The molecular cloning and expression of a human synaptic vesicle amine transporter that suppresses MPP+ toxicity

MOLECULAR BRAIN RESEARCH ELSEVIER

Molecular Brain Research 25 (1994) 90-96

Research Report

The molecular cloning and expression of a human synaptic vesicle amine transporter that suppresses MPP + toxicity L. Liu, W. Xu, K.A. Harrington, P.C. Emson * MRC Molecular Neuroscience Group, Department of Neurobiology, The Babraham Institute, Babraham, Cambridge CB2 4/1 T, UK

Accepted 10 March 1994

Abstract A synaptic vesicle amine transporter cDNA, termed hSVAT, has been isolated by the reverse transcription and polymerase chain reaction (PCR) technique from human substantia nigra and subsequent screening of a human substantia nigra library. The hSVAT sequence obtained is highly homologous to the rat SVAT sequence (92% homology) and is essentially identical to the human sequence identified recently by Surratt and colleagues [33]. This labelled hSVAT cDNA detected a single band ( ~ 5.0 kb) when used as a probe for Northern analysis of human nigral RNA extract. In situ hybridization studies using hSVAT specific antisense oligonucleotides showed a strong hybridization signal concentrated over the cells of the substantia nigra pars compacta. This cDNA sequence when expressed in chinese hamster ovary (CHO) cells conferred resistance to MPP + the toxic metabolite of MPTP and cells containing it accumulated dopamine. Key words: MPP + toxicity; hSVAT; Amine transporter; MPTP

1. Introduction M o n o a m i n e - c o n t a i n i n g n e u r o n e s of the C N S express b o t h p l a s m a m e m b r a n e a n d vesicular a m i n e t r a n s p o r t e r s which a r e r e s p o n s i b l e for the r e - u p t a k e of r e l e a s e d m o n o a m i n e s into the nerve t e r m i n a l a n d t h e i r r e - p a c k a g i n g into synaptic vesicles [13,5,6,8,9,12,13,14, 15,20,21,25,26,31]. T h e vesicular t r a n s p o r t e r is the site of action o f r e s e r p i n e a n d t e t r a b e n a z i n e [5,9,12,29,30, 32,34] which are k n o w n to d i s r u p t m o n o a m i n e s t o r a g e and the vesicle a m i n e t r a n s p o r t e r is i m p o r t a n t in seq u e s t e r i n g m o n o a m i n e n e u r o t o x i n s such as N - m e t h y l 4 - p h e n y l p y r i d i n i u m ( M P P + ) the toxic m e t a b o l i t e of the neurotoxin N-methyl-l,2,3,6-tetrahydropyridine ( M P T P ) which is u s e d to p r o d u c e a m o d e l o f P a r k i n son's d i s e a s e in p r i m a t e s [4,10,11,16,17,22]. T h e r e c e n t cloning o f c D N A s e n c o d i n g t h e rat synaptic vesicular a m i n o t r a n s p o r t e r ( r S V A T ) [6,17] p r o m p t e d us to use reverse t r a n s c r i p t i o n - P C R on h u m a n s u b s t a n t i a nigra R N A a n d library s c r e e n i n g to identify c D N A s e n c o d ing the h u m a n synaptic vesicular a m i n e t r a n s p o r t e r . A full length c D N A clone t e r m e d h S V A T was o b t a i n e d

* Corresponding author. Fax: (44) 223-836 614. 0169-328X/94/$07.00 © 1994 Elsevier Science B.V. All rights reserved SSDI 0169-328X(94)00052-G

a n d s e q u e n c e d . This clone is essentially identical to that o b t a i n e d by S u r r a t t a n d c o l l e a g u e s [33] from a h u m a n b r a i n stem library. In o r d e r to e x a m i n e the p r o p e r t i e s of h S V A T , especially as to w h e t h e r it w o u l d r e n d e r cells r e s i s t a n t to M P P + the toxic m e t a b o l i t e of M P T P h S V A T was e x p r e s s e d in C H O cells a n d t h e i r ability to survive M P P + e x p o s u r e a n d a c c u m u l a t e d o p a m i n e studied. It is a l r e a d y k n o w n that r S V A T confers M P P + resistance on C H O cells, but as h u m a n s a r e m u c h m o r e sensitive to M P T P t h a n r o d e n t s it was not obvious t h a t h S V A T w o u l d e n a b l e cells expressing it to resist the toxic effects o f M P P + [11].

2. Materials and m e t h o d s 2.1. RT-PCR

A pair of primers derived from the published rat vesicular amine transporter cDNA sequence were used to carry out the PCR reaction. The forward primer (F1) is 5'-gcgcaaactgatcctgttcatcg; at position 124-148, the reverse primer (RI) is 5'-ggtagccttgtgtactgcctc; at position 357-381. Total RNA was isolated from three separate human substantia nigra samples using a standard phenol-extraction method [27]. The first strand of cDNA was generated using random primers and reverse transcriptase [27]. The subsequent PCR was carried out using the following cycling conditions; denaturation at

L. Liu et al. / Molecular Brain Research 25 (1994) 90-96 94°C, 1 min, 63°C 1 min, and 72°C 1 min for 30 cycles. T h e P C R products were cloned into the Bluescript II SK-vector using the T-vector method and sequenced [18].

2.2. Screening human brain cDNA libraries T h e cloned P C R products which contained the h S V A T sequences were used as probes to screen a h u m a n brain c D N A library (Stratagene, h u m a n brain substantia nigra library, catalogue no. 936206). 3 X 106 plaques were screened using 5 × 108 cpm//,Lg of the 32p labelled partial c D N A probe. Positive clones were isolated as Bluescript II SK plasmids via an in vivo excision method through the use of helper phage (Stratagene, USA).

2.3. Subcloning and sequencing Isolated positive clones were digested with several different restriction enzymes. PstI and HindlII sites found within the insert were used to subclone inserts into the Bluescript II SK-vector. Three different PstI subclones, and two different HindlII subclones were generated; these were sequenced using T3 and T7 primers. A series of designed oligonucleotide primers were also used to fill in the gaps in sequence between the different subclones. Sequence analysis was carried out on both strands using the chain termination method [28] and Sequenase Tm (US Biochemicals).

91

2.6. In situ hybridization Four antisense oligonucleotides complementary to different coding regions of the h u m a n and rat SVAT sequences were used. Two antisense oligonucleotides complementary to bases 106-156 (hSVAT-F1) and bases 819-855 (hSVAT-F2) of the h S V A T clone (Table 1) sequence and two antisense nucleotides specific for the rat SVAT sequences were used [6,17]. The probes were 3'-end labelled with [35S]dATP a S (300 Ci//zmol; N E N 034H) and terminal deoxynucleotidyl transferase (Pharmacia) to a specific activity of 1 × 108 d p m / / x g . Unincorporated radionucleotide was removed from the reaction mixture by purifying probes through Sephadex G-50 (Pharmacia) columns. Oligonucleotides were labelled as mixtures of two for h S V A T or rSVAT, respectively. In situ hybridization was carried out using the labelled probes as described previously [35]. Briefly, fresh frozen cryostat sections (15/~m) of h u m a n substantia nigra were fixed in 4% neutral buffered paraformaldehyde (20 min), rinsed in 0.1 M PBS and dehydrated. Sections were hybridized overnight at 37°C with saturating concentration of [35S]hSVAT or 35S-labelled rat SVAT probes. Sections were then washed in 1 x SSC at 55°C (3 × 30 min) dehydrated and then exposed to film Hyperfilm /3 Max (Amersham) for 3 weeks at room temperature. Finally, sections were dipped in autoradiographic emulsion (llford K2) for 8 weeks at 4°C. Sections were then developed, conterstained and coverslipped. Control sections where an excess of cold probe (25 ng/slide) was added to the hybridization buffer were processed in parallel.

2.4. RNA and Northern blot analysis Poly(A) + R N A was isolated using a fast-track m R N A isolation kits (In Vitrogen, California). For Northern analysis, 5 ~ g of poly(A) ÷ R N A was separated by electrophoresis through 1.0% agarose and blotted on nylon (Hybond-N, A m e r s h a m ) [27]. For hybridization, the filters were prehybridized in 50% formamide, 5 × S S C , 5 % × Denhardt's, 200 / z g / m l salmon sperm D N A for 4 h at 42°C then hybridized in the same solution with the h S V A T c D N A insert labelled by r a n d o m priming with [32p]dCTP at 42°C for 16 h [7]. Finally the m e m b r a n e was washed twice at 42°C for 15 mins in 2 x S S C and twice at room temperature in 2 × S S C (1 h). The hybridized filter was then opposed to autoradiography film (Kodak) with an intensifying screen at - 7 0 ° C for 7 days.

2.5. Construction of an expression plasmid and transfection T h e p R C / C M V vector (In V~trogen) was used as the expression vector. A 1.6 kb HindIII fragment which contained the entire hSV A T coding sequence was cloned into p R C / p C M V and a clone which had the correct orientation was maxi-prepared using standard CsCl 2 ultracentrifugation methods [27]. A standard phosphatecalcium chloride precipitation m e t h o d was used to transfect the plasmid into C H O cells [27]. After 2 days, neomycin, G148 (500 / z g / m l ) was added to the RPMI-1640 medium with 10% foetal calf s e r u m to select the neomycin resistant clones. After a further 2 weeks, neomycin-resistant clones were exposed to 05-1 m M MPP + which was added directly to the culture medium. Cells resistant to the toxic effects of this compound survived [17]. Resistant cells were tested for their ability to accumulate dopamine relative to control non-transfected cells. Cells were permeabilized [6] and incubated in R P M I m e d i u m containing 10-100 /zM dopamine. After uptake for 30 minutes cells were extensively washed in cold PBS (4°C) and then extracted in 0.2 M perchloric acid for determination of retained cellular dopamine content. A m o u n t s of dopamine retained in transfected and non-transfected cells were determined by H P L C and electrochemical detection [19].

3. Results

3.1. Isolation of a fuU-length human synaptic vesicle amine transporter cDNA, (clone 2) from a human substantia nigra cDNA library One of the cDNA clones isolated by RT-PCR was used to screen a human substantia nigra cDNA library. After several attempts, a positive clone which has a 2.2 kb insert was successfully identified from 106 plaques. This clone contains three Pst I fragments of 540 bp, 300 bp and 1.2 kb, and two HindlII fragment of 1.6 kb and 0.6 kb. Sequence analysis revealed a single open reading frame with the first A T G start codon, in a context that conforms to the consensus for translation initiation (Table 1). The predicted protein of 514 amino acids shows no strong homology to any other known proteins except for the rat SVAT, with which it has 86% nucleotide identity and a 92% amino acid identity. The first predicted intralumenal loop in this transporter contains a number of significant differences between the human and rat sequences. From amino acid 63 to 113 there is only 50% amino acid identity. Two amino acid insertions occurred in the humanhSVAT. Insertion one occurred at position 75-77, Phe-Gln-Ser. There are no counterparts in the rat sequence. The other insertion occurred at position 94-96 where the rat only has one amino acid Leu, but the human cDNA has Arg-Asp-Leu.

L. Liu et al. / Molecular Brain Research 25 (1994) 90-96

92

Table 1 Nucleic acid and deduced amino acid sequence of human-SVAT

l.rat-svat 2.Human-svat GAA 1 Asp 2 Ser Glu Leu AGC GAG CTG 1 2 Leu Phe Ile CTG TTC ATC 1 2 Pro Ile Ile CCC ATC ATC 1 2 Gln Thr Ala CAG ACG GCC

A r g P r o V a l His T h r A l a S e r Ile Ser A s p S e r P h e G l n S e r I l e P h e 79 A G G C C A G T G C A C A C T G C C T C C A T C T C A G A C A G C T T C C A G A G C A T C T T C 279

1

Ash

TTC CGC Val Ala Leu GCG CTG

Met ACC GCA AGC GAC CCC GAG CGG AGC CCC GGA GCC ATG Leu Arg Asp His Val Arg Trp Leu Gln Glu Ser Arg Arg Ser Arg Lys GTC CGC TGG CTG CAG GAG AGC CGC CGC TCG CGG AAG

Ala Leu GCC CTG

3 51

Leu Ile 22 C T C A T C 108

Val Phe Leu Ala Leu Leu Leu Asp Asn Met Leu Leu Thr Val Val Val 41 G T G T T C C T G G C G C T G C T G C T G G A C A A C A T G C T G C T C A C T G T C G T G G T C 165 P r o S e r T y r L e u T y r S e t Ile L y s His G l u L y s A s n A l a T h r G l u I l e 60 C C A A G T T A T C T G T A C A G C A T T A A G C A T G A G A A G A A T G C T A C A G A A A T C 222

2 Ser Tyr Tyr Asp Asn TCC TAT TAT GAT AAC

V~ILo~II@

-

leu

-

Set Thr Met Val Thr Gly ASh Ala Thr Arg Asp Leu Thr Leu 98 T C G A C T A T G G T C A C C G G G A A T G C T A C C A G A G A C C T G A C A C T T 336

~=~m~aAl~E~®~ Thr Ala Thr Thr 2 H i s G l n T h r A l a T h r G l n H i s M e t V a l T h r A s n A l a S e r A l a V a l P r o S e r A s p C y s 117 C A T C A G A C C G C C A C A C A G C A C A T G G T G A C C A A C G C G T C C G C T G T T C C T T C C G A C T G T 393 Arg 1 P r o S e r G l u A s p L y s A s p L e u L e u A s n G l u A s n V a l G l n V a l G l y L e u L e u P h e A l a 136 2 C C C A G T G A A G A C A A A G A C C T C C T G A A T G A A A A C G T G C A A G T T G G T C T G T T G T T T G C C 450

Leu 1 Ser 2 TCG 1 2 Ile ATT 1 2 Met ATG 1 2 Ile ATC 1 2 Asp GAT 1 2 Val GTC 1 2 Pro CCG 1 2 Leu CTC 1 2 Leu CTG 1 2 Ile ATC 1 2 Lys AAG

L y s A l a T h r V a l G l n L e u Ile AAA GCC ACC GTC CAG CTC ATC Met G l y T y r P r o Ile P r o Ile P h e GGC TAT CCA ATT CCC ATA TTT

Ash(Ash) Thr Asn Pro Phe Ile GIy Leu Leu ACC AAC CCT TTC ATA GGA CTA CTG Ile Ala GIy Phe Cys Ile Met Phe Val GCG GGA TTC TGC ATC ATG TTT GTC

P h e A l a P h e S e r S e r S e r T y r A l a P h e L e u L e u Ile A l a A r g TTT GCC TTC TCC AGC AGC TAT GCC TTC CTG CTG ATT GCC AGG G17 Ser Ser Cys Ser Ser GGC TCG TCC TGC TCC TCT Lys Asp Glu Glu Arg Gly Asn GAT GAA GAG AGA GGC AAC

Val Ala GTG GCT Pro Val Met GTC ATG

T h r S e t A r g 155 A C C A G C A G A 507 Val S e r T h r I l e 174 T C A A C A A T T 564

S e r L e u G l n G 1 7 193 T C G C T G C A G G G C 621

G l y M e t G 1 7 M e t L e u A l a S e r V a l T y r T h r 212 G G G A T G G G C A T G C T T G C C A G T G T C T A C A C A 678 G I y I l e A l a L e u G I y G l y L e u A l a M e t G I y 231 G G A A T C G C C T T G G G A G G C C T G G C C A T G G G T 735

L e u V a l G I y P r o P r o P h e G 1 7 S e r V a l L e u T y r G l u P h e V a l G l y L y s T h r V a l 250 GTG CTC TAT GAG TTT GTG GGGAAG A C G G T T 792 TTA GTG GGC CCC CCC TTC GGGAGT P h e L e u V a l L e u A l a A l a L e u V a l L e u L e u A s p G l y A l a I l e G l n L e u P h e V a l 269 T T C C T G G T G C T G G C C G C C C T G G T A C T C T T G G A T G G A G C T A T T C A G C T C T T T G T G 849 Gln Pro Ser Arg Val Gln Pro Glu Ser Gln Lys Gly Thr CAG CCG TCC CGG GTG CAG CCA GAG AGT CAG AAG GGG ACA Ser L y s A s p P r o T y r I l e L e u Ile A l a A l a G 1 7 S e r Ile C y s AAG GAC CCG TAC ATC CTC ATT GCT GCA GGC TCC ATC TGC

P r o L e u T h r T h r L e u 288 C C C C T A A C C A C G C T G 906 P h e A l a A s n M e t G 1 7 307 T T T G C A A A C A T G G G C 963

A l a M e t L e u G l u P r o A l a L e u P r o Ile T r p M e t M e t G l u T h r M e t C y s S e r A r g 326 GCC ATG CTG GAG CCA GCC~CTG CCC ATC TGG ATG ATG GAG ACC ATG TGT TCC CGAI020 T r p G l n L e u G I 7 V a l A l a P h e L e u P r o A l a S e r Ile S e r T y r L e u I l e G I 7 T h r 345 TGG CAG CTG GGC GTT GCC TTC TTG CCA GCT AGT ATC TCT TAT CTC ATT GGA ACCI077

L. Liu et al. / Molecular Brain Research 25 (1994) 90-96

While this manuscript was in preparation, Surratt et al. [33] reported the isolation of a cDNA clone from a human brain stem library. Their coding sequences (hSVMT-1) has 98% sequence identity with our clone. In the 3' untranslated region, our sequence is about 500 bp longer. There are only five amino acid differences between the hSVAT and hSVMT-1 sequences these are indicated in bold italic letters on Table 1. At three positions our clone has the same amino acids as found in the rat; at position 302, where rSVAT and our hSVAT clone have a cysteine (Cys), whereas hSVMT-1 has a serine (Ser), at position 355, where rat has a lysine (Lys), and hSVMT-1 has a threonine (Thr) and at position 379, the rat sequence have asparagine (Asn), whereas hSVMT-1 has a proline (Pro). The significance of these small differences is not understood but they may only be technical errors associated with use of an automatic sequencer by Surratt et al 1993 [33]. In

93

our hSVAT clone these sequences have been checked by sequencing from both orientations. 3.2. Establishment of a permanent transfected cell line that suppresses MPP ÷ toxicity To establish if our clone was functional, we developed a permanent C H O cell line which contained the construct-pRC/CMV-svat. This cell line was compared with the control untransfected C H O cell line for MPP ÷ resistance. Using cell culture conditions of medium cell density (40% confluence) the non-transfected control 'CHO' cells were not viable after 3 days in the presence of 0.5-1 mM MPP ÷ (Fig. 1). In contrast C H O cells transfected with the p R C / C M V - s v a t construct were resistant to 0.5-1 mM MPP ÷, cells were still surviving after 2 weeks and 1 month exposure, however, their growth rate relative to the normal non-toxin

Table 1 (continued) 1 2 Asn AAT 1 2 Met ATG 1 2 Leu CTC 1 2 Met ATG 1 2 Tyr TAC 1 2 GIy GGT 1 2 AsP GAT 1 2 Lys AAA 1 2 Asn AAT

Thr Ile Phe G 1 7 Ile Leu A l a His Lys Met Gly A r g Trp Leu A T T TTT G G G A T A CTT GCA CAC A A A A T G G G G A G G TGG CTT Pro Ile Ile Val G 1 7 Val Ser Ile Leu Cys Ile Pro Phe A l a A T A A T T GTT G G A GTC A G C ATT TTA TGT A T T CCA TTT G C A Ile Ile A l a Pro A s n Phe Glv Val GIy Phe Ala A s n G17 Met A T A G C T C C G A A C TTT G G A GTT GGT TTT GCA AAT GGA A T G

Cys A l a Leu L e u G17 364 TGT GCT CTT C T G GGAII34 Lys A s n Ile Tyr Gly 383 A A A A A C A T T T A T GGA1191

Val A s p Ser Ser Met 402 G T G G A T T C G T C A ATG1248

Pro Ile Met G 1 7 Tyr Leu Val A s p Leu A r g His Val Ser Val Tyr G l y Ser V a l 421 CCT A T C A T G GGC TAC CTC GTA GAC CTG CGG CAC GTG TCC GTC TAT G G G A G T GTG1305 A l a Ile A l a A s p Val A l a Phe Cys Met G17 Tyr Ala Ile G 1 7 Pro Ser A l a G17 440 GCC A T T G C G GAT G T G GCA TTT TGT A T G G G G TAT GCT A T A GGT CCT TCT GCT GGTI362 A l a Ile GCT A T T Ala Ile P r o ATT CCT

A l a Lys GCA AAG (Leu) Phe Ala T T T GCC

A l a Ile Gly Phe Pro Trp Leu Met Thr Ile Ile G 1 7 Ile Ile 459 GCA A T T GGA TTT CCA T G G CTC A T G A C A A T T A T T G G G A T A ATT1419 Pro Leu Cys Phe Phe Leu Arg Ser Pro Pro A l a Lys Glu Glu 478 CCT CTC TGC TTT TTT CTT C G A AGT C C A CCT GCC A A A G A A GAA1476

Met A l a Ile Leu Met A s p His A s n Cys Pro Ile Lys Thr Lys Met Tyr Thr G l n 497 A T G GCT A T T CTC A T G GAT CAC A A C TGC CCT ATT A A A A C A A A A A T G TAC A C T CAG1533 A s n Ile G l n Ser Tyr Pro Ile Gly Glu Asp GIu GIu Ser Glu Ser A s p TER 514 A A T A T C C A G T C A TAT CCG A T A GGT G A A GAT GAA GAA TCT G A A A G T GAC T G A GATI590

GAGATCCTCAAAAATCATCAAAGTGTTTAATTGTATAAAACAGTGTTTCCAGTGACACAACTCATCCAGAACTGT CTTAGTCATACCATCCATCCCTGGTGAAAGAGTAAAACCAAAGGTTATTATTTCCTTTCCATGGTTATGGTCGAT TGCCAACAGCCTTATAAAGAAAAAGAAGCTTTTCTAGGGGTTTGTATAAATAGTGCTTGAAACTTTATTTTATGT ATTTAATTTTATTAAATATCATACAATATATTTTGATGAATAGGTATTGTGTAAATCTATAAATATTTGAATCC AAACCAAATATAATTTTTTTTTAACTTACATTAACAAACATTTGGGCAAAAATCATATTAATGAATGAGTGTTTA AAATTAAAGCACACATTATCTCTGAGACTCTTCCAACAAAGAGAAACTAGAATGAAGTCTGAAAAACAGAATCGA TAAGACAGCATGTTATATAGTGACACTGGATGTTATTTAACTTGTAGTTACTATCAATATATTTATCGTGTAAAC AGCTAGTTCTCTCAAGTGTAGAGGACAAGAACTTGTGTCAGTTATCTTTTGAATCCATAAATCTTAGCTGGCATT AGTTTTCTATGTAATCACCTACCTAGAGAGAGTTGTAAATATATATGTTAACATGTTATCTGGTTGGCAGCAAGG AATTCC

1665 1740 1815 1890 1965 2040 2115 2190 2265 2271

Nucleotides and amino acids are numbered consecutively from the putative initiation codon. Putative transmembrane domains are underlined. The four potential asparagine (Asn) glycosylation sites at positions (a, b, c, and d) are also underlined. Bold lettering indicates the difference between our hSVAT sequence and rat SVAT [6,17]. The italic lettering shows amino acid differences between our clone and hSVMT [33]. Outline lettering indicates insertion sites.

94

L. Liu et al. / Molecular Brain Research 25 (1994) 90-96

a

b

28S-

-5kb

18S-

Fig. 3. Northern analysis of 5 /~g poly(,A)+ RNA extracted from human substantia nigra hybridized with a 32p labelled hSVAT cDNA. Positions of 28S and 18S rRNA are marked. Arrow indicates the position of hSVAT mRNA (5.0 kb).

Fig. 1. Effects of exposure of CHO cells to MPP + (0.5 mM). Cells in A were transfected with the expression vector pRC/CMVsvat. Cells in B are control non-transfected CHO cells. Cells were exposed to 0.5 mM MPP ÷ for 72 h and then cell viability determined by exposing cells to fluorescence diacetate. Fluorescent cells (A) are viable and have accumulated and metabolized the dye. Only a very few viable cells remain in the non-transfected controls (B).

(Fig. 2). T h e h S V A T h y b r i d i z a t i o n signal was c o n c e n t r a t e d in the p a r s c o m p a c t a of s u b s t a n t i a nigra (Fig. 2A). This specific signal was d i s p l a c e d by an excess o f u n l a b e l t e d o l i g o n u c l e o t i d e (Fig. 2B). In contrast, using the two rat specific o l i g o n u c l e o t i d e s e q u e n c e s , no specific h y b r i d i z a t i o n signal was d e t e c t e d in h u m a n substantia nigra sections ( d a t a not shown).

e x p o s e d C H O cells was substantially r e d u c e d . Fig. 1 shows the effects of 0.5 m M M P P + on the viability of h S V A T - t r a n s f e c t e d C H O cells (A) a n d n o n - t r a n s f e c t e d c o n t r o l C H O cells (B). Cell viability was d e t e r m i n e d by the cells ability to a c c u m u l a t e fluorescein d i a c e t a t e [24]. A f t e r 3 days, less t h a n 1% of control n o n - t r a n s fected cells survived (Fig. 1B) while the h S V A T transfected cells a r e viable a n d strongly fluorescent, P e r m a bilized M P P + resistant cells also a c c u m u l a t e d m o r e d o p a m i n e from the R P M I m e d i u m ( d o p a m i n e c o n c e n t r a t i o n 10 /~M) t h a n did c o n t r o l n o n - t r a n s f e c t C H O cells. A f t e r r e m o v a l of M P P + from the c u l t u r e m e d i u m the growth rate o f the t r a n s f e c t e d C H O cells r e t u r n e d to normal.

3.4. Northern blot analysis U s i n g the 2.2 kb insert from the h S V A T clone as a h y b r i d i z a t i o n p r o b e , a single m R N A b a n d ( ~ 5.0 kb) was d e t e c t e d in the h u m a n s u b s t a n i a n i g r a R N A extract (Fig. 3).

4. Discussion In this p a p e r , we d e s c r i b e the isolation of a h u m a n synaptic vesicle a m i n e t r a n s p o r t e r c D N A clone. O u r clone, h S V A T has a full-length coding s e q u e n c e , which confers resistance to M P P ÷ w h e n t r a n s f e c t e d into C H O cells, w h e n used as a p r o b e for N o r t h e r n analysis d e t e c t s a single b a n d of 5.0 kb in h u m a n s u b s t a n t i a nigra R N A extracts a n d is selectively a n d specifically

3.3. Tissue distribution o f m R N A by in situ hybridization Using a n t i s e n s e o l i g o n u c l e o t i d e sequences, h S V A T F1 a n d F2, a h y b r i d i z a t i o n signal c o u l d be d e t e c t e d readily in h u m a n s u b s t a n t i a nigra p a r s c o m p a c t a cells

A

B

. - . ,

Fig. 2. Localisation of hSVAT mRNA in human substantia nigra dopamine cells using film autoradiography. A shows the specific radioactive hybridization signal in the area of the substantia nigra pars compacta. B shows a control section hybridized with an excess of unlabelled probe. Note the hSVAT specific signal is displaced in the control (B).

L. Liu et al. / Molecular Brain Research 25 (1994) 90-96

expressed by dopaminergic cells in the human substantia nigra. This clone has a coding sequence almost identical to that recently published for a human synaptic vesicle amine (hSVMT) transporter isolated from a human brain stem cDNA library [33] although the 3' untranslated region of our clone is longer. The four amino acid differences between SVMT [33] and hSVAT reported here may be only minor technical differences, as our clones were sequenced by subcloning and routine double stranded sequencing in either orientation, whilst the brain stem hSVMT [33] was sequenced by an automatic sequencer. Both hSVMT [33] and our hSVAT sequences show a high degree of homology (with 92% amino acid identity) with the rat SVAT, [6,17] and, therefore, are likely to correspond to the human hSVAT. In the context of Parkinson's disease it is interesting to note that our human cDNA clone sequence when expressed in C H O cells does confer resistance to MPP ÷ on these cells [17]. The ability of hSVAT to confer resistance to MPP ÷ is not unexpected [17], but it is interesting in that it is known rats are more resistant to MPP ÷ and that primates including man are much more sensitive to MPP ÷ [11]. The relative sensitivity (primates) or insensitivity (rats) to MPP ÷ is not therefore an intrinsic property of the different transporters and both hSVAT and rSVAT confer MPP ÷ resistance. The C H O cells expressing the human SVAT transporter presumably survive the toxic effects of MPP ÷ because as suggested by Liu et al [17] the transporter reduces the intracellular toxic concentration of MPP +. 'Detoxification' of MPP ÷ by hSVAT may also occur in nigral cells of individuals who have ingested MPP ÷ or other related toxins. Thus it may be that the 'detoxification' is not sufficiently rapid or effective in human nigral cells to completely protect these cells against MPP ÷, as human adrenal chromaffin cells which express the related chromaffin granule amine transporter C G A T [4,10,22] survive MPTP exposure. It may be possible therefore that vulnerable individuals have lower or modified hSVAT expression in their substantia nigra dopamine cells and r e d u c e d / m o d i f i e d expression of hSVAT may be a contributory factor underlying the development of Parkinsonism in susceptible individuals. Indeed it has been suggested that the endogenous transmitter dopamine may itself produce oxidative stress [2,20,23] and reduce the functioning of hSVAT thus predisposing vulnerable individuals to Parkinson's disease.

Acknowledgements Ms L. Liu is supported by the Parkinson's Disease Society (UK) and Dr. K. Harrington by Glaxo (UK). We are grateful to the staff of the Parkinson's Disease

95

Society Brain Bank, Institute of Neurology, London for their help and provision of brain tissue.

References [1] Anderson, D.C., King, S.C. and Parsons, S.M., Pharmacological characterization of the acetylcholine transport system in purified Torpedo electric organ synaptic vesicles, Mol. Pharmacol., 24 (1983) 48-54. [2] Cohen, G., Monoamine oxidase and oxidative stress at dopaminergic synapses, J. Neural Transm., (Suppl.) 32 (1990) 229-238. [3] Carlsson, A., Hillarp, N.A. and Waldeck, B., Analysis of the Mg2+-ATP-depenent storage mechanism in the amine granules of the adrenal medulla, Acta Physiol. Scand., (Suppl.) 215 (1963) 1-38.

[4] Daniels, A.J. and Reinhard, J.F., Energy-driven uptake of the neurotoxin 1-methyl-4-phenylpyridinium into chromaffin granules via the catecholamine transporter, J. Biol. Chem., 263 (1988) 5034-5036. [5] Darchen, F., Scherman, E. and Henry, J.-P., Reserpine binding to chromaffin granules suggests the existence of two conformations of the monoamine transporter, Biochemistry, 28 (1989) 1692-1697. [6] Erickson, J.D., Eiden, L.E. and Hoffman, B.J., Expression cloning of a reserpine-sensitive vesicular monoamine transporter, Proc. Natl. Acad. Sci. USA, 89 (1992) 10993-10997. [7] Feinberg, A.P. and Vogelstein, B., A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity, Anal. Biochem., 132 (1983) 6-13. [8] Isambert, M.-F., Gasnier, B., Botton, D. and Henry, J.-P., Characterization and purification of the monoamine transporter of bovine chromaffin granules, Biochemistry, 31 (1992) 19801986. [9] Iversen, L.L., The uptake of biogenic amines. In S.D. Iversen and S.H. Snyder (Eds.), Handbook of Psychopharmacology, Vol. 3, Plenum, New York, 1976, pp. 381-442. [10] Javitch, J., D'Amato, R., Strittmatter, S.M. and Snyder, S.M., Parkinsonism-inducing neurotoxin N-methyl-4-phenyl-l,2,3,6-tetrahydropyridine: uptake of the metabolite N-methyl-4-phenylpyridine by dopamine neurons explains selective toxicity, Proc. Natl. Acad. Sci. USA, 82 (1985) 2173-2177. [11] Johannessen, J.N., Chiueh, C.C., Burns, R.S. and Markey, S.P., Current concepts. IV. Differences in the metabolism of MPTP in the rodent and primate parallel differences in sensitivity to its neurotoxic effects, Life Sci., 36 (1985) 219-224. [12] Johnson, R.G., Accumulation of biological amines into chromaffin granules: a model for hormone and neurotransmitter transport, Physiol. Rev., 68 (1988) 232-307. [13] Kanner, B.I. and Schuldiner, S., Mechanism of storage and transport of neurotransmitters, CRC Crit. Rev. Biochem., 22 (1987) 1-38. [14] Kilty, J.E., Lorang, D. and Amara, S.G., Cloning and expression of a cocaine-sensitive rat dopamine transporter, Science, 254 (1991) 578-579. [15] Kirshner, N., Uptake of catecholamines by a particulate fraction of the adrenal medulla, J. Biol. Chem., 237 (1962) 2311-2317. [16] Krueger, M.J., Singer, T.P., Casida, J.E. and Ramsay, R.R., Evidence that the blockade of mitochondrial respiration by the neurotoxin 1-methyl-4-phenylpyridinium (MPP ÷ ) involves binding at the same site as the respiratory inhibitor, rotenone, Biochem. Biophys. Res. Commun., 169 (1990) 123-128. [17] Liu, Y., Peter, D., Roghani, A., Schuldiner, S., Prive, G.G., Eisenberg, D., Brecha, N. and Edwards, R.H., A cDNA that suppresses MPP + toxicity encodes a vesicular amine transporter, Cell, 70 (1992) 539-551.

96

L. Liu et al. / Molecular Brain Research 25 (1994) 90-96

[18] Marchuk, D., Drumm, M., Saulino, A. and Collins, F., Construction of T-vectors, a rapid and general system for direct cloning of unmodified PCR products, Nucl. Acid Res., 19 (1991) 1154. [19] Mefford, I.N., Application of high-performance liquid chromotography with electrochemical detection to neurochemical analysis. Measurement of catecholamines, serotonin and metabolities in rat brain, J. Neurosci. Methods, 3 (1981) 207-224. [20] Michel, P.P. and Hefti, F., Toxicity of 6-hydroxydopamine and dopamine for dopaminergic neurones in culture, J. Neurosci. Res., 26 (1990) 428-435. [21] Pachoiczyk, T., Blakely, R.D. and Amara, S.G., Expression cloning of a cocaine- and antidepressant-sensitive human noradrenaline transporter, Nature, 350 (1991) 350-354. [22] Reinhard, J.F., Jr., Diliberto, E.J., Jr., Viveros, O.H. and Daniels, A.J., Subcellular compartmentalization of l-methyl-4phenyl-pyridinium with catecholamines in adrenal medullary chromaffin vesicles may explain the lack of toxicity to adrenal chromaffin cells, Proc. Natl. Acad. Sci. USA, 84 (1987) 81608164. [23] Rosenberg, P.A., Catecholamine toxicity in cerebral cortex in dissociated cell culture, J. Neurosci., 8 (1988) 2887-2894. [24] Rotman, B. and Papermaster, B.W., Membrane properties of living mammalian cells as studied by enzymatic hydrolysis of fluorogenic esters, Proc. Natl. Acad. Sci. USA, 55 (1966) 134-141. [25] Rudnick, G., ATP-driven H ÷ pumping into intracellular organelles, Annu. Rev. Physiol., 48 (1986) 403-413. [26] Rudnick, G., Steiner-Mordoch, S.S., Fishkes, H., Stern-Bach, Y. and Schuldiner, S., Energetics of reserpine binding and occlusion by the chromaffin granule biogenic amine transporter, Biochemistry, 29 (1990) 603-608. [27] Sambrook, J., Fritschi, E. and Maniatis, T., Molecular Cloning, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.

[28] Sanger, F., Nicklen, S. and Coulson, A., DNA sequencing with chain-terminating inhibitors, Proc. Natl. Acad. Sci. USA, 74 (1977) 5463-5467. [29] Scherman, D., Dihydrotetrabenazine binding and monamine uptake in mouse brain regions, J. Neurochem., 47 (1986) 331339. [30] Scherman, D. and Henry, J.-P., Reserpine binding to bovine chromaffin granule membranes: characterization and comparison with dihydrotetrabenazine binding, Mol. Pharmacol., 25 (1984) 113-122. [31] Stern-Bach, Y., Greenberg-Ofrath, N., Fletcher, I. and Schuldiher, S., Identification and purification of a functional amine transporter from bovine chromaffin granules, J. Biol. Chem., 265 (1990) 3961-3966. [32] Sulzer, D. and Rayport, S., Amphetamine and other psychostimulants reduce pH gradients in midbrain dopaminergic neurons and chromaffin granules: a mechanism of action, Neuron, 5 (1990) 797-808. [33] Surratt, C.K., Persico, A.M., Yang, X.-D., Edgar, S.R., Bird, G.S., Hawkins, A.L., Griffin, C.A., Ethylin, X.L., Jabs, W. and Uhl, G.R., A human synaptic vesicle monoamine transporter cDNA predicts posttranslational modifications, reveals chromosome 10 gene localization and identifies TaqI RFLPs, FEBS Lett., 318 (1993) 325-330. [34] Vincent, M.S. and Near, J.A., Identification of a [3H]dihydrotetrabenazine-binding protein from bovine adrenal medulla, Mol. Pharmacol., 40 (1991) 889-894. [35] Young, W.S., In situ hybridization histochemistry. In F. Wouterlood and A. Van den Pol (Eds.), Methods for the Study of Neuronal Microcircuits and Synaptic Interactions. Handbook of Chemical Neuroanatomy, Vol. 8, Series eds Bj6rklund, A. and H6kfelt, T., Elsevier, Amsterdam, 1990, pp. 481-512.