ZnSOD and MnSOD and its responses of mRNA expression and enzyme activity to Aeromonas hydrophila or lipopolysaccharide challenge in Qihe crucian carp Carassius auratus

Fish & Shellfish Immunology 67 (2017) 429e440

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

The molecular characterizations of Cu/ZnSOD and MnSOD and its responses of mRNA expression and enzyme activity to Aeromonas hydrophila or lipopolysaccharide challenge in Qihe crucian carp Carassius auratus Xianghui Kong a, b, *, Dan Qiao a, b, Xianliang Zhao a, b, Li Wang a, b, Jie Zhang a, Dandan Liu b, Hongxu Zhang b a b

College of Fisheries, Henan Normal University, Henan province, PR China College of Life Science, Henan Normal University, Henan province, PR China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 21 November 2016 Received in revised form 16 April 2017 Accepted 8 June 2017 Available online 10 June 2017

Superoxide dismutases (SODs), as the prime antioxidant enzymes, present the first line of defense against oxidative stress caused by excessive reactive oxygen species (ROS) in organism. In the study, two distinct members of SOD family were cloned and analyzed in Qihe crucian carp Carassius auratus (designated as CaCu/ZnSOD and CaMnSOD, respectively). The full-length cDNA of CaCu/ZnSOD is 759 bp, containing a 5' -untranslated region (UTR) of 39 bp, a ORF (including stop codon, TAG) of 465 bp and a 30 UTR of 255 bp. The ORF of CaCu/ZnSOD encodes a protein of 154 amino acids (aa), in which, two Cu/ ZnSOD signature (45GFHVHAFGDNT55 and 139GNAGGRLACGVI150) and four conserved amino acids for Cu/ Zn2þ-binding sites (H64, H72, H81 and D84) were observed. The full-length CaMnSOD cDNA (960 bp) consists of a 50 -UTR of 114 bp, a ORF of 675 bp and a 30 -UTR of 231 bp, the ORF of CaMnSOD encodes a 224 aa protein with a 26 aa mitochondrial-targeting sequence (MTS) in the N-terminus, and four conserved amino acids for manganese binding (H52, H100, D185 and H189) were observed. Multiple alignment and the structural analysis revealed two Cu/ZnSOD signature motifs and a MnSOD signature motif as well as the invariant binding sites for Cu2þ/Zn2þ in CaCu/ZnSOD and Mn2þ in CaMnSOD. The phylogenetic analysis indicated that CaCu/ZnSOD was homologous to cytosolic Cu/ZnSODs, and CaMnSOD was high similarity with mitochondrial MnSODs from other fish. The tissue distribution analysis demonstrated that CaCu/ZnSOD and CaMnSOD were highly expressed in liver, heart and muscle. The dynamic expressions of CaCu/ZnSOD and CaMnSOD were observed after the challenges with Aeromonas hydrophila or LPS, which generally increased in liver, gill, kidney and spleen, while, the mRNA expressions were downregulated at some time points in head kidney. The enzyme activities increased after A. hydrophila or LPS challenge, compared to the control. In this study, the molecular structures and functional motifs of CaCu/ZnSOD and CaMnSOD were determined, and it is crucial for us to understand the biological functions of SODs. The highest level in liver showed that the function of liver to remove ROS is much more important. The obvious responses of mRNA expression levels and enzyme activities to pathogens indicate the important roles of CaCu/ZnSOD and CaMnSOD in antioxidant defense in C. auratus. © 2017 Elsevier Ltd. All rights reserved.

Keywords: Superoxide dismutase Aeromonas hydrophila Lipopolysaccharide Carassius auratus

1. Introduction The superoxide dismutases (SODs), as the essential antioxidant

* Corresponding author. Postal Address: No. 46, Jianshe Road, College of Fisheries, Henan Normal University, Xinxiang 453007, PR China. E-mail address: [email protected] (X. Kong). http://dx.doi.org/10.1016/j.fsi.2017.06.031 1050-4648/© 2017 Elsevier Ltd. All rights reserved.

enzymes, play an important role in antioxidant defense in oxygendepended organism. When the animal was invaded by microbes or under a changed environment, a series of oxygen free radicals (e.g. superoxide anion, O 2 ; hydrogen peroxide, H2O2; and hydroxyl radical, $OH) were produced to disturb the physiological status [1], for example, the excess reactive oxygen species (ROS) could damage cellular proteins, lipids, and DNA, and subsequently lead to the cytotoxic effects and functional disorders in organism [2].

430

X. Kong et al. / Fish & Shellfish Immunology 67 (2017) 429e440

Therefore, when the surplus ROS are accumulated in organism, the effective and rapid elimination of ROS will be performed properly by host antioxidant defense system to scavenge the excess ROS. Conversely, when ROS levels are lower than those at the normal physiological level, the ability to kill bacteria will be reduced. It is well-known that macrophages could release a large quantities of ROS (known as the respiratory burst) to kill bacteria in response to pathogens. It has been addressed that the reducing ROS could stop proliferating, which are required for mouse spermatogonial stem cell self-renewal [3]. Therefore, the balance between the production and the removement of ROS is maintained at stable level to ensure the normal physiological status [4]. Based on the structure, cellular localization and the metal cofactor in the active sites, the proteins of SOD family are usually classified into four groups: manganese SOD (MnSOD), copper/zinc SOD (Cu/ZnSOD), iron SOD (FeSOD) and nickel SOD (NiSOD) [5]. Generally speaking, Cu/ZnSOD and MnSOD are localized in cytoplasm and mitochondrial matrix, respectively [6]. The Cu/ZnSOD serves as a bulk scavenger of radicals in the intracellular environment, and has been attracted much more attention because of its physiological function and therapeutic potential [7]. The MnSOD, located in mitochondria, plays a vital role in defense against superoxide radicals generated as byproducts of oxidative phosphorylation [8]. Both Cu/ZnSOD and MnSOD have been cloned in Takifugu obscurus [9], Anguilla marmorata [10], Atlantic salmon (Salmo salar L.) [11], Cyprinus carpio var. Jian [12,13] and Ctenopharyngodon idella [14]. It was demonstrated that the Cu/ZnSOD and MnSOD sequence and structure could ensure performing the physiological function [15,16]. Qihe crucian carp Carassius auratus, as an important commercial fish, are widely cultured in the northern region of Henan province. In recent years, the intensive aquaculture with the high density always results in the decrease of immune level and evenly incurs the occurrence of fish disease. Actually, it is well-known that oxidative stress is one of the reasons, which can result in the decrease of immune level. Hence, understanding the antioxidant defense strategies of immune system in crucian carp can facilitate the development of sustainable fisheries. SODs, as the important antioxidant enzymes, perform the crucial function to reduce oxidative stress. Therefore, to characterize molecular structures of SODs and to clarity the responses to pathogen and analogues are very important for us to understand its biological function.

A. hydrophila, a gram-negative bacterium, is the most widely popular opportunistic pathogen, which can infect people, livestock and aquatic animals [17]. The infection of A. hydrophila, spreads very fast and causes extensive losses in aquaculture, and it has been considered as the most devastating pathogenic bacteria for Cyprinid fish [18]. Lipopolysaccharide (LPS), a highly conserved cell wall component of gram-negative bacteria, is known as a model stimulant to induce oxidative stress, and triggers signaling cascade for the expressions of inflammatory mediators such as tumor necrosis factor a (TNF-a) and interleukin (IL)-6 [9]. To clarity the immune responses of SODs to A. hydrophila or LPS, will be helpful for better understanding the roles of SODs [19,20]. In the present study, two SODs of Qihe crucian carp C. auratus (denoted as CaCu/ZnSOD and CaMnSOD) were cloned and studied, the aims are: (1) to characterize and analyze the molecular structures of SODs based on the complete cDNA sequence; (2) to compare the expression differences among the tissues and organs in healthy fish; and (3) to analyze the expression profiles at the mRNA level and enzyme activities after challenges with A. hydrophila or LPS in vivo, respectively. It was expected to further provide the comparative perspectives into the two SODs with the similar function and diverse structures, and offer the useful evidence to clarify the physiological functions of SODs in crucian carp. 2. Material and methods 2.1. Fish and bacteria Qihe crucian carp C. auratus, with the body weight of 50 ± 3 g (means ± SD), were obtained from the breeding farm in Hebi City, Henan Province. Fish were acclimated in continuously aerated water in 250 L tanks, with pH 8.0 ± 0.2, dissolved oxygen 7 ± 0.5 mg/L, water hardness 20 ± 1 mg/L CaCO3, total ammonia 0.006 ± 0.001 mg/L, and nitrite 0.03 ± 0.01 mg/L. Temperature was maintained at 25 ± 2  C. Photoperiod was in the cycles of 12 h light/ 12 h darkness. Fish were fed twice daily for a week before experiments. For the bacterial challenge test, A. hydrophila strain was maintained in our laboratory. 2.2. RNA extraction and reverse transcription Total RNA was extracted from the liver of C. auratus using RNAiso

Table 1 The Primers used for RACE and qRT-PCR in this study. Primer

Sequence (5' - 3')

Usage

Fragment length (bp)

Amplification efficiency

P1þ P1P2þ P230 RACE- P1þ 30 RACE- P130 RACE- P2þ 30 RACE- P250 RACE- P1þ 50 RACE- P150 RACE- P2þ 50 RACE- P230 RACE adaptor 50 RACE adaptor Cu/ZnSOD-qPCRþ Cu/ZnSOD-qPCRMnSOD-qPCRþ MnSOD-qPCRb-actinþ b-actin-

TTCCATGTCCATGCTTTTG GYGATGCCTATAACWCCACA TAGAGCATGCTGTGCAGAGTCG ATTTATTTCTTGGCAGCTTGGA CGTCGGAGACCTTGGTAATG TGGGTAAAGGAGGCAATGAA TGGGCTTTGATAAGGACAGT GGGATAGATGTCTGGGAGCA TGTCACATTACCAAGGTCTCCGA CGTGTCTGTCAGTATCGGTTGGT CTCCCAGACATCAATCCCAATG CAAAGCAGGCTGAAGGGAGAC CTGATCTAGAGGTACCGGATCC GACTCGAGTCGACATCG GGTCCGCACTACAACCCTCATA GCCTCCTTTACCCAAGTCATCC GGCTTTGATAAGGACAGTGGAA CAGTTTATTTCTTGGCGGCTTG GATGCGGAAACTGGAAAGGG TGAGGGCAGAGTGGTAGACG

Intermediate fragment of Cu/ZnSOD

323

e

Intermediate fragment of MnSOD

683

e

30 RACE of Cu/ZnSOD 30 RACE of Cu/ZnSOD 30 RACE of MnSOD 30 RACE of MnSOD 50 RACE of Cu/ZnSOD 50 RACE of Cu/ZnSOD 50 RACE of MnSOD 50 RACE of MnSOD Universal primers for 30 RACE Universal primers for 50 RACE Cu/ZnSOD qPCR

478 341 452 360 306 283 618 324 e e 210

e e e e e e e e e e 102.6%

MnSOD qPCR

223

96.6%

Reference gene

118

100.8%

“-” indicated no data were available.

X. Kong et al. / Fish & Shellfish Immunology 67 (2017) 429e440

431

Fig. 1. The nucleotide and amino acid sequences of CaCu/ZnSOD (A) and CaMnSOD (B) genes in Qihe crucian carp C. auratus. The start codon (ATG) and the stop codon (TGA) are marked in double underline. The letters in box is the polyadenylation signal sequence (AATAAA). (A) Two predicted Cu/ZnSOD family signatures (45GFHVHAFGDNT55 and 139 GNAGGRLACGVI150) are marked in single line. Two N-Glycosylation sites (N16 and N69) are bold. Two cysteines (C58 and C147) to form a disulphide bond are shaded grey. (B) A mitochondrial targeting sequence (1MLCRVGYVRRCAATLNPILGAVASKQ26) is shaded grey. A predicted MnSOD family signature (185DVWEHAYY192) is marked in single line. Two NGlycosylation sites (N65 and N106) are bold. The full sequence of CaCu/ZnSOD and CaMnSOD were submitted to GenBank database with the accession No. KR080191.1 and KM065388.1, respectively.

432

X. Kong et al. / Fish & Shellfish Immunology 67 (2017) 429e440

Plus (Takara, Dalian, China) according to the instruction of manufacture. The quality of RNA was evaluated by 1.5% agarose gel electrophoresis. The first-strand cDNA was synthesized using the

total RNA with the HiFi-MMLV cDNA Kit (Takara, Dalian, China). The reaction system contains 2 mL total RNA, 4 mL dNTP Mix, 2 mL Primer Mix, 4 mL 5  RT Buffer, 2 mL DTT, 1 mL HiFi-MMLV and 5 mL RNasefree water in a final volume of 20 mL. The reaction condition was at 42  C for 45 min and at 85  C for 5 min. 2.3. Full-length cDNA cloning and sequencing of CaCu/ZnSOD and CaMnSOD The primers to amplify the intermediate fragment were designed respectively according to the conserved sequences of Cu/ ZnSOD and MnSOD from Hypophthalmichthys molitrix, Hypophthalmichthys nobilis, Danio rerio and other fish. The primers for CaCu/ZnSOD and CaMnSOD were listed in Table 1. The amplification was performed in 2  Taq Mix (Takara, Dalian, China) with an initial denaturation at 94  C for 2 min, followed by 30 cycles of 30 s at 94  C, 40 s at 50  C and 30 s at 72  C, a final extension for 2 min at 72  C. The PCR products were detected by 1.5% agarose gel electrophoresis and purified by DNA gel extraction kit (Takara, Dalian, China). The purified DNA fragments were cloned into the pMD-19T vector (Takara, Dalian, China). The recombinant vectors were transformed into Escherichia coli DH5a, and the positive clones were selected and sequenced. The 30 and 50 RACE primers were designed based on the achieved intermediate sequences, and listed in Table 1. The 30 RACE primers: 30 RACE- P1þ, 30 RACE- P1-, 30 RACE- P2þ, 30 RACE- P2- and the 30 RACE adaptor (supplied by the kit), were used to clone the 30 end sequences of CaCu/ZnSOD and CaMnSOD, respectively. The PCR reaction was performed at 94  C for 2 min, followed by 30 cycles of 94  C for 30 s, 60  C for 40s and 72  C for 30 s, a final extension at 72  C for 2 min. The 50 RACE for CaCu/ZnSOD and CaMnSOD were performed using the designed 50 RACE primers: 50 RACE- P1þ, 50 RACE- P1-, 50 RACE- P2þ, 50 RACE- P2- and the 50 RACE adaptor, were used to clone the 50 end sequences of CaCu/ZnSOD and CaMnSOD, respectively. The amplifying procedure for 50 RACE was similar with that for the 30 RACE, and the DNA fragments were purified and cloned into pMD-19T vector, which were transferred into the bacteria DH5a, and positive clones were sequenced. The full-length of CaCu/ZnSOD and CaMnSOD genes were assembled respectively with the DNAMAN 5.2 software. 2.4. Bioinformatic analyses

Fig. 2. Multiple alignments of CaCu/ZnSOD (A) and CaMnSOD (B) amino acid sequences from Qihe crucian carp C. auratus and other species. Cysteine residues predicted to form a disulfide bridge are marked by :. N-Glycosylation sites are marked by △. Cu/ZnSOD or MnSOD family signatures are boxed. Identical residues among the sequences are highlighted with the background in different colors. (A) Cu/ZnSOD amino acid sequences from Qihe crucian carp C. auratus and other species: Carassius auratus ssp. 'Pengze (AGC50803.1), Cyprinus carpio 'jian' (AEC11112.1), Danio rerio (NP_571369.1), Hemibarbus mylodon (ACR56338.1), Gobiocypris rarus (AHA82627.1) Hypophthalmichthys nobilis (ADJ67809.1). (B) MnSOD amino acid sequences from Qihe crucian carp C. auratus and other species: Danio rerio (NP_956270.1), Hypophthalmichthys molitrix (ADM86391.1), Hypophthalmichthys nobilis (ADM26563.1), Oplegnathus fasciatus (AFO64916.1), Oreochromis niloticus (XP_003449988.1), Haplochromis burtoni (XP_005921694.1), Homo sapiens (CAA32502.1). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

The open reading frame (ORF) was predicted with the NCBI ORF Finder (www.ncbi.nlm.nih.gov/gorf/gorf.html). The isoelectric point and molecular weight were predicted by the EXPASY (http:// www.expasy.org/compute_pi). The signal peptide was predicted by the SignalP 4.1 Server (http://www.cbs.dtu.dk/services/SignalP/). Subcellular localization of Cu/ZnSOD protein was predicted using the PSORT II algorithm (http://psort.hgc.jp/form2.html), while subcellular localization of MnSOD was predicted using the MitoProt II (http://ihg.gsf.de/ihg/mitoprot.html). The protein structure and function region were analyzed by the software Phyre 2 (http://www.sbg.bio.ic.ac.uk/phyre2/html). The multiple sequence alignment was performed using the software DNAMAN. Phylogenetic tree was constructed using the neighborjoining method implemented in the software MEGA 6.0, and bootstrap analysis was performed with 1000 bootstrap replications. 2.5. The expressing of the gene CaCu/ZnSOD and CaMnSOD in various tissues The mRNA expression levels of CaCu/ZnSOD and CaMnSOD were determined in the various tissues (kidney, head kidney, intestine, heart, spleen, liver, muscle, brain, skin, and gill) of the health

X. Kong et al. / Fish & Shellfish Immunology 67 (2017) 429e440

433

Fig. 3. Three-dimensional structures of C. auratus CaCu/ZnSOD and CaMnSOD in Qihe crucian carp C. auratus. (A) Ribbon diagram of CaCu/ZnSOD based on human Cu/ZnSOD (PDB, 1n19B), N- and C- terminus are marked. (B) Magnified view of Cu2þ liganded active sites and Zn2þ liganded active sites in CaCu/ZnSOD are shown with blue box and red ellipse, respectively. Disulfide bridge formed by Cys residues are marked. (C) Ribbon diagram of CaMnSOD based on human MnSOD (PDB, 2adqB), N- and C- terminus are marked. (D) Magnified view of Mn2þ liganded active sites is indicated with blue box in CaMnSOD. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

C. auratus, using the quantitative real-time PCR (qRT-PCR). The total RNA was extracted respectively according to the protocol described as above. Based on the obtained sequences in this study, the designed primer Cu/ZnSOD-qPCRþ and Cu/ZnSOD-qPCR- were used to determine the expressing of CaCu/ZnSOD, and MnSODqPCRþ and MnSOD-qPCR- were used to determine the expressing of CaMnSOD. The expression of reference gene b-actin was measured by the primer b-actinþ and b-actin- [21,22]. The qRT-PCR reaction was performed in the ABI 7500 system with the Ultra SYBR Mixture (Takara, Dalian, China). 20 mL reaction system contained 10 mL of 2  Ultra SYBR Mixture, 1 mL of each primer, 1 mL of diluted cDNA from the respective tissue and 7 mL RNase free ddH2O. The amplifying program included 95  C for 10 min, followed by 40 cycles of 95  C for 15 s and 60  C for 1 min. The b-actin was selected as a housekeeping gene, and each experiment was conducted in triplicate. The relative gene expression level of the target gene to reference gene in the same tissue was analyzed using the 2-△△Ct method [23]. Data were given as mean ± SD in terms of relative mRNA expression. 2.6. The responses of SODs in fish challenged with A. hydrophilia and LPS The bacterial pathogen A. hydrophilia were cultured in LB

medium at 28  C, then washed with 0.75% saline and resuspended to 5  107 CFU/mL. The experimental fish were grouped randomly, with 30 fish each group, and cultured in aerated tanks in triplication. With regard to the bacterial stimulation, each fish was injected intraperitoneally (i.p.) with 200 mL of A. hydrophilia at a dose of 5  107 CFU/mL. For the lipopolysaccharide (LPS) stimulation, each fish was injected with 200 mL of LPS (1 mg/mL) in 0.75% saline [21]. In the control, each fish was injected with 200 mL of 0.75% saline. Fish were randomly sampled from each group at 0, 3, 6, 12, 24 and 48 h after injection, and the tissue samples (liver, gill, kidney, spleen and head kidney) were collected immediately. Total RNA extraction, cDNA synthesis and qRT-PCR were performed as described above. The expression patterns of CaCu/ZnSOD and CaMnSOD, in the different challenged groups, were converted to fold changes relative to the control at the same time points. 2.7. Measurement of SOD enzyme activity after challenge The five kinds of tissues of C. auratus were homogenized in a chilled saline (pH 7.4), and the homogenates were centrifuged at 2000 g for 10 min (4  C), then the clear supernatant fractions were used to investigate the SOD activity. Tissue protein contents in crude extracts were determined with the Coomassie Brilliant Blue protein assay kit (Jiancheng Bioengineering, Nanjing, China) and

434

X. Kong et al. / Fish & Shellfish Immunology 67 (2017) 429e440

Fig. 4. The phylogenetic tree based on amino acid sequences of Cu/ZnSOD (A) and MnSOD (B) from different species of animals. (A) The abbreviation of animal Cu/ZnSOD and the GenBank accession numbers are listed as follow: Hypophthalmichthys molitrix (ADJ67808), Aristichthys nobilis (ADJ67809), Gobiocypris rarus (AHA82627), Hemibarbus mylodon (ACR56338), Danio rerio (NP_571369), Cyprinus carpio 'jian' (AEC11112), Carassius auratus ssp. 'Pengze' (AGC50803), Qihe crucian carp C. auratus (:), Argopecten irradians (ACM48346), Rana catesbeiana (ACO51906), Rana sylvatica (AIT92095), Zonotrichia albicollis (XP_005493483), Gallus gallus (NP_990395), Rattus norvegicus (CAA79925), Homo sapiens (NP_000445), Cavia porcellu (AAB29682), Marsupenaeus japonicus (BAP28204), Macrobrachium rosenbergii (AAZ29240), Macrobrachium nipponense (AFR54114), C. sapidus

X. Kong et al. / Fish & Shellfish Immunology 67 (2017) 429e440

read using a spectrophotometer. Total SOD and Cu/ZnSOD activities in different tissues were detected using the Superoxide Dismutase (SOD) typed assay kit (Nanjing Jian Cheng Bio Inst., China). Fifty microlitre clear supernatant fraction of a tissue homogenate was used to detect the total SOD and Cu/ZnSOD activities following the manufacturer's instructions. The total SOD and Cu/ZnSOD activities of the tested samples could be obtained through the formula calculation of manufacturer's instructions based on the absorbance values. Then MnSOD activity is the total SOD activity minus Cu/ ZnSOD activity. The unit of SOD activity was expressed as U/mg protein. Each sample was measured in triplicate.

2.8. Statistical analyses The data were expressed as mean ± SD (n ¼ 3). Statistical differences were analyzed using one-way ANOVA and Tukey multiple comparisons, implemented in software SPSS 22.0 (SPSS Inc., Chicago, Illinois, USA) and GraphPad Prism 5. Comparative difference was considered to be significant at p < 0.05, and extremely significant at p < 0.01.

3. Result 3.1. Sequence analyses of CaCu/ZnSOD and CaMnSOD genes Complete cDNA sequences of CaCu/ZnSOD and CaMnSOD were obtained using the method RT-PCR, 30 -RACE and 50 -RACE. The nucleotide and amino acid sequences were shown in Fig. 1, which have been deposited in GenBank (Accession No. KR080191.1 and KM065388.1). The full-length CaCu/ZnSOD cDNA comprised of 759 bp, containing a 5' -untranslated region (UTR) of 39 bp, a ORF (including stop codon, TAG) of 465 bp and a 3' -UTR of 255 bp (Fig. 1A). The ORF of CaCu/ZnSOD encoded a putative polypeptide of 154 residues with a calculated molecular mass of 16.11 kDa and a theoretical pI of 5.95. Prediction analysis revealed that CaCu/ZnSOD contains two Cu2þ and Zn2þ signatures from 45 to 55 (45GFHVHAFGDNT55) and from 139 to 150 (139GNAGGRLACGVI150), four Cu2þ binding sites (His 47, 49, 64, and 121), and four Zn2þ binding sites (His 64, His 72, His 81 and Asp 84) (Fig. 2A). Moreover, our data also revealed two potential sites for N-glycosylation (N16 and N69). The 960 bp CaMnSOD full-length cDNA consisted of a 675 bp open reading frame (ORF), flanked by a 114 bp 5' -untranslated region (UTR) and a 231 bp 3' -UTR containing a typical polyadenylation signal sequence (921AATTAA926), with the distance of 34 bp from the poly (A) tail (Fig. 1 B). The ORF of CaMnSOD encoded a putative polypeptide of 224 residues with a calculated molecular mass of 24.87 kDa and a theoretical pI of 8.28, while a 26 aa long mitochondrial targeting sequence (MTS) was revealed at the Nterminus. Fig. 1 B also showed a potential MnSOD family signature motif (185DVWEHAYY192) and four putative Mn2þ binding sites (His 49, His 97, Asp 182 and His 183), which mediated its catalytic activity.

435

3.2. Multiple alignment, 3D structural modeling and molecular phylogeny of SODs Amino acid sequences of CaCu/ZnSOD and CaMnSOD were respectively compared with the SODs from other species. The amino acid sequence of CaCu/ZnSOD showed the similarities of 77%e99% with the other Cu/ZnSOD sequences, and the highest identity was demonstrated with C. auratus ssp. 'Pengze' Cu/ZnSOD (99%) (Fig. 2 A). The amino acid sequence of CaMnSOD showed the similarities of 87%e96% with the other MnSOD sequences, and the highest identity was demonstrated with Hypophthalmichthys molitrix MnSOD (96%) (Fig. 2 B). These results demonstrated the highly conserved regions in signature motifs of Cu/ZnSOD and MnSOD. Based on human Cu/ZnSOD and MnSOD protein templates, the three-dimensional structures of CaCu/ZnSOD and CaMnSOD were constructed respectively (Fig. 3 A and C). The Ribbon diagrams of CaCu/ZnSOD and CaMnSOD revealed their specificity in 3D folding and evolutionary conservation of the active sites such as Cu2þ (His 47, His 49, His 64 and His 121) and Zn2þ (His 64, His 72, His 81 and Asp 84) in CaCu/ZnSOD (Fig. 3 B) and Mn2þ (His 49, His 97, Asp 182 and His 183) in CaMnSOD (Fig. 3 D). To evaluate the molecular evolutionary relationships of CaCu/ ZnSOD and CaMnSOD respectively, the sequences of Cu/ZnSOD and MnSOD from representative species were used to construct the phylogenetic trees by NJ method. The phylogenetic analysis indicated that Cu/ZnSOD can be classified into two distinct clusters based on subcellular localization: Cytosolic Cu/ZnSOD and extracellular Cu/ZnSOD. The CaCu/ZnSOD is somewhat closer to Cytosolic Cu/ZnSOD sequences from mollusca and mammal, but is far away from the extracellular Cu/ZnSOD of arthropoda (Fig. 4 A). However, CaMnSOD was positioned within fish cluster of mitochondrial branch, and is far away from the MnSOD of arthropoda (Fig. 4 B). 3.3. Spatial expressions and differential distributions of CaMnSOD and CaCu/ZnSOD In the present study, the expressions of CaCu/ZnSOD and CaMnSOD were examined at the mRNA level by qRT-PCR assay. The results showed that CaCu/ZnSOD and CaMnSOD were widely expressed in the various tissues (liver, heart, muscle, spleen, intestine, skin, head-kidney, brain, kidney and gill), but the mRNA expression levels were variable (Fig. 5). The expression profiles of CaCu/ZnSOD in different tissues were similar to those of CaMnSOD. The finding showed that the predominant expressions of CaCu/ ZnSOD and CaMnSOD were detected in liver, muscle and heart, while their expressions in the rest tissues were significantly low. 3.4. Temporal transcriptions of CaCu/ZnSOD and CaMnSOD after challenges of A. hydrophilia and LPS The mRNA expressions of CaCu/ZnSOD and CaMnSOD were investigated in five tissues following the injections of bacteria or LPS using the method qRT-PCR. The results showed that the transcriptions of CaCu/ZnSOD and CaMnSOD were considerably altered (Fig. 6). In liver, generally, the mRNA expression levels of CaCu/

(ADD51365.1), Scylla paramamosain (ACY66384), Cherax quadricarinatus (AFK82510), Scylla serrata (ABL63467), Portunus trituberculatus (ACI13851). (B) The abbreviation of animals MnSOD and the GenBank accession numbers are listed as follow: Hypophthalmichthys nobilis (ADM26563), Hypophthalmichthys molitrix (ADM86391), Hemibarbus mylodon (ACR23312), Megalobrama amblycephala (AHK06412), Qihe crucian carp C. auratus (:), Danio rerio (AAP34300), Astyanax mexicanus (XP_007260921), Osmerus mordax (ACO10131), Oryzias latipes (XP_004083519), Oreochromis niloticus (XP_003449988), Sparus aurata (AFV39807), Xenopus laevis (AAQ63483), Gallus gallus (AAK97214), Meleagris gallopavo (XP_010705429), Haliaeetus leucocephalus (XP_010582797), Homo sapiens (Y00985), Mus musculus (AAB60902), Rattus norvegicus (EDL83700), Azumapecten farreri (AFN29183), Mizuhopecten yessoensis (BAE78580), Mimachlamys nobilis (AHX22598), Argopecten irradians (ACU00737), Tegillarca granosa (ADC34695), Scylla paramamosain (AFP89582 and ADA63848), Callinectes sapidus (AAF74770 and AAF74771), Fenneropenaeus chinensis (ABB05539 and ABR10072), Marsupenaeus japonicus (ADB90402 and ADB90400), Macrobrachium nipponense (AEK77428 and AEK77429), Macrobrachium rosenbergii (AAZ81617 and AAY79405), Palaemon carinicauda (AGV76057 and AGR44723).

436

X. Kong et al. / Fish & Shellfish Immunology 67 (2017) 429e440

Fig. 5. The mRNA expressions of CaCu/ZnSOD and CaMnSOD in various tissues of Qihe crucian carp C. auratus.

ZnSOD were significantly upregulated after the injection of A. hydrophilia or LPS, compared to the control (p < 0.01) (Fig. 6 A). In gill, the expressions of CaCu/ZnSOD at the mRNA level significantly increased at 3 h, 6 h and 12 h after A. hydrophilia challenge (p < 0.01 or p < 0.05). The mRNA expression levels of CaCu/ZnSOD increased at 6 h, 12 h and 24 h after LPS challenge (p < 0.01 or p < 0.05) and reached the peak at 12 h (Fig. 6 B). In kidney, the expression of CaCu/ZnSOD significantly increased post-challenge with A. hydrophila (p < 0.01 or p < 0.05), with the highest level at 12 h. After LPS challenge, CaCu/ZnSOD expression was significantly upregulated at 3 h (p < 0.01) and 24 h (p < 0.05) (Fig. 6 C). In spleen, the expression of CaCu/ZnSOD was significantly induced at 3 h (p < 0.01) and 48 h (p < 0.05) post A. hydrophila challenge, and only at 3 h after LPS challenge (p < 0.01) (Fig. 6 D). In head-kidney, the expressions of CaCu/ZnSOD were significantly down-regulated at 12 h and 24 h after A. hydrophila challenge (p < 0.01) or LPS challenge (p < 0.01 or p < 0.05) (Fig. 6 E). With regard to the mRNA expression level of CaMnSOD, the expression changes were generally similar with those of CaCu/ ZnSOD in liver and gill (Fig. 6F and G). In kidney, the mRNA expression levels of CaMnSOD significantly increased at 12 h, 24 h and 48 h after A. hydrophila challenge (p < 0.01), and only significantly increased at 24 h after LPS challenge (p < 0.01) (Fig. 6 H). In spleen, CaMnSOD expression significantly increased at 3 h, 6 h and 12 h after A. hydrophila challenge (p < 0.01), and only significantly increased at 24 h after LPS challenge (p < 0.01). In head-kidney, mRNA expressions of CaMnSOD significantly decreased at 12 h, and significantly increased at 24 h and 48 h after A. hydrophila challenge. After LPS challenge, the expression changes of CaMnSOD were complex, indicating that mRNA expression level was significantly upregulated at 3 h and 6 h, following decreased at 12 h, then significantly increased again at 24 h and 48 h (p < 0.01) (Fig. 6 J). 3.5. Temporal changes of Cu/ZnSOD and MnSOD activities postchallenge In parallel with the expression changes of CaCu/ZnSOD and CaMnSOD at the mRNA level post-challenge, the enzyme activities of Cu/ZnSOD and MnSOD also exhibited significant changes after challenge of A. hydrophila or LPS. The changes of Cu/ZnSOD and MnSOD activities in liver, gill, kidney, spleen and head-kidney of C. auratus were shown in Fig. 7. In liver, after either A. hydrophila or LPS stimulation, Cu/ZnSOD activities significantly increased at 6 h, 12 h, and 24 h (p < 0.01), and peaked at 12 h (Fig. 7 A). In gill, Cu/

ZnSOD activities significantly increased at 6 h and 12 h (p < 0.01 or p < 0.05), and reached the highest at 6 h after A. hydrophila stimulation and only significantly increased at 12 h after LPS stimulation (p < 0.05) (Fig. 7 B). In kidney, Cu/ZnSOD activities significantly increased at 6 h, 12 h, 24 h and 48 h after A. hydrophila challenge (p < 0.01 or p < 0.05), compared to the control, and only significantly increased only at 6 h after LPS challenge (p < 0.01) (Fig. 7 C). In spleen, Cu/ZnSOD activities were significantly induced at 6 h with the injection of A. hydrophila or LPS (p < 0.01) (Fig. 7 D). In head-kidney, Cu/ZnSOD activity significantly increased only at 6 h after A. hydrophila challenge (p < 0.01), and no significant change was observed after LPS injection (p > 0.05), compared to the control (Fig. 7 E). Activity changes of MnSOD showed the difference, compared to Cu/ZnSOD, in C. auratus challenged with A. hydrophila or LPS. In liver, the MnSOD activities were significantly upregulated at 6 h, 12 h and 24 h (p < 0.01 or p < 0.05) after A. hydrophila stimulation, and only increased at 12 h after LPS challenge (p < 0.01) (Fig. 7 F). In gill, MnSOD activities were significantly induced at 3 h, 6 h and 12 h after A. hydrophila challenge (p < 0.01) and at 3 h, 6 h, 12 h and 24 h after LPS challenge (p < 0.01), and the maximum induction was observed at 3 h (Fig. 7 G). In kidney, MnSOD activity significantly increased only at 6 h after A. hydrophila challenge (p < 0.01), and no significant change was observed after LPS challenge (p > 0.05), (Fig. 7 H). In spleen, MnSOD activities were obviously higher at 6 h and 12 h after A. hydrophila challenge (p < 0.01 or p < 0.05), and at 12 h after LPS challenge (p < 0.05) (Fig. 7I). In head-kidney, MnSOD activities significantly increased at 3 h, 6 h and 12 h after challenge (p < 0.01 or p < 0.05), and reached the highest at 3 h after A. hydrophila stimulation, and at 6 h after LPS stimulation (Fig. 7 J). 4. Discussion SODs play an important role in eliminating of excessive ROS and preventing cellular damage induced by the reactive oxygen free radical in biological system [24e26]. In the present study, the full-length sequences of CaCu/ZnSOD and CaMnSOD were respectively cloned in Qihe crucian carp C. auratus, and the comparative analyses were conducted to characterize the two metalloenzymes and to understand their functional coordination. Cu/ZnSOD has been shown to play an important role in protecting cells against oxygen toxicity and to act as a major repository for copper ions in eukaryotes [27], which requires Cu2þ to function the oxidizing and reducing alternation, and Zn2þ to maintain enzyme stability. Loss of Cu2þ results in its complete inactivation and induces many diseases in human and animal [28e30]. Two Cu/ZnSODs, intracellular Cu/ZnSOD (icCu/ZnSOD) and extracellular Cu/ZnSODs (ecCu/ZnSODs), encoded by two different genes, have been found in eukaryotes [31], and localized in cytoplasm and nucleus. In this study, CaCu/ZnSOD cDNA sequence was cloned with 759 bp. The predicted molecular weight and the theoretical isoelectric point of the CaCu/ZnSOD protein were 16.11 kDa and 5.95. Sequence analysis showed that the protein of CaCu/ZnSOD lacks of transmembrane region and signal peptide, and it was suggested that it is an intracellular protein. In general, MnSOD is synthesized in the cytosol and then translocated into mitochondrial matrix, and the translocation is conducted by the conserved mitochondrial targeting sequence (MTS) [32,33]. Recently, cytosolic MnSOD isoforms without MTS have been identified in several species, and it is suggested the significance as antioxidant enzyme in the entire cellular compartment [19,34]. In this study, an MTS of 26 aa at N-terminus (1MLCRVGYVRRCAATLNPILGAVASKQ26) was identified in CaMnSOD, indicating that it should be a mitochondrial matrix protein. Based on the multiple alignment analyses of CaCu/ZnSOD and

X. Kong et al. / Fish & Shellfish Immunology 67 (2017) 429e440

437

Fig. 6. Temporal expressions of CaCu/ZnSOD and CaMnSOD in liver, gill, kidney, spleen, and head-kidney of Qihe crucian carp C. auratus after infected respectively by A. hydrophila or LPS (mean ± SD, n ¼ 3, p < 0.05*, p < 0.01**).

CaMnSOD, respectively, it was demonstrated that the domains and signature motifs in SOD family were highly conserved among the different species. The structure conservations of two SODs were further supported by the structural analyses of CaCu/ZnSOD and CaMnSOD. The phylogeny tree, constructed with the retrieved CaCu/ZnSOD and CaMnSOD homologs in GenBank, demonstrated that the fish were clustered one line, which was consistent with the results of previous studies [35,36]. In this study, CaCu/ZnSOD and CaMnSOD were ubiquitously

expressed in the examined tissues of C. auratus, which is consistent with the fact that SODs are involved in a variety of biological processes. As the main tissues involved in the immune response, such as liver, head-kidney and spleen, are the major sites for the syntheses of immune defense molecules, and are involved in eliminating pathogens or other particulate matter. In some studies, the mRNA expression levels of Cu/ZnSOD and MnSOD were higher in liver, head-kidney and spleen, indicating that these tissues are vital for removing ROS and detoxification metabolism [37,38]. It has

438

X. Kong et al. / Fish & Shellfish Immunology 67 (2017) 429e440

Fig. 7. Temporal changes of Cu/ZnSOD and MnSOD activities in liver, gill, kidney, spleen, and head-kidney of Qihe crucian carp C. auratus after infected respectively by A. hydrophila or LPS (mean ± SD, n ¼ 3, p < 0.05*, p < 0.01**).

X. Kong et al. / Fish & Shellfish Immunology 67 (2017) 429e440

been suggested that multiple oxidative reactions and maximal free radical generation occur in liver [39], which is confirmed in our experiment. The similar tissue distribution profile of Cu/ZnSOD has been reported in Hypophthalmichthys molitrix [40], and the spatial expression pattern of MnSOD was analogous to that of Megalobrama amblycephala [36], and it was revealed that its highest expression was in liver. In the present study, A. hydrophila significantly induced the expressions of CaCu/ZnSOD and CaMnSOD, which got to the highest value at 24 h in liver, and at 6 h in gill post-challenge, and it was suggested that the responses of SODs to A. hydrophila are more sensitive in gill than in liver. It has been shown that the expressions of MnSOD are up-regulated at 12 he48 h in liver of Oplegnathus fasciatus and Channa striatus [41,42]. In this study, CaMnSOD expressions in liver were up-regulated, which were similar with CaCu/ZnSOD expressions in liver after challenging. In head-kidney of C. auratus, CaCu/ZnSOD expressions were markedly declined at 12 h and 24 h post A. hydrophila injection, which were similar with the Cu/ZnSOD expressions in Procambarus clarkii post A. hydrophila challenge [43] and in gills of Asian seabass after Vibrio anguillarum infection [44]. Noticeably, the expression of CaMnSOD peaked at 12 h in kidney and spleen after A. hydrophila challenge, while it peaked at 48 h in head-kidney post challenge, and these findings indicated that the responses of CaMnSOD to A. hydrophila challenge perhaps delay in head-kidney compared with the other tissues. Based on the temporal expression profiles of CaCu/ZnSOD and CaMnSOD in this study, it was indicated that expression responses of CaCu/ZnSOD or CaMnSOD are different in various tissues at the different time points, and the tissue specificity and time response changes might be attributed to the balance between ROS production and removement in specific tissues. Based on the sensitive expression responses of CaCu/ZnSOD and CaMnSOD to A. hydrophila or LPS, it is predicted that SODs have an important function in the antioxidant defense against bacterial infection in C. auratus. Generally, the removing of ROS (e.g. superoxygen anion) should be performed coordinately by various SODs [45]. Therefore, the Cu/ ZnSOD and MnSOD activities can reflect the ability to remove ROS. After A. hydrophila or LPS challenge, the dynamic changes of Cu/ ZnSOD and MnSOD activities were observed to be generally similar with the fluctuations of mRNA expressions in the same tissue. The expression pattern of Cu/ZnSOD in liver after challenge was similar with the result in P. clarkii against pathogen [43]. However, Cu/ ZnSOD activities in kidney and spleen after challenge were slightly inconsistent with the mRNA expressions of CaCu/ZnSOD at several time points, and it was suggested that the increase of enzyme activity was generally later than the increased mRNA expressions of CaCu/ZnSOD post-challenge. However, the different change patterns of enzyme activities were observed between Cu/ZnSOD and MnSOD after A. hydrophila or LPS challenge, and MnSOD activity showed a faster response than Cu/ZnSOD. In brief, in this study, these results indicated that CaCu/ZnSOD and CaMnSOD may play a complementary role in the antioxidant response against pathogens in C. auratus. 5. Conclusion In this study, the full-length cDNAs of CaCu/ZnSOD (759 bp) and CaMnSOD (960 bp) were characterized to find the different structures and binding sites to combine with metal ions. It is very important to understand the physiological function. The phylogenetic analysis indicated that CaCu/ZnSOD is homologous to cytosolic Cu/ZnSOD, and CaMnSOD was high similarity with mitochondrial MnSOD. The mRNA expression levels and enzyme activities were generally increased in liver, gill, kidney and spleen of C. auratus challenged with A. hydrophila or LPS, compared to the

439

control. It was demonstrated that CaCu/ZnSOD and CaMnSOD play an important role in antioxidant defense in C. auratus. The findings further facilitated to understand the complicated relationship between the responses of SODs and pathogen infection in C. auratus. However, it is necessary to further study the regulation mechanism from transcript expression to enzyme synthesis in order to understand completely the antioxidant defense of SOD action in C. auratus. Acknowledgments This work was sponsored by the Joint Fund of Natural Science Foundation of China and Henan Province (U1604104) and Program for Innovative Research Team in Science and Technology in the University of Henan Province (Project No. 15IRTSTHN018). We would like to thank our colleagues for the valuable suggestions on the overall manuscript preparation. References [1] M. Valko, D. Leibfritz, J. Moncol, M.T. Cronin, M. Mazur, J. Telser, Free radicals and antioxidants in normal physiological functions and human disease, Int. J. Biochem. Cell Biol. 39 (2007) 44e84. [2] L. Fialkow, Y.C. Wang, G.P. Downey, Reactive oxygen and nitrogen species as signaling molecules regulating neutrophil function, Free Radic. Bio. Med. 42 (2007) 153e164. [3] H. Morimoto, K. Iwata, N. Ogonuki, K. Inoue, O. Atsuo, M. Kanatsu-Shinohara, et al., ROS are required for mouse spermatogonial stem cell self-renewal, Cell Stem Cell 12 (2013) 774e786. [4] B. Poljsak, D. Suput, I. Milisav, Achieving the balance between ROS and antioxidants: when to use the synthetic antioxidants, Oxid. Med. Cell Longev. 2013 (2013) 956792. [5] I. Fridovich, Superoxide radical and superoxide dismutases, Annu. Rev. Biochem. 64 (1995) 97e112. [6] I.N. Zelko, T.J. Mariani, R.J. Folz, Superoxide dismutase multigene family: a comparison of the CuZn-SOD (SOD1), Mn-SOD (SOD2), and EC-SOD (SOD3) gene structures, evolution, and expression, Free Radic. Biol. Med. 33 (2002) 337e349. [7] D. Ni, L. Song, Q. Gao, L. Wu, Y. Yu, J. Zhao, et al., The cDNA cloning and mRNA expression of cytoplasmic Cu, Zn superoxide dismutase (SOD) gene in scallop Chlamys farreri, Fish. Shellfish Immunol. 23 (2007) 1032e1042. [8] W. Beyer, J. Imlay, I. Fridovich, Superoxide dismutases, Prog. Nucleic Acid. Res. Mol. Biol. 40 (1991) 221e253. [9] L. Wang, Z.Q. Wu, X.L. Wang, Q. Ren, G.S. Zhang, F.F. Liang, et al., Immune responses of two superoxide dismutases (SODs) after lipopolysaccharide or Aeromonas hydrophila challenge in pufferfish, Takifugu obscurus, Aquaculture 459 (2016) 1e7. [10] L. Wang, X. Wang, S. Yin, Effects of salinity change on two superoxide dismutases (SODs) in juvenile marbled eel Anguilla marmorata, PeerJ 4 (2016) e2149. [11] P.A. Olsvik, F. Kroglund, B. Finstad, T. Kristensen, Effects of the fungicide azoxystrobin on Atlantic salmon (Salmo salar L.) smolt, Ecotoxicol. Environ. Saf. 73 (2010) 1852e1861. [12] P. Wu, W.D. Jiang, Y. Liu, G.F. Chen, J. Jiang, S.H. Li, et al., Effect of choline on antioxidant defenses and gene expressions of Nrf2 signaling molecule in the spleen and head kidney of juvenile Jian carp (Cyprinus carpio var. Jian), Fish. Shellfish Immunol. 38 (2014) 374e382. [13] W.D. Jiang, Y. Liu, J. Jiang, P. Wu, L. Feng, X.Q. Zhou, Copper exposure induces toxicity to the antioxidant system via the destruction of Nrf2/ARE signaling and caspase-3-regulated DNA damage in fish muscle: amelioration by myoinositol, Aquat. Toxicol. 159 (2015) 245e255. [14] L. Shi, L. Feng, W.D. Jiang, Y. Liu, J. Jiang, P. Wu, et al., Folic acid deficiency impairs the gill health status associated with the NF-kappaB, MLCK and Nrf2 signaling pathways in the gills of young grass carp (Ctenopharyngodon idella), Fish. Shellfish Immunol. 47 (2015) 289e301. ~ eyro, V. Demicheli, et al., [15] A. Martinez, G. Peluffo, A.A. Petruk, M. Hugo, D. Pin Structural and molecular basis of the peroxynitrite-mediated nitration and inactivation of Trypanosoma cruzi iron-superoxide dismutases (Fe-SODs) A and B: disparate susceptibilities due to the repair of Tyr35 radical by Cys83 in Fe-SodB through intramolecular electron transfer, J. Biol. Chem. 289 (2014) 12760e12778. [16] R.L. Peterson, A. Galaleldeen, J. Villarreal, A.B. Taylor, D.E. Cabelli, P.J. Hart, et al., The phylogeny and active site design of eukaryotic copper-only superoxide dismutases, J. Biol. Chem. 291 (2016) 20911e20923. [17] M. Ligaj, M. Tichoniuk, D. Gwiazdowska, M. Filipiak, Electrochemical DNA biosensor for the detection of pathogenic bacteria Aeromonas hydrophila, Electrochim Acta 128 (2014) 67e74. [18] M. Wonglapsuwan, P. Kongmee, N. Suanyuk N, W. Chotigeat, Roles of phagocytosis activating protein (PAP) in Aeromonas hydrophila infected

440

X. Kong et al. / Fish & Shellfish Immunology 67 (2017) 429e440

Cyprinus carpio, Dev. Comp. Immunol. 59 (2016) 25e33. [19] N. Umasuthan, S.D. Bathige, K.S. Revathy, Y. Lee, I. Whang, C.Y. Choi, et al., A manganese superoxide dismutase (MnSOD) from Ruditapes philippinarum: comparative structural- and expressional-analysis with copper/zinc superoxide dismutase (Cu/ZnSOD) and biochemical analysis of its antioxidant activities, Fish. Shellfish Immunol. 33 (2012) 753e765. [20] X.L. Wang, L. Wang, Q. Ren, S.W. Yin, F.F. Liang, Y.H. Jia, Two superoxide dismutases (SODs) respond to bacterial challenge identified in the marbled eel Anguilla marmorata, Aquaculture 451 (2016) 316e325. [21] M.J. Wang, X.L. Zhao, X.H. Kong, L. Wang, D. Jiao, H.X. Zhang, Molecular characterization and expressing analysis of the c-type and g-type lysozymes in Qihe crucian carp Carassius auratus, Fish. Shellfish Immunol. 52 (2016) 210e220. [22] J. Zhang, L. Li, X.H. Kong, F. Wu, C.J. Zhou, G.X. Nie, et al., Expression patterns of Toll-like receptors in natural triploid Carassius auratus after infection with Aeromonas hydrophila, Vet. Immunol. Immunop 168 (2015) 77e82. [23] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method, Methods 25 (2001) 402e408. [24] M. Marikovsky, V. Ziv, N. Nevo, C. Harris-Cerruti, O. Mahler, Cu/Zn superoxide dismutase plays important role in immune response, J. Immunol. 170 (2003) 2993e3001. [25] T. Fukai, M. Ushio-Fukai, Superoxide dismutases: role in redox signaling, vascular function, and diseases, Antioxid. Redox Signal 15 (2011) 1583e1606. [26] S. Kwiecien, K. Jasnos, M. Magierowski, Z. Sliwowski, R. Pajdo, B. Brzozowski, et al., Lipid peroxidation, reactive oxygen species and antioxidative factors in the pathogenesis of gastric mucosal lesions and mechanism of protection against oxidative stress-induced gastric injury, J. Physiol. Pharmacol. 65 (2014) 613e622. [27] J.Y. He, C.F. Chi, H.H. Liu, Identification and analysis of an intracellular Cu/Zn superoxide dismutase from Sepiella maindroni under stress of Vibrio harveyi and Cd2þ, Dev. Comp. Immunol. 47 (2014) 1e5. [28] I. Mavelli, M.R. Ciriolo, L. Rossi, T. Meloni, G. Forteleoni, A. De Flora, et al., Favism: a hemolytic disease associated with increased superoxide dismutase and decreased glutathione peroxidase activities in red blood cells, Eur. J. Biochem. 139 (1984) 13e18. [29] C. Karunakaran, H. Zhang, J.P. Crow, W.E. Antholine, B. Kalyanaraman, Direct probing of copper active site and free radical formed during bicarbonatedependent peroxidase activity of bovine and human copper, zincsuperoxide dismutases. Low-temperature electron paramagnetic resonance and electron nuclear double resonance studies, J. Biol. Chem. 279 (2004) 32534e32540. [30] D. Son, I. Kojima, R. Inagi, M. Matsumoto, T. Fujita, M. Nangaku, Chronic hypoxia aggravates renal injury via suppression of Cu/Zn-SOD: a proteomic analysis, Am. J. Physiol. Ren. Physiol. 294 (2008) F62eF72. [31] C.L. Fattman, L.M. Schaefer, T.D. Oury, Extracellular superoxide dismutase in biology and medicine, Free Radic. Biol. Med. 35 (2003) 236e256. [32] M. Higuchi, F.T. Celino, S. Shimizu-Yamaguchi, C. Miura, T. Miura, Taurine plays an important role in the protection of spermatogonia from oxidative stress, Amino Acids 43 (2012) 2359e2369.

[33] B.W. Kong, H. Kim, D.N. Foster, Expression analysis and mitochondrial targeting properties of the chicken manganese-containing superoxide dismutase, Biochim. Biophys. Acta 1625 (2003) 98e108. [34] M. Brouwer, T. Hoexum Brouwer, W. Grater, N. Brown-Peterson, Replacement of a cytosolic copper/zinc superoxide dismutase by a novel cytosolic manganese superoxide dismutase in crustaceans that use copper (haemocyanin) for oxygen transport, Biochem. J. 374 (2003) 219e228. [35] Y.S. Cho, S.Y. Lee, I.C. Bang, D.S. Kim, Y.K. Nam, Genomic organization and mRNA expression of manganese superoxide dismutase (Mn-SOD) from Hemibarbus mylodon (Teleostei, Cypriniformes), Fish. Shellfish Immunol. 27 (2009) 571e576. [36] S. Sun, J. Zhu, X. Jiang, B. Li, X. Ge, Molecular cloning, tissue distribution and expression analysis of a manganese superoxide dismutase in blunt snout bream Megalobrama amblycephala, Fish. Shellfish Immunol. 38 (2014) 340e347. [37] V. Kumaresan, A.J. Gnanam, M. Pasupuleti, M.V. Arasu, N.A. Al-Dhabi, R. Harikrishnan, Comparative analysis of CsCu/ZnSOD defense role by molecular characterization: gene expression-enzyme activity-protein level, Gene 564 (2015) 53e62. [38] H.H. Liu, J.Y. He, C.F. Chi, Y.F. Gu, Identification and analysis of icCu/Zn-SOD, Mn-SOD and ecCu/Zn-SOD in superoxide dismutase multigene family of Pseudosciaena crocea, Fish. Shellfish Immunol. 43 (2015) 491e501. [39] A. Avci, M. Kacmaz, I. Durak, Peroxidation in muscle and liver tissues from fish in a contaminated river due to a petroleum refinery industry, Ecotoxicol. Environ. Saf. 60 (2005) 101e105. [40] Z.W. Zhang, Z. Li, H.W. Liang, L. Li, X.Z. Luo, G.W. Zou, Molecular cloning and differential expression patterns of copper/zinc superoxide dismutase and manganese superoxide dismutase in Hypophthalmichthys molitrix, Fish. Shellfish Immunol. 30 (2011) 473e479. [41] N. Umasuthan, K.S. Revathy, S.D. Bathige, B.S. Lim, M.A. Park, I. Whang, et al., A manganese superoxide dismutase with potent antioxidant activity identified from Oplegnathus fasciatus: genomic structure and transcriptional characterization, Fish. Shellfish Immunol. 34 (2013) 23e37. [42] J. Arockiaraj, R. Palanisamy, P. Bhatt, V. Kumaresan, A.J. Gnanam, M. Pasupuleti, et al., A novel murrel Channa striatus mitochondrial manganese superoxide dismutase: gene silencing, SOD activity, superoxide anion production and expression, Fish. Physiol. Biochem. 40 (2014) 1937e1955. [43] Q. Meng, J. Chen, C. Xu, Y. Huang, Y. Wang, T. Wang, et al., The characterization, expression and activity analysis of superoxide dismutases (SODs) from Procambarus clarkii, Aquaculture 406 (2013) 131e140. [44] N. Chakravarthy, K. Aravindan, N. Kalaimani, S.V. Alavandi, M. Poornima, T.C. Santiago, Intracellular Copper Zinc Superoxide dismutase (icCuZnSOD) from Asian seabass (Lates calcarifer): molecular cloning, characterization and gene expression with reference to Vibrio anguillarum infection, Dev. Comp. Immunol. 36 (2012) 751e755. [45] B.M. Kim, J.S. Rhee, G.S. Park, J. Lee, Y.M. Lee, J.S. Lee, Cu/Zn- and Mnsuperoxide dismutase (SOD) from the copepod Tigriopus japonicus: molecular cloning and expression in response to environmental pollutants, Chemosphere 84 (2011) 1467e1475.