The Mouse RecA-like Gene Dmc1 Is Required for Homologous Chromosome Synapsis during Meiosis

Molecular Cell, Vol. 1, 707–718, April, 1998, Copyright 1998 by Cell Press

The Mouse RecA-like Gene Dmc1 Is Required for Homologous Chromosome Synapsis during Meiosis Kayo Yoshida,* Gen Kondoh,† Yoichi Matsuda,‡ Toshiyuki Habu,* Yoshitake Nishimune,* and Takashi Morita*§ * Division of Molecular Embryology Research Institute for Microbial Diseases Osaka University 3–1 Yamadaoka, Suita Osaka 565 Japan † Genome Information Research Center Osaka University 3-1 Yamadaoka, Suita Osaka 565 Japan ‡ Laboratory of Animal Genetics School of Agricultural Sciences Nagoya University Furo-cho, Chikusa-ku Nagoya 464-01 Japan

Summary The mouse Dmc1 gene is an E. coli RecA homolog that is specifically expressed in meiosis. The DMC1 protein was detected in leptotene-to-zygotene spermatocytes, when homolog pairing likely initiates. Targeted gene disruption in the male mouse showed an arrest of meiosis of germ cells at the early zygotene stage, followed by apoptosis. In female mice lacking the Dmc1 gene, normal differentiation of oogenesis was aborted in embryos, and germ cells disappeared in the adult ovary. Meiotic chromosome analysis of Dmc1deficient mouse spermatocytes revealed random spread of univalent axial elements without correct pairing between homologs. In rare cases, however, we observed complex pairing among nonhomologs. Thus, the mouse Dmc1 gene is required for homologous synapsis of chromosomes in meiosis. Introduction The vast majority of eukaryotic organisms have adopted sexual reproduction, characterized by the segregation of their parents’ genetic information into the haploid genomes of gametes through meiosis. In meiosis, homologous chromosomes undergo reductional segregation leading to the formation of haploid gametes, and the chromosomes exchange DNA with their homologous partners by homologous recombination. The most characteristic feature of meiosis is the synapsis of homologous chromosomes, which ensures equal segregation of the chromosomes to their gametes (Roeder, 1995; Kleckner, 1996; Xu et al., 1997), but the mechanism that promotes proper pairing and synapsis is still unclear. § To whom correspondence should be addressed (e-mail: tmorita@

biken.osaka-u.ac.jp).

E. coli RecA-like gene products, which may carry out recombination, are good candidates for molecules involved in homolog synapsis in meiosis because they catalyze pairing and strand exchange between homologous DNA molecules (Kowalczykowski, 1991; Stasiak and Egelman, 1994; Voloshin et al., 1996). Recent studies revealed that the eukaryotes have two kinds of homologs of the E. coli RecA gene (Stassen et al., 1997). One such homolog is Rad51 (Morita et al., 1993; Shinohara et al., 1993; Yoshimura et al., 1993; Maeshima et al., 1995), which has been shown to catalyze strand transfer between homologous DNA in yeast and humans (Benson et al., 1994; Sung and Robberson, 1995; Baumann et al., 1996; Gupta et al., 1997). The Rad51 gene is expressed not only in meiotic tissues but also in somatic tissues dependent on a cell cycle (late G1-S–G2/M), suggesting involvement in double-strand break (DSB) repair of DNA in replication (Taki et al., 1996; Tashiro et al., 1996; Yamamoto et al., 1996). Gene targeting studies of mouse Rad51 revealed that the absence of Rad51 resulted in their early embryonic lethality, presumably due to their defect during cell proliferation in early embryogenesis (Lim and Hasty, 1996; Tsuzuki et al., 1996). Thus, it is experimentally difficult to evaluate the importance of Rad51 in meiosis because homozygotes die before gametes are produced. Dmc1 is a second RecA homolog in eukaryotes (Bishop et al., 1992; Kobayashi et al., 1993; Sato et al., 1995; Habu et al., 1996; Matsuda et al., 1996). In contrast to the Rad51 gene, the Dmc1 gene is expressed only during meiosis. Both RAD51 and DMC1 proteins have structures similar to the central core region of the RecA protein (domain II), which includes two nucleotide binding motifs (Story et al., 1993). In yeast, the DMC1 gene is required to convert DNA DSB recombination intermediates to homologous joint molecules in vivo (Bishop et al., 1992; Schwacha and Kleckner, 1997). In vitro study has revealed that purified human DMC1 protein has DNA-dependent ATPase activity, single-stranded DNA binding activity, and strand exchange activity (Li et al., 1997). Thus, the DMC1 protein is expected to catalyze the DNA-mediated recombination reaction in meiosis, as was observed with RecA and RAD51 proteins. From cytological observations, homologs associate with each other in the zygotene stage and synapse along their lengths to form synaptonemal complexes (SCs) in the pachytene stage of meiosis. During this period, two types of recombination nodules (early and late) appear as spherical proteinaceous structures (reviewed by Carpenter, 1988). At the zygotene stage, early recombination nodules are observed at the convergence point between axial elements of homologs (Albini and Jones, 1987; Anderson and Stack, 1988). They are thought to be involved in homology searches of DNA and synaptic initiation. The late nodules are larger and more densely stained and appear from the early pachytene chromosomes. They persist until the diplotene stage to become chiasmata. Judging from their frequency and distribution, they are likely to be the sites of crossing-over recombination (Carpenter, 1979; Sherman et al., 1992).

Molecular Cell 708

Figure 1. Immunohistochemical Localization of the DMC1 Protein in a Wild-Type Mouse Testis Immunohistochemistry was performed as described in the Experimental Procedures. (A) Cryostat sections were stained with rabbit anti-DMC1 polyclonal antibody. The cells stained in the outer layer of the tubules in stages IX-XII were leptotene-to-zygotene spermatocytes. (B) The control without the first antibody. Magnification of (A) and (B), 3200. (C) High magnification (31000) revealed nuclear foci with anti-DMC1 antibody.

Cytological analysis shows that the RecA-like gene products, RAD51 and DMC1, colocalize as numerous foci in meiotic prophase nuclei at the zygotene stage in yeast and lily (Bishop, 1994; Terasawa et al., 1995). Furthermore, the antibody capable of reacting with both RAD51 and LIM15, a lily homolog of DMC1 (Kobayashi et al., 1993), immunolabeled the early recombination nodules of the lily (Anderson et al., 1997), suggesting that RAD51 and/or DMC1 proteins in the early recombination nodules may be involved in recombination-related events searching for DNA sequence homology between homologs. The function of the DMC1 gene has been intensely analyzed by using yeast mutants. The dmc1 mutation leads to defects in reciprocal recombination, accumulation of DSB recombination intermediates, abnormal formation of SCs, and arrest in late meiotic prophase (Bishop et al., 1992). Recently, nearly complete chromosome synapsis has been shown to occur in this dmc1 mutant (Rockmill et al., 1995), although in a delayed manner, and the Dmc1 protein is thought to be nonessential for homologous synapsis in yeast. However, synapsis in the dmc1 mutant is defective as compared with the wild-type (Bishop et al., 1992; Rockmill et al., 1995). An increase in the frequency of polycomplexes as well as long axial elements has been observed (Bishop et al., 1992). The Zip1 protein is required for the formation of the central region of the SC at the pachytene stages (Sym et al., 1993). The zip1dmc1 double mutants formed axial elements, but these were not associated, suggesting that the Dmc1 protein is required for establishing

or stabilizing axial associations at a few sites between homologs, and the absence of Dmc1 results in delay or inefficient synapsis. There is also evidence of a partial defect in pairing homologs assayed by FISH in dmc1 mutants in yeast (Weiner and Kleckner, 1994). Thus, many lines of evidence support the hypothesis that there are defects in the progression of synapsis in dmc1 mutants in yeast. However, it has not been possible to determine whether or not all of the synapsed regions detected are homologous, due to limitations of ultrastructural analysis of spread meiotic chromosomes in yeast. We demonstrate that the mouse Dmc1 gene is absolutely required for homologous synapsis in mice. We disrupted the mouse Dmc1 gene by gene targeting and observed that the germ cells in Dmc1-deficient mice were arrested in the early zygotene stage of meiosis and then underwent apoptosis. The chromosomes of Dmc1-deficient mouse spermatocytes revealed the presence of randomly spread univalent axial elements, but these did not synapse between homologs. Results Expression of the DMC1 Protein in Mouse Testis The Dmc1 gene is expressed specifically in testis and embryonic ovary, which include the germ cells in meiosis. To determine the cell types or stages of expression, we carried out immunocytochemistry by using a rabbit polyclonal antibody raised against an N-terminal polypeptide (MKEDQVVQEESGFQ), which did not react with

Homologous Synapsis by DMC1 Protein in Meiosis 709

Figure 2. Targeting of the Dmc1 Locus by Homologous Recombination (A) A schematic representation of the mouse Dmc1 gene. The numbered boxes (1–4) denote a 59 noncoding exon and three coding exons. The targeting vector pTVN4 includes the pMC1neo gene (neo) and the HSV-thymidine kinase gene (TK). The wild-type allele produced an 18 kb KpnI product, while the disrupted allele gave rise to a 13 kb band with a 59 hybridization probe and a 5.9 kb band with a 39 probe, respectively. (B) Southern blot analysis of representative offspring from heterozygous matings. (1/1), wild-type; (1/2) heterozygous; (2/2), homozygous Dmc1-deficient mice. The 18 kb bands are faint because of inefficient blotting of longer DNA. (C) Northern blot analysis. Poly(A)-RNA (5 mg) isolated from testes was hybridized with probes of the complete mouse Dmc1 cDNA (Dmc1 cDNA), the 39 untranslated region of the Dmc1 cDNA (Dmc1–39UT), and the human glyceraldehyde-3 phosphate dehydrogenase cDNA (GAPDH). The upper band of GAPDH RNA, which is specific to the postmeiotic phase (Gapd-S), disappeared in Dmc1-deficient mouse (Welch et al., 1992). (D) Western blot analysis of DMC1 protein from testis with an anti-DMC1 polyclonal antibody. Lysates from the testis (100 mg of protein equivalent in each lane) were loaded. Bands corresponding to DMC1 (37 kDa) and DMC1-D (32 kDa) are indicated. (E and F) DMC1-specific immunostaining of paraformaldehyde-fixed frozen sections of testis from 8-week-old mice of wild-type (E) and homozygous Dmc1-deficient mouse (F).

the RAD51 protein (Habu et al., 1996). Staining was detected in the nuclei of cells in a single layer located closest to the basal lamina (Figures 1A and 1B). The tubules, which contained the stained cells, corresponded to the differentiation stages of IX-XII (Russell et al., 1990) in testis. Thus, we concluded that the leptotene-tozygotene spermatocytes expressed DMC1 protein in testis. By higher magnification (31000), it was found that the staining was not uniform in the nuclei but was observed as nuclear foci (Figure 1C), as in the case of RAD51 (Plug et al., 1996; Yamamoto et al., 1996; Moens et al., 1997). They may correspond to the chromosome sites, where RAD51 and DMC1 make complexes in early recombination nodules.

Targeted Disruption of the Dmc1 Gene A Dmc1 targeting construct was designed to replace a part of the second exon containing the initiation codon (ATG) with a neomycin resistance cassette (neo) in the reverse direction and to insert the herpes simplex virus thymidine kinase gene 6.0 kb upstream of the neo gene (Figure 2A). The targeting vector was linearized and used to transfect RI embryonic stem (ES) cells (Nagy et al., 1993). Successful targeting of the Dmc1 gene was achieved in 3 out of 451 G418 resistant clones, as judged by Southern blot analysis. The three independently targeted ES clones were used to produce chimeras by a slightly modified aggregation method (G. K., unpublished data). One female and ten male chimeras were born, and they

Molecular Cell 710

Figure 3. Reproductive Organs Are Impaired in Dmc1-Deficient Mice (A) Gross appearance of each testis from a wild-type (1/1), a heterozygous (1/2), and a homozygous mouse (2/2). The testis from the Dmc1-deficient mouse was proportionally small. (B) Gross appearance of each ovary from a wild-type (1/1), a heterozygous (1/2), and a homozygous mouse (2/2). The ovary from the Dmc1-deficient mouse was small as compared with those from wild-type and heterozygous mice. (C) Weights of testes from a wild-type (1/1), heterozygous (1/2), and homozygous mouse (2/2). The mean and standard errors are indicated. The testis from Dmc1-deficient mice weighed significantly less than their wild-type littermates after 16 days of age (n$5). (D) Dmc1-deficient mice display normal constitutive weight gain and are the same in size as are wild-type controls. Error bars represent standard errors.

were derived 100% from ES cells, judging by their coat color (agouti). They transmitted the targeted allele to half of their progeny by mating with C57BL/6 mice. Breedings of heterozygotes by heterozygous crosses produced offspring in the expected Mendelian distribution (Figure 2B). From 906 offspring, 222 were mice containing the wild-type Dmc1 gene, 453 were heterozygous, and 231 were homozygous for the disrupted Dmc1 allele, indicating that homozygosity for the Dmc1 mutation is not associated with detectable embryonic or neonatal lethality. Molecular Characterization of Dmc1-Deficient Mice To confirm the complete inactivation of the Dmc1 gene, Northern blot analysis was carried out. Two distinct poly(A)1 mRNAs for Dmc1 were detected in the normal mouse testis (Figure 2C), one 1.3 kb and the other 2.3 kb. We have isolated the longer 2.3 kb cDNA from a mouse testis cDNA library, corresponding to 2.3 kb (Habu et al., 1996). Using a 39 noncoding sequence (nt 1561–1920) of this cDNA as a hybridization probe, the shorter mRNA species (1.3 kb) was not detected, implying that the 1.3 kb mRNA was likely to be polyadenylated at about 1290 nt, where a putative polyadenylation signal resided. Sato et al. (1995) isolated the Dmc1 cDNA with a poly(A) tail at this site. In testis from homozygous mutant, we observed band shifts of both mRNAs from 2.3 and 1.3 kb to 3.3 and 2.3 kb, respectively. The increases in size corresponded to that of the neo cassette (1 kb) integrated into the allele. The larger mRNA bands in Dmc1-deficient mice were very dense compared with the wild-type mRNA, suggesting that the DMC1 protein might repress its own mRNA level, or

that the arrested leptotene-to-zygotene spermatocytes continued to express mRNA. To rule out the possibility that the mutated allele still produced DMC1 protein, we carried out Western blot analysis by using rabbit antiDMC1 antibody. The nuclear extracts from wild-type and heterozygous mouse testes revealed two bands with molecular weights of 37 and 32 kDa, corresponding to DMC1 and DMC1-D (a product from alternatively spliced mRNA) (Habu et al., 1996) proteins, respectively (Figure 2D). In contrast, the nuclear extract from the Dmc1deficient mouse testis did not show these bands. This result was confirmed by using rat polyclonal antibody against all of the DMC1 protein (data not shown). Thus, neither DMC1 nor DMC1-D protein was produced by the disrupted Dmc1 allele. The 30 kDa band was nonspecifically detected in testis and other tissues. In wild-type mouse testis, leptotene and zygotene spermatocytes were specifically stained (Figure 2E) by immunohistochemistry. However, sections of the Dmc1-deficient mouse testis showed no positive signals with the antiDMC1 antibody, consistent with the above Western blot data (Figure 2F). Anatomical Analysis of Dmc1-Deficient Mice Anatomical analysis of reproductive organs showed that the adult testes of homozygous mice were tiny compared with those of wild-type and heterozygous mice (Figure 3A). Until 16 days after birth, the average testis weight for Dmc12/2 males was identical to that of the wild-type and heterozygous mice. However, 16 days after birth, the weight of Dmc12/2 male testis ceased increasing (Figure 3C). This is the time when pachytene spermatocytes should appear. This was in contrast to

Homologous Synapsis by DMC1 Protein in Meiosis 711

Figure 4. Histological Analysis of Dmc1Deficient Testes and Ovary (A–F) Hematoxylin- and eosin-stained cross sections of testes from 8-week-old mice. (A) A section from the wild-type male testis showing the gross morphological appearance of seminiferous tubules (magnification, 3200). (B–G) Sections of testes from 8-week-old Dmc1-deficient disrupted mice. (B) Showing the absence of pachytene-diakinesis spermatocytes, round and elongating spermatids, and spermatozoa, at 2003 magnification. (C–E) Typical appearances of seminiferous tubules of Dmc1-deficient mouse testes. Photos are enlarged 31.5 from the original observation (3200). (C) The tubules are composed of many layers of spermatocytes at the leptotene and zygotene stages. (D) Numerous apoptotic cells are in the layers inside the tubules. (E) A single layer of type-B spermatogonia is the closest to the basal lamina. (F–G) Continuous sections of the Dmc1-deficient mouse testis stained with hematoxylin–eosin (F) or labeled by the TUNEL method (G); magnification, 3200. (H) The wild-type adult ovary shows the presence of oocytes at various stages of maturation forming large follicles (3100). (I) The Dmc1-deficient mouse ovary is small and no maturing follicle was observed (3100). (J) The wild-type ovary of neonatal mouse with oocytes at the dictyate stage of meiosis. The arrow shows the enlarged oocytes surrounded by follicle cells (3200). (K) The neonatal Dmc1-deficient mouse ovary, which had no oocytes at the dictyate stage inside. The apoptotic cells with condensed nuclei were detected (3200).

the weight gain in the wild-type as well as in the heterozygote (Figure 3C). The growth curve of wild-type, heterozygous, and Dmc12/2 male mice is shown in Figure 3D, indicating no significant difference in body weight among those mice up to 10 weeks after birth. Females at 8 weeks after birth had tiny ovaries. There was a 4- to 5-fold reduction in ovary mass in Dmc12/2 mice compared with the wild-type and heterozygous mice (Figure 3B).

Histological Analysis of Male Testis Histological examination of seminiferous tubules from Dmc1-deficient male mice showed abnormal spermatogenesis (Figure 4) compared with those in wild-type and

heterozygous male testes. The diameters of seminiferous tubules in Dmc1-deficient mouse testes were apparently reduced. In wild-type and heterozygous testes, normal proliferation and spermatogenesis occurred and mature spermatozoa were observed, (Figure 4A), whereas in Dmc1-deficient mouse testes, we detected no maturating spermatids or sperm (Figure 4B). The abnormal tubules of 8-week-old testes were categorized into three types. The first type of tubules contained 2–5 layers of spermatocytes at the leptotene and zygotene stages, together with the spermatogonia (Figure 4C). In these tubules, we observed no spermatocytes beyond these stages. The second type of tubules revealed many apoptotic cells with nuclei that were round and densely stained with eosin, along with early spermatocytes and

Molecular Cell 712

Table 1. Chromosomes of Wild-Type and Dmc-1–Deficient Mouse Testis Nuclei Meiotic Prophase Mouse

Dmc1

E. Zygotene

L. Zygotene

E. Pachytene

M. Pachytene

L. Pachytene

Diplotene

Degeneration

Total

G855 G856 G295 Total

1/1 1/1 1/1

8 10 5 23 (6.4%)

9 5 7 21 (5.9%)

9 10 16 35 (9.7%)

50 56 52 158 (44.0%)

22 14 23 59 (16.4%)

14 18 25 57 (15.9%)

3 1 2 6 (1.7%)

115 114 130 359 (100%)

G839 G849 G222

1/2 1/2 1/2

13 8 8 29 (8.8%)

7 8 11 26 (7.8%)

12 7 12 31 (9.4)%

48 58 38 144 (43.5%)

14 23 15 52 (15.7%)

16 10 17 43 (13.0%)

3 1 2 6 (1.8%)

113 115 103 331 (100%)

G838 G841 G297

2/2 2/2 2/2

35 31 36 102 (75.6%)

0 0 0 0

0 0 0 0

0 0 0 0

0 0 0 0

0 0 0 0

14 10 9 33 (24.4%)

49 41 45 135 (100%)

Number of Synaptic Sites in Nucleus

G838 G841 G297

2/2 2/2 2/2

0

1

2

3

4

$5

Total

17 4 23 44

9 1 7 17

1 6 5 12

4 2 1 7

3 1 0 4

1 3 0 4

35 31 36 102

Meiotic nuclei were spread and stained with silver nitrate and were observed by electron microscope. Nuclei with meiotic chromosomes were categorized into early zygotene, late zygotene, early pachytene, midpachytene, late pachytene, and diplotene stages. Nuclei with degenerated chromosomes were also counted. Three individuals of each genotype were examined. In Dmc1-deficient mice, the number of homologous and nonhomologous synapses within a nucleus was counted at each sample. In WT and heterozygous nuclei, we detected no unusual synapsis between nonhomologs.

spermatogonia (Figure 4D). We carried out the TdTmediated dUTP-biotin nick end labeling (TUNEL) assay for the degenerated spematocytes. Results showed that the degenerated cells in Dmc1-deficient testis were labeled with fluorescence, demonstrating that the spermatocytes were undergoing apoptotic cell death (Figures 4F and 4G, left tubule). The first type of tubules with enriched leptotene and zygotene spermatocytes were negative for the TUNEL assay (Figures 4G and 4F, right tubule). The interstitium was nonspecifically reacted either in wild-type or Dmc1-deficient mouse testis. The third type of the tubules had rather simple structures consisting of a single layer of spermatogonia, some of which were at the stage of mitosis. These three kinds of abnormal tubules were persistently observed until 10 weeks of age, all through the first meiotic wave of spermatogenesis. The Leydig cells and Sertoli cells appeared normal in the mutant. In summary, Dmc12/2 mutation arrested meiosis at the zygotene stage in prophase. Accumulation of arrested zygotene spermatocytes may lead to apoptosis. The mice had no germ cells that developed further than the zygotene stage, leading to infertility. Dmc1-Deficient Phenotypes in Female Germ Cells Ovaries of Dmc1-deficient mice from 8-week-old female mice were greatly reduced in size, as compared with those of the wild-type female of the same age (Figures 4H and 4I). The average size of Dmc12/2 ovaries was about 20% of the wild-type. However, the oviduct and

uterus of the Dmc12/2 female appeared normal, except that the uterus had a thin appearance (data not shown). Histological analysis showed that the adult ovaries from Dmc1-deficient mice contained no follicles at any developmental stage. They consisted of follicle cells without organized structure, and we did not observe any germ cells in the ovary (Figure 4I). In contrast, the ovaries from wild-type and heterozygous females contained follicles in various stages of maturation (Figure 4H). To define the stages of disappearance of oocytes, we examined the sections of genital ridges or ovaries from Dmc1-deficient females, following the days of embryonic development. The female genital ridges of 16 dpc (days post coitus) contained leptotene, zygotene, and pachytene oocytes in meiosis. Although there is some histological difference (increase in apoptotic cells in Dmc12/2 genital ridges) between wild-type and Dmc1deficient mouse genital ridges 16 dpc, it is not as clear as in the case of testes. However, just after birth (0 days), we observed that the ovaries of the Dmc12/2 were composed only of follicle cells and small apoptotic cells (Figure 4K), whereas, in the wild type we observed large germ cells in the dictyate stage surrounded by follicle cells (Figure 4J). In conclusion, the Dmc12/2 females had no follicles containing oocytes, and thus they were infertile. Meiotic Chromosome Analysis of Dmc1-Deficient Mice To investigate the effect of disruption of the Dmc1 gene on chromosome metabolism, as well as to confirm the

Homologous Synapsis by DMC1 Protein in Meiosis 713

Figure 5. Electron Micrographs of Meiotic Chromosomes Spread from Dmc1-Deficient Mouse Spermatocytes (A) An early zygotene nucleus of the wild-type mouse, in which most of the axes were univalent axial elements, and sex chromosomes were not observed. (B) A late zygotene nucleus of the wild-type with fully paired and synapsed bivalents. X and Y chromosomes were thick but not synapsed. (C–J) Nuclei of the Dmc1-deficient mouse. (C) Nucleus of the Dmc1-deficient mouse showing extensive asynapsis, despite axial element formation. (D) Nucleus with chromosome degeneration. (E–J) Higher magnification of the Dmc1-deficient mouse testis nuclei. (E) Extensive asynapsis is observed. (F) Degenerated chromosome, presumably in the process of apoptosis. (G) Partial synapsis between equal lengths of axial elements. (H) Unusual partial synapsis (arrow) is observed between nonhomologous chromosomes with clearly different lengths. (I) Synapsis formation among three nonhomologs. (J) Complex intermingled region of synapsis among several nonhomologs in the Dmc1-deficient mouse. Magnification, (A) and (J), 31,500; (B)-(D), 31,000; (E)-(I), 33,500.

arrested stage of meiosis, we analyzed the meiotic chromosomes from the testicular germ cells of Dmc1-deficient mice. The germ cells were spread, and nuclei stained with silver nitrate were analyzed by electron microscope. We observed zygotene, pachytene, and

diplotene chromosomes from wild-type mice (Table 1, and Figures 5A, 5B, and 6A). However, in Dmc1-deficient mice, we detected neither pachytene nor diplotene chromosomes (Table 1). Most of the nuclei that we observed were univalent axial elements characteristic of those at

Molecular Cell 714

early zygotene stages in the wild-type. However, we did not observe any chromosomes with the appearance of those at late zygotene stages. In the early zygotene stage, autosomes in wild-type mice are observed as univalent axial elements, and sex chromosomes do not appear (Figure 5A). In the late zygotene stage, autosomes of the wild-type form synapses between homologs, except for sex chromosomes, which become dense but do not associate with each other (Figure 5B). A high magnification (310,000) revealed that the autosomes of Dmc12/2 germ cells formed univalent axial elements but not bivalents (Figure 5E). There was no appearance of the sex chromosomes in Dmc12/2 nuclei. Thus, we concluded that the latest stage we observed in Dmc1-deficient spermatocytes corresponded to the early zygotene. In Dmc1-deficient spermatocyte nuclei, most of the axial structures detected were not closely aligned. However, 57% of spreads contained at least one segment in which a region of synapsis was formed. It is possible that some synapsis might be homologous, because the chromosomes of identical lengths were aligned (Figure 5G). However, some of the synapses are clearly heterologous, because the lengths of the axial elements aligned were completely different (Figure 5H). In our experimental condition of spreading meiotic nuclei, we did not observe any broken chromosome fragments in the nuclei of mouse spermatocytes. The most convincing evidence for the presence of heterologous chromosome synapsis in Dmc1-deficient mouse spermatocytes was the synapsis formation among more than three chromosomes of different length (Figure 5I). Complex intermingled regions of synapsis of many heterologous chromosomes were also detected (Figure 5J). We counted the frequency of sites of unusual synapsis in Dmc1-deficient mouse spermatocytes. Many had one (16.6%) or two sites (11.8%) of homologous or nonhomologous synapsis in Dmc1-deficient mouse nuclei (Table 1 and Figure 6B). That Dmc1-deficient mouse spermatocytes had the capability to synapse partially in a small number of chromosomes indicated that DMC1 protein should be required specifically for the recognition of homologs in the process of synapsis. We also observed nuclei with degeneration characterized by fragmentation of axes (Figures 5D and 5F) at a higher rate (24.4%) in Dmc12/2 spermatocytes than in wild-type (1.7%). They seem to be derived from the nuclei to undergo apoptosis. From this, we concluded that Dmc1-deficiency conferred defects in homologous synapsis of homologs leading to the arrest of meiosis at the early zygotene stage, followed by degeneration of chromosomes. In heterozygous mice, there were no defects in their chromosome metabolisms compared with wild-type mice. Discussion Germ Cells of Dmc1-Deficient Mice Arrested at Meiosis In mouse spermatogenesis, the first meiotic wave begins around day 10, when preleptotene spermatocytes appear. At day 10, spermatogonia enter the meiotic cell cycle, and subsequently, preleptotene spermatocytes undergo DNA replication. At day 12, zygotene spermatocytes are observed in the peripheral compartment of

Figure 6. Distribution of Meiotic Nuclei in Dmc1-Deficient Mouse Spermatocytes (A) The meiotic nuclei from wild-type, heterozygous, and Dmc1deficient mice were categorized by electron microscopy, and their populations were shown as percentages. (B) The number of unusual synaptic sites in a Dmc1-deficient mouse spermatocyte nuclei were counted.

the tubule, and at days 14–20, pachytene spermatocytes appear in the adluminal compartment of the tubule (Russell et al., 1990). In our experiment, the testis weight of Dmc1-deficient mice ceased to increase 16 days after birth. This corresponds to that of the first meiotic wave, where pachytene spermatocytes are expected to emerge. However, we were unable to observe any germ cells developing further than the zygotene stage, as judged by histological and meiotic chromosome analyses. Furthermore, we observed apoptotic cells more frequently as the differentiating cells reached the zygotene stage. From these observations, we concluded that the Dmc1deficiency first affects the first meiotic wave of spermatogenesis. After the first meiotic wave, the same pattern of cell distribution in seminiferous tubules was persistently observed until the mice were 10 weeks old. This implies that in later stages after the first meiotic wave the incomplete differentiation cycle occurs repeatedly, from the proliferation stage of spermatogonia through the germ cell development, up to the early zygotene stage and subsequent apoptosis. The wild-type female germ cells undergo meiosis from 12 to 18 dpc in the fetal ovary. By day 5 after birth, thousands of oocytes are in the dictyate stage ready for maturation. However, in Dmc1-deficient female mice

Homologous Synapsis by DMC1 Protein in Meiosis 715

we did not observe normal oocytes in the ovary after birth. In embryos 14 dpc we saw some apoptotic cells in female genital ridges. As oogonia do not proliferate after the last division in the embryos, the meiotic arrest and subsequent apoptotic cell death would result in the complete lack of germ cells in adult mice, as we have observed. This is in contrast to male spermatogenesis, where the germ cells proliferate continuously and repeat the incomplete differentiation cycle in their lifetime.

Cells in Meiotic Arrest Undergo Apoptosis In yeast, the dmc1-deletion mutant shows an arrest of meiosis during the pachytene stage, leading to accumulation of DSB, incomplete formation of tripartite SC, and arrest of spindle pole body morphogenesis (Bishop et al., 1992). As a consequence of the recombination/SC formation defect, the dmc1 deletion apparently turns on a meiosis-specific cell cycle “checkpoint” gene. In the case of mice, the Dmc1 defect results in apoptotic cell death following the arrest of meiosis and accumulation of abnormal zygotene spermatocytes carrying unsynapsed chromosomes. The cross section revealed that only about 5%–10% of seminiferous tubules in the testis were full of apoptotic cells, and that no other tubules showed apoptosis to such extent. It seems that apoptosis of meiotically arrested spermatocytes occurs in only a restricted region of the tubules, in rather a short time period. This is in contrast to the spontaneous death of selected spermatocytes and spermatids seen as a regular feature of normal spermatogenesis (BlancoRodriguez and Martinez-Garcia, 1996). It is known that DNA strand breaks can trigger p53dependent apoptosis. In wild-type pachytene spermatocytes, relatively high levels of p53 are expressed. Thus, the p53 gene may play a significant role in the meiotic process of spermatogenic differentiation and maturation (Sjoblom and Lahdetie, 1996). In the Dmc1-deficient mouse, the chromosome aberration might signal meiotic arrest and apoptosis mediated by p53. Loss of p53 function may render spermatocytes resistant to meiotic arrest and apoptosis and ultimately lead to further proceeding through the meiotic stages with unsynapsed, abnormal chromosomes. In budding yeast, a dmc1 single mutant was arrested in prophase. In contrast, a mec1dmc1 double mutant proceeded through two meiotic divisions with normal kinetics, then forming aberrant meiotic products containing fragmented DNA and very few spores (Lydall et al., 1996). Thus, the DNA damage checkpoint gene MEC1 (also known as esr1) (Kato and Ogawa, 1994; Weiner et al., 1994) is required for meiotic arrest caused by blocking the repair of DSB in the dmc1 mutant. Similarly, the mammalian homolog might also be involved in meiotic arrest in Dmc1-deficient mice. A mammalian homolog of MEC1 is the Atm (Ataxia-Telangiectasia mutated) gene (Savitsky et al., 1995), which may act in a signal transduction pathway from DNA damages to cell cycle arrest. Interestingly, the defective phenotypes of germ cells in Atm-deficient mice are very similar to those in Dmc1-deficient mice. In Atm-deficient mouse testis, seminiferous tubules have neither spermatids nor spermatozoa, and ovaries have neither maturing follicles nor

oocytes (Barlow et al., 1996; Elson et al., 1996; Xu et al., 1996). Thus, we speculate that Atm may be involved in some part of the DNA recombination process, directly or indirectly, as well as in surveillance for abnormality of pairing and synapsis formation of homologs in meiosis. Recent studies reveal that Atm/p53 or Atm/p21 double mutant mice partially rescue the prophase defects in Atm in meiosis (Barlow et al., 1997). Role of the Dmc1 Gene in Pairing and Synapsis of Homologs In yeast, Bishop et al. (1992) described how the dmc1 mutant failed to form normal SCs. They observed no nuclei containing the full-length SCs 7 hr after entering meiosis in the mutant, when most cells in wild type had completed the first meiotic division. They also observed unusual intermediates called “dense boxes” and long axial cores in the synaptic process, which resembled the intermingled heterozyous axial elements and unpaired axial elements, respectively, in our study. Rockmill et al. (1995) observed that dmc1 mutants could form nearly complete chromosome synapsis in a substantially delayed manner (about 20 hr after entering meiosis), as compared with wild-type. This delay is explained by the absence of axial associations between homologs. Our electron microscope analysis of spread meiotic nuclei revealed that axial elements were formed normally in Dmc1-deficient mouse spermatocytes, but that synapsis of homologs was blocked. Spreading meiotic chromosomes of 3-, 8-, and 10-week-old mouse spermatocytes, we did not detect any complete SCs even in 10-week-old Dmc1-deficient mouse spermatocytes, whereas in wild-type we found completely paired SCs from 3-week old mouse testes. These results clearly demonstrated that in mouse Dmc1-deficient spermatocytes the homolog synapsis, as well as SC formation, was completely blocked but was not delayed. That there are more severe Dmc1-deficient meiotic phenotypes in mice than in yeast may be explained as follows. In the case of yeast, random physical interactions between chromosome DNA may eventually allow them to find corresponding homologous sequences. Thus, even in the absence of the Dmc1 protein, the homologs could finally synapse in a delayed manner. However, in mice the size of chromosomes is more than 100 times larger than those in yeast. Thus, in mammals it would be impossible for all of the chromosomes to find their corresponding homologs by chance, without help of DMC1 function. The observed unusual pairing of nonhomologous chromosomes in Dmc1-deficient mice provides strong supporting evidence for the presence of the random physical interaction and subsequent synapsis of chromosomes. An alternative explanation is that cell cycle checkpoint genes might detect the defects of homolog synapsis at early stages in mammals, thus promptly eliminating such defective spermatocytes by apoptotic mechanisms. In this way, the random, accidental homolog search would not occur any more in mice. We propose the following model for synapsis of homologs in mice. The RAD51 protein first attaches and forms complexes with DNA, recognizing DSB that are generated in a meiosis-specific manner. Then, directly or indirectly, the DMC1 protein recognizes and associates with

Molecular Cell 716

those DNA–RAD51 complexes (Bishop, 1994). The DMC1 protein is used to search for the corresponding homologous DNA sequences. Then, strand exchange occurs between DNA of paternal and maternal chromatids at the sites of early recombination nodules. Next, the DMC1 protein would be removed from the early recombination nodules to allow the formation of tight SCs with homologs in a DNA sequence-independent manner. However, in the case of Dmc1-deficient mice, the RAD51 protein would make foci, because we detected normal levels of Rad51 mRNA. But, due to the absence of the DMC1 protein, RAD51 foci would be unable to search for homologous sequences. Thus, the foci would fail to become the early recombination nodules and axial elements would remain univalent without synapsis. The RAD51 and DMC1 proteins in eukaryotes are comparable to the E. coli RecA protein. However, our study of the Dmc1-knockout mouse revealed that the roles of DMC1 and RAD51 proteins are distinct and cannot be replaced by each other (Shinohara et al., 1997). The Dmc1 gene has likely evolved specifically to recognize and synapse only paternal and maternal homologs in meiosis. Experimental Procedures Construction of the Dmc1 Targeting Vector From a 129/Sv strain library (lEMBL3), we isolated a genomic clone containing an 11 kb insert, bearing the first four exons of the open reading frame. For this, a full-length mouse Dmc1 cDNA probe was used (Habu et al., 1996). The pPNT plasmid DNA (Tybulewicz et al., 1991), which contains neo and HSV-tk genes for gene targeting, was modified. We deleted the original HindIII site, cutting with HindIII, and carried out T4 polymerase filling-in reaction and ligation. The neo gene was excised with XhoI and EcoRI, and then an EcoRI– HindIII–XhoI linker was inserted. Within the resulting HindIII–NotI sites, we introduced the following DNA fragments: (1) a 2.7 kb HindIII (converted from EcoRV by subcloning to pBluescript plasmid followed by excision)–HindIII insert containing exon 1 of Dmc1 genomic DNA; (2) a HindIII–BamH fragment including intron 1; (3) BamHI–exon 2 (ATG)–SphI–SalI fragment. The PCR was carried out between the 39terminal part of intron 1 and the initiation codon ATG, which was later converted to a SphI site. The PCR product was subcloned into pBR322 and excised by BamHI and SalI sites; (4) A SalI–neo–XhoI fragment. The neo gene was derived from pMC1NeoPolyA cassette; and (5) a 4.7 kb of XhoI–NotI fragment. The genomic DNA fragment containing intron 2 through intron 4 was amplified by PCR. The 59 end was modified to an XhoI–EcoRI–KpnI linker and the 39 end to a NotI site. The KpnI site was introduced as a marker for the introduction of the vector for Southern blot genotyping. The resulting gene targeting vector was designated pTVN4. ES Cell Culture and Electroporation Targeting vector pTVN4 (25 mg) was linearized at the single Not1 site and electroporated into 1 3 10 7 R1 ES cells (Nagy et al., 1993). R1 cells were grown and subjected to G418 selection at a concentration of 200 mg/ml. After 7 days of culture, colonies were picked up, and homologous recombinant ES clones were identified by Southern analysis using a 240 bp fragment located in the 39 external position of the genomic sequence contained in the targeting vector. Homologous recombinant clones were confirmed by KpnI digestion, yielding a 6 kb band. We also checked the 59 end using an external 59probe just outside the genomic sequence in the vector, producing a 13 kb band in Southern blot. Generation of Dmc1-Deficient Mice by Aggregation Method The ES cells were cultured in medium and aggregated with F1 embryos from C57BL/6 and DBA2 at the 8-cell stage (Nagy et al., 1993). After 24 hr of culture in medium, they developed to the blastocyst

stage and were transferred into the uteri of pseudopregnant female recipient C3H mice. Genotyping of Mice Oligonucleotide primers for PCR that distinguish the insertion of the neo gene from the wild-type allele were designed for genotyping of mice: N4-neo: TCTCCTGTCATCTCACCTTGCT; N4-up: ATTTTAC TGCCGCTCTCCTTTCA; N4-down: CATCTCTCCAGCCTTCATTT GAC. Primers N4-neo and N4-up give a 597 bp DNA, diagnostic of the targeted allele, while the primers N4-down and N4-up yield the wild-type allele product of 462 bp. PCR was carried out in a 15 ml reaction mixture containing 100 ng of DNA, 20 pmol of each primer, 1.5 mM MgCl2, 0.2 mM of each dNTP, and 0.5 U Taq polymerase. Cycling conditions were 948C for 30 s, 608C for 30 s, and 728C for 1 min (40 cycles). RNA Analysis Total RNA (15 mg) isolated from testes of 8-week-old mice using the guanidinium thiocyanate method (Chomczynski and Sacchi, 1987). RNA was analyzed by Northern blot. As hybridization probes we prepared 1–444 nt of Dmc1 cDNA, 1561–1920 nt of 39 untranslated sequence of Dmc1 cDNA, and human glyceraldehyde-3 phosphate dehydrogenase (GAPDH) cDNA. Western Blot Analysis For Western blot analysis, 100 mg of protein from testis nuclear extracts was separated by SDS-PAGE and transferred onto a Hibond membrane (Bio-Rad). The membrane was incubated with affinity-purified rabbit anti-DMC1 antibody, and was detected by chemiluminescence ECL kit (Amersham) using a goat anti-rabbit IgG horseradish peroxidase conjugate. Histological Analysis Tissues and organs were fixed in Bouin’s solution, dehydrated, and embedded in paraffin wax. Embedded samples were sectioned at 3 mm and stained with haematoxylin and eosin. Apoptotic cells were labeled in situ on 3 mm tissue sections using In situ Apoptosis Detection Kit (Takara) according to the instructions of the manufacturer. Immunohistochemistry The mouse testis was frozen in liquid nitrogen and sectioned at 4 mm on a cryostat. Immunostaining was carried out using a polyclonal rabbit antibody that was raised against an N-terminal peptide (amino acids 1–14) of the DMC1 protein. The primary antibody was used at 1:150 dilution and incubated at 48C for 24 hr. Staining was developed by using the Vectastain Elite ABC kit (Stratagene). For counter staining, hematoxylin was used. Meiotic Analysis Microspreads of spermatocytes were prepared and stained with 50% silver nitrate and observed under the light and electron microscope. Acknowledgments We are grateful to Dr. Nozaki for sequence analysis, and Dr. Koshimizu for his suggestions on manipulation of genital ridges. We thank Dr. Kawada and Dr. Li for their suggestions on immunological experiments. The targeting experiments were done in the Genome Information Research Center of Osaka University. The laboratory mice are maintained in Quarters for Experimentally Infected Animals at Osaka University. We thank Dr. Wynshaw-Boris and Dr. Tanaka for critical reading of the manuscript. This work is supported by a grantin-aid of the Japanese Ministry of Education, Science, Sports, and Culture (08280102) and a grant from the Association of Livestock Technology, Japan (Bioscience Research for Livestock Technology 95–1). Received December 30, 1997; revised February 23, 1998.

Homologous Synapsis by DMC1 Protein in Meiosis 717

References Albini, S.M. and Jones, G.H. (1987). Synaptonemal complex spreading in Allium cepa and A. fistulosum. Chromosoma 95, 324–338. Anderson, L.K., and Stack, S.M. (1988). Nodules associated with axial cores and synaptonemal complexes during zygotene in Psilotum nudum. Chromosoma 97, 96–100. Anderson, L.K., Offenberg, H.H., Verkuijlen, W.M.H.C., and Heyting, C. (1997). RecA-like proteins are components of early meiotic nodules in lily. Proc. Natl. Acad. Sci. USA 94, 6868–6873. Barlow, C., Hirotsune, S., Paylor, R., Liyanage, M., Eckhaus, M., Collins, F., Shiloh, Y., Crawley, J.N., Ried, T., Tagle, D., et al. (1996). Atm-deficient mice: a paradigm of ataxia telangiectasia. Cell 86, 159–171. Barlow, C., Liyanage, M., Moens, P.B., Deng, C-X., Ried, T., and Wynshaw-Boris, A. (1997). Partial rescue of the prophase I defects of Atm-deficient mice by p53 and p21 null alleles. Nat. Genet. 17, 462–466. Baumann, P., Benson, F.E., and West, S.C. (1996). Human RAD51 protein promotes ATP-dependent homologous pairing and strand transfer reactions in vitro. Cell 87, 757–766. Benson, F.E., Stasiak, A., and West, S.C. (1994). Purification and characterizaiton of the human Rad51 protein, an analogue of E. coli RecA. EMBO J. 13, 5764–5771. Bishop, D.K. (1994). RecA homologs Dmc1 and Rad51 interact to form multiple nuclear complexes prior to meiotic chromosome synapsis. Cell 79, 1081–1092. Bishop, D.K., Park, D., Xu, L., and Kleckner, N. (1992). DMC1: a meiosis-specific yeast homolog of E. coli recA required for recombination, synaptonemal complex formation, and cell cycle progression. Cell 69, 439–456. Blanco-Rodriguez, J., and Martinez-Garcia, C. (1996). Spontaneous germ cell death in the testis of the adult rat takes the form of apoptosis. Cell Prolif. 29, 13–31. Carpenter, A.T.C. (1979). Synaptonemal complex and recombination nodules in wild-type Drosophila melanogaster females. Genetics 92, 511–541. Carpenter, A.T.C. (1988). Thoughts on recombination nodules, meiotic recombination, and chiasmata. In Genetic Recombination, R. Kucheriapati and G.R. Smith, eds. (Washington, D.C.: American Society of Microbiology), pp. 529–548. Chomczynski, P., and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159. Elson, A., Wang, Y., Daugherty, C., Morton, C.C., Zhou, F., CamposTorres, J., and Leder, P. (1996). Pleiotropic defects in ataxia-telangiectasia protein-deficient mice. Proc. Natl. Acad. Sci. USA 93, 13084– 13089. Gupta, R.C., Bazemore, L.R., Golub, E.I., and Radding, C.M. (1997). Activities of human recombination protein Rad51. Proc. Natl. Acad. Sci. USA 94, 463–468. Habu, T., Taki, T., Weat, A., Nishimune, Y., and Morita, T. (1996). The mouse and human homologs DMC1, the yeast meiosis-specific homologous recombination gene, have a common unique form of exon-skipped transcript in meiosis. Nucleic Acids Res. 24, 470–477. Kato, R., and Ogawa, H. (1994). An essential gene, ESR1, is required for mitotic cell growth, DNA repair, and meiotic recombination in Saccharomyces cerevisiae. Nucleic Acids Res. 22, 3104–3112. Kleckner, N. (1996). Meiosis: how could it work? Proc. Natl. Acad. Sci. USA 93, 8167–8174.

Lim, D-S., and Hasty, P. (1996). A mutation in mouse rad51 results in an early embryonic lethality that is suppressed by a mutation in p53. Mol. Cell. Biol. 16, 7133–7143. Lydall, D., Nikolsky, Y., Bishop, D.K., and Weiner, T. (1996). A meiotic recombination checkpoint controled by mitotic checkpoint genes. Nature 383, 840–843. Maeshima, K., Morimatsu, K., Shinohara, A., and Horii, T. (1995). Rad51 homologs in Xenopus laevis: two distinct genes are highly expressed in ovary and testis. Gene 160, 195–200. Matsuda, Y., Habu, T., Hori, T., and Morita, T. (1996). Chromosome mapping of the mouse homolog of DMC1, the yeast meiosis-specific homologous recombination gene. Chromosome Res. 4, 249–250. Moens, P.B., Chen, D.J., Shen, Z., Kolas, N., Tarsounas, M., Heng, H.H.Q., and Spyropoulos, B. (1997). Rad51 immunocytology in rat and mouse spermatocytes and oocytes. Chromosoma 106, 207–215. Morita, T., Yoshimura, Y., Yamamoto, A., Murata, K., Mori, M., Yamamoto, H., and Matsushiro, A. (1993). A mouse homolog of the Escherichia coli recA and Saccharomyces cerevisiae RAD51 genes. Proc. Natl. Acad. Sci. USA 90, 6577–6580. Nagy, A., Rossant, J., Nagy, R., Abramow-Newerly, W., and Roder, J.C. (1993). Derivation of completely cell culture-derived mice from early-passage embryonic stem cells. Proc. Natl. Acad. Sci. USA 90, 8424–8428. Plug, A.W., Xu, J., Reddy, G., Golub, E.I., and Ashley, T. (1996). Presynaptic association of Rad51 protein with selected sites in meiotic chromatin. Proc. Natl. Acad. Sci. USA 93, 5920–5924. Roeder, G.S. (1995). Sex and the single cell: meiosis in yeast. Proc. Natl. Acad. Sci. USA 92, 10450–10456. Rockmill, B., Sym, M., Scherthan, H., and Roeder, G.S. (1995). Roles for two RecA homologs in promoting meiotic chromosome synapsis. Genes Dev. 9, 2684–2695. Russell, L.D., Ettlin, R.A., Sinha Hikim, A.P., and Clegg, E.D. (1990). Histological and Histopathological Evaluation of the Testis (Clearwater, FL: Cache River Press). Sato, S., Hotta, Y., and Tabata, S. (1995) Structural analysis of recAlike gene in the genome of Arabidopsis thaliana. DNA Res. 2, 89–93. Savitsky, K., Sfez, S., Tagle, D., Ziv, Y., Sartiel, A., Collins, F.S., Shiloh, Y., and Rotman, G. (1995). The complete sequence of the coding region of the ATM gene reveals similarity to cell cycle regulators in different species. Hum. Mol. Genet. 4, 2025–2032. Schwacha, A., and Kleckner, N. (1997). Interhomolog bias during meiotic recombination: meiotic functions promote a highly differentiated interhomolog-only pathway. Cell 90, 1123–1135. Sherman, J.D., Herickhoff, L.A., and Stack, S.M. (1992). Silver staining two types of meiotic nodules. Genome 35, 907–915. Shinohara, A., Ogawa, H., Matsuda, Y., Ushio, N., Ikeo, K., and Ogawa, T. (1993). Cloning of human, mouse and fission yeast recombination genes homologous to RAD51 and recA. Nat. Genet. 4, 239–243. Shinohara, A., Gasior, S., Ogawa, T., Kleckner, N., and Bishhop, D.K. (1997). Saccharomyces cerevisiae recA homologues RAD51 and DMC1 have both distinct and overlapping roles in meiotic recombination. Genes to Cells 2, 615–629. Sjoblom, T., and Lahdetie, J. (1996). Expression of p53 in normal and g-irradiated rat testis suggests a role for p53 in meiotic recombination and repair. Oncogene 12, 2499–2505. Stasiak, A., and Egelman, E.H. (1994). Structure and function of RecA-DNA complexes. Experientia 50, 192–203.

Kobayashi, T., Hotta, Y., and Tabata, S. (1993). Isolation and characterization of a yeast gene that is homologous with a meiosis-specific cDNA from a plant. Mol. Gen. Genet. 237, 225–232.

Stassen, N.Y., Logsdon, J.M., Jr., Vora, G.J., Offenberg, H.H., Palmer, J.D., and Zolan, M.E. (1997). Isolation and characterization of rad51 orthologs from Coprinus cinereus and Lycopersicon esculentum, and phylogenetic analysis of eukaryotic recA homologs. Curr. Genet. 31, 144–157.

Kowalczykowski, S.C. (1991). Biochemistry of genetic recombination: energetics and mechanism of DNA strand exchange. Annu. Rev. Biophys. Biophys. Chem. 20, 539–575.

Story, R.M., Bishop, D.K., Kleckner, N., and Steitz, T.A. (1993). Structural relationship of bacterial RecA proteins to recombination proteins from bacteriaphage T4 and yeast. Science 259, 1892–1896.

Li, Z., Golub, E.I., Gupta, R., and Radding, C.M. (1997). Recombination activities of HsDmc1 protein, the meiotic human homolog of RecA protein. Proc. Natl. Acad. Sci. USA 94, 11221–11226.

Sung, P., and Robberson, D.L. (1995). DNA strand exchange mediated by a RAD51-ssDNA nucleoprotein filament with polarity opposite to that of RecA. Cell 82, 453–461.

Molecular Cell 718

Sym, M., Engebrecht, J., and Roeder, G.S. (1993). ZIP1 is a synaptonemal complex protein required for meiotic chromosome synapsis. Cell 72, 365–378. Taki, T., Ohnishi, T., Yamamoto, A., Hiraga, S., Arita, N., Izumotoa, S., Hayakawa, T., and Morita, T. (1996). Antisense inhibition of RAD51 enhances radiosensitivity. Biochim. Biophys. Res. Commun. 223, 434–438. Tashiro, S., Kotomura, N., Shinohara, A., Tanaka, K., Ueda, K., and Kamada, N. (1996). S phase specific formation of the human Rad51 protein nuclear foci in lymphocytes. Oncogene 12, 2165–2170. Terasawa, M., Shinohara, A., Hotta, Y., Ogawa, H., and Ogawa, T. (1995). Localization of RecA-like recombination proteins on chromosomes of the lily at various meiotic stages. Genes Dev. 9, 925–934. Tsuzuki, T., Fujii, Y., Sakumi, K., Tominaga, Y., Nakao, K., Sekiguchi, M., Matsushiro, A., Yoshimura, Y., and Morita, T. (1996). Targeted disruption of the Rad51 gene leads to lethality in embryonic mice. Proc. Natl. Acad. Sci. USA 93, 6236–6240. Tybulewicz, V.L.J., Crawford, C.E., Jackson, P.K., Bronson, R.T., and Mulligan, T.C. (1991). Neonatal lethality and lymphopenia in mice with a homozygous disruption of the c-abl proto-oncogene. Cell 65, 1153–1163. Voloshin, O.N., Wang, L., and Camerini-Otero, R.D. (1996). Homologous DNA pairing promoted by a 20-amino acid peptide derived from RecA. Science 272, 868–872. Weiner, B.M., and Kleckner, N. (1994). Chromosome pairing via multiple interstitial interactions before and during meiosis in yeast. Cell 77, 977–991. Weiner, T.A., Kiser, G.L., and Hartwell, L.H. (1994). Mitotic checkpoint genes in budding yeast and the dependence of mitosis on DNA replication and repair. Genes Dev. 8, 652–665. Welch, J.E., Schatte, E.C., O’Brien, D.A., and Eddy, E.M. (1992). Expression of a glyceraldehyde 3-phosphate dehycrogenase gene specific to mouse spermatogenic cells. Biol. Reprod. 46, 869–878. Xu., Y., Ashley, T., Brainerd, E.E., Bronson, R.T., Meyn, M.S., and Baltimore, D. (1996). Targeted disruption of ATM leads to growth retardation, chromosomal fragmentation during meiosis, immune defects, and thymic lymphoma. Genes Dev. 10, 2411–2422. Xu, L., Weiner, B.M., and Kleckner, N. (1997). Meiotic cells monitor the status of the interhomolog recombination complex. Genes Dev. 11, 106–118. Yamamoto, A., Taki, T., Yagi, H., Habu, H., Yoshida, K., Yoshimura, Y., Yamamoto, K., Matsushiro, A., Nishimune, Y., and Morita, T. (1996). Cell cycle-dependent expression of the mouse Rad51 gene in proliferating cells. Mol. Gen. Genet. 251, 1–12. Yoshimura, Y., Morita, T., Yamamoto, A., and Matsushiro, A. (1993). Cloning and sequence of the human Rec-A-like gene cDNA. Nucleic Acids Res. 21, 1665.