, and b-catenin/TCF pathways.
Vitamin D Receptor and b-Catenin Interaction 807
Figure 7. Hypothetical Model Depicting Open and Closed VDR Confirmations
Mutation of b-Catenin C-Terminal Lysine Residues Inhibits VDR Interactions Mutation of the acetylation target lysines 671/672 inhibited b-catenin interaction with VDR but markedly potentiated its ability to coactivate TCF-sensitive reporters. Consequently, it is possible that a form of b-catenin that cannot interact with TCF might be more available to bind to and activate VDR. Consistent with this, we found that a mutant form of b-catenin with greatly reduced TCF binding activity (mutations at 312 and 345) is significantly better at activating VDR than wt b-catenin (data not shown). Specific Residues in the AF-2 Domain of the VDR Can Discriminate between Its Classical Activity and Its Ability to Interact with b-Catenin HVDRR patients have point mutations in the ligand binding domain and/or activation function domain (AF-2) of the VDR. Some HVDDR mutations lead to rickets even though they do not affect ligand binding; however, failure to bind ligand always results in both rickets and alopecia. Activation of the VDR by ligand may be envisaged in the following steps: (1) binding of ligand to the LBD, (2) release of corepressors, (3) conformational change in H-12, and (4) recruitment of coactivators. Our data suggest a model in which the second and third steps can be visualized as a multistep process that starts with ligand binding and passes through an intermediate stage before creating a new surface for classical coactivator interaction. In this model, the intermediate change represents a stage where the AF-2 domain undergoes a conformational change that may be enough to release corepressors but which cannot yet bind to classical co-
activators. Upon ligand binding, the conformational change that allows H-12 to bind coactivators is stabilized by many electrostatic interactions, one of which is between E420 and K264. We propose that when E420 is mutated, H-12 can assume a conformation that allows interaction with b-catenin, but not with classical VDR coactivators (such as DRIP205). The structural studies of liganded VDR and our predicted structure of apo-VDR show that E420 is close to K264 in the presence of ligand but distant in its absence. Even though E420K VDR can bind ligand and presumably release corepressors, it cannot undergo the complete conformational change required for the recruitment of classical coactivators; however, this change is enough for b-catenin interaction (Figure 7). Consequently, E420Q VDR can interact with b-catenin, and the resulting complex can transactivate heterologous and VDRE-containing promoters. When b-catenin interacts with the wt VDR, it must compete with other VDR coactivators to interact with VDR. Consistent with this, our data show that b-catenin interaction with wt VDR is significantly less efficient than with the E420Q mutant form. Interestingly, antagonists, which block the VDRE-directed activity of the VDR and recruitment of classical coactivators, do allow VDR to interact with b-catenin, which strongly suggests that such antagonistic ligands (and perhaps other nonclassical ligands) would permit those functions of the VDR that involve b-catenin interaction. These data further suggest that in the development of vitamin D analogs, one should measure not only VDR activity but also VDR/b-catenin interaction and b-catenin signaling. The newly discovered role of wnt/b-catenin activity in bone development makes this even more important (Glass et al., 2005).
Molecular Cell 808
Experimental Procedures Plasmids Expression vectors for VDR, VDRDAF2, L417S and E420Q VDR, VDRE, and Gal4-VDR wt (118–427, D 166–216) were described earlier (Jimenez-Lara and Aranda, 1999; Rochel et al., 2001). b-catenin wt, S37A b-catenin, DN-b2cat/VP16 (553–781), TOPFlash, FOPFlash, renilla luciferase, Gal4-luciferase, and p300 are described in (Shah et al., 2003). 24-hydroxylase-luciferase was kindly provided by Jack Omdahl, University of New Mexico (Narvaez et al., 2003). To generate the L417S point mutation in the Gal4 background, we used the following primers: forward, 50 -AAGCTAACGCCCTCTGTG CTCGAAGTG-30 , and reverse, 50 - TTCGATTGCGGGAGACACGAG CTTCAC-30 , and for E420Q, forward, 50 -CCCCTTGTGCTCCAAGTGT TTGGCAAT-30 , and reverse, 50 -GGGGAACACGAGGTTCACAAACC GTTA-30 . To construct VP16/b-catenin, full-length b-catenin was amplified by PCR from pcDNA-b-catenin-FLAG and cloned into the pCMXVP16 vector by using 50 -GAGCTCGGATCCAGCCCGATCGGTAC CT-30 and 50 -ACTAGTGGATCCTTAGGCGTAGTCGGGGA-30 as the forward and reverse primers, respectively. VP16 b-catenin (553– 781), VP16 b-catenin (1–575), and p300 plasmids are described in Hecht et al. (2000). Lysine mutants of wt b-catenin, VP16 b-catenin (553–781) were made by using the following primers: forward, 50 -TCTGAGGACATGCCACAAGATTACATGATACGGCTT-30 , and reverse, 30 -TGAAAGCCGTATCATGTAATCTTGTGGCATGTCCT CAGT-50 , respectively. To generate VP16/b-catenin (553–664), we introduced stop codons by using: forward, 50 -CGAATGTCTTAGGACAAGCCA-30 , and reverse, 30 -TGGCTTGTCCTAAGACATTCG-50 , primers. VP16/ b-catenin (637–781) was generated from VP16/b-catenin (553–781) by removing residues 553–636. All the mutants were generated by site-directed mutagenesis using the Gene Editor system (Promega Corp., Madison, WI). pCMX-VP16 vectors were kindly provided by Ronald Evans.
Antibodies An anti-b-catenin monoclonal antibody (Transduction Labs) was used for immunocytochemistry (1:100) and Western blotting (1:500). An anti-b-catenin polyclonal antibody, SHB7 (David Rimm, Yale University, New Haven, CT), was used for immunocytochemistry (1:500) and immunoprecipitation. An anti-E-cadherin monoclonal antibody (Transduction Labs) and VE-cadherin monoclonal antibodies (Immunotech) were used for immunocytochemistry (1:100). In Western blots, we used VDR polyclonal antibodies (1:250) (Neomarker), a acetyl lysine polyclonal (1:500) (Upstate Biotech.), and a tubulin monoclonal antibodies (1:1000) (Sigma). All antibodies were diluted in 5% skim milk in phosphate-buffered saline for Western blotting or 6% normal goat serum for immunocytochemistry.
Cell Culture and Treatment SW480, SKBR-3, and HEK 293 cells are described in Shah et al. (2003). NCI-H28 cells were obtained from Dr. Robert Shoemaker, and VDR+/+ and VDR2/2 cells are described in Zinser et al. (2003). VDR+/+ and VDR2/2 cells were grown in DMEM/F-12 with 5% FBS, and NCI-H28 cells were grown in 1640 RPMI with 10% FBS. 1,a, 25-dihydroxy vitamin D3 (1,25D) was obtained from Sigma. TEI9647 is described in Mizwicki et al. (2004), and ZK 159222 was provided by Dr. Ekkehard May. To study the effects of 1,25D, TEI-9647, and ZK, cells were treated with the indicated concentration of each or with vehicle for 24 hr.
Transient Transfection and Reporter Assays Cells were seeded in 12-well plates at 1 3 105 cells per well and were transiently transfected by using FuGene 6 (Roche). Generally, 100 ng of expression vector and 150 ng TOPFlash/VDRE-luc/Gal4-luc vectors and 40 ng renilla luciferase vector as an internal control were transfected. Cells were treated with 1,25D (1 mM) for 24 hr after 24 hr of transfection. Interactions between VDR and b-catenin were studied by using the mammalian two-hybrid system (Shah et al., 2003). Cells were treated with 1,25D or antagonists after
24 hr of transfection and luciferase activity measured after an additional 24 hr. After treatment, cells were harvested and lysed in passive lysis buffer, and luciferase activity was measured by using a luminometer (LB 96v, Berthold). In Vitro Acetylation and ChIP Assays Acetylation assays were carried out as described earlier (Dornan et al., 2003). Briefly, 20 ml of reaction mixture (50 mM Tris$HCl, pH 8.0/10% glycerol [vol/vol]/0.1 mM EDTA/1 mM DTT/10 mM Na butyrate[1-14C]acetyl CoA, or 500 nM acetyl CoA [Sigma]) was incubated with 50 ng of histone protein, b-catenin, or mutated b-catenin with or without purified p300. To measure incorporation, the mixture was blotted on 3 mm Whatman filter paper and washed several times with acetone. The resulting filter paper was dried and subjected to detection of radiolabeled acetyl group by using a g counter. The results are represented as relative incorporation of 14C. ChIP was performed as previously described by using HEK-293 cells transfected with wt b-catenin, K671/72-mutated b-catenin, and TOPFlash constructs (Hulit et al., 2004). Molecular Modeling VDR crystal structures (PDB code, 1DB1) were visualized and analyzed by using SYBYL7.0 (Tripos, Inc. St. Louis). A homology model of the VDR apo structure was generated by using the program MODELLER-7v2 (Sali and Blundell, 1993; Thompson et al., 1994). Input alignment for MODELLER was obtained with ClustalW based on the sequence of the human VDR ligand binding domain (1DB1). Because there is no crystal structure of the VDR in its apo conformation, we used the retinoic acid X receptor (RXR) apo conformation (1LBD) as a template for our structural analysis. The model was refined further by the energy minimization routine of the DISCOVER module of INSIGHT II (Accelrys Inc., San Diego, CA, USA). The quality of the refined model was checked with PROCHECK and images produced by using the SYBYL7.0 and UCSF Chimera package from the Computer Graphics Laboratory, University of California, San Francisco (Goddard et al., 2005; Laskowski et al., 1993). Molecular Docking Structures of 1,25 D, ZK 159222 [butyl-(5z,7e,22e)-(1s,3r,24r)-1,3,24trihydroxy-26,27-cyclo-9,10(19),22-tetraene-25-carboxylate], TEI9647 [25-dehydro-1 a, 25-(OH)2-D3-26,23R-lactone] were constructed using SYBYL7.0. Initial geometric optimizations of these ligands were carried out by using the standard MMFF94 force field, with a 0.001 kcal/mol energy gradient convergence criterion and a distance-dependent dielectric constant employing Gasteiger charges. Additional geometric optimizations were performed by using the semiempirical method molecular orbital package (MOPAC). VDR cavity residues were identified based on the available crystal structure binding model for vitamin D ligand [5-{2-[1-(5-hydroxy1,5-dimethyl-hexyl)-7a-methyl-octahydro-inden-4-ylidene]-ethylidene}4-methylene-cyclohexane-1,3-diol] (1DB1). Molecular docking was performed by using the FlexX program of SYBYL7.0. Because of the steric clash of the extended side chains with H3 and H12, we first docked the calcipotriol skeletons into the VDR crystal structure. The ligands with extended side chains were superimposed, and the binding orientation of 1DB1 ligand and the orientation of extended side chains were manually adjusted. Supplemental Data Supplemental Data include Supplemental Experimental Procedures, Supplemental References, and two figures and can be found with this article online at http://www.molecule.org/cgi/content/full/21/6/ 799/DC1/. Acknowledgments The authors wish to acknowledge the support of National Institutes of Health grants DK058196 and U54 CA100971 (S.W.B.), the AACRBristol Myers Squibb Translational Fellowship in Colon Cancer (S.S.), and the following LCCC Core Facilities: macromolecular analysis, microscopy, and tissue culture. The authors are also grateful to A. Steinmeyer (Schering AG) for providing ZK159222 and to the reviewers of this manuscript who provided several important insights.
Vitamin D Receptor and b-Catenin Interaction 809
Received: January 30, 2005 Revised: December 12, 2005 Accepted: January 30, 2006 Published: March 16, 2006
MCF-7 Vitamin D3-resistant variant can be sensitized by TPA. J. Steroid Biochem. Mol. Biol. 84, 199–209. Nelson, W.J., and Nusse, R. (2004). Convergence of Wnt, betacatenin, and cadherin pathways. Science 303, 1483–1487.
Carlberg, C. (2003). Molecular basis of the selective activity of vitamin D analogues. J. Cell. Biochem. 88, 274–281.
Palmer, H.G., Gonzalez-Sancho, J.M., Espada, J., Berciano, M.T., Puig, I., Baulida, J., Quintanilla, M., Cano, A., de Herreros, A.G., Lafarga, M., and Munoz, A. (2001). Vitamin D(3) promotes the differentiation of colon carcinoma cells by the induction of E-cadherin and the inhibition of beta-catenin signaling. J. Cell Biol. 154, 369–387.
Carlberg, C. (2004). Ligand-mediated conformational changes of the VDR are required for gene transactivation. J. Steroid Biochem. Mol. Biol. 89–90, 227–232.
Rochel, N., Wurtz, J.M., Mitschler, A., Klaholz, B., and Moras, D. (2000). The crystal structure of the nuclear receptor for vitamin D bound to its natural ligand. Mol. Cell 5, 173–179.
Clevers, H. (2004). Wnt breakers in colon cancer. Cancer Cell 5, 5–6.
Rochel, N., Tocchini-Valentini, G., Egea, P.F., Juntunen, K., Garnier, J.M., Vihko, P., and Moras, D. (2001). Functional and structural characterization of the insertion region in the ligand binding domain of the vitamin D nuclear receptor. Eur. J. Biochem. 268, 971–979.
References
Daniels, D.L., and Weis, W.I. (2002). ICAT inhibits beta-catenin binding to Tcf/Lef-family transcription factors and the general coactivator p300 using independent structural modules. Mol. Cell 10, 573– 584. Dornan, D., Shimizu, H., Perkins, N.D., and Hupp, T.R. (2003). DNAdependent acetylation of p53 by the transcription coactivator p300. J. Biol. Chem. 278, 13431–13441. Easwaran, V., Pishvaian, M., Salimuddin, and Byers, S. (1999). Cross-regulation of beta-catenin-LEF/TCF and retinoid signaling pathways. Curr. Biol. 9, 1415–1418. Fu, M., Wang, C., Zhang, X., and Pestell, R.G. (2004). Acetylation of nuclear receptors in cellular growth and apoptosis. Biochem. Pharmacol. 68, 1199–1208.
Sali, A., and Blundell, T.L. (1993). Comparative protein modelling by satisfaction of spatial restraints. J. Mol. Biol. 234, 779–815. Shah, S., Pishvaian, M.J., Easwaran, V., Brown, P.H., and Byers, S.W. (2002). The role of cadherin, beta-catenin, and AP-1 in retinoid-regulated carcinoma cell differentiation and proliferation. J. Biol. Chem. 277, 25313–25322. Shah, S., Hecht, A., Pestell, R., and Byers, S.W. (2003). Trans-repression of beta-catenin activity by nuclear receptors. J. Biol. Chem. 278, 48137–48145.
Giovannucci, E., and Platz, E.A. (2005). Epidemiology of cancer risk: vitamin D and c. In Vitamin D, D. Feldman, J.W. Pike, and F.H. Glorieux, eds. (Burlington, MA: Elsevier Academic Press), pp. 1617– 1634.
Song, L.N., Herrell, R., Byers, S., Shah, S., Wilson, E.M., and Gelmann, E.P. (2003). Beta-catenin binds to the activation function 2 region of the androgen receptor and modulates the effects of the N-terminal domain and TIF2 on ligand-dependent transcription. Mol. Cell. Biol. 23, 1674–1687.
Glass, D.A., Bialek, P., Ahn, J.D., Starbuck, M., Patel, M.S., Clevers, H., Taketo, M.M., Long, F., McMahon, A.P., Lang, R.A., and Karsenty, G. (2005). Canonical Wnt signaling in differentiated osteoblasts controls osteoclast differentiation. Dev. Cell 8, 751–764.
Thompson, J.D., Higgins, D.G., and Gibson, T.J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680.
Goddard, T.D., Huang, C.C., and Ferrin, T.E. (2005). Software extensions to UCSF chimera for interactive visualization of large molecular assemblies. Structure 13, 473–482.
Tocchini-Valentini, G., Rochel, N., Wurtz, J.M., and Moras, D. (2004). Crystal structures of the vitamin D nuclear receptor liganded with the vitamin D side chain analogues calcipotriol and seocalcitol, receptor agonists of clinical importance. Insights into a structural basis for the switching of calcipotriol to a receptor antagonist by further side chain modification. J. Med. Chem. 47, 1956–1961.
Hecht, A., Vleminckx, K., Stemmler, M.P., Van Roy, F., and Kemler, R. (2000). The p300/CBP acetyltransferases function as transcriptional coactivators of beta-catenin in vertebrates. EMBO J. 19, 1839–1850. Hulit, J., Wang, C., Li, Z., Albanese, C., Rao, M., Di Vizio, D., Shah, S., Byers, S.W., Mahmood, R., Augenlicht, L.H., et al. (2004). Cyclin D1 genetic heterozygosity regulates colonic epithelial cell differentiation and tumor number in ApcMin mice. Mol. Cell. Biol. 24, 7598– 7611. Jimenez-Lara, A.M., and Aranda, A. (1999). Lysine 246 of the vitamin D receptor is crucial for ligand-dependent interaction with coactivators and transcriptional activity. J. Biol. Chem. 274, 13503–13510. Laskowski, R.A., Moss, D.S., and Thornton, J.M. (1993). Main-chain bond lengths and bond angles in protein structures. J. Mol. Biol. 231, 1049–1067. Malloy, P.J., Pike, J.W., and Feldman, D. (1999). The vitamin D receptor and the syndrome of hereditary 1,25-dihydroxyvitamin D-resistant rickets. Endocr. Rev. 20, 156–188. Malloy, P.J., Xu, R., Peng, L., Clark, P.A., and Feldman, D. (2002). A novel mutation in helix 12 of the vitamin D receptor impairs coactivator interaction and causes hereditary 1,25-dihydroxyvitamin D-resistant rickets without alopecia. Mol. Endocrinol. 16, 2538– 2546. Mizwicki, M.T., Keidel, D., Bula, C.M., Bishop, J.E., Zanello, L.P., Wurtz, J.M., Moras, D., and Norman, A.W. (2004). Identification of an alternative ligand-binding pocket in the nuclear vitamin D receptor and its functional importance in 1alpha,25(OH)2-vitamin D3 signaling. Proc. Natl. Acad. Sci. USA 101, 12876–12881. Moon, R.T., Kohn, A.D., De Ferrari, G.V., and Kaykas, A. (2004). WNT and beta-catenin signalling: diseases and therapies. Nat. Rev. Genet. 5, 691–701. Narvaez, C.J., Byrne, B.M., Romu, S., Valrance, M., and Welsh, J. (2003). Induction of apoptosis by 1,25-dihydroxyvitamin D3 in
Usami, N., Sekido, Y., Maeda, O., Yamamoto, K., Minna, J.D., Hasegawa, Y., Yoshioka, H., Imaizumi, M., Ueda, Y., Takahashi, M., and Shimokata, K. (2003). Beta-catenin inhibits cell growth of a malignant mesothelioma cell line, NCI-H28, with a 3p21.3 homozygous deletion. Oncogene 22, 7923–7930. Vanhooke, J.L., Benning, M.M., Bauer, C.B., Pike, J.W., and DeLuca, H.F. (2004). Molecular structure of the rat vitamin D receptor ligand binding domain complexed with 2-carbon-substituted vitamin D3 hormone analogues and a LXXLL-containing coactivator peptide. Biochemistry 43, 4101–4110. Zinser, G.M., McEleney, K., and Welsh, J. (2003). Characterization of mammary tumor cell lines from wild type and vitamin D3 receptor knockout mice. Mol. Cell. Endocrinol. 200, 67–80.