The monomeric orphan nuclear receptor Schistosoma mansoni Ftz-F1 dimerizes specifically and functionally with the schistosome RXR homologue, SmRXR1

BBRC Biochemical and Biophysical Research Communications 327 (2005) 1072–1082 www.elsevier.com/locate/ybbrc

The monomeric orphan nuclear receptor Schistosoma mansoni Ftz-F1 dimerizes specifically and functionally with the schistosome RXR homologue, SmRXR1 Benjamin Bertina,1, Ste´phanie Cabya,1, Fre´de´rik Ogera, Souphatta Sasorithb, Jean-Marie Wurtzb, Raymond J. Piercea,* b

a INSERM U547, Institut Pasteur de Lille, 1 rue du Professeur Calmette, 59019 Lille, France De´partement de Biologie et Ge´nomique Structurales, Institut de Ge´ne´tique et de Biologie Mole´culaire et Cellulaire, 1 rue Laurent Fries, B.P. 163, 67404 Illkirch, France

Received 1 December 2004 Available online 29 December 2004

Abstract In an attempt to understand development and differentiation processes of the parasitic blood fluke Schistosoma mansoni, several members of the nuclear receptor superfamily were cloned, including SmFtz-F1 (S. mansoni Fushi Tarazu-factor 1). The Ftz-F1 nuclear receptor subfamily only contains orphan receptors that bind to their response element as monomers. Whereas SmFtz-F1 displays these basic functional properties, we have identified an original and specific interaction between SmFtz-F1 and the schistosome RXR homologue, SmRXR1. The mammalian two-hybrid assay showed that the D, E, and F domains of SmFtz-F1 were capable of interacting specifically with the E domain of SmRXR1 but not with that of mouse RXRa. Using three-dimensional LBD homology modelling and structure-guided mutagenesis, we were able to demonstrate the essential role of exposed residues located in the dimerization interfaces of both receptors in the maintenance of the interaction. Cotransfection experiments with constructions encoding full-length nuclear receptors show that SmRXR1 potentiates the transcriptional activity of SmFtz-F1 from various promoters. Nevertheless, the lack of identification of a dimeric response element for this SmFtz-F1/SmRXR1 heterodimer seems to indicate a ‘‘tethering’’ mechanism. Thus, our results suggest for the first time that a member of the Ftz-F1 family could heterodimerize functionally with a homologue of the universal heterodimerization partner of nuclear receptors. This unique property confirms that SmFtz-F1 may be involved in the development and differentiation of schistosome-specific structures. Ó 2004 Elsevier Inc. All rights reserved. Keywords: Nuclear hormone receptors; Ftz-F1; RXR heterodimer; Schistosoma mansoni; 3D LDB modelling; Signalling pathway evolution

Nuclear receptors form a superfamily of ligand-regulated transcription factors that play a critical role in development, differentiation, and metabolism [1]. In addition to receptors that bind defined ligands, such as steroid hormones, thyroid hormone or retinoids, the superfamily also includes a majority of members, called orphan receptors, for which no ligand has been identified [2]. Nuclear receptors share a common modular *

Corresponding author. Fax: +33 0 3 20 87 78 88. E-mail address: [email protected] (R.J. Pierce). 1 These authors have contributed equally to the work.

0006-291X/$ - see front matter Ó 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2004.12.101

structure and are composed of several domains, of which the most functionally important are the C domain (or DNA-binding domain, DBD) that mediates the binding to DNA, and the E domain (or ligand binding domain, LBD), which is a multi-functional domain responsible for ligand-binding, transcriptional activation and the dimerization process. Like other transcription factors, nuclear receptors exert their effects on gene regulation via binding to specific DNA sequences referred to as hormone response elements (HREs). These response elements consist of a typical consensus hexameric motif AGGTCA which can represent a half-site

B. Bertin et al. / Biochemical and Biophysical Research Communications 327 (2005) 1072–1082

capable of adopting various configurations when duplicated. Thus, nuclear receptors can bind to DNA in three distinct manners: as monomers on a 5 0 -extended halfsite, as homodimers or as heterodimers on a duplicated half-site [3]. Whilst members of the steroid receptor family mainly bind to palindromic response elements spaced by three nucleotides (IR3) as homodimers, a large number of receptors exert their physiological functions as heterodimers with the retinoid X receptor (RXR). These heterodimers display distinct hormone response element specificities and recognize a large and variable number of dimeric response elements (e.g., direct repeats, inverted repeats or everted repeats separated by variable numbers of nucleotides). Heterodimerization with RXR is a fundamental mechanism since RXR acts as a critical partner for receptors such as the proliferated peroxisome-activated receptors (PPARs), thyroid hormone receptors (TRs), retinoic acid receptors (RARs), vitamin D receptor, and several orphan receptors [4]. Two distinct dimerization interfaces have been identified for the nuclear receptors. One is present in the DNA-binding domain and corresponds to a weak interaction surface that determines specificity for the response element recognized by the dimer [5,6]. The second is a strong dimerization surface present on the ligand binding domain of each partner of the dimer. Crystallographic data have determined that this interface mainly involves residues from helices H9 and H10, and to a lesser extent from the loop between H7 and H8, in the canonical nuclear receptor LBD structure [7,8]. Functional analyses have characterized the 40 amino acid sub-region corresponding to helices H9 and H10 as a transferable dimerization domain sufficient to control the identity of dimer partners in RXR–RAR and RXR–TR heterodimers. Consequently, this region is also referred to as the I-box (identity box) in the nuclear receptor LBD [9]. As part of a study of developmental and differentiation processes in the parasitic blood fluke Schistosoma mansoni, we and others have cloned and characterized several members of the nuclear receptor superfamily from this platyhelminth [10,11]. One of these is a member of the Ftz-F1 (Fushi Tarazu-factor 1) subfamily (NR5 subfamily under the unified nuclear receptor nomenclature [12]) called SmFtz-F1 (S. mansoni Ftz-F1) [13]. This subfamily only contains orphan receptors that bind to their response element as monomers, the most studied members being mammalian SF-1 (steroidogenic factor-1) and LRH-1 (liver receptor homologue-1). These are both critical embryonic development regulators: SF-1 is an essential factor in sex determination and gonadal differentiation [14], whereas mice knocked out for the lrh-1 gene die in utero, showing gastrulation defects and visceral endoderm dysfunctions [15]. In adulthood, SF-1 is a key regulator of endocrine function of the hypothalamus–pituitary–ste-

1073

roidogenic organ axis [14] and LRH-1 a central mediator of cholesterol homeostasis [16]. Ftz-F1 members are also present in ecdysozoan invertebrates, where they are again implicated in essential developmental processes [17,18]. We previously demonstrated that SmFtz-F1 conserves some basic functional properties of the subfamily, notably in terms of DNA binding, since SmFtz-F1 displays the same SFRE (SF-1 response element; TCAAGGTCA) nucleotide specificity as SF-1 [13]. However, functional and structural studies also showed that SmFtz-F1 presents unique and distinct capacities compared with its mammalian counterparts [19]. In the present study, we have identified a new original behavior of SmFtz-F1. Results obtained show that SmFtz-F1 interacts specifically with SmRXR1, one of the two RXR homologues present in S. mansoni [11], in a mammalian two-hybrid assay. Mutations of exposed residues located in the I-box of both receptors modulate this interaction, reinforcing the hypothesis of a heterodimeric complex between SmFtz-F1 and SmRXR1. SmRXR1 potentiates the SmFtz-F1 transcriptional activity from different promoters. These results suggest for the first time that a member of the Ftz-F1 family could heterodimerize functionally with an RXR homologue. This unique and original feature seems to confirm that SmFtz-F1 has evolved to acquire different transcriptional functions that could participate in the appearance and/or the maintenance of schistosome-specific structures.

Materials and methods Plasmid construction and fusion proteins. PCR was used to create constructs expressing fusion proteins with the DBD of Gal4 (amino acids 1–147) and with the VP16 transcriptional activator domain. Constructs pTL1FF1, encoding the full-length SmFtz-F1 protein, and Gal-SmFF1 are described elsewhere [13,19]. The E domain of SmRXR1 (Accession No. AF094759) was amplified from residues 400 to 681 with SRXR5 0 1 and SRXR3 0 2 primers using the fulllength cDNA cloned in pTL1 (a modified version of pSG5; Stratagene) as template. The same fragment was also amplified using the same oligonucleotides, except that SRXR5 0 1 was modified to include an in-frame ATG codon. The mouse RXRa (Accession No. NM_057011305) E domain from residues 261 to 627 was amplified with MRXR5 0 1 and MRXR3 0 1 primers using the full-length cDNA cloned in pSG5 as template. SmFtz-F1 D, E, and F domains were amplified with FF1VP16 5 0 1 and FF1VP16 3 0 1 primers using the pTL1FF1 [19] vector as template. Each PCR product was cloned into pCR4 (TOPO TA Cloning; Invitrogen) and sequenced. Positive inserts were cloned in frame with the VP16 activation domain in the pVP16 vector (Clontech) using SalI/HindIII for the SmRXR1 fragment (VP16-SmRXR1 construct), EcoRI/HindIII for the mRXRa fragment (VP16-mRXRa construct), and SalI/XbaI for SmFtz-F1 (VP16SmFF1 construct). The human RAR (Accession No. X06538) E domain (from amino acid 200 to 462) was obtained by PCR with HRAR5 0 1 and HRAR3 0 1 primers, and cloned in pCR4. After sequence verification, the fragment was cloned in-frame with Gal4 DBD in the pTL1Gal4 vector as a HindIII/NotI fragment (Gal-RAR

1074

B. Bertin et al. / Biochemical and Biophysical Research Communications 327 (2005) 1072–1082

construct). The SmRXR1 E domain fragment with an in-frame ATG codon at the 5 0 end was cloned into the pTL-1 vector using the SalI/ HindIII restriction sites giving the SmRXR1LBD construct. The full-length cDNA of SmRXR1 was obtained by PCR with primers SRXRFL5 0 and SRXRFL3 0 using adult worm cDNA as template. The PCR product was cloned into pCR4 and sequenced. A positive clone was digested with XhoI and KpnI, and insert was cloned into the expression vector pTL1 to generate construct SmRXR1FL. SFRE-Luc and pFR-Luc reporter plasmids are described in [13] and in [19], respectively. The promoFF1-Luc reporter plasmid contains the first 309 nucleotides located upstream of the second transcription initiation site of the Smftz-f1 gene [13]. This fragment was amplified with primer A4 and A5 using BAC clone no. 13B8 as template [20], sequence verified, and cloned as a XhoI/KpnI (restriction sites introduced in the oligonucleotides) fragment into the pGL3-Luc basic vector (Promega). The same strategy was used to generate the promop14-Luc reporter vector, which contains the 440 nucleotides upstream of the transcription initiation site of the S. mansoni p14 gene [21]. This fragment was amplified with primer p14prom1 and p14prom2 using BAC clone no. 135B10 as template. After sequence verification, the restriction sites XhoI and HindIII, introduced in the oligonucleotide, were used to clone the fragment into the pGL3-Luc basic vector. All the primers used in the study are listed in Table 1. Site-directed mutagenesis. All the mutants were generated using the QuikChange Site-directed Mutagenesis Kit (Stratagene), according to the manufacturerÕs instructions. The mutants D585A (a mutant bearing the replacement of Asp585 with alanine), N588A, N592A, and E596A were described in [19]. The Gal-SmFF1 construct was used as template for the single mutant R562A and the double mutant R569A/ R570A. The E596A construct was used as template to generate the double mutant D585A/E596A. For the three SmRXR1 double mutants, the VP16-SmRXR1 construct was used as a template. The oli-

Table 1 Primers used for deleted and mutated protein constructions SRXR5 0 FL SRXR3 0 FL A4 A5 p14proml p14prom2 R562A5 0 R5S2A3 0 RR/AA5 0 RR/AA3 0 D/A5 0 D/A3 0 EK5 0 EK3 0 GA5 0 GA3 0 AL5 0 AL3 0 SRXR5 0 l SRXR3 0 2 MRXR5 0 1 MRXR3 0 1 FF1VP165 0 1 FF1VP163 0 1 HRAR5 0 1 HRAR3 0 1 E/A5 0 E/A3 0

GGCACGAGCACACAAGTGTTGG CTCATGGTGAGCAACAGGTTTCAGGTGG AACTCGAGACCTTCCAAAGTGACCTTCGAA AAGGTACCAAATCTTATCGTAAGGCTCAA TTCTCGAGTGGAGAATGGATTGTTGGCT TTAAGCTTTGTGTAGACTAGTGTGATTT GCAAGTTCTCAAGTTGCATCCTATCAAGAATCT AGATTCTTGATAGGATGCAACTTGAGAACTTGC CAAGAATCTGTTGCAGCGCTAATGGATTATGTC GACATAATCCATTAGTAGCGCTGCAACAGATTCTTG CCTGATATAAATGCTAAGTTTAACAAATTGATCAATCG CGATTGATCAATTTGTTAAACTTAGCATTTATATCAGG CCTTATTCAGCTCTTGAATCGTATTGTAAGACTAATCAACCT AGGTTGATTAGTCTTACAATACGATTCAACAGCTGAATAAAG CAAGATACTOOCCGTTTCGCAAAATTACTACTAAGA TCTTAGTAGTAATTTTCCOAAACGCCCAGTATCTTG AGATTACCTGCTTTACGATCCATCGCATTGAACTGCCTT AAGGCACTTCAATGCOATGCATCGTAAAGCAGGTAATCT AATATTTCTGTCGACTTAATAACCCCTAACCACT GTTCAAAACTAAGCTTCTATTTCTCTTGTATAGG CCAGCAGTGAATDCGCCAACGAGGCAC TTAAGCTTCTAGGGTGGCTTGATGTGGTGC GATTGCAGTCGACTGGCACGGGTTAGTGGG GTCAAATCTAGACTATTAGAAATAACATC GAAACCTTCAAGCTTCCTGCCCTCTOOCAG AAGCGGCCCCTCACGGGGAGTGGGTGGCCGG ATCAATCGAATTCCTGCACTACGCAAAACAAGTCAG CTGACTTGTTTGCGTAGTGCAGGAATTCGATTGAT

Restriction sites used for cloning are underlined and stop codons are in bold.

gonucleotides used were R562A5 0 and R562A3 0 for the R562A mutant; RR/AA5 0 and RR/AA3 0 for the R569A/R570A mutant; D/ A5 0 and D/A3 0 for the D585A/E596A mutant; EK5 0 and EK3 0 for the SmRXR1 mut1-VP16 mutant;GA5 0 and GA3 0 for the SmRXR1 mut2-VP16 mutant; and AL5 0 and AL3 0 for the SmRXR1 mut3-VP16 mutant. Following sequence verification, positive clones were used directly in transfection assays. Cell culture and transfection. CV-1 cells were maintained in DMEM supplemented with 10% SVF and gentalin 50 lg/ml at 37 °C and 5% CO2. Cells were plated one day before transfection in six-well plates at a density of 200,000 cells/well. Transfections were performed with linear PEI ExGen 500 (Euromedex, France), under the conditions recommended by the supplier. Cells were lysed 48 h after transfection and assayed using a luciferase assay kit (Promega) in a Wallac Victor2 1420 multilabel counter (Perkin–Elmer). For all experiments, protein content was used to normalize luciferase results. The mammalian twohybrid assay was assessed on the pFR Luc reporter plasmid (Stratagene) (200 ng/well). The effect of dimerization on the transcriptional activity of SmFtz-F1 was assessed using the SFRE-Luc reporter plasmid (500 ng/well), the promoFF1-luc reporter plasmid (500 ng/ well), and the p14promo-Luc reporter plasmid (500 ng/well). Each experiment represents at least three sets of independent triplicates. LBD modelling and heterodimer modelling. Different homology models of S. mansoni FTZ-F1 (SmFtz-F1) LBD were generated by homology as already published [19]. In order to construct the SmFtzF1/SmRXR1 heterodimer, the LBD homology models of both SmFtzF1 and SmRXR1 were generated with the Modeller software by taking human RARa and mouse RXRa as templates as observed in the experimental complex (1DKF) [7]. For the 3D model construction default Modeller parameters were used [22]. The two LBDs were analyzed in the orientation observed in the 1DKF complex. The sequence identities (sequence similarity) between SmFtz-F1 and hRARa, and SmRXR1 and hRXRa were 22% (35%) and 43% (65%), respectively. The different mutants were analyzed in the light of this heterodimer complex. The accessibility of the residues was calculated with the DSSP software [23].

Results SmFtz-F1 interacts with SmRXR1 The Ftz-F1 sub-family of nuclear receptors only contains members which bind their response element as monomers. We have previously demonstrated that SmFtz-F1 follows this rule and possesses the same SFRE nucleotide specificity as SF-1 [13]. However, there is some evidence that members of the Ftz-F1 family can form dimers. Xenopus laevis Ftz-F1 required more than one copy of the response element upstream of reporter genes to transactivate transcription significantly, but there was no clear evidence for homodimer formation in vitro [24]. In the case of zebrafish Ftz-F1 it was demonstrated that the receptor, as well as SF-1, could interact physically with ER but this interaction was not I-box dependent [25]. To date, no data concerning the interaction between the universal heterodimeric partner RXR and Ftz-F1 receptors have been reported, but it has been shown that RXR can heterodimerize with the orphan monomeric nuclear receptors Nurr1 and NGFI-B [26– 28]. To ask whether SmFtz-F1 could form a heterodimer with RXR, we used a mammalian two-hybrid assay to

B. Bertin et al. / Biochemical and Biophysical Research Communications 327 (2005) 1072–1082

study the physical interaction between SmFtz-F1 and two RXR proteins, mouse RXRa (mRXRa) and SmRXR1 (one of the two RXR homologues present in S. mansoni [11]). We also fused domains D–E–F of SmFtz-F1 to the VP16 activation domain to check whether homodimerization could occur and we used the E domain of human RARa fused to Gal4 DBD as a control for RXR-heterodimer formation. Results are presented in Fig. 1. We first confirmed that Gal4 alone did not interact with VP16 alone nor with VP16 fusion proteins. As expected, luciferase activity was increased when constructs Gal-hRARa and VP16-mRXRa were cotransfected into CV-1 cells, indicating a physical inter-

1075

action between the LBD of each receptor. Surprisingly, the schistosome RXR homologue, SmRXR1, did not interact with hRARa, whereas, as expected, no interaction was detected between hRARa and SmFtz-F1. However, cotransfection of the Gal-SmFF1 construct (D, E, and F domains of SmFtz-F1 fused to the Gal4 DBD) with VP16-SmRXR1 strongly enhanced luciferase activity, clearly showing that the LBD of SmRXR1 can interact with domains D–E–F of SmFtz-F1. Moreover, this interaction seemed to be ‘‘schistosome nuclear receptor’’-specific since only the background level of luciferase was obtained upon cotransfection of GalSmFF1 with VP16-mRXRa. Finally, no homodimeric interaction was detected between the SmFtz-F1 D–E– F domains. In this system, mammalian SF-1 was unable to interact with any VP16-RXR fusion proteins and the deletion of the D domain of SmFtz-F1 completely abolished interaction, confirming, as we previously demonstrated [19], the essential role of this domain for the active conformation of the receptor (data not shown). Thus, our results show that domains D–E–F of SmFtz-F1 interact with the SmRXR1 LBD, strongly suggesting for the first time that a heterodimeric interaction could exist between a member of the Ftz-F1 family and the universal partner RXR. The dimerization interface

Fig. 1. SmFtz-F1 interacts specifically with SmRXR1 but not with mRXRa in a mammalian two-hybrid assay. CV-1 cells were transfected with 200 ng pFR-Luc reporter vector, 200 ng vectors encoding Gal4 fusion proteins and 800 ng vectors encoding VP16 fusion proteins. Results concerning the Gal4 (on its own) and Gal-SmFF1 constructs are expressed as fold activity relative to the basal reporter activity obtained by cotransfection with plasmids encoding Gal4 and VP16 alone. The two-hybrid assay using construct Gal-RAR was performed without the corresponding ligand and results are expressed as fold activity relative to the basal reporter activity obtained by cotransfection with plasmids encoding Gal-RAR and VP16 alone.

In order to confirm that SmRXR1 could be a heterodimeric partner for SmFtz-F1, we tried to modulate the interaction between the two proteins by mutating exposed residues located in the dimerization interface of the LDB of the two receptors. For this purpose, we used previously established 3D models of the SmFtz-F1 LBD and constructed models for the SmRXR1 LBD. Seven exposed amino acids of the I-box of SmFtz-F1 were substituted with alanine (Fig. 2A). Based on the Gal-SmFF1 construct, we made five single mutants and two double mutants, and tested these constructions in the mammalian two-hybrid assay (Fig. 2B). Each mutation tested had the capacity to modulate the interaction between SmFtz-F1 and the LBD of SmRXR1. The single mutants D585A, N588A, N592A, and E596A in helix H10 weakly decreased the interaction and a more pronounced effect was obtained with the double mutant D585A/E596A. The first three residues belong to the core of the dimer interface whereas the E596 is more exposed to the solvent in the heterodimer. The charged residues D585 and E596 are surrounded mainly by charged residues belonging both to SmRXR1 (R608 for D585, and R641 for E596) and to SmFtz-F1 (R531, K586, K589 for D585, and K599 for E596). A similar weak decrease in interaction has been observed for mutations of charged residues in the RXR/RAR heterodimer [7]. N588 and N592 are buried at the dimer interface and are most likely involved in a hydrogen

1076

B. Bertin et al. / Biochemical and Biophysical Research Communications 327 (2005) 1072–1082

Fig. 2. Interaction between SmFtz-F1 and SmRXR1 is modulated by mutations of exposed amino acids in the I-box of SmFtz-F1. (A) The sequences encompassing the I-box of SmFtz-F1 and hRARa are represented. The regions corresponding to the predicted helix H9 and helices H10–H11 are boxed. Stars (*) indicate residues involved in dimerization in the experimental dimer RXRa/RARa [7]. Arrowheads indicate the exposed residues of the dimerization interface that were mutated to alanine. (B) Single or double mutations were introduced in the Gal-SmFF1 construct and the capacities of the mutated constructs to interact with SmRXR1 were assessed in a mammalian two-hybrid assay. CV-1 cells were transfected with 200 ng pFR-Luc reporter vector, 200 ng vectors encoding Gal4 fusion proteins, and 800 ng of vectors encoding SmRXR1-VP16 fusion protein. Results are expressed as fold activity relative to the basal reporter activity obtained by cotransfection with plasmids encoding Gal4 and VP16 alone (not shown).

bond network. The removal of the polar side chain, and consequently the loss of hydrogen bonds, is most likely partially compensated by the desolvation energy which is negligible for the alanine residues as compared to the polar asparagines. Surprisingly, the single mutant R562A and the double mutant R569A/R570A of helix H9 were more efficient than the wild-type Gal-SmFF1 construct in interacting with SmRXR1-VP16. Thus, these results show that mutations in the I-box of SmFtz-F1 can modulate the interaction with SmRXR1 in this assay. In the SmRXR1/SmFtz-F1 heterodimer, R562 (D349 in hRARa) is surrounded by at least three positively charged residues of SmRXR1 (R571, K632, and K636). Similarly, R569 is close to R562 of SmRXR1 whereas R570 is rather exposed in the complex. The increase in activity of two of the mutants compared to the wild type receptor may be due to the replacement of a positively charged (Arg) residue by a hydrophobic Ala residue, leading to a less repulsive environment, stabilizing the overall dimer structure. The models of the SmRXR1 LBD revealed that, compared to the mammalian RXR, six residues involved in dimerization are not conserved in SmRXR1 (Fig. 3A). We therefore hypothesized that these amino acids could be, at least in part, responsible for the specificity of the

interaction between the two schistosome receptors. In order to test this hypothesis, we replaced, two by two, these residues by those present in the murine RXR, in an attempt to reduce the interaction between SmFtzF1 and SmRXR1 (Fig. 3A; mut1: H616/E and T620/ K; mut2: S628/G and T631/A; and mut3: P639/A and S645/L). Note that all these mutations are located at the surface of the structure as suggested by the LBD homology modelling (data not shown), and are thus unlikely to alter the 3D organization of the NR-LBD. The results of the mammalian two-hybrid assay with the three SmRXR1-VP16 double mutant constructs are shown in Fig. 3B. All the three tested constructions were able to reduce the luciferase activity to a level corresponding to the Gal-SmFF1 construct alone, indicating that the interaction between SmFtz-F1 and SmRXR1 was abolished. The first mutant (H616/E and T620/K) introduces charged residues which in the RXR/RAR heterodimer form a salt bridge whereas the original residues are mostly in a hydrophobic environment. The second mutant replaces polar side chains (S628/G and T631/A) by small non-polar groups which are unable to contribute to a hydrogen bond network where R569 of SmRXR1 is involved. For the last mutant, the change from proline to alanine is most likely which causes the

B. Bertin et al. / Biochemical and Biophysical Research Communications 327 (2005) 1072–1082

1077

Fig. 3. Mutations in the I-box of SmRXR1 alter the interaction with SmFtz-F1. (A) The dimerization interface of SmRXR1. The peptide sequence alignment of the LBD H9 to H11 sub-regions of SmRXR1 and mRXRa is shown (i). The last 14 residues corresponding to helix H9 of the mRXRa LBD are indicated with an arrow and residues of the helices H10–H11 sub-region are boxed. Stars (*) indicate residues involved in dimerization in the experimental dimer RXRa/RARa [7] and conserved in SmRXR1. Arrowheads indicate residues involved in dimerization and not conserved in SmRXR1. The lower sequence (ii) represents the three mutants, and their corresponding amino acid substitutions, that were used in the mammalian two-hybrid assay. Based on the alignment presented above, each residue was replaced by the corresponding amino acid in the mRXRa sequence. (B) Mutations introduced in the I-box of SmRXR1 alter the interaction with SmFtz-F1 in a mammalian two-hybrid assay. CV-1 cells were transfected with 200 ng pFR-Luc reporter vector, 200 ng vectors encoding Gal4 fusion proteins, and 800 ng vectors encoding VP16 fusion proteins. Results are expressed as fold activity relative to the basal reporter activity obtained by cotransfection with plasmids encoding Gal4 and VP16 alone.

loss of interaction, as S645 is rather exposed and does not contact any residue of SmRXR1. Thus, taken together our results show that mutations of residues located in the I-box of both receptors modulate their interaction, strongly suggesting that SmRXR1 could be a heterodimeric partner for SmFtz-F1, and that this dimerization involves the classical dimerization interface of each nuclear receptor. Moreover, it seems that the ‘‘schistosome’’ specificity of this interaction implicates six residues situated in a region corresponding to helices H10 and H11 of the SmRXR1 LBD. Functional significance of the dimerization between SmFtz-F1 and SmRXR1 In order to determine whether the dimerization between the SmFtz-F1 and SmRXR1 LBDs had any effect

on the transcriptional activity of the former, we cotransfected plasmids expressing the full-length nuclear receptors into CV-1 cells, along with reporter plasmids containing the luciferase gene under the control of three different promoters. The first promoter contained three SFRE elements, separated from each other by 21 nucleotides. We have previously shown that SmFtz-F1 was able to transactivate transcription of the reporter gene from this construct, called SFRE-Luc [13]. The second construct contained a 300 bp region upstream of exon 2 of the Smftz-f1 gene which contains four potential response elements for SmFtz-F1 [13]. 5 0 -RACE-PCR and real-time quantitative PCR showed that transcription in adult or larval schistosomes can initiate either from exon 1 or 2, the latter accounting for 90% of the transcripts (not shown). Finally, Freebern et al. [11], using a yeast one-hybrid assay, showed that SmRXR1 was capable

1078

B. Bertin et al. / Biochemical and Biophysical Research Communications 327 (2005) 1072–1082

of transactivating transcription from a 154 bp region upstream of the S. mansoni p14 eggshell protein gene. We used a larger region of this promoter and cloned the 440 bp upstream of the transcription initiation site of the S. mansoni p14 gene into the pGL3 basic vector, in order to test the activity of both SmFtz-F1 and SmRXR1 on this promoter in CV-1 cells. When co-transfections were carried out using the SFRE-Luc construct (Fig. 4A), SmFtz-F1 alone transactivated transcription of the luciferase gene in a similar manner to that previously described [13], with an activity increased about threefold compared to cells transfected with the reporter vector alone. SmRXR1 on its own failed to stimulate transfection above background, even when increasing amounts of the expression vector, up to three times that used for the vector expressing SmFtz-F1, were added. In contrast, when SmRXR1 was co-expressed with SmFtz-F1, a significant increase in transcription was

noted and this was dose-dependent. When we used the Smftz-f1 gene promoter in similar assays (Fig. 4B), we were also able to show first that SmFtz-F1 was capable of transactivating transcription from its own promoter, and that this was reproducibly more efficient than the SFRE-luc promoter with a 5- to 6-fold increase in transcription over background. This strongly suggests that, as in the case of the rat Ftz-F1 [29], SmFtz-F1 may in part control the transcription of its own gene. Again, SmRXR1 was not capable of transactivating transcription when expressed in CV-1 cells in the presence of the reporter vector. However, the co-expression of both full-length receptors led to an increase in transcriptional activity that was again dependent on the quantity of the SmRXR1 expression vector used. Taken together, these results show that SmFtz-F1 and SmRXR1 interact functionally to transactivate transcription from promoters containing response elements for the former.

Fig. 4. Differential transcriptional properties of the co-transfected full-length SmFtz-F1 and SmRXR1 constructs on various promoters. CV-1 cells were co-transfected with plasmids encoding the full-length SmFtz-F1 and SmRXR1, along with different reporter plasmids. (A) CV-1 cells were transfected with 500 ng SFRE-Luc reporter vector, 500 ng plasmid expressing full-length SmFtz-F1, and increasing amounts of plasmid expressing full-length SmRXR1 (500, 1000, and 1500 ng). Results are expressed as the normalized luciferase units (RLU). (B) CV-1 cells were transfected with 500 ng promoFF1-Luc reporter vector, 500 ng plasmid expressing full-length SmFtz-F1 and increasing amounts of plasmid expressing full-length SmRXR1 (250, 500, and 1000 ng). Results are expressed as the normalized luciferase units (RLU). (C) CV-1 cells were transfected with 500 ng promop14-Luc reporter vector, 500 ng plasmid expressing full-length SmFtz-F1 and increasing amounts of plasmid expressing full-length SmRXR1 (250, 500, and 1000 ng). Results are expressed as the normalized luciferase units (RLU). (D) CV-1 cells were transfected with 200 ng pFR-Luc reporter vector, 200 ng plasmid expressing the Gal-SmFF1 construct, and increasing amounts of plasmids expressing full-length SmRXR1 (200, 400, and 600 ng). Results are expressed as the normalized luciferase units (RLU).

B. Bertin et al. / Biochemical and Biophysical Research Communications 327 (2005) 1072–1082

Although SmRXR1 is able to transactivate transcription from the S. mansoni p14 gene promoter in the yeast one-hybrid system, the promoter sequence contains no strict consensus nuclear receptor response elements. We therefore sought to test the transactivational capacity of both nuclear receptors on this promoter in mammalian cells. The results (Fig. 4C) show that no transactivation of transcription over background was achieved with either receptor alone, or when both were co-expressed. These results support the conclusion that the transcriptional activity observed with the two other promoters necessitated the fixation, at least of SmFtzF1, on a response element. We have shown previously during this study that the LBDs (D, E, and F domains) of SmRXR1 and SmFtzF1 interact alone, without the necessity for the presence of the A/B and C domains. In order to determine whether the synergistic effect of the co-expression of SmRXR1 on the transcriptional activity of SmFtz-F1 depended on the fixation of SmFtz-F1 on its response element, via its own DBD, we next tested the eventual synergistic effect of the co-expression of the full-length SmRXR1, with the D, E, and F domains of SmFtz-F1 fused to the Gal-4 DBD. For these assays, we used the pFR-Luc expression vector containing the Gal-4 response element upstream of the luciferase reporter gene. Thus, transcription would be driven via the fixation of the Gal-4 DBD on its response element. The results shown in Fig. 4D clearly show that although the GalSmFF1 construct transactivated transcription in this system, SmRXR1 had no effect, whatever the amount of expression vector co-transfected. These results suggest that the conformation adopted by SmFtz-F1 when

Fig. 5. The SmRXR1 E domain potentiates the transcriptional activity of SmFtz-F1. CV-1 cells were co-transfected with the plasmid encoding the full-length SmFtz-F1 (500 ng) and increasing amounts (500, 1000 or 1500 ng) of plasmids encoding either full-length SmRXR1 or the E domain of SmRXR1, along with the SFRE-luc reporter plasmid (500 ng). Results are expressed as the normalized luciferase units (RLU).

1079

fixed on its response element determines the functional interaction with SmRXR1. In contrast, the fixation of the latter on DNA seems not to be necessary as a construct expressing the LBD (E domain) of SmRXR1 is equally capable of interacting functionally with fulllength SmFtz-F1 on the SFRE-luc promoter to increase its transcriptional activity (Fig. 5). Similar to the fulllength SmRXR1, this effect was dose-dependent, but was more marked. This is suggestive of a ‘‘tethering’’ mechanism [30] of functional interaction between these two nuclear receptors, with only SmFtz-F1 physically bound to the promoter. Indeed, in our hands SmRXR1 does not bind to any of the promoters used in EMSA nor to classical direct repeat (DR) elements tested (DR1, DR2, DR4, and DR5; not shown).

Discussion Nuclear receptors of the Ftz-F1/NR5 family are orphans which transactivate transcription as monomers. We recently provided evidence for the ligand-dependent activation of the Ftz-F1 from the platyhelminth, S. mansoni, SmFtz-F1 and here we have shown that this receptor is also able to form a transcriptionally active dimer with a schistosome member of the RXR family, SmRXR1. This is the first time that a member of this family has been shown to interact physically with a member of the RXR family and provides a further example, along with the orphan receptors Nurr1 and NGBF-1 [26,27] of the possible dual function of such receptors. There have been previous reports of the physical interaction between Ftz-F1 family members and other nuclear receptors. In addition to the examples we have already cited [24,25] SF-1, the mammalian orthologue of SmFtz-F1 has been shown to interact with the androgen receptor, with the effect of suppressing the transcriptional activity of SF-1 on the LHb promoter [31]. However, this interaction occurred via the DNAbinding domain of the androgen receptor and the LBD of SF-1. In no case has it been demonstrated that dimerization involved either the classical dimerization interfaces (I-box), or the universal dimer partner, RXR. The formation of dimers between SmFtz-F1 and SmRXR1 was specific and involved the I-box of each receptor. Dimerization did not occur with mouse RXRa nor did SmRXR1 dimerize with the mammalian RXR dimer partner, RARa. The mutation of residues of the I-boxes of either SmFtz-F1 or SmRXR1, predicted by molecular modelling to be exposed and potentially involved in dimer formation, indeed led to modifications in the strength of dimerization. The influence of the mutation of I-box and other residues on the formation of RXR homo- or heterodimers has been examined in detail by Vivat-Hannah et al. [22]. They found that the heterodimerization of mouse RXRa was not disrupted

1080

B. Bertin et al. / Biochemical and Biophysical Research Communications 327 (2005) 1072–1082

by multiple mutations of the I-box, whereas the capacity to form homodimers was sensitive to such mutations. In our experiments, double mutations of SmRXR1 I-box residues were carried out. The chosen amino acids were all predicted to be exposed at the dimerization interface and were not conserved compared to the mouse orthologue. In all cases, these mutations (to residues present at the equivalent positions in mouse RXRa) caused the complete loss of the capacity of SmRXR1 to dimerize with SmFtz-F1. This result confirms the specificity of the interaction between the schistosome receptors and could provide a mechanistic basis for the lack of interaction between SmFtz-F1 and mouse RXRa. In contrast, single mutations of the SmFtz-F1 I-box either reduced (D585) had no effect (for example N592) or increased (R569/R570 or R562) the level of interaction. In the latter case, mutations of arginine residues to alanine led to the increased binding in the mammalian two-hybrid assay. It is conceivable that this may be due to the elimination of positively charged sidechains and similar effects were also observed in the case of RXR–RAR heterodimers, as well as in the formation of RXR homodimers [22]. The observation that the mutation of D585 to alanine and particularly the double mutation D585A/E596A reduced binding again demonstrates the specificity of the interaction. Vivat-Hannah et al. [22] suggested that dimer partners of mammalian RXR differ from non-partner nuclear receptors at one crucial residue in the I-box. When this residue is a leucine, the receptor is unable to dimerize with RXR due to the rigidity and size of the side-chain. On the other hand, when this residue is replaced by one with a smaller (glycine, alanine), more flexible (methionine) or polar (glutamine) side-chain, dimerization can occur. This crucial region is shown in Fig. 6 in which the I-box sequence of SmFtz-F1 is compared to those of both partner and non-partner receptors. The crucial amino acid at position 592 in SmFtz-F1 is an asparagine in agreement with the suggestion of Vivat-Hannah et al. [22]. As would be expected, the mutation of this residue to alanine had no effect on binding to SmRXR1. However, SmFtz-F1 does not bind to mouse RXRa and it remains to be seen whether, for example, its mutation to a leucine would abolish the interaction with SmRXR1. Overall, our results indicate that the specificity of interaction between these two schistosome receptors may depend on different residues than those crucial for mouse RXRa heterodimerization. However, this can only be finally resolved by determining the 3D crystal structure of the dimer. Not only did SmFtz-F1 bind to SmRXR1 in the twohybrid assay, but more importantly, SmRXR1 potentiated the transcriptional activity of SmFtz-F1 on two different promoters. The SFRE promoter contains three monomeric response elements spaced by 21 nucleotides. Transcription from this promoter stimulated by SmFtz-

Fig. 6. Sequence alignment of helix H10 RXR partner and nonpartner nuclear receptors. Vivat-Hannah et al. [22] have proposed that receptors which do not form heterodimers with RXR (here, for example, SF-1, ERa or LRH-1) generally possess a leucine residue at the position corresponding to Leu425 of mRXRa. On the other hand, RXR heterodimerization partners (here, RARa, PPARa or Nurr1) often contain a smaller or a more flexible residue at this position. Interestingly, unlike SF-1 or LRH-1, SmFtz-F1 does not contain the leucine residue, but possesses an asparagine. Adapted from [22].

F1 was relatively modest, but the addition of equimolar or excess SmRXR1 led to a marked, dose-dependent increase in reporter gene transcription, whilst SmRXR1 had no effect on its own. These results were reproduced even more strikingly when we used a native promoter from S. mansoni. This was the promoter region upstream of the most used of the two transcription initiation sites for the Smftz-f1 gene, representing about 90% of transcripts from both adult worms and cercarial larvae. This promoter contains four consensus monomeric binding sites for SmFtz-F1 within 50 nucleotides upstream of the transcription initiation site [13]. The transactivation of transcription by SmFtz-F1 from this promoter suggests that SmFtz-F1 may act in an autocrine fashion to stimulate transcription from its own promoter as was observed for ELP1, the rat Ftz-F1 orthologue [29]. This point will be pursued using ChIP analysis [32] on whole adult schistosomes. The absence of any intrinsic transcriptional activity of SmRXR1 on either the SFRE or the Smftz-f1 promoter was also noted when we used the S. mansoni p14 gene promoter. SmRXR1 had previously been shown to transactivate transcription from this promoter in a yeast one-hybrid assay [11] and although the different assay system, as well as the size of the promoter fragment used, may explain this discrepancy, we also questioned the ability of SmRXR1 to bind to DNA. Indeed, this receptor failed to bind to any of the promoter elements, or to oligonucleotides containing conventional direct repeat elements (DR1–DR5) classically bound either by RXR homo- or heterodimers [33] in an electrophoretic mobility shift assay (not shown). This

B. Bertin et al. / Biochemical and Biophysical Research Communications 327 (2005) 1072–1082

suggested that direct binding to DNA was not necessary for the synergistic effect of SmRXR1 on SmFtz-F1 transcriptional activity. The latter, however, is required to bind to its response element via its own DBD in order to observe the activity of SmRXR1. The use of a construct in which the SmFtz-F1 DBD is replaced by the Gal4 DBD and a promoter containing the Gal4 response element showed that although the D, E, and F domains of SmFtz-F1 were capable of transactivating transcription from this promoter, SmRXR1 failed to demonstrate any synergistic effect in this case. In contrast, we showed that the full-length sequence of SmRXR1 was not necessary to exhibit full synergistic activity, but that its E domain sufficed. This supports the view that this activity is mediated by a ‘‘tethering’’ mechanism, whereby SmRXR1 binds to SmFtz-F1, but not to the promoter DNA. In this way, it would serve as a supplementary recruiting surface for transcriptional co-activators. A similar mechanism has been suggested for mammalian RXR tethered to the monomeric orphan receptor Nurr1 [30] for which it was clearly shown that the RXR ligand domain was necessary and sufficient to stimulate transcription in an RXR ligand-dependent manner. However, this dimer has also been shown to function via the binding of each partner to response elements with unusual spacing (11, 17 or 21 nucleotides [27]). In this case, it seems unlikely that the dimerization interface present on the DBD of each receptor could come into play, and that it is more probable that binding of the partners to each other would be only via their I-boxes. There are numerous examples of nuclear receptors that act on transcription without necessarily binding directly to DNA. The transcriptional activity of NF-jB is modulated via interactions with the androgen receptor, with PPAR or with the estrogen and progesterone receptors [34]. In addition, the glucocorticoid receptor (GR) is able to exert anti-inflammatory effects by its inhibitory activity on the transcription factors NF-jB, NF-AT or AP-1 via several different mechanisms (for review see [35]). Among these a ‘‘composite’’ mechanism has been described implicating the direct binding of GR to the transcription factor itself bound to its DNA response element which was suggested to lead to inhibition of transcription through co-repressor recruitment [36]. We can advance the hypothesis that SmRXR1 mediates its activity on SmFtz-F1 via a similar tethering mechanism, which in this case enhances the recruitment of transcriptional coactivators. Taken together, our results show that SmFtz-F1, in contrast to all other members of the Ftz-F1/NR5 family, has the ability to dimerize with another nuclear receptor and that this interaction is schistosome-specific. Moreover, the interaction has a positive effect on the transcriptional activity of SmFtz-F1 and requires (i) that SmFtz-F1 be bound to its response element via its

1081

own DBD and (ii) only the D, E, and F domains of its partner, SmRXR1. It also seems likely that SmRXR1 may interact with other partners. Its apparent inability to bind to DNA in our experiments may indicate either that it requires a specific response element, or that, like GR, it may mediate its effects principally via protein– protein interactions.

Acknowledgments We thank Dr. Philippe Lefebvre (INSERM U459, Faculte´ de Me´decine Henri Warembourg, Lille, France) for the pVP16 vector. The work was supported by the Institut National de la Sante´ et de la Recherche Me´dicale (U547), the Institut Pasteur de Lille, the Centre National de la Recherche Scientifique, and the Microbiology program of the Ministe`re de lÕEducation Nationale, de la Recherche et de la Technologie (MENRT). B.B. is supported by the MENRT and the Fondation pour la Recherche Me´dicale (FRM). F.O. is supported by INSERM-Region Nord Pas de Calais.

References [1] H. Gronemeyer, V. Laudet, Transcription factors 3: nuclear receptors, Protein Profile 2 (1995) 1173–1308. [2] V. Giguere, Orphan nuclear receptors: from gene to function, Endocr. Rev. 20 (1999) 689–725. [3] C.K. Glass, Differential recognition of target genes by nuclear receptor monomers, dimers, and heterodimers, Endocr. Rev. 15 (1994) 391–407. [4] D.J. Mangelsdorf, R.M. Evans, The RXR heterodimers and orphan receptors, Cell 83 (1995) 841–850. [5] C. Zechel, X.Q. Shen, J.Y. Chen, Z.P. Chen, P. Chambon, H. Gronemeyer, The dimerization interfaces formed between the DNA binding domains of RXR, RAR and TR determine the binding specificity and polarity of the full-length receptors to direct repeats, EMBO J. 13 (1994) 1425–1433. [6] F. Rastinejad, T. Wagner, Q. Zhao, S. Khorasanizadeh, Structure of the RXR–RAR DNA-binding complex on the retinoic acid response element DR1, EMBO J. 19 (2000) 1045–1054. [7] W. Bourguet, V. Vivat, J.M. Wurtz, P. Chambon, H. Gronemeyer, D. Moras, Crystal structure of a heterodimeric complex of RAR and RXR ligand-binding domains, Mol. Cell 5 (2000) 289– 298. [8] R.T. Gampe Jr., V.G. Montana, M.H. Lambert, A.B. Miller, R.K. Bledsoe, M.V. Milburn, S.A. Kliewer, T.M. Willson, H.E. Xu, Asymmetry in the PPARgamma/RXRalpha crystal structure reveals the molecular basis of heterodimerization among nuclear receptors, Mol. Cell 5 (2000) 545–555. [9] T. Perlmann, K. Umesono, P.N. Rangarajan, B.M. Forman, R.M. Evans, Two distinct dimerization interfaces differentially modulate target gene specificity of nuclear hormone receptors, Mol. Endocrinol. 10 (1996) 958–966. [10] H. Escriva, R. Safi, C. Hanni, M.C. Langlois, P. SaumitouLaprade, D. Stehelin, A. Capron, R. Pierce, V. Laudet, Ligand binding was acquired during evolution of nuclear receptors, Proc. Natl. Acad. Sci. USA 94 (1997) 6803–6808. [11] W.J. Freebern, A. Osman, E.G. Niles, L. Christen, P.T. LoVerde, Identification of a cDNA encoding a retinoid X receptor

1082

[12]

[13]

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

B. Bertin et al. / Biochemical and Biophysical Research Communications 327 (2005) 1072–1082

homologue from Schistosoma mansoni. Evidence for a role in female-specific gene expression, J. Biol. Chem. 274 (1999) 4577– 4585. V. Laudet, J. Auwerx, J.A. Gustafsson, W. Wahli, A unified nomenclature system fot the nuclear receptor superfamily, Cell 97 (1999) 161–163. R.L. De Mendonca, D. Bouton, B. Bertin, H. Escriva, C. Noel, J.M. Vanacker, J. Cornette, V. Laudet, R.J. Pierce, A functionally conserved member of the FTZ-F1 nuclear receptor family from Schistosoma mansoni, Eur. J. Biochem. 269 (2002) 5700–5711. P. Val, A.M. Lefrancois-Martinez, G. Veyssiere, A. Martinez, SF-1 a key player in the development and differentiation of steroidogenic tissues, Nucl. Recept. 1 (2003) 8. J.F. Pare, D. Malenfant, C. Courtemanche, M. Jacob-Wagner, S. Roy, D. Allard, L. Belanger, The fetoprotein transcription factor (FTF) gene is essential to embryogenesis and cholesterol homeostasis and is regulated by a DR4 element, J. Biol. Chem. 279 (2004) 21206–21216. E. Fayard, J. Auwerx, K. Schoonjans, LRH-1: an orphan nuclear receptor involved in development, metabolism and steroidogenesis, Trends Cell Biol. 14 (2004) 250–260. G. Lavorgna, H. Ueda, J. Clos, C. Wu, FTZ-F1, a steroid hormone receptor-like protein implicated in the activation of Fushi Tarazu, Science 252 (1991) 848–851. C.R. Gissendanner, A.E. Sluder, nhr-25, the Caenorhabditis elegans ortholog of ftz-f1, is required for epidermal and somatic gonad development, Dev. Biol. 221 (2000) 259–272. B. Bertin, S. Sasorith, S. Caby, F. Oger, J. Cornette, J.M. Wurtz, R.J. Pierce, Unique functional properties of a member of the Fushi Tarazu-factor 1 family from Schistosoma mansoni, Biochem. J. 382 (2004) 337–351. M.C. Le Paslier, R.J. Pierce, F. Merlin, H. Hirai, W. Wu, D.L. Williams, D. Johnston, P.T. LoVerde, D. Le Paslier, Construction and characterization of a Schistosoma mansoni bacterial artificial chromosome library, Genomics 65 (2000) 87–94. L.A. Bobek, D.M. Rekosh, P.T. LoVerde, Small gene family encoding an eggshell (chorion) protein of the human parasite Schistosoma mansoni, Mol. Cell. Biol. 8 (1988) 3008–3016. V. Vivat-Hannah, W. Bourguet, M. Gottardis, H. Gronemeyer, Separation of retinoid X receptor homo- and heterodimerization functions, Mol. Cell. Biol. 23 (2003) 7678–7688. W. Kabsch, C. Sander, Dictionary of protein secondary structure: pattern recognition of hydrogen-bonded and geometrical features, Biopolymers 22 (1983) 2577–2637. H. Ellinger-Ziegelbauer, B. Glaser, C. Dreyer, A naturally occurring short variant of the FTZ-F1-related nuclear orphan

[25]

[26]

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36]

receptor xFF1rA and interactions between domains of xFF1rA, Mol. Endocrinol. 9 (1995) 872–886. D. Liu, M. Chandy, S.K. Lee, Y. Le Drean, H. Ando, F. Xiong, J. Woon Lee, C.L. Hew, A zebrafish ftz-F1 (Fushi Tarazu factor 1) homologue requires multiple subdomains in the D and E regions for its transcriptional activity, J. Biol. Chem. 275 (2000) 16758–16766. P. Aarnisalo, C.H. Kim, J.W. Lee, T. Perlmann, Defining requirements for heterodimerization between the retinoid X receptor and the orphan nuclear receptor Nurr1, J. Biol. Chem. 277 (2002) 35118–35123. P. Sacchetti, H. Dwornik, P. Formstecher, C. Rachez, P. Lefebvre, Requirements for heterodimerization between the orphan nuclear receptor Nurr1 and retinoid X receptors, J. Biol. Chem. 277 (2002) 35088–35096. T. Perlmann, L. Jansson, A novel pathway for vitamin A signaling mediated by RXR heterodimerization with NGFI-B and NURR1, Genes Dev. 9 (1995) 769–782. M. Nomura, H. Nawata, K. Morohashi, Autoregulatory loop in the regulation of the mammalian ftz-f1 gene, J. Biol. Chem. 271 (1996) 8243–8249. B.M. Forman, K. Umesono, J. Chen, R.M. Evans, Unique response pathways are established by allosteric interactions among nuclear hormone receptors, Cell 81 (1995) 541–550. J.S. Jorgensen, J.H. Nilson, AR suppresses transcription of the LHbeta subunit by interacting with steroidogenic factor-1, Mol. Endocrinol. 15 (2001) 1505–1516. A.S. Weinmann, P.J. Farnham, Identification of unknown target genes of human transcription factors using chromatin immunoprecipitation, Methods 26 (2002) 37–47. S. Mader, J.Y. Chen, Z. Chen, J. White, P. Chambon, H. Gronemeyer, The patterns of binding of RAR, RXR and TR homo- and heterodimers to direct repeats are dictated by the binding specificities of the DNA binding domains, EMBO J. 12 (1993) 5029–5041. V. Vlaeminck-Guillem, V. Laudet, M. Duterque-Coquillaud, [Negative cross-talk between nuclear receptors and transcription factors: implications in inflammation and oncogenesis], Med. Sci. (Paris) 19 (2003) 1121–1127. W.Y. Almawi, O.K. Melemedjian, Molecular mechanisms of glucocorticoid antiproliferative effects: antagonism of transcription factor activity by glucocorticoid receptor, J. Leukoc. Biol. 71 (2002) 9–15. R.M. Nissen, K.R. Yamamoto, The glucocorticoid receptor inhibits NFkappaB by interfering with serine-2 phosphorylation of the RNA polymerase II carboxy-terminal domain, Genes Dev. 14 (2000) 2314–2329.