The molecular insight into the antihyperuricemic and renoprotective effect of Shuang Qi gout capsule in mice

Journal of Ethnopharmacology 163 (2015) 278–289

Contents lists available at ScienceDirect

Journal of Ethnopharmacology journal homepage: www.elsevier.com/locate/jep

Research Paper

The molecular insight into the antihyperuricemic and renoprotective effect of Shuang Qi gout capsule in mice Nandani Darshika Kodithuwakku a, Yi-dong Feng b, Yan-yan Zhang a, Min Pan c, Wei-rong Fang a,n, Yun-man Li a,n a

State Key Laboratory of Natural Medicines, Department of Physiology, China Pharmaceutical University, Nanjing 210009, PR China Technology Center of Shenzhen Neptunus Bioengineering Co., Ltd, Shenzhen 518057, PR China c Department of Pharmacy, The Third People's Hospital of Changzhou, No. 300, Lanling North Road, Changzhou, Jiangsu, China b

art ic l e i nf o

a b s t r a c t

Article history: Received 30 May 2014 Received in revised form 12 January 2015 Accepted 14 January 2015 Available online 19 January 2015

Ethnopharmacological relevance: Shuang-Qi gout capsule, a traditional Chinese medicine prescription, has been used in the treatment of, gout arthritis, arthralgia and inflammation. Since renal urate overload associated with severe disability including gout, elimination of excess renal uric acid is highly essential. Therefore, in this study we evaluated the antihyperuricemic and the renoprotective effect of the Shuang Qi gout capsule (SQ) with elucidation of its mechanism. Materials and methods: We assessed the antihyperuricemic activity of SQ on urinary and serum uric acid, creatinine, blood urea nitrogen, fractional excretion of uric acid (FEUA) and glomerular filtration rate of creatinine and uric acid in potassium oxonate (PO) – induced mice as well as in non-induced mice. To illuminate the mechanism of antihyperuricemic activity, we investigated renal transport activity and the expression of mRNA levels in PO-induced and non-induced mice by western blot and RT-PCR methods. Results: SQ showed significant reduction in serum uric acid, creatinine and blood urea nitrogen levels and marked elevation of urine uric acid, creatinine and FEUA levels only in hyperuricemic mice. Furthermore, SQ could recover the altered expressions of proteins and mRNA levels of all the main renal transporters significantly in dose dependent manner. Conclusions: SQ could effectively regulate the main renal transporters denoted its denote probable antihyperuricemic mechanism of SQ and its dose dependent uricosuric effect. In addition, SQ attenuated the deleterious effects of hyperuricemia with renal dysfunction. Thus SQ could be a potent antihyperuricemic agent which can perform as a safer and effective agent in the management of hyperuricemia via regulating the renal transporters. & 2015 Elsevier Ireland Ltd. All rights reserved.

Keywords: SQ gout capsule Gout Antihyperuricemic activity Regulatory actions Renal transporters Mice

1. Introduction Dysfunction of urate excretion mostly via renal pathway is the hallmark of the increased serum uric acid level which is termed as hyperuricemia. Hyperuricemia is the key causative factor of the gout arthritis and it is also associated with many other disorders

Abbreviations: SQ, Shuang-Qi gout capsule; PO, potassium oxonate; TF, Tong Feng tablet; UA, Uric acid; UUA, urinary uric acid; SUA, serum uric acid; Cr, creatinine level; SCr, Serum creatinine; UCr, Urine creatinine; FEUA, fractional excretion of uric acid; BUN, Blood urea nitrogen; GLUT9, glucose transporter 9; URAT1, urate transporter 1; OAT1, organic anion transporters; OCT1 and OCT2, organic cation transporter1 and 2; ABCG2, ATP- binding cassette sub-family G 2; OCTN1 and OCTN2, carnitine transporters 1 and 2 n Corresponding authors. Tel./fax: þ 862583271173. E-mail addresses: [email protected] (W.-r. Fang), [email protected] (Y.-m. Li). http://dx.doi.org/10.1016/j.jep.2015.01.013 0378-8741/& 2015 Elsevier Ireland Ltd. All rights reserved.

and conditions such as renal disorders, metabolic syndrome, and metabolic disorders (Chen et al., 2001; Choi and Ford, 2007). Uric acid is not permeable to the cell membrane in the absence of renal urate transporters. Organic anion and cation transporters are involved in renal urate excretion or the reabsorption such as glucose transporter 9 (GLUT9, SLC2A9), urate transporter 1 (URAT1, SLC22A12), organic anion transporters (OAT1, SLC22A6), OCT1 (SLC22A1), OCT2 (SLC22A2) and ATP- binding cassette subfamily G 2 (ABCG2), play critical roles in urate homeostasis in vivo which homolog with the human transporters (Hediger et al., 2005; Wright et al., 2010; Matsuo et al., 2014). In addition, carnitine transporters such as OCTN1 and OCTN2 are also considered to be mediating in uric acid homeostasis as tubular transporters (Wright et al., 2010). Recent studies demonstrated that hURAT1 and hGLUT9 lead to the renal reabsorption of urate which results in the increase of serum urate levels as well as decrease of FEUA (Matsuo et al., 2008). The OAT1 as well as OCT1 and OCT2 are

N.D. Kodithuwakku et al. / Journal of Ethnopharmacology 163 (2015) 278–289

accountable for the uptake of organic anions and cations from the blood into proximal tubule cells (Hediger et al., 2005; Matsuzaki et al., 2008), demonstrating that these transporters play a vital role in the pathogenesis of hyperuricemia. Moreover, hyperuricemia itself can lead to chronic kidney disease including glomerular hypertrophy and endothelial dysfunction (Mok et al., 2012). Therefore nephroprotection and reduction of hyperuricemia on which we focused in this study would be the major strategies of pharmacotherapy to treat hyperuricemia and renal dysfunction of metabolic syndrome. However detrimental side effects of uricosuric agents such as hepatotoxicity of benzbromarone (Bomalaski and Clark, 2004) are drawing researches to explore more safer and effective new therapeutic options. Shuang-Qi (SQ) gout capsule contains six traditional Chinese herbal medicines: Phragmites communis Trin. (Family – Poaceae, Lú gēn, rhizome of Reed), Berchemia floribunda (wall.) Brongn. (Family – Rhamnaceae, Tiě bāo jīn, root of Linate Supplejack), Mallotus apelta (Lour.) Müll. Arg. (Family – Euphorbiaceae, Bái bèi yè gēn, Root of White-back leaf Mallotus), Schefflera arboricola (Hayata) Merr -(Family – Araliaceae, Qī yè lián, dry stem of Dwarf Umbrella tree), Cinnamomum camphora (L.) J.Presl (Family – Lauraceae, Bīngpiàn, a resin of the plant termed in English as Borneol) and Panax notoginseng (Burkill) F. H.Chen (Family – Araliaceae (Sānqī, the root of Radix Notoginseng) [detailed description was provided in Kodithuwakku et al. (2013)] and it is indicated for inflammation, pain, fever and gout arthritis in traditional medicine clinics (Province(Ed.), 2009; State Pharmacopoeia Commission of People's Republic of China(Ed.), 2010). We have previously demonstrated the anti-inflammatory and antinorciceptive effect of SQ (Kodithuwakku et al., 2013). According to traditional Chinese medicine concepts, SQ is said to act on the qi channels, which are originating from the heart and kidney in the body and also recommended for reducing the heat, eliminating dampness, purification of toxic substances, enhancing blood circulation, dispelling wind, relieving pain and inflammation. Based on the fact that SQ is further indicated for gout arthritis, in this study, we focused on hyperuricemia, which is the crucial factor of gout arthritis. So far, there are no appropriate scientific evidences for the collective effect of these plant materials on antihyperuricemic effect. Therefore, the present study would emphasis the nephroprotective effect, antihyperuricemic activity and the possible underlying mechanism of SQ. Because of Allopurinol is one of the common antihyperuricemic drugs and the TF is one of the common anti-gout herbal agents in common clinical practice we applied both of the drugs as positive controls of this study to give a better insight of the function of these renal transporters and renal dysfunction.

2. Materials and methods 2.1. Reagents and materials Reagents were purchased as follows: PO: Sigma, St. Louis, MO, USA, Allopurinol: Jiangsu Fangqiang Pharmaceutical Factory Co. Ltd, China and Tong Feng tablets: Shanxi Renyuantang Pharmaceutical Co. Ltd, China. Diagnostic kits for UA, Cr and BUN, were applied for biochemical assays (Nanjing Jiancheng Bioengineering Institute, China) in this study. The China Pharmaceutical University kindly provided prepared SQ gout capsules. mGLUT9 primary antibody was purchased from Novus Biologicals, LLC, USA. OCT1, OCT2 and α- tubulin were provided by Anbo Biotechnology Company, China. ABCG2 and OCTN1, OAT1 were provided by Sangon Antibody R&D Center, China. GAPDH antibody and Goat anti-rabbit HRP and anti-mouse HRP antibodies were products of Beyotime Institute of Biotechnology, China. All the kits for RT-

279

PCR were purchased from Takara Bio Inc., China. Primers were synthesized by Sangong Biotechnology Co., Ltd. (Nanjing, Jiangsu, PR China) (Table 2). 2.2. Animals Male ICR mice (20 72 g, from the animal center of QingLongshan, PR China) were acclimatized at least for 7 days before being used for experiments. Animals were housed 5 per cage (320  180  160 cm3) under a normal 12-h/12-h light/dark schedule and housed at 22 72 1C with relative humidity (557 5%). Standard chow and water were supplied ad libitum for the experimental duration. The Provision and General Recommendation of Chinese Experimental Animals Administration Legislation guidance were approved by the Science and Technology Department of Jiangsu Province and also by the Animal Care and Use Committee of China Pharmaceutical University. Furthermore, the European Community guidelines (EEC Directive of 1986: 86/609/ EEC) were implemented on all the procedures and animal care. 2.3. Preparation of drugs P. communis Trin., B. floribunda (wall) Brongn, M. apelta (Lour.) Muell.-Arg, S.a arboricola (Hayata) Merr., Cinnamomum camphara (L.) J.Presl and P. notoginseng (Burkill) F.H.Chen were purchased from JiangSu Medicine Company (Nangjing, China) and authenticated by Prof. Qin min Jian in School of Chinese Herbal Medicine, China Pharmaceutical University and all the voucher specimens were deposited in the Herbarium of School of traditional Chinese medicine, China Pharmaceutical University. And then SQ capsule was prepared as described in (Kodithuwakku et al., 2013). The quality of each capsule was controlled by measuring the amount of oleanolic acid and Ginseng saponinin (ginsenoside Rg1 (C42H72O14), Ginseng saponins Rb1 (C54H92O23) and 37 saponins R1 (C47H80O18)) by using HPLC analysis as the total amount 0.42 mg and 3.3 mg, respectively. Moreover, TLC was carried out for quality standards for each component by comparing with the existing prescription. Prepared SQ, Allopurinol and TF were ground and dispersed in 0.5%CMC-Na to make a homogeneous suspension. The administered volumes (20 ml/kg body weight) were measured prior to each drug administration. Doses of SQ were determined based on the previous studies and doses for other drugs were calculated using the dose conversion procedures which are in compliance with the Pharmacopoeias and the study of Reagan –Shaw (Chinese Pharmacopoeia Committee, 2005; Reagan-Shaw and Ahmad , 2008). 2.4. Experimental design PO was applied to induce hyperuricemia in mice. (Stavric et al., 1975; Wang et al., 2004). Mice were randomly divided into 13 groups as follows (Table 1). Normal, the non-induced groups were introduced to investigate the effect of SQ on normal functioning Table 1 Drug administrative plan (each group consists of 10 animals). Normal

Normal group Normal

Hyperuricemic group Normal

Model Allopurinol SQ gout capsule

– 5 mg/kg 113 mg/kg 225 mg/kg 450 mg/kg 600 mg/kg

PO PO PO PO PO PO

Tong Feng Shu

(250 mg/kg) þ5 mg/kg þ113 mg/kg þ225 mg/kg þ450 mg/kg þ600 mg/kg

280

N.D. Kodithuwakku et al. / Journal of Ethnopharmacology 163 (2015) 278–289

kidney and PO induced groups were introduced to find out efficacy of the drug on hyperuricemia. Drug administration was done by gavage once daily in morning for seven consecutive days and PO was given orally prior to the drug administration. Food was withdrawn from mice one hour before to the PO administration.

the the 1h the

2.5. Assessment of hyperuricemia and kidney function

Table 2 Summary of the gene-specific RT-PCR primer sequences. Name of the primer

Primers 50 -30

Product size

Gene bank no.

mURAT1

GCTACCAGAATCGGCACGCT CACCGGGAAGTCCACAATCC GAGATGCTCATTGTGGGACG GTGCTACTTCGTCCTCGGT TAAATGGAGCACCTCAACCT GAGATGCCACGGATAAACTG GCCTATGTGGGCACCTTGAT CTTGTTTCCCGTTGATGCGG ACATCCATGTTGCTCTTTCG TTGCTCCATTATCCTTACCG ACAGGTTTGGGCGGAAGT CACCAGAAATAGAGCAGGAAG TGAGGCCGGTGCTGAGTATGT CAGTCTTCTGGGTGGCAGTGAT

342

NM_009203

316

NM_001102414

238

NM_011920

238

NM_008766

315

NM_009202

331

NM_013667

299

NM_008084

mGLUT9 mABCG2

Mice were placed in metabolic cages on the 6th day, 1 h after the drug administration for collecting the 24 h of urine. Urine, blood and kidney cortex tissue were collected 1 h after the final drug administration on the 7th day. Collected urine was centrifuged at 3500g for 5 min to remove the precipitations. Collected blood was allowed to clot at room temperature for about 1 h and then centrifuged at 3500g for 5 min to obtain the serum. Both samples were kept under  20 1C until assayed. Concurrently animals were sacrificed by cervical dislocation and immediately, kidney cortex was separated carefully on an ice plate and stored promptly at 80 1C until assayed. 2.6. Biochemical evaluations BUN, UA and Cr were measured in both urine (U) and serum (S). All the above parameters were evaluated spectrophotometrically/colorimetrically using standard diagnostic kits. For further confirmation of kidney function, GFR was analyzed for Cr and UA. Fractional Excretion of Uric Acid was evaluated using following formula FEUA ¼ (UUA  SCr)/(SUA  UCr)  100, expressed as a percentage (Perez-Ruiz et al., 2002). 2.7. Effect of SQ gout capsule on renal transporters: western blot analysis To find out the efficacy of the SQ on regulation of mURAT1, mOAT1, mOCT1, mOCT2, mABCG2, mOCTN1, mOCTN 2, mαtubulin and mGAPDH, renal transporters, western blot analysis was performed as follows. Mouse renal cortical brush-border membrane vesicles were prepared according to the methods of Hosoyamada et al. (2004) with few modifications and then analyzed for mURAT1, mOCTN1, mOCTN2 and α- tubulin. All the preparation was done under 4 1C. Briefly, kidney cortex was homogenized (10 v/wt) in 2.5 mM EGTA, 150 mM d-mannitol, and 5 mM HEPES–Tris, pH 7.4. 12 mM MgCl2 was added to the homogenate, kept for 20 min and then centrifuged at 2400g for 15 min. The supernatant was centrifuged at 30,000g for 30 min. A buffer (5 mM EGTA, 10 mM HEPES–Tris, pH 7.4 and 300 mM mannitol,) was used to resuspend the pellets, homogenized the tissue pellets again and then the final supernatants were put in 0.5 ml RIPA buffer and 1 mMPMSF to obtained final peptides. For the analysis of, mOAT1, mOCT1, mOCT2, mABCG2 and mGAPDH, mouse kidney cortex was carefully removed and then homogenized in RIPA buffer with PMSF according to the instructions. Then follow the procedures of western blot method to analyze the protein expressions. The target proteins were normalized by the respective blotting of α- tubulin or mGAPDH. 2.8. mRNA analysis of mURAT1, mGLUT9, mOAT1, mOCT1, mOCT2, and ABCG2:RT-PCR method. Total RNA was extracted from mouse kidney cortex using the kits provided by Takara. Bio Inc. and followed the instructions strictly. The reverse transcription was implemented by following the instructions of the kit. Total RNA was reverse-transcribed and cDNA was subsequently amplified using the manufacture's protocol, ABI 7500 StepOnePlus™ Real-Time PCR System (Life

mOAT1 mOCT1 mOCT2 mGAPDH

Technologies). PCR amplification was carried out using genespecific PCR primers (Table 2). Amplification products were detected via intercalation of the fluorescent dye SYBR Green Ι. Relative quantitation was calculated by normalizing to the GAPDH mRNA levels. 2.9. Statistical analysis Data were expressed as the mean 7standard error (Mean 7 S.E. M ) and statistical analysis was performed using one-way analysis of variance (ANOVA) followed by Dunnett's analysis to assess the differences between all the groups with model group and also used the ANOVA followed by Turkey's test to compare the interand intra-treatment groups. Unpaired T-test was employed to evaluate the impact of model and the normal group. p o0.05 was considered as statistically significant and Graphpad prism 6 was used to analyze the data.

3. Results 3.1. Effectiveness of the SQ gout capsule on renal dysfunction and hyperuricemia (n ¼ 10) The effectiveness of SQ, Allopurinol and TF was assessed on parameters that can detect the serum uric acid level and renal dysfunction in non-induced mice. Allopurinol treated group significantly decreased the SUA (38.0570.04 and 34.6970.06 mg/dl respectively for normal and Allopurinol) (po0.05) and decreased the UUA levels (76.0070.19 and 74.3270.31 mg/dl respectively for normal and Allopurinol) (po0.01) compared with normal group. SQ and TF had not shown a significant difference in non-induced mice compared with normal group for all the below mentioned biological parameters (For FEUA: 16.5770.69, 17.6070.87, 15.9170.65, 14.5470.63 and 14.5470.63 mg/dl respectively for normal, Allopurinol, SQ high dose and TF, for UUA: 76.0070.19,75.4570.23 and 75.1370.23 respectively for normal, SQ high dose and TF, for SUA 38.0570.04,34.6970.06,37.8270.06 and 37.1370.06 mg/respectively for normal, Allopurinol, SQ high dose and TF, for UCr 71.0771.76, 68.7371.66, 70.0671.33 and 71.1171.59 mg/dl respectively for normal, Allopurinol, SQ high dose and TF) (Fig. 1). 3.2. Effectiveness of the SQ gout capsule on nephroprotective and antihyperuricemic effect in PO-induced mice (n ¼10) PO induction markedly elevated the SUA, SCr and BUN levels and significantly reduced the UUA, UCr compared with normal

N.D. Kodithuwakku et al. / Journal of Ethnopharmacology 163 (2015) 278–289

281

Fig. 1. Nephroprotective and antihyperuricemic effect of SQ gout capsule in non-induced mice. The value of SCr multiplied by 100 and the value of the SUA was multiplied by 10 to illustrate the data properly. Data were expressed as the mean 7 S.E.M for 10 mice. N: normal group, MO: PO-induced mice, SQ at high dose (450 mg/kg) (H), at middle dose (225 mg/kg) (M), at low dose (113 mg/kg) (L) A: Allopurinol, TF: Tong Feng tablet.

group (18 70.69, 84.01 73.19, 25.17 70.29, 44.15 71.13, and 47.36 7 0.85 mg/dl respectively) (Fig. 2). High dose of SQ notably increased the UUA level (77.007 1.77 mg/dl) (p o0.01) (Fig. 2B) and high dose was effective compared with middle and low dose of the SQ in the management of UUA levels ( 64.27 71.30, 53.96 71.02 mg/dl respectively for middle and high dose). The high and middle dose of SQ remarkably decreased the SUA levels (41.45 70.51 and 42.66 70.81 mg/dl respectively) and high dose was effective compared with middle dose (Fig. 2D). Allopurinol reduced the SUA (36.99 70.72 mg/dl) (Fig. 2D) and increased the UUA levels (71.25 71.40 mg /dl) (Fig. 2B) even below than that of normal level (p o 0.001). SQ effectively elevated the UCr (75.34 70.89 mg/dl) (Fig. 2C) and restored the raised SCr levels (58.69 71.65 mg/dl) significantly and the effectiveness was dose dependent (Fig. 2E). Allopurinol and TF had similar tendency with the SQ. FEUA level as a renal uric acid handling parameter, also significantly reduced in the model group (16.31 70.41 mg/dl) and only low dose of SQ (12.71 71.07 mg/dl) showed no significance in

the elevations of the FEUA. Allopurinol (11.7770.39 mg/dl) and TF (14.927 0.90 mg/dl) significantly elevated the FEUA levels compared with model group and the low dose of SQ. With regards to the BUN levels, SQ could lower the PO induced BUN levels (19.14 70.68, 21.73 70.62, and 19.52 70.55 mg/dl respectively for the high, middle and low doses) significantly (Fig. 2F) and high dose was effective compared with the middle and low dose. Compared with the model group, significance of the effectiveness of SQ on all the biochemical parameters was dose dependent. Low dose of SQ was less significant or not significant compared with model, the middle dose and high dose of SQ for the all the parameters.

3.2.1. Effectiveness of the SQ gout capsule on kidney function in noninduced and PO-induced mice (n ¼10) In the non-induced group there were no significant differences between normal and treatment groups. In the PO- induced group

282

N.D. Kodithuwakku et al. / Journal of Ethnopharmacology 163 (2015) 278–289

Fig. 2. Effectiveness of the Nephroprotective and antihyperuricemic effect of SQ gout capsule on PO-induced mice. The value of SCr multiplied by 100 and the value of the SUA multiplied by 10 to illustrate the data properly. FEUA was expressed in percent. Data were expressed as the mean 7 S.E.M for 10 mice. N: normal group, MO: PO-induced mice, SQ at high dose (450 mg/kg) (H), at middle dose (225 mg/kg) (M), at low dose (113 mg/kg) (L) A: Allopurinol, TF: Tong Feng tablet. Statistical significances were considered as follows:npo 0.05, nnpo 0.01, compared with model group, and compared with inter- and intra-treatment groups. #p o0.05, compared with normal group.

the urinary volume, glomerular filtration rate for creatinine and uric acid were significantly different from normal group. Furthermore, model group (0.51 70.03 ml/24 h, 0.21 70.01 ml/min, 0.30 70.02 ml/min) and the treatment group under the same influence showed a marked difference for the GFR (For Allopurinol: 1.50 70.13 ml/min, 1.21 7 0.07 ml/min, 1.96 70.10 ml/min, For SQ H: 1.48 70.13 ml/24 h, 1.26 70.10 ml/min, 1.95 70.14 ml/ min, for SQ M: 1. 27 70.08 ml/24 h, 0.98 70.06 ml/min, 1.33 7 0.09 ml/min. for SQL: 1.02 70.07 ml/24 h, 0.56 70.04 ml/min, 0.85 70.11 ml/min, and for TF: 1.21 70.07 ml/24 h, 0.97 7 0.06 ml/min, 1.46 70.10 ml/min respectively for the urine volume, GFR for Cr and UA). With regards to the intra group comparison in the regulation of GFR of Cr, SQ at the high dose was effective than the low dose and the TF. High dose of SQ significantly regulated

the GER of UA compared with middle and low dose of SQ and TF (Table 3). 3.3. Effectiveness of the SQ gout capsule on regulation of renal transporters in non-induced mice Effectiveness of SQ on normal functioning kidney was evaluated by assessing protein levels of the renal transporters using drug- administered non- induced mice by western blot methods (Fig. 3A and B). Data showed that, there were not any significant differences for any of the proteins of the renal transporters between non-induced treated groups and normal mice. Therefore, SQ gout capsule had no regulatory effect on any of the protein levels of the renal transporters in non-hyperuricemic mice.

N.D. Kodithuwakku et al. / Journal of Ethnopharmacology 163 (2015) 278–289

Table 3 GFR of non-induced and PO-induced mice for creatinine and uric acid. Normal mice

Normal (CMC Na) Allopurinol SQ H SQ M SQL TF

Dose (mg/kg)

5 450 225 113 600

Hyperuricemic mice Normal Model (PO) 250 Allopurinol 5 SQ H 450 SQ M 225 SQ L 113 TF 600

Urine volume (ml/24 h)

GFR Crx10 (ml/min)

GFR UAx100 (ml/min)

1.247 0.12

1.14 70.11

1.71 70.15

1.357 0.10 1.23 7 0.07 1.197 0.06 1.217 0.06 1.20 7 0.06

1.21 70.09 1.14 70.07 1.13 70.07 1.13 70.06 1.15 70.07

2.01 70.15 1.7070.09 1.68 70.10 1.72 70.09 1.69 70.10

1.25 7 0.11 0.517 0.03## 1.50 7 0.13nn 1.487 0.13nn 1.277 0.08nn 1.02 7 0.07nab 1.217 0.07nn

1.16 70.13 0.21 70.01## 1.21 70.07nn 1.26 70.10nn 0.98 70.06nn 0.56 70.04naa,bb, 0.97 70.06nnb,dd

1.64 70.14 0.30 70.02## 1.96 70.10nn 1.95 70.14nn 1.3370.09nnaa,bb 0.85 70.11naaa,bbb 1.46 70.10nnb,c,dd

Data were expressed as the mean 7 SEM for 10 mice. N: normal group, SQ at high dose (450 mg/kg) (H), at middle dose (225 mg/kg) (M), at low dose (113 mg/kg) (L) A: Allopurinol, TF: Tong Feng tablet. Statistical significances were considered as follows: np o0.05, nnpo 0.01, compared with hyperuricemia model group. # p o 0.05, compared with normal group. a: po 0.05 compared with Allopurinol, b: p o 0.05 compared with high dose of SQ, c: p o 0.05 compared with middle dose of SQ, d: p o 0.05 compared with low dose of SQ.

3.3.1. SQ gout capsule regulated the renal transporters in POinduced mice PO- induced hyperuricemia significantly elevated the renal protein levels of mURAT1 (p o0.05). Furthermore, PO significantly diminished the protein levels of mABCG2, mOCTN1 and mOCTN2 (p o0.001). SQ reduced the elevated mURAT1 protein expression in a dose dependent manner. 450 mg/kg and 225 mg/kg dose of SQ showed a significant effectiveness while 113 mg/kg showed no significant difference compared to the two other doses of SQ. Similarly, SQ restored the mABCG2 expression to the normal levels (p o0.001 and 0.05, respectively for the high and middle dose) and low dose was not effective compared with the two other doses compared with model group. In addition, Allopurinol at 5 mg/kg remarkably restored the mURAT1. TF, the positive herbal drug also restored the elevated mURAT1 protein level significantly (p o0.05), but compared with the high dose of SQ, the function of TF was less significant. However, in the regulation of the mOCTN1 and mOCTN2, SQ had not shown the similar tendency as with other proteins. SQ at the 450 mg/kg showed an up regulation of the mOCTN2 less significantly (p o0.05) but not the mOCTN1. Interestingly TF also had not shown any significance difference in the regulation of mOCTN1 and the mOCTN2 protein levels. However, Allopurinol showed a successful up regulation of the both mOCTN1 and mOCTN2 (Fig. 4).

3.3.2. SQ gout capsule regulated the renal transporters in POinduced mice In the regulation of m GLUT9, mOCT1, mOCT2 and the mOAT1 proteins, SQ at 450 mg/kg significantly up-regulated the downregulated protein levels and down regulated the mGLUT9 protein level (p o0.05 and p o0.01 respectively for OCT1, OCT2, OAT1 and GLUT9). Allopurinol also showed the similar effects with SQ in the restoration of the same proteins at the dose of 5 mg/kg (po 0.05 and p o0.01 respectively for OCT1, OCT2, OAT1 and GLUT9). The 250 mg/kg of SQ and the TF also demonstrated the up-regulated expression of mOCT1, and mOCT2 and mOAT1 protein and down regulated the mGLUT9 protein in hyperuricemic mice compared

283

with model group. However, as we observed in other regulations of protein expressions, low dose (113 mg/kg) was not successful in the management of mOCT1, mOCT2 and the mOAT1 protein expression compared with model, SQ high dose and Allopurinol (Fig. 5). 3.4. SQ could regulate the dysfunctional mRNA expressions of renal transporters mRNA levels of the renal transporters were evaluated using the RT-PCR method (Fig. 6). In this study we evaluated the mRNA levels of mABCG2, mURAT1, mGLUT9, mOAT1, mOCT1, and mOCT2. PO induction could remarkably elevate the mRNA levels of the mGLUT9 and mURAT1 (p o0.01 and p o0.001 respectively) (Fig. 6A–C respectively). Moreover, PO markedly down- regulated the mRNA levels of the mABCG2, mOAT1, mOCT1 and mOCT2 (p o0.01) (Fig. 6D–F). SQ at 450 mg/kg remarkably restored the mRNA levels of mURAT1 and the effectiveness of SQ was dose dependent. In the regulation of mGLUT9 and mABCG2, SQ showed a dose dependent effectiveness compared with low dose and, TF was less significant compared with high dose of SQ. In the regulation of all the mRNA expressions, SQ high dose showed a similar effect to Allopurinol at 5 mg/kg. In addition, 225 mg/kg and the 113 mg/kg of the SQ gout succeeded in down-regulation of renal mRNA levels of mURAT1 but, less effectively when compared with 450 mg/kg and model group. SQ at 450 mg/kg, and Allopurinol succeeded in recovering mRNA expressions of renal mOCT1, mOCT2 and mOAT1 even with better effectiveness than TF and low dose of SQ when compared with 450 mg/kg of SQ and model group. SQ at 225 mg/kg also significantly elevated the mRNA expression of mOCT1, mOCT2 and mOAT1 compared with model group but SQ at 113 mg/kg could regulate neither mRNA levels of mOAT1 nor mOCT2 compared with model, high dose of SQ and Allopurinol.

4. Discussion The multifactorial nature of hyperuricemia and gout make discovering of diverse novel drugs for urate handling that could be characterized with regulating the urate transport molecules. The prescription of SQ is commonly indicated for gout and inflammation as an effective agent in traditional Chinese medicine. In the present study, we focused to disclose the antihyperuricemic effect and its mechanism of SQ. Furthermore, to confirm SQ as an efficient therapeutic strategy against hyperuricemia associated renal dysfunction, we evaluated the nephroprotective ability of SQ. To achieve the above experimental tasks we introduced normal, non-induced mice group and PO- induced mice group to our study. Normal, the non-induced group was denoted the uric acid regulatory effect and illustrated the renoprotective effect of SQ on normal functioning kidney. PO- induced group was performed to reveal the efficacy of the drug on hyperuricemia and the renal dysfunction. PO, the hyperuricemic inducer in this study, is used more frequently as uricase inhibitor which sustained high SUA level, hyperuicosuria and high concentration of UA in whole renal tissue (Johnson et al., 1969; Ishibuchi et al., 2001; Nguyen et al., 2005). Notably, changes in the biochemical parameters including elevated SUA level and diminished FEUA in this study, further confirmed the aforesaid PO functions. In the present study, SQ improved the renal urate excretion only in hyperuricemic mice, by reducing the SUA level and increasing the FEUA level significantly. These results demonstrate the potent hypouricemic effect of SQ and suggest that SQ may not alter the normal renal functions. It is further proven by the non-

284

N.D. Kodithuwakku et al. / Journal of Ethnopharmacology 163 (2015) 278–289

Fig. 3. A (i) and (ii) Protein levels of the renal transporters in non-induced mice treated with the corresponding drugs and assessed using the western blots. All the proteins were normalized to α- tubulin. B (i) and (ii): Protein levels of the renal transporters in non-induced mice treated with the corresponding drugs and assessed using the western blots and all the proteins were normalized to GAPDH protein level. Data were expressed as the mean 7S.E.M for 10 mice. N: normal group, MO: PO-induced mice, SQ at high dose (450 mg/kg) (H), at middle dose (225 mg/kg) (M), at low dose (113 mg/kg) (L) A: Allopurinol, TF: Tong Feng tablet.

N.D. Kodithuwakku et al. / Journal of Ethnopharmacology 163 (2015) 278–289

285

Fig. 4. (i) and (ii) Protein levels of the renal transporters in PO- induced mice treated with the SQ, Allopurinol and TF drugs and assessed using the western blots. Data were expressed as the mean 7 7S.E.M for 10 mice. N: normal group, MO: PO-induced mice, SQ at high dose (450 mg/kg) (H), at middle dose (225 mg/kg) (M), at low dose (113 mg/kg) (L) A: Allopurinol, TF: Tong Feng tablet. Statistical significances were considered as follows:np o 0.05, nnp o0.01, compared with model group and, compared with inter- and intra-treatment groups. #p o 0.05, compared with normal group.

altered glomerular filtration rates of creatinine and UA in noninduced mice. Assessment of GFR is useful in the interpretation of the kidney function more precisely against the SQ administration, or evaluation of the effectiveness of SQ on renal dysfunctions. GFR of creatinine and UA was restored approximately to the normal levels with the administration of SQ, implying its capability to recover the renal dysfunction. Conversely, Allopurinol exerted its hypouricemic action in both induced and non-induced groups. Several prospective studies have reported that hyperuricemia is accompanied with chronic kidney disease including glomerular hypertrophy and endothelial dysfunction (Zoppini et al., 2012). On the other hand, prolong untreated hyperuricemia leads to kidney damage via the deposition of urate microcrystals in the kidneys which even could progress to chronic kidney diseases rather than solely reflecting the declined renal urate excretion. Our drug, SQ could reduce the serum uric acid levels as well as urate concentration in the kidney, denoted that, SQ may diminish those inflammatory reactions

occurred by uric acid/urate microcrystal, that pacify the renal fibrosis, loss of nephrons, and chronic renal failure (Shimizu and Hori, 2009). It implies that SQ may be a potential renoprotector and an effective antihyperuricemic agent. In addition, increased uric acid is integral to hypertension, therefore reducing uric acid level by SQ can control hypertension at the initial stages (Feig and Johnson, 2007). Moreover, traditional Chinese medicine concepts describes that SQ is acted on heart and kidney meridians and our findings further provide scientific evidences to those traditional medicinal concepts. Assessment of kidney function is essential for proper therapeutic management to prevent therapeutic errors. In contrary, when a novel drug is introduced or developed for the antihyperuricemic effect with a confirmation of the renoprotective effects, it will be beneficial for the effective management of gout arthritis. SQ is supposed to be acting on the tubular functions as a potent antihyperuricemic agent, and it will be advantageous that if it can act as a renoprotector to give a safer and efficient therapeutic

286

N.D. Kodithuwakku et al. / Journal of Ethnopharmacology 163 (2015) 278–289

Fig. 5. (i) and (ii) Protein levels of the renal transporters in PO- induced mice treated with the SQ, Allopurinol and TF drugs and assessed using the western blots. Data were expressed as the mean7S.E.M. for 10 mice. N: normal group, MO: PO-induced mice, SQ at high dose (450 mg/kg) (H), at middle dose (225 mg/kg) (M), at low dose (113 mg/kg) (L) A: Allopurinol, TF: Tong Feng tablet. Statistical significances were considered as follows:npo0.05, nnpo0.01, compared with model group and, compared with inter- and intra-treatment groups. #po0.05, compared with normal group.

effect. Therefore, in the current study, we further verified the renoprotective ability of SQ by analyzing the creatinine and BUN levels in the blood and urine. Besides the evaluation of GFR, renal dysfunction is also screened by elevated SCr and BUN levels as well as decreased UCr levels (Duncan et al., 2001; Retnakaran et al., 2006). In the present study, SQ attenuated the PO-induced SCr, BUN and UCr levels to the normal level without regulating any of the biochemical parameters in the non-induced mice implying the renoprotective ability of SQ. Of interest, SQ did not regulate the UA levels to the below normal levels, disclosing that the accustomed equilibrium levels of the urate are much conservative with the functions of the SQ, which further endorses the availability of potentially less side effects of SQ. With relevance to the clinical practice, it is found that, in spite of the renal urate overload, renal urate under excretion is more common among the gout patients and renal transporters play a critical role in the regulation of urate excretion (Wright et al., 2010). Conversely,

human renal urate transporters are homologous with mice renal transporters (Matsuzaki et al., 2008). Therefore regulation of mice renal transporters can mimic the regulation of human renal transporters. Though the function of various putative urate transporters has been much argued, so far, URAT1, GLUT9, OAT1, ABCG2, OCT1, OCT2, OCTN1 and OCTN2 are considered to be playing the major role in the regulatory process of hyperuricemia (Karbach et al., 2000; Bomalaski and Clark, 2004; Hediger et al., 2005; Enomoto and Endou, 2005; Matsuo et al., 2014). Consequently, we focused on protein and mRNA levels of aforementioned renal regulatory transporters to assess the molecular level efficacy of the SQ on hyperuricemia. Regulation of URAT1 and GLUT9 is effectively involved with renal urate reabsorption which affects the alteration of serum uric acid levels (Enomoto and Endou, 2005; Anzai et al., 2008). Hence, as these transporters are considered to be effective therapeutic targets in the management of hyperuricemia, we assessed the regulatory ability of SQ on URAT1 and GLUT9. Our study disclosed that SQ could

N.D. Kodithuwakku et al. / Journal of Ethnopharmacology 163 (2015) 278–289

287

Fig. 6. mRNA levels of the renal transporters in PO induced mice treated with the correspondence drugs and assessed using the Real Time PCR. Data were expressed as the mean 7 S.E.M. for 10 mice. N: normal group, MO: PO-induced mice, SQ at high dose (450 mg/kg) (H), at middle dose (225 mg/kg) (M), at low dose (113 mg/kg) (L) A: Allopurinol, TF: Tong Feng tablet. Statistical significances were considered as follows:np o 0.05, nnp o0.01, compared with hyperuricemia model group and, compared with inter- and intra-treatment groups. #p o 0.05, compared with normal group.

significantly attenuate the PO-induced elevated mURAT1 and mGLUT9 protein levels and down-regulate the expression of these renal mRNA levels which lead to enhance the urate excretion in the kidney. SQ successfully restored the protein and mRNA expressions of OAT1 which is one of the potential molecules in the first step of renal urate secretion along with the various uremic toxins on the basolateral membrane of the proximal tubules ( Ichida et al., 2004; Hediger et al., 2005). Dysfunction of OAT1 can lead to a progression of chronic kidney diseases (Deguchi et al., 2005) and the increased expression of OAT1 protein by SQ, further implies that SQ may be beneficial in the prevention of chronic kidney diseases by regulating the organic anionic and cationic proteins and the mRNA expressions. TF and Allopurinol also significantly restored the down regulated OAT1 protein and mRNA expression showing their potential ability of regulation of renal transporters.

ABCG2 is expressed in the apical membrane of the kidney and has a high ability to reabsorb urate into the blood, shows its significant role in regulation of hyperuricemia (Matsuo et al., 2011; Woodward et al., 2013). In the present study, SQ altered the dysfunction of ABCG2 by up regulating the ABCG2 protein level and the mRNA expression. A recent study reported that, dysfunction of ABCG2 significantly elevate renal under excretion hyperuricemia and renal overload hyperuricemia in Japanese male patients (Matsuo et al., 2014). Moreover, ABCG2 attributes to urate excretion via extra renal pathway. Therefore, we can hypothesize that SQ could further be able to manage urate excretion through the extra renal pathway with the assistance of ABCG2 regulations. In addition, creatinine, a biomarker of renal dysfunction is a substrate of OCT1 and OCT2 in kidney proximal tubules (Karbach et al., 2000; Motohashi et al., 2002). PO- induced hyperuricemic

288

N.D. Kodithuwakku et al. / Journal of Ethnopharmacology 163 (2015) 278–289

rats show renal dysfunction and decrease expressions of renal rOAT1 and rOCT2 in rats (Mo et al., 2007). Our study also demonstrated a similar function with PO induction and SQ could successfully recover the OCT1 and OCT2 mRNA and protein levels, disclosing that SQ could enhance the functional capabilities of the kidney. In other words, regulation of OCT1 and OCT2 functional disorders by SQ verify that SQ could reduce the prevalence of hyperuricemia associated chronic kidney disease. However, expression of OCTN2 protein showed a less significant difference compared with model group and OCTN1 showed no significance compared with model group suggest that SQ may not be successful in the regulation of OCTN1 and also SQ may have less functional ability with OCTN2. Although protein level is not the sole predictor for the mRNA expression, based on these results we did not perform further study on the mRNA expression of OCTN1 and OCTN2 in order to reduce the unnecessary involvement of experimental procedures. According to the present study, SQ could successfully reduce the increased serum uric acid levels and, increase the urinary urate excretion as well as FEUA, showing that SQ may be a better therapeutic opportunity in the treatment of hyperuricemia. In addition, SQ could be defined as a safe uricosuric drug as it was not affecting the normal urate levels in the non-induced mice and restored the creatinine and BUN changes in the induced mice. With regards to the regulation of renal transporters, SQ gout capsules showed a successful regulation of mURAT1, mGLUT9, mOAT1, mABCG2, mOCT1, mOCT2 and mOCTN2 predicting that the SQ regulate the altered renal transporters which are responsible for excretion or reabsorption of renal urate in the management of molecular level hyperuricemia. Even if, the pharmacological therapeutic target of action of Allopurinol is different from the SQ, Allopurinol and SQ showed a similar effects in the management of hyperuricemia, indicating that SQ and Allopurinol may be functioning in similar manner. Though Tong Feng tablet could decline the hyperuricemia and regulate the renal transporters, SQ showed better competence than Tong Feng tablet compared with the model group or the high dose of the SQ group, implying that, SQ could be a better therapeutic choice than Tong Feng tablet. Conversely, as these transporters could alter the renal functional impairment SQ would be able to recover the renal dysfunction fruitfully divulging the renoprotective ability of the drug. It is further proved in the study of non-induced mice by the nonregulated renal transporters. Considering the present circumstances of the clinical use, the most common strategy in the management of hyperuricemia is focused on the urate lowering therapy which enhances the urinary urate excretion as uricosuric drugs. Probennecid and sulfinpyrazone are ineffective with concomitant renal impairment (Gutman, 1966). Benzbomarone is also one of the best clinical choices for patients with renal insufficiency that act on URAT1 and GLUT9 (Bibert et al., 2009) but is being unpopular due to severe hepatotoxicity (Hande et al., 1984; Reinders et al., 2009). Allopurinol is prescribed for the patients with nephrolithiasis who are taking cyclosphorines as well as those who are overproducing uric acids. Allopurinol is also associated with severe hypersensitivity reactions particularly common among aged patient. Although the hypersensitivity effects of Allopurinol are infrequent, they suppress its priority of clinical choice (Wright et al., 2010). Therefore still safer and effective therapeutic agents are essential to overcome the difficulties in the management of hyperuricemia. Prescription of SQ has long been used in traditional medicine and is found to be effective in clinical use for gout arthritis and inflammation. The present study showed SQ could inhibit the abnormal tubular reabsorption as well as increase the urinary urate excretion via regulating the main renal transporters in greater or lesser degree. Therefore, we scientifically proved its

antihyperuricemic effectivity and its probable molecular mechanism through the regulation of renal organic ion transporters. Though we have explored the possible mechanism of the antihyperuricemic activity of the SQ gout capsule, we may need to perform further investigations to reveal and confirm the exact role of the function SQ gout capsule and its exact mechanisms of actions.

5. Conclusion The present study showed for the first time that, Shuang Qi gout capsules possess potent antihyperuricemic effect via regulating renal mURAT1 and mGLUT9, mOAT1, and mABCG2, which are attributable to the enhancement of urinary uric acid excretion in the renal tubules. Furthermore, SQ attenuated hyperuricemiainduced renal functional impairment by up-regulating renal mOCT1, mOCT2, mOCTN2 in mice. All the biochemical parameters also assured the antihyperuricemic and nephroprotective effect of SQ. These discoveries provide an insight to elucidate the molecular explanation for the uricosuric and nephroprotective effects of SQ in the treatment of hyperuricemia. Although further descriptive studies are essential to confirm the most effective dose, in the present study, SQ showed the better effectiveness at the high dose compared to the model group, disclosing that 450 mg/kg (for mice) may be the most effective dose for the Shuang Qi gout capsule. References Anzai, N., Ichida, K., Jutabha, P., Kimura, T., Babu, E., Jin, C.J., Srivastava, S., Kitamura, K., Hisatome, I., Endou, H., Sakurai, H., 2008. Plasma urate level is directly regulated by a voltage-driven urate efflux transporter URATv1 (SLC2A9) in humans. The Journal of Biological Chemistry 283, 26834–26838. Bibert, S., Hess, S.K., Firsov, D., Thorens, B., Geering, K., Horisberger, J.D., Bonny, O., 2009. Mouse GLUT9: evidences for a urate uniporter. American Journal of Physiology – Renal Physiology297, F612–619. Bomalaski, J.S., Clark, M.A., 2004. Serum uric acid-lowering therapies: where are we heading in management of hyperuricemia and the potential role of uricase. Current Rheumatology Reports 6, 240–247. Chen, S.Y., Chen, C.L., Shen, M.L., Kamatani, N., 2001. Clinical features of familial gout and effects of probable genetic association between gout and its related disorders. Metabolism: Clinical and Experimental 50, 1203–1207. Chinese Pharmacopoeia Committee, 2005. Pharmacopoeia of the People's Republic of China. Chemical Industry Press, Beijing p. 50. Choi, H.K., Ford, E.S., 2007. Prevalence of the metabolic syndrome in individuals with hyperuricemia. The American Journal of Medicine 120, 442–447. Deguchi, T., Kouno, Y., Terasaki, T., Takadate, A., Otagiri, M., 2005. Differential contributions of rOat1 (Slc22a6) and rOat3 (Slc22a8) to the in vivo renal uptake of uremic toxins in rats. Pharmaceutical Research 22, 619–627. Duncan, L., Heathcote, J., Djurdjev, O., Levin, A., 2001. Screening for renal disease using serum creatinine: who are we missing? Nephrology Dialysis Transplantation 16, 1042–1046. Enomoto, A., Endou, H., 2005. Roles of organic anion transporters (OATs) and a urate transporter (URAT1) in the pathophysiology of human disease. Clinical and Experimental Nephrology 9, 195–205. Feig, D.I., Johnson, R.J., 2007. The role of uric acid in pediatric hypertension. Journal of Renal Nutrition: The Official Journal of the Council on Renal Nutrition of the National Kidney Foundation 17, 79–83. Gutman, A.B., 1966. Uricosuric drugs, with special reference to probenecid and sulfinpyrazone. Advances in Pharmacology 4, 91. Hande, K.R., Noone, R.M., Stone, W.J., 1984. Severe allopurinol toxicity. Description and guidelines for prevention in patients with renal insufficiency. The American Journal of Medicine 76, 47–56. Hediger, M.A., Johnson, R.J., Miyazaki, H., Endou, H., 2005. Molecular physiology of urate transport. Physiology 20, 125–133. Hosoyamada, M., Ichida, K., Enomoto, A., Hosoya, T., Endou, H., 2004. Function and localization of urate transporter 1 in mouse kidney. Journal of the American Society of Nephrology: JASN 15, 261–268. Ichida, K., Hosoyamada, M., Hisatome, I., Enomoto, A., Hikita, M., Endou, H., Hosoya, T., 2004. Clinical and molecular analysis of patients with renal hypouricemia in Japan-influence of URAT1 gene on urinary urate excretion. Journal of the American Society of Nephrology: JASN 15, 164–173. Ishibuchi, S., Morimoto, H., Oe, T., Ikebe, T., Inoue, H., Fukunari, A., Kamezawa, M., Yamada, I., Naka, Y., 2001. Synthesis and structure-activity relationships of 1phenylpyrazoles as xanthine oxidase inhibitors. Bioorganic & Medicinal Chemistry Letters11, 879–882.

N.D. Kodithuwakku et al. / Journal of Ethnopharmacology 163 (2015) 278–289

Johnson, W.J., Stavric, B., Chartrand, A., 1969. Uricase inhibition in the rat by s-triazines: an animal model for hyperuricemia and hyperuricosuria. Proceedings of the Society for Experimental Biology and Medicine 131, 8–12. Karbach, U., Kricke, J., Meyer-Wentrup, F., Gorboulev, V., Volk, C., Loffing-Cueni, D., Kaissling, B., Bachmann, S., Koepsell, H., 2000. Localization of organic cation transporters OCT1 and OCT2 in rat kidney. American Journal of Physiology – Renal Physiology 279, F679–687. Kodithuwakku, N.D., Pan, M., Zhu, Y.L., Zhang, Y.Y., Feng, Y.D., Fang, W.R., Li, Y.M., 2013. Anti-inflammatory and antinociceptive effects of Chinese medicine SQ gout capsules and its modulation of pro-inflammatory cytokines focusing on gout arthritis. Journal of Ethnopharmacology 150, 1071–1079. Matsuo, H., Chiba, T., Nagamori, S., Nakayama, A., Domoto, H., Phetdee, K., Wiriyasermkul, P., Kikuchi, Y., Oda, T., Nishiyama, J., Nakamura, T., Morimoto, Y., Kamakura, K., Sakurai, Y., Nonoyama, S., Kanai, Y., Shinomiya, N., 2008. Mutations in glucose transporter 9 gene SLC2A9 cause renal hypouricemia. American Journal of Human Genetics 83, 744–751. Matsuo, H., Nakayama, A., Sakiyama, M., Chiba, T., Shimizu, S., Kawamura, Y., Nakashima, H., Nakamura, T., Takada, Y., Oikawa, Y., Takada, T., Nakaoka, H., Abe, J., Inoue, H., Wakai, K., Kawai, S., Guang, Y., Nakagawa, H., Ito, T., Niwa, K., Yamamoto, K., Sakurai, Y., Suzuki, H., Hosoya, T., Ichida, K., Shimizu, T., Shinomiya, N., 2014. ABCG2 dysfunction causes hyperuricemia due to both renal urate underexcretion and renal urate overload. Scientific Reports 4, 3755. Matsuo, H., Takada, T., Ichida, K., Nakamura, T., Nakayama, A., Takada, Y., Okada, C., Sakurai, Y., Hosoya, T., Kanai, Y., Suzuki, H., Shinomiya, N., 2011. Identification of ABCG2 dysfunction as a major factor contributing to gout. Nucleosides, Nucleotides & Nucleic Acids 30, 1098–1104. Matsuzaki, T., Morisaki, T., Sugimoto, W., Yokoo, K., Sato, D., Nonoguchi, H., Tomita, K., Terada, T., Inui, K., Hamada, A., Saito, H., 2008. Altered pharmacokinetics of cationic drugs caused by down-regulation of renal rat organic cation transporter 2 (Slc22a2) and rat multidrug and toxin extrusion 1 (Slc47a1) in ischemia/ reperfusion-induced acute kidney injury. Drug Metabolism and Disposition: The Biological Fate of Chemicals 36, 649–654. Mo, S.F., Zhou, F., Lv, Y.Z., Hu, Q.H., Zhang, D.M., Kong, L.D., 2007. Hypouricemic action of selected flavonoids in mice: structure-activity relationships. Biological & Pharmaceutical Bulletin 30, 1551–1556. Mok, Y., Lee, S.J., Kim, M.S., Cui, W., Moon, Y.M., Jee, S.H., 2012. Serum uric acid and chronic kidney disease: the Severance cohort study. Nephrology, Dialysis, Transplantation: Official Publication of the European Dialysis and Transplant Association – European Renal Association 27, 1831–1835. Motohashi, H., Sakurai, Y., Saito, H., Masuda, S., Urakami, Y., Goto, M., Fukatsu, A., Ogawa, O., Inui, K., 2002. Gene expression levels and immunolocalization of

289

organic ion transporters in the human kidney. Journal of the American Society of Nephrology: JASN 13, 866–874. Nguyen, M.T., Awale, S., Tezuka, Y., Shi, L., Zaidi, S.F., Ueda, J.Y., Tran, Q.L., Murakami, Y., Matsumoto, K., Kadota, S., 2005. Hypouricemic effects of acacetin and 4,5-odicaffeoylquinic acid methyl ester on serum uric acid levels in potassium oxonatepretreated rats. Biological & Pharmaceutical Bulletin 28, 2231–2234. Province(Ed.), P.C.o.H., 2009. Pharmacopoeia of Hunan Traditonal drug 8,218. Reagan-Shaw, S, Ahmad N., N.M., 2008. Dose translation from animal to human studies revisited. Federation of American Societies for Experimental Biology 22 (3), 659–661. Reinders, M.K., van Roon, E.N., Jansen, T.L., Delsing, J., Griep, E.N., Hoekstra, M., van de Laar, M.A., Brouwers, J.R., 2009. Efficacy and tolerability of urate-lowering drugs in gout: a randomised controlled trial of benzbromarone versus probenecid after failure of allopurinol. Annals of the Rheumatic Diseases 68, 51–56. Retnakaran, R., Cull, C.A., Thorne, K.I., Adler, A.I., Holman, R.R., 2006. Risk factors for renal dysfunction in type 2 diabetes: U.K. Prospective Diabetes Study 74. Diabetes 55, 1832–1839. Stavric, B., Clayman, S., Gadd, R.E., Hebert, D., 1975. Some in vivo effects in the rat induced by chlorprothixene and potassium oxonate. Pharmacological research communications 7, 117–124. Shimizu, T., Hori, H., 2009. The prevalence of nephrolithiasis in patients with primary gout: a cross-sectional study using helical computed tomography. The Journal of Rheumatology36, 1958–1962. State Pharmacopoeia Commission of People's Republic of China (Ed.), 2010. Pharmacopoeia of People's Republic of China. 11,136,152 Wang, Y., Zhu, J.X., Kong, L.D., Yang, C., Cheng, C.H.K., Zhang, X., 2004. Administration of Procyanidins from Grape Seeds Reduces Serum Uric Acid Levels and Decreases Hepatic Xanthine Dehydrogenase/Oxidase Activities in Oxonate‐ Treated Mice. Pharmacology & Toxicology 94, 232–237. Woodward, O.M., Tukaye, D.N., Cui, J., Greenwell, P., Constantoulakis, L.M., Parker, B. S., Rao, A., Kottgen, M., Maloney, P.C., Guggino, W.B., 2013. Gout-causing Q141K mutation in ABCG2 leads to instability of the nucleotide-binding domain and can be corrected with small molecules. Proceedings of the National Academy of Sciences of the United States of America 110, 5223–5228. Wright, A.F., Rudan, I., Hastie, N.D., Campbell, H., 2010. A 'complexity' of urate transporters. Kidney International 78, 446–452. Zoppini, G., Targher, G., Chonchol, M., Ortalda, V., Abaterusso, C., Pichiri, I., Negri, C., Bonora, E., 2012. Serum uric acid levels and incident chronic kidney disease in patients with type 2 diabetes and preserved kidney function. Diabetes Care 35, 99–104.