- Email: [email protected]
The murine Wilms tumor suppressor gene (wt1) locus
Gene 279 (2001) 119–126 www.elsevier.com/locate/gene
The murine Wilms tumor suppressor gene (wt1) locus Yulan Gong, Holger Eggert, Christoph Englert* Forschungszentrum Karlsruhe, Institut fu¨r Toxikologie und Genetik, Postfach 3640, 76021 Karlsruhe, Germany Received 6 August 2001; received in revised form 4 October 2001; accepted 11 October 2001 Received by A.J. van Wijnen
Abstract The Wilms tumor suppressor gene WT1 plays a crucial role in the etiology of various human diseases as well as in the development of specific organs including the kidneys, gonads and the spleen. At present the human as well as the Fugu wt1 locus have been characterized. We have used a PAC clone to analyze the murine wt1 locus and report here the structure of the wt1 gene as well as a characterization of the nine wt1 introns regarding their size and sequence at the exon/intron and intron/exon boundaries. In addition we provide a restriction map of the murine wt1 locus which should prove useful for the cloning of various constructs designed for the generation of mouse models. Prompted by the existence of a WT1 antisense transcript in humans we also examined strand-specific transcription at the murine wt1 locus. Our analysis suggests that there is no detectable antisense transcription of sequences within or immediately downstream of wt1 exon 1. We find, however, evidence for a divergent transcript which encompasses sequences at and around minor transcriptional initiation sites of wt1 and which is transcribed in the opposite direction. Despite the very high degree of similarity between the human and the murine wt1 sequence and expression as well as the presence of divergent transcripts in both cases, the existence of antisense transcription does not seem to be conserved between the two species. q 2001 Elsevier Science B.V. All rights reserved. Keywords: Zinc finger protein; Antisense transcription; Genomic structure; Exon/intron boundaries; Evolutionary conservation
1. Introduction The Wilms tumor suppressor gene WT1 (wt1 in the mouse) encodes a zinc finger transcription factor whose inactivation leads to a variety of human diseases. In addition to Wilms tumor, a pediatric kidney cancer (Call et al., 1990; Gessler et al., 1990), these diseases involve WAGR (Wilms tumor, aniridia, genitourinary abnormalities, mental retardation), and Denys-Drash and Frasier syndrome (Riccardi et al., 1978; Pelletier et al., 1991a; Barbaux et al., 1997; Kikuchi et al., 1998; Klamt et al., 1998). Among other phenotypes these syndromes are characterized by urogenital malformations. The major sites of WT1 expression include the developing kidney, the stromal cells of the gonads and spleen and the Abbreviations: ASI and II, alternatively spliced sequences I and II; bp, base pair(s); cDNA, DNA complementary to RNA; cpm, counts per minute; kb, kilobase(s); kDa, kilodalton(s); PAC, P1 artificial chromosome; PIPES, 1,4-piperazinediethanesulfonic acid; RNase, ribonuclease; RT, reverse transcriptase; SDS, sodium dodecyl sulfate; tRNA, transfer RNA; WAGR, Wilms tumor, aniridia, genitourinary abnormalities, mental retardation; WIT-1, Wt1 antisense transcript; Wt1, Wilms tumor suppressor gene 1; YAC, yeast artificial chromosome * Corresponding author. Tel.: 149-7247-823444; fax: 149-7247823354. E-mail address: [email protected] (C. Englert).
mesothelial cells that line the heart, diaphragm and peritoneum (Pritchard-Jones et al., 1990; Armstrong et al., 1992; Rackley et al., 1993). The factors which are responsible for the very specific spatial and temporal expression pattern of WT1 have not yet been defined. WT1, which is encoded by ten exons, is expressed as a 36–62 kDa protein family that arises because of three alternative sites of translation initiation and two alternative splicing events (Haber et al., 1991; Bruening and Pelletier, 1996; Scharnhorst et al., 1999). Alternative splice I comprises exon 5, which encodes 17 amino acids in the central part of the protein. Alternative splice II results from use of an alternative splice donor sequence between exons 9 and 10. Its insertion leads to three additional amino acids (the KTS sequence) that disrupt the spacing between the last two of the four zinc fingers. In order to analyze the physiological function of wt1, a number of mouse models have been generated. In a first approach both copies of wt1 have been deleted from the germline of mice (Kreidberg et al., 1993). Wt1 2/2 animals die at embryonic stage 13.5–15.5 and show an absence of kidney and gonad development. These studies have recently been extended and it has been shown that the time point of embryonic lethality of wt1 mutant embryos depends on the
0378-1119/01/$ - see front matter q 2001 Elsevier Science B.V. All rights reserved. PII: S 0378-111 9(01)00757-0
120
Y. Gong et al. / Gene 279 (2001) 119–126
mouse strain used. In addition, an essential role for wt1 in the development of the spleen has been described (Herzer et al., 1999). In an alternative series of experiments the generation of YAC transgenic mice has been employed. Using this technique it was shown that 470 and 280 kb YAC transgenes containing the human WT1 locus were able to recapitulate the endogenous wt1 expression pattern (Moore et al., 1998). The same YAC transgenes were used to complement wt1 knockout mice (Moore et al., 1999). These experiments revealed further functions for wt1 in the development of the heart, specifically the epicardium, as well as in the adrenal glands. Attempts to overexpress wt1 have so far failed (Menke et al., 1998). While expression of a form of wt1 which encodes a truncated wt1 protein did show features which are characteristic of patients with the respective mutation, a mouse line carrying this mutation could not be established (Patek et al., 1999). Clearly the generation of more animal models is required in order to gain further insights into the physiological function of wt1. One interesting feature relating to WT1 expression is the existence of an antisense transcript. Upon characterization of the human Wilms tumor locus on chromosome 11p13 the existence of two genes, WT1 and WIT-1, which are divergently transcribed from one promoter region was noted (Huang et al., 1990). WIT-1 does not contain an open reading frame of significant length. Both genes are expressed in the same temporal and tissue-specific pattern. In addition, cDNAs have been described which are transcribed in an antisense orientation with regard to WT1, contain parts of the WT1 coding region and extend into intron 1 of WT1 (Eccles et al., 1994; Malik et al., 1995). It has been postulated that the antisense transcript might regulate WT1 expression levels (Moorwood et al., 1998; Malik et al., 2000). The mouse wt1 locus has not yet been characterized to the same extent. In this report we describe the genomic structure of the mouse wt1 locus including the positions of exons/introns as well as a restriction map. This should facilitate the generation of future mouse models which are needed to analyze the function of wt1 in vivo. We also demonstrate the existence of a divergent transcript which includes sequences immediately adjacent to the 5 0 -end of the wt1 gene. The analysis of different mouse tissues and cell lines suggests that, like with human WT1, this transcript is expressed in wt1-expressing cells and tissues and absent where wt1 is not transcribed. In contrast to the situation in humans, however, in mouse this transcript does not significantly overlap with wt1 and is therefore most likely not involved in the regulation of wt1 expression.
2. Materials and methods 2.1. Identification and characterization of a genomic clone harboring the mouse wt1 gene A probe covering exons 2–10 from the mouse wt1 cDNA
was used to screen a mouse genomic library (RPCI 21 Mouse PAC) provided by the RZPD (Resource Center/ Primary Database, Heidelberg, Berlin). This library contained inserts of approximately 140 kb derived from genomic DNA from the spleen of female mice (strain: 129/SvevTACfBr) in the vector pPAC4. Southern Blotting and PCR analysis confirmed the presence of exons 1 and 10 of wt1 in all eight clones which were obtained. One of the clones was then used to analyze the wt1 locus in more detail. Characterization was done using a combination of restriction enzyme digestion, Southern Blotting, subcloning and sequencing. In order to identify the sequences surrounding exon/intron junctions exon-anchored primers were designed. As a basis for the primer design the mouse cDNA sequence of wt1 (Buckler et al., 1991) as well as the exon/intron structure of human WT1 were used (Haber et al., 1991). For the amplification of longer PCR products (introns 1, 3, 5, 6, 7 and 9) the Elongase enzyme mix (GibcoBRL) was used. 2.2. Isolation of RNA Preparation of total RNA was done using the TRIzol reagent (GibcoBRL) following the recommendations of the manufacturer. Briefly, tissues were isolated from 5day-old mice, snap-frozen in liquid nitrogen and resuspended in 1 ml TRIzol. Homogenization was done by passing the suspension several times through a 26G needle. After chloroform extraction, RNA was precipitated by adding 500 ml isopropanol, centrifuged, washed once with 80% ethanol and resuspended in sterile water. 2.3. RT-PCR analysis For RT-PCR analysis polyadenylated RNA was prepared using the mini-mRNA purification system (Qiagen). Firststrand cDNA synthesis was done using 0.5 mg of the RNA preparation with SuperScript reverse transcriptase (GibcoBRL) in the presence of 100 ng oligo-dT15 primers in a volume of 20 ml. For PCR analysis an aliquot of 2 ml of the RT reaction was used. The wt1 intron 1-specific primers were CTGAAGAAGCGGCAGGGAAG and AGCAGGTCGCGGAGCCACTA. 2.4. RNase protection RNase protection was carried out according to Current Protocols of Molecular Biology (Ausubel et al., 1989). Genomic wt1 fragments encompassing nucleotides 2124 to 1118 (probe 1) and 1723 to 11152 (probe 2) (Pelletier et al., 1991b) were amplified by PCR, subcloned into the vector pGEM-Teasy (Promega) and verified by sequencing. A third fragment contained 550 bp starting at position 1014 and extending into intron 1 (probe 3). To generate labeled probes, plasmid templates were linearized by restriction enzyme digestion and reverse transcribed with SP6 or T7 RNA polymerase in the presence of [ 32P]UTP. Probes (50 ml
Y. Gong et al. / Gene 279 (2001) 119–126
121
Fig. 1. Genomic organization of the murine wt1 gene. (A) Schematic representation of the murine wt1 gene (top) and a map of restriction enzyme sites (bottom). Exons are boxed, and the shaded region indicates the translated sequence. The main initiation codon, the two alternative initiation codons as well as the termination codon are indicated. ASI and ASII denote the two alternatively spliced sequences. (B) Determination of the wt1 intron sizes. The nine introns of the murine wt1 locus were amplified by PCR and separated on an agarose gel. M1, 1 kb marker; M2, 100 bp marker.
122
Y. Gong et al. / Gene 279 (2001) 119–126
Table 1 Comparison of intron sizes of the wt1 locus in man, mouse and the pufferfish Fugu rubripes a Intron #
Human
Mouse
Pufferfish
1 2 3 4 5 6 7 8 9
6.080 0.438 10.301 1.036 16.445 3.540 3.501 0.601 2.792
5.7 0.6 10.5 1.15 2.0 3.7 2.2 0.95 2.3
1.538 0.462 0.912 0.216 0.084 0.085 0.495 0.142
a Data regarding human WT1 are taken from GenBank (Accession number: AL138811), mouse data are from this paper and the information on pufferfish wt1 is based on the published sequence (Miles et al., 1998). Note that human and mouse wt1 comprise ten exons, whereas Fugu wt1 consists of only nine exons. The alternatively spliced exon 5 is missing. Exons 7–10 in human and mouse wt1 correspond to exons 6–9 in Fugu wt1 and encode the four zinc fingers of the protein. Sizes are given in kilobases.
volume) were precipitated three times with 200 ml of 2.5 M ammonium acetate and 750 ml of 100% ethanol before they were used in hybridization reactions. For RNA:RNA hybridization a 30 ml reaction containing 5 £ 10 5 cpm of probe and 30 mg of total RNA was incubated in hybridization buffer (80% deionized formamide, 40 mM PIPES (pH 6.4), 400 mM NaCl and 1 mM EDTA). Control samples contained 30 mg of bacterial tRNA. Hybridization reactions were incubated at 458C overnight and subsequently digested with RNase A and T1 in 10 mM Tris–HCl (pH 7.5), 300 mM NaCl, 5 mM EDTA for 1 h at 308C. Samples were deproteinized by SDS/Proteinase K treatment and RNA hybrids were recovered by ethanol precipitation. Products were separated by electrophoresis using a denaturing 6% polyacrylamide gel and visualized by autoradiography.
3. Results and discussion 3.1. Genomic organization of the murine wt1 gene Until now the wt1 loci of two species, namely human (Tadokoro et al., 1992; GenBank Accession number: AL138811) and Fugu (Miles et al., 1998), have been characterized. We have used a PAC (P1 artificial chromosome) clone to characterize the murine wt1 locus (Fig. 1A). The overall structure and organization of the murine wt1 locus is very similar to the human counterpart. In both cases the genomic locus encompasses ten exons. Exon 5 as well as an extension of three amino acids (KTS) at the end of exon 9 are subject to alternative splicing (Haber et al., 1991). This is different in Fugu where the exon 5 sequence is missing and the KTS tripeptide is replaced by KPS (Miles et al., 1998). With regard to the size of the introns (Fig. 1B and Table 1) it is interesting to note that whereas most murine and human wt1 introns have a very similar length, intron 5 is
an exception. In the human WT1 locus, intron 5 spans more than 16 kb and is the largest intron. In the murine wt1 locus, intron 5 encompasses only 2 kb. The discrepancy in the size of intron 5 is the main reason for the difference in length between the murine and the human Wt1 gene of 32.6 and 47.0 kb, respectively. The size of the Fugu wt1 locus is 5.2 kb which represents a nine-fold reduction compared to the human WT1 gene. Intronic sequences at the exon/intron and intron/exon junctions of the murine wt1 locus were determined using exon-anchored primers (Fig. 2). All wt1 introns start with GT and end with AG, and sequences adjacent to the splice sites are in good agreement with the consensus splice rule (Senapathy et al., 1990). We have used the available data concerning the wt1 cDNA as well as our own analysis of the wt1 genomic locus to assemble a comprehensive restriction map (Fig. 1A) which should prove useful for the generation of constructs based on the murine wt1 sequence. 3.2. Characterization of a divergent transcript at the wt1 locus In humans two transcripts have been mapped to the WT1 locus which are expressed in the same spatial and temporal pattern (Huang et al., 1990). The primary transcript, WT1, acts as a tumor suppressor and encodes a zinc finger transcription factor (Call et al., 1990; Gessler et al., 1990). The second transcript, WIT-1, does not harbor a significantly long open reading frame and is transcribed in the opposite direction with regard to WT1. Multiple transcriptional start sites have been reported for WIT-1, some of which show significant overlap with the 5 0 region of WT1 (Campbell et al., 1994; Eccles et al., 1994). Prompted by the high degree of sequence conservation between human and mouse wt1, as well as by the very similar expression pattern, we wanted to examine whether similar antisense wt1 transcription also exists in the mouse. We have therefore performed RNase protection analysis using three different genomic fragments. Three different transcriptional start sites have been reported for wt1 (Pelletier et al., 1991b). The major site is located at position 1337 and two minor sites are at positions 11 and 125. The probes for the RNase protection experiment were located either at the 5 0 end (probe 1), within exon 1 (probe 2) or encompassing the junction between exon 1 and intron 1 of the wt1 gene (probe 3; see Fig. 3A). As a source for the RNA we have used various tissues from 5-day-old mice as well as two cell lines. The mouse mesonephric cell line M15 has been shown to express significant endogenous wt1 mRNA levels (Larsson et al., 1995). As a negative control, LB cells derived from a murine T cell lymphoma were used (Zahalka et al., 1993) which do not show any wt1 expression (data not shown). The results from the RNase protection analysis can be seen in Fig. 3. A sense probe 1 (with regard to wt1 transcrip-
Y. Gong et al. / Gene 279 (2001) 119–126
123
Fig. 2. Exon/intron junctions of the murine wt1 gene. Nucleotide numbering begins with the first nucleotide of the published sequence (Buckler et al., 1991). Exonic and the corresponding amino acid sequences are shown in upper case letters, and intronic sequences are in lower case letters. Consensus 5 0 -donor and 3 0 -acceptor splice site residues are underlined. The alternatively spliced sequences are shown in italics.
tion) detected a transcript of approximately 240 bases, indicating full protection of the probe. Interestingly, a signal could be seen in RNA from the kidney, the spleen (see inset) as well as from M15 cells (Fig. 3B, top). This is the pattern which would be expected from wt1 expression.
When the probe was used in the antisense orientation, however, no specific signal could be detected (Fig. 3B, bottom). This suggests the existence of a transcript which is transcribed into the opposite direction from wt1 and encompasses the minor transcriptional initiation sites of
124
Y. Gong et al. / Gene 279 (2001) 119–126
Fig. 3. Characterization of a divergent transcript at the wt1 locus. (A) Schematic representation of the wt1 promoter region. Right-angled arrows indicate minor (11 and 125) and major (1337) wt1 transcriptional start sites (Pelletier et al., 1991b). The arrow at position 723 denotes the major start site of wt1 translation. The positions of the probes are indicated. (B–D) RNase protection analysis of the wt1 promoter region. Single-stranded RNA probes were used representing the sense (upper) or the antisense (lower) orientation (with regard to the direction of wt1 transcription) of probes 1 (B), 2 (C) and 3 (D). Due to the use of restriction enzymes for linearization of the template plasmids all six probes contain sequences of variable length which is not complementary to the genomic wt1 sequence. Total RNA from the mouse tissues indicated as well as from cell lines was hybridized with the probes and processed as described. After RNase digestion the sense probe 1 detects a specific signal in kidney, spleen (better seen on the longer exposure shown on top) and M15 cells. No specific signal can be seen with the sense probes 2 and 3. The reciprocal is true for use of the antisense probes. Specific signals are marked by arrowheads. A 100 bp DNA ladder was used to estimate the size of the protected fragments.
wt1. In this experiment we were, however, not able to detect wt1 transcription which is probably due to a lack of sensitivity. Alternatively the different tissues which served as a source for the RNA analyzed (data in the literature are based on RNA isolated from testis and ovary) could serve as an explanation for this discrepancy. When we used probes 2 and 3 (Fig. 3C,D) which cover exonic and intronic wt1 sequences further downstream from the transcriptional start site the antisense probes detected wt1 transcripts in kidney, spleen and M15 cells. In this case there was no evidence to suggest the existence of an antisense transcript. This suggests that in this genomic area only one strand, namely the sense strand (wt1), is transcribed. The length of the various fragments detected by the antisense probe 3 (Fig. 3D, bottom) suggests that the RNA preparation contained significant amounts of non-spliced wt1 mRNA.
This was also confirmed by RT-PCR analysis using intron 1specific primers (data not shown). Our analysis of the transcription of the 5 0 end of the murine wt1 locus demonstrates the existence of two divergent transcripts. In addition to wt1 there is a second mRNA which encompasses sequences overlapping with the reported 5 0 end of a minor portion of wt1 transcripts. This second transcription unit is transcribed in the opposite direction relative to the wt1 gene. We found no evidence for the existence of a true antisense transcription, i.e. a significant overlap of transcription units containing the same sequences but transcribed in opposite directions. The absence of an antisense transcript in the area of the wt1 exon 1/intron 1 boundary is different from the situation with the human WT1 locus for which such an antisense transcript has been reported (Campbell et al., 1994; Eccles et al., 1994; Moor-
Y. Gong et al. / Gene 279 (2001) 119–126
wood et al., 1998). It has been speculated that the antisense WT1 transcript might serve to regulate WT1 expression at the RNA and protein level (Moorwood et al., 1998; Malik et al., 2000). Our data suggest that at least in the mouse, antisense transcription is not a mechanism which regulates wt1 expression levels. It is curious that the divergent transcript in the mouse as well as WIT-1 in human is expressed in the same spatiotemporal pattern as the Wt1 transcripts. If this does not have a functional role, might this be a reflection of processes at the Wt1 locus? Obviously the expression of a gene like Wt1 with a defined role during development needs to be exquisitely regulated. In most organs and at most times the status of Wt1 gene expression is ‘off’. Activation of Wt1 transcription is very likely accompanied by changes in chromatin structure. This process usually involves a decondensation of the nucleosomes and results in increased accessibility of target sequences. Conceivably this loosening of the chromatin could in turn lead to the activation of cryptic promoter sequences which are also contained within this chromatin domain. Whether this is indeed the case or whether the existence of a divergent transcription unit has a functional role can only be determined once mouse models are generated which lack expression of the divergent transcript. Acknowledgements We are grateful to Dagmar Wilhelm and Jonathan Sleeman for reading and improving this manuscript. We would like to thank Dagmar Wilhelm for providing us with the wt1 exon 1-specific probe and Birgit Besenbeck and Nathalie Decker for their excellent technical help. This work was supported by a PhD scholarship from the Forschungszentrum Karlsruhe to Y.G. and a grant from the Deutsche Forschungsgemeinschaft (En 280/2-4) to C.E. References Armstrong, J.F., Pritchard-Jones, K., Bickmore, W.A., Hastie, N.D., Bard, J.B., 1992. The expression of the Wilms’ tumour gene, WT1, in the developing mammalian embryo. Mech. Dev. 40, 85–97. Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., Struhl, K., 1989. Current Protocols in Molecular Biology, Wiley, New York. Barbaux, S., Niaudet, P., Gubler, M.C., Grunfeld, J.P., Jaubert, F., Kuttenn, F., Fekete, C.N., Souleyreau-Therville, N., Thibaud, E., Fellous, M., McElreavey, K., 1997. Donor splice-site mutations in WT1 are responsible for Frasier syndrome. Nat. Genet. 17, 467–470. Bruening, W., Pelletier, J., 1996. A non-AUG translational initiation event generates novel WT1 isoforms. J. Biol. Chem. 271, 8646–8654. Buckler, A.J., Pelletier, J., Haber, D.A., Glaser, T., Housman, D.E., 1991. Isolation, characterization, and expression of the murine Wilms’ tumor gene (WT1) during kidney development. Mol. Cell. Biol. 11, 1707– 1712. Call, K.M., Glaser, T., Ito, C.Y., Buckler, A.J., Pelletier, J., Haber, D.A., Rose, E.A., Kral, A., Yeger, H., Lewis, W.H., et al., 1990. Isolation and characterization of a zinc finger polypeptide gene at the human chromosome 11 Wilms’ tumor locus. Cell 60, 509–520.
125
Campbell, C.E., Huang, A., Gurney, A.L., Kessler, P.M., Hewitt, J.A., Williams, B.R., 1994. Antisense transcripts and protein binding motifs within the Wilms tumour (WT1) locus. Oncogene 9, 583–595. Eccles, M.R., Grubb, G., Ogawa, O., Szeto, J., Reeve, A.E., 1994. Cloning of novel Wilms tumor gene (WT1) cDNAs; evidence for antisense transcription of WT1. Oncogene 9, 2059–2063. Gessler, M., Poustka, A., Cavenee, W., Neve, R.L., Orkin, S.H., Bruns, G.A., 1990. Homozygous deletion in Wilms tumours of a zinc-finger gene identified by chromosome jumping. Nature 343, 774–778. Haber, D.A., Sohn, R.L., Buckler, A.J., Pelletier, J., Call, K.M., Housman, D.E., 1991. Alternative splicing and genomic structure of the Wilms tumor gene WT1. Proc. Natl. Acad. Sci. USA 88, 9618–9622. Herzer, U., Crocoll, A., Barton, D., Howells, N., Englert, C., 1999. The Wilms tumor suppressor gene wt1 is required for development of the spleen. Curr. Biol. 9, 837–840. Huang, A., Campbell, C.E., Bonetta, L., McAndrews-Hill, M.S., ChiltonMacNeill, S., Coppes, M.J., Law, D.J., Feinberg, A.P., Yeger, H., Williams, B.R., 1990. Tissue, developmental, and tumor-specific expression of divergent transcripts in Wilms tumor. Science 250, 991–994. Kikuchi, H., Takata, A., Akasaka, Y., Fukuzawa, R., Yoneyama, H., Kurosawa, Y., Honda, M., Kamiyama, Y., Hata, J., 1998. Do intronic mutations affecting splicing of WT1 exon 9 cause Frasier syndrome? J. Med. Genet. 35, 45–48. Klamt, B., Koziell, A., Poulat, F., Wieacker, P., Scambler, P., Berta, P., Gessler, M., 1998. Frasier syndrome is caused by defective alternative splicing of WT1 leading to an altered ratio of WT1 1/-KTS splice isoforms. Hum. Mol. Genet. 7, 709–714. Kreidberg, J.A., Sariola, H., Loring, J.M., Maeda, M., Pelletier, J., Housman, D., Jaenisch, R., 1993. WT-1 is required for early kidney development. Cell 74, 679–691. Larsson, S.H., Charlieu, J.P., Miyagawa, K., Engelkamp, D., Rassoulzadegan, M., Ross, A., Cuzin, F., van Heyningen, V., Hastie, N.D., 1995. Subnuclear localization of WT1 in splicing or transcription factor domains is regulated by alternative splicing. Cell 81, 391–401. Malik, K.T., Wallace, J.I., Ivins, S.M., Brown, K.W., 1995. Identification of an antisense WT1 promoter in intron 1: implications for WT1 gene regulation. Oncogene 11, 1589–1595. Malik, K., Salpekar, A., Hancock, A., Moorwood, K., Jackson, S., Charles, A., Brown, K.W., 2000. Identification of differential methylation of the WT1 antisense regulatory region and relaxation of imprinting in Wilms’ tumor. Cancer Res. 60, 2356–2360. Menke, A., McInnes, L., Hastie, N.D., Schedl, A., 1998. The Wilms’ tumor suppressor WT1: approaches to gene function. Kidney Int. 53, 1512– 1518. Miles, C., Elgar, G., Coles, E., Kleinjan, D.J., van Heyningen, V., Hastie, N., 1998. Complete sequencing of the Fugu WAGR region from WT1 to PAX6: dramatic compaction and conservation of synteny with human chromosome 11p13. Proc. Natl. Acad. Sci. USA 95, 13068– 13072. Moore, A.W., Schedl, A., McInnes, L., Doyle, M., Hecksher-Sorensen, J., Hastie, N.D., 1998. YAC transgenic analysis reveals Wilms’ tumour 1 gene activity in the proliferating coelomic epithelium, developing diaphragm and limb. Mech. Dev. 79, 169–184. Moore, A.W., McInnes, L., Kreidberg, J., Hastie, N.D., Schedl, A., 1999. YAC complementation shows a requirement for Wt1 in the development of epicardium, adrenal gland and throughout nephrogenesis. Development 126, 1845–1857. Moorwood, K., Charles, A.K., Salpekar, A., Wallace, J.I., Brown, K.W., Malik, K., 1998. Antisense WT1 transcription parallels sense mRNA and protein expression in fetal kidney and can elevate protein levels in vitro. J. Pathol. 185, 352–359. Patek, C.E., Little, M.H., Fleming, S., Miles, C., Charlieu, J.P., Clarke, A.R., Miyagawa, K., Christie, S., Doig, J., Harrison, D.J., Porteous, D.J., Brookes, A.J., Hooper, M.L., Hastie, N.D., 1999. A zinc finger truncation of murine WT1 results in the characteristic urogenital
126
Y. Gong et al. / Gene 279 (2001) 119–126
abnormalities of Denys-Drash syndrome. Proc. Natl. Acad. Sci. USA 96, 2931–2936. Pelletier, J., Bruening, W., Li, F.P., Haber, D.A., Glaser, T., Housman, D.E., 1991a. WT1 mutations contribute to abnormal genital system development and hereditary Wilms’ tumour. Nature 353, 431–434. Pelletier, J., Schalling, M., Buckler, A.J., Rogers, A., Haber, D.A., Housman, D., 1991b. Expression of the Wilms’ tumor gene WT1 in the murine urogenital system. Genes Dev. 5, 1345–1356. Pritchard-Jones, K., Fleming, S., Davidson, D., Bickmore, W., Porteous, D., Gosden, C., Bard, J., Buckler, A., Pelletier, J., Housman, D., et al., 1990. The candidate Wilms’ tumour gene is involved in genitourinary development. Nature 346, 194–197. Rackley, R.R., Flenniken, A.M., Kuriyan, N.P., Kessler, P.M., Stoler, M.H., Williams, B.R., 1993. Expression of the Wilms’ tumor suppressor gene WT1 during mouse embryogenesis. Cell Growth Differ. 4, 1023–1031.
Riccardi, V.M., Sujansky, E., Smith, A.C., Francke, U., 1978. Chromosomal imbalance in the Aniridia-Wilms’ tumor association: 11p interstitial deletion. Pediatrics 61, 604–610. Scharnhorst, V., Dekker, P., van der Eb, A.J., Jochemsen, A.G., 1999. Internal translation initiation generates novel WT1 protein isoforms with distinct biological properties. J. Biol. Chem. 274, 23456–23462. Senapathy, P., Shapiro, M.B., Harris, N.L., 1990. Splice junctions, branch point sites, and exons: sequence statistics, identification, and applications to genome project. Methods Enzymol. 183, 252–278. Tadokoro, K., Oki, N., Fujii, H., Ohshima, A., Inoue, T., Yamada, M., 1992. Genomic organization of the human WT1 gene. Jpn. J. Cancer Res. 83, 1198–1203. Zahalka, M.A., Okon, E., Naor, D., 1993. Blocking lymphoma invasiveness with a monoclonal antibody directed against the beta-chain of the leukocyte adhesion molecule (CD18). J. Immunol. 150, 4466–4477.
The murine Wilms tumor suppressor gene (wt1) locus Yulan Gong, Holger Eggert, Christoph Englert* Forschungszentrum Karlsruhe, Institut fu¨r Toxikologie und Genetik, Postfach 3640, 76021 Karlsruhe, Germany Received 6 August 2001; received in revised form 4 October 2001; accepted 11 October 2001 Received by A.J. van Wijnen
Abstract The Wilms tumor suppressor gene WT1 plays a crucial role in the etiology of various human diseases as well as in the development of specific organs including the kidneys, gonads and the spleen. At present the human as well as the Fugu wt1 locus have been characterized. We have used a PAC clone to analyze the murine wt1 locus and report here the structure of the wt1 gene as well as a characterization of the nine wt1 introns regarding their size and sequence at the exon/intron and intron/exon boundaries. In addition we provide a restriction map of the murine wt1 locus which should prove useful for the cloning of various constructs designed for the generation of mouse models. Prompted by the existence of a WT1 antisense transcript in humans we also examined strand-specific transcription at the murine wt1 locus. Our analysis suggests that there is no detectable antisense transcription of sequences within or immediately downstream of wt1 exon 1. We find, however, evidence for a divergent transcript which encompasses sequences at and around minor transcriptional initiation sites of wt1 and which is transcribed in the opposite direction. Despite the very high degree of similarity between the human and the murine wt1 sequence and expression as well as the presence of divergent transcripts in both cases, the existence of antisense transcription does not seem to be conserved between the two species. q 2001 Elsevier Science B.V. All rights reserved. Keywords: Zinc finger protein; Antisense transcription; Genomic structure; Exon/intron boundaries; Evolutionary conservation
1. Introduction The Wilms tumor suppressor gene WT1 (wt1 in the mouse) encodes a zinc finger transcription factor whose inactivation leads to a variety of human diseases. In addition to Wilms tumor, a pediatric kidney cancer (Call et al., 1990; Gessler et al., 1990), these diseases involve WAGR (Wilms tumor, aniridia, genitourinary abnormalities, mental retardation), and Denys-Drash and Frasier syndrome (Riccardi et al., 1978; Pelletier et al., 1991a; Barbaux et al., 1997; Kikuchi et al., 1998; Klamt et al., 1998). Among other phenotypes these syndromes are characterized by urogenital malformations. The major sites of WT1 expression include the developing kidney, the stromal cells of the gonads and spleen and the Abbreviations: ASI and II, alternatively spliced sequences I and II; bp, base pair(s); cDNA, DNA complementary to RNA; cpm, counts per minute; kb, kilobase(s); kDa, kilodalton(s); PAC, P1 artificial chromosome; PIPES, 1,4-piperazinediethanesulfonic acid; RNase, ribonuclease; RT, reverse transcriptase; SDS, sodium dodecyl sulfate; tRNA, transfer RNA; WAGR, Wilms tumor, aniridia, genitourinary abnormalities, mental retardation; WIT-1, Wt1 antisense transcript; Wt1, Wilms tumor suppressor gene 1; YAC, yeast artificial chromosome * Corresponding author. Tel.: 149-7247-823444; fax: 149-7247823354. E-mail address: [email protected] (C. Englert).
mesothelial cells that line the heart, diaphragm and peritoneum (Pritchard-Jones et al., 1990; Armstrong et al., 1992; Rackley et al., 1993). The factors which are responsible for the very specific spatial and temporal expression pattern of WT1 have not yet been defined. WT1, which is encoded by ten exons, is expressed as a 36–62 kDa protein family that arises because of three alternative sites of translation initiation and two alternative splicing events (Haber et al., 1991; Bruening and Pelletier, 1996; Scharnhorst et al., 1999). Alternative splice I comprises exon 5, which encodes 17 amino acids in the central part of the protein. Alternative splice II results from use of an alternative splice donor sequence between exons 9 and 10. Its insertion leads to three additional amino acids (the KTS sequence) that disrupt the spacing between the last two of the four zinc fingers. In order to analyze the physiological function of wt1, a number of mouse models have been generated. In a first approach both copies of wt1 have been deleted from the germline of mice (Kreidberg et al., 1993). Wt1 2/2 animals die at embryonic stage 13.5–15.5 and show an absence of kidney and gonad development. These studies have recently been extended and it has been shown that the time point of embryonic lethality of wt1 mutant embryos depends on the
0378-1119/01/$ - see front matter q 2001 Elsevier Science B.V. All rights reserved. PII: S 0378-111 9(01)00757-0
120
Y. Gong et al. / Gene 279 (2001) 119–126
mouse strain used. In addition, an essential role for wt1 in the development of the spleen has been described (Herzer et al., 1999). In an alternative series of experiments the generation of YAC transgenic mice has been employed. Using this technique it was shown that 470 and 280 kb YAC transgenes containing the human WT1 locus were able to recapitulate the endogenous wt1 expression pattern (Moore et al., 1998). The same YAC transgenes were used to complement wt1 knockout mice (Moore et al., 1999). These experiments revealed further functions for wt1 in the development of the heart, specifically the epicardium, as well as in the adrenal glands. Attempts to overexpress wt1 have so far failed (Menke et al., 1998). While expression of a form of wt1 which encodes a truncated wt1 protein did show features which are characteristic of patients with the respective mutation, a mouse line carrying this mutation could not be established (Patek et al., 1999). Clearly the generation of more animal models is required in order to gain further insights into the physiological function of wt1. One interesting feature relating to WT1 expression is the existence of an antisense transcript. Upon characterization of the human Wilms tumor locus on chromosome 11p13 the existence of two genes, WT1 and WIT-1, which are divergently transcribed from one promoter region was noted (Huang et al., 1990). WIT-1 does not contain an open reading frame of significant length. Both genes are expressed in the same temporal and tissue-specific pattern. In addition, cDNAs have been described which are transcribed in an antisense orientation with regard to WT1, contain parts of the WT1 coding region and extend into intron 1 of WT1 (Eccles et al., 1994; Malik et al., 1995). It has been postulated that the antisense transcript might regulate WT1 expression levels (Moorwood et al., 1998; Malik et al., 2000). The mouse wt1 locus has not yet been characterized to the same extent. In this report we describe the genomic structure of the mouse wt1 locus including the positions of exons/introns as well as a restriction map. This should facilitate the generation of future mouse models which are needed to analyze the function of wt1 in vivo. We also demonstrate the existence of a divergent transcript which includes sequences immediately adjacent to the 5 0 -end of the wt1 gene. The analysis of different mouse tissues and cell lines suggests that, like with human WT1, this transcript is expressed in wt1-expressing cells and tissues and absent where wt1 is not transcribed. In contrast to the situation in humans, however, in mouse this transcript does not significantly overlap with wt1 and is therefore most likely not involved in the regulation of wt1 expression.
2. Materials and methods 2.1. Identification and characterization of a genomic clone harboring the mouse wt1 gene A probe covering exons 2–10 from the mouse wt1 cDNA
was used to screen a mouse genomic library (RPCI 21 Mouse PAC) provided by the RZPD (Resource Center/ Primary Database, Heidelberg, Berlin). This library contained inserts of approximately 140 kb derived from genomic DNA from the spleen of female mice (strain: 129/SvevTACfBr) in the vector pPAC4. Southern Blotting and PCR analysis confirmed the presence of exons 1 and 10 of wt1 in all eight clones which were obtained. One of the clones was then used to analyze the wt1 locus in more detail. Characterization was done using a combination of restriction enzyme digestion, Southern Blotting, subcloning and sequencing. In order to identify the sequences surrounding exon/intron junctions exon-anchored primers were designed. As a basis for the primer design the mouse cDNA sequence of wt1 (Buckler et al., 1991) as well as the exon/intron structure of human WT1 were used (Haber et al., 1991). For the amplification of longer PCR products (introns 1, 3, 5, 6, 7 and 9) the Elongase enzyme mix (GibcoBRL) was used. 2.2. Isolation of RNA Preparation of total RNA was done using the TRIzol reagent (GibcoBRL) following the recommendations of the manufacturer. Briefly, tissues were isolated from 5day-old mice, snap-frozen in liquid nitrogen and resuspended in 1 ml TRIzol. Homogenization was done by passing the suspension several times through a 26G needle. After chloroform extraction, RNA was precipitated by adding 500 ml isopropanol, centrifuged, washed once with 80% ethanol and resuspended in sterile water. 2.3. RT-PCR analysis For RT-PCR analysis polyadenylated RNA was prepared using the mini-mRNA purification system (Qiagen). Firststrand cDNA synthesis was done using 0.5 mg of the RNA preparation with SuperScript reverse transcriptase (GibcoBRL) in the presence of 100 ng oligo-dT15 primers in a volume of 20 ml. For PCR analysis an aliquot of 2 ml of the RT reaction was used. The wt1 intron 1-specific primers were CTGAAGAAGCGGCAGGGAAG and AGCAGGTCGCGGAGCCACTA. 2.4. RNase protection RNase protection was carried out according to Current Protocols of Molecular Biology (Ausubel et al., 1989). Genomic wt1 fragments encompassing nucleotides 2124 to 1118 (probe 1) and 1723 to 11152 (probe 2) (Pelletier et al., 1991b) were amplified by PCR, subcloned into the vector pGEM-Teasy (Promega) and verified by sequencing. A third fragment contained 550 bp starting at position 1014 and extending into intron 1 (probe 3). To generate labeled probes, plasmid templates were linearized by restriction enzyme digestion and reverse transcribed with SP6 or T7 RNA polymerase in the presence of [ 32P]UTP. Probes (50 ml
Y. Gong et al. / Gene 279 (2001) 119–126
121
Fig. 1. Genomic organization of the murine wt1 gene. (A) Schematic representation of the murine wt1 gene (top) and a map of restriction enzyme sites (bottom). Exons are boxed, and the shaded region indicates the translated sequence. The main initiation codon, the two alternative initiation codons as well as the termination codon are indicated. ASI and ASII denote the two alternatively spliced sequences. (B) Determination of the wt1 intron sizes. The nine introns of the murine wt1 locus were amplified by PCR and separated on an agarose gel. M1, 1 kb marker; M2, 100 bp marker.
122
Y. Gong et al. / Gene 279 (2001) 119–126
Table 1 Comparison of intron sizes of the wt1 locus in man, mouse and the pufferfish Fugu rubripes a Intron #
Human
Mouse
Pufferfish
1 2 3 4 5 6 7 8 9
6.080 0.438 10.301 1.036 16.445 3.540 3.501 0.601 2.792
5.7 0.6 10.5 1.15 2.0 3.7 2.2 0.95 2.3
1.538 0.462 0.912 0.216 0.084 0.085 0.495 0.142
a Data regarding human WT1 are taken from GenBank (Accession number: AL138811), mouse data are from this paper and the information on pufferfish wt1 is based on the published sequence (Miles et al., 1998). Note that human and mouse wt1 comprise ten exons, whereas Fugu wt1 consists of only nine exons. The alternatively spliced exon 5 is missing. Exons 7–10 in human and mouse wt1 correspond to exons 6–9 in Fugu wt1 and encode the four zinc fingers of the protein. Sizes are given in kilobases.
volume) were precipitated three times with 200 ml of 2.5 M ammonium acetate and 750 ml of 100% ethanol before they were used in hybridization reactions. For RNA:RNA hybridization a 30 ml reaction containing 5 £ 10 5 cpm of probe and 30 mg of total RNA was incubated in hybridization buffer (80% deionized formamide, 40 mM PIPES (pH 6.4), 400 mM NaCl and 1 mM EDTA). Control samples contained 30 mg of bacterial tRNA. Hybridization reactions were incubated at 458C overnight and subsequently digested with RNase A and T1 in 10 mM Tris–HCl (pH 7.5), 300 mM NaCl, 5 mM EDTA for 1 h at 308C. Samples were deproteinized by SDS/Proteinase K treatment and RNA hybrids were recovered by ethanol precipitation. Products were separated by electrophoresis using a denaturing 6% polyacrylamide gel and visualized by autoradiography.
3. Results and discussion 3.1. Genomic organization of the murine wt1 gene Until now the wt1 loci of two species, namely human (Tadokoro et al., 1992; GenBank Accession number: AL138811) and Fugu (Miles et al., 1998), have been characterized. We have used a PAC (P1 artificial chromosome) clone to characterize the murine wt1 locus (Fig. 1A). The overall structure and organization of the murine wt1 locus is very similar to the human counterpart. In both cases the genomic locus encompasses ten exons. Exon 5 as well as an extension of three amino acids (KTS) at the end of exon 9 are subject to alternative splicing (Haber et al., 1991). This is different in Fugu where the exon 5 sequence is missing and the KTS tripeptide is replaced by KPS (Miles et al., 1998). With regard to the size of the introns (Fig. 1B and Table 1) it is interesting to note that whereas most murine and human wt1 introns have a very similar length, intron 5 is
an exception. In the human WT1 locus, intron 5 spans more than 16 kb and is the largest intron. In the murine wt1 locus, intron 5 encompasses only 2 kb. The discrepancy in the size of intron 5 is the main reason for the difference in length between the murine and the human Wt1 gene of 32.6 and 47.0 kb, respectively. The size of the Fugu wt1 locus is 5.2 kb which represents a nine-fold reduction compared to the human WT1 gene. Intronic sequences at the exon/intron and intron/exon junctions of the murine wt1 locus were determined using exon-anchored primers (Fig. 2). All wt1 introns start with GT and end with AG, and sequences adjacent to the splice sites are in good agreement with the consensus splice rule (Senapathy et al., 1990). We have used the available data concerning the wt1 cDNA as well as our own analysis of the wt1 genomic locus to assemble a comprehensive restriction map (Fig. 1A) which should prove useful for the generation of constructs based on the murine wt1 sequence. 3.2. Characterization of a divergent transcript at the wt1 locus In humans two transcripts have been mapped to the WT1 locus which are expressed in the same spatial and temporal pattern (Huang et al., 1990). The primary transcript, WT1, acts as a tumor suppressor and encodes a zinc finger transcription factor (Call et al., 1990; Gessler et al., 1990). The second transcript, WIT-1, does not harbor a significantly long open reading frame and is transcribed in the opposite direction with regard to WT1. Multiple transcriptional start sites have been reported for WIT-1, some of which show significant overlap with the 5 0 region of WT1 (Campbell et al., 1994; Eccles et al., 1994). Prompted by the high degree of sequence conservation between human and mouse wt1, as well as by the very similar expression pattern, we wanted to examine whether similar antisense wt1 transcription also exists in the mouse. We have therefore performed RNase protection analysis using three different genomic fragments. Three different transcriptional start sites have been reported for wt1 (Pelletier et al., 1991b). The major site is located at position 1337 and two minor sites are at positions 11 and 125. The probes for the RNase protection experiment were located either at the 5 0 end (probe 1), within exon 1 (probe 2) or encompassing the junction between exon 1 and intron 1 of the wt1 gene (probe 3; see Fig. 3A). As a source for the RNA we have used various tissues from 5-day-old mice as well as two cell lines. The mouse mesonephric cell line M15 has been shown to express significant endogenous wt1 mRNA levels (Larsson et al., 1995). As a negative control, LB cells derived from a murine T cell lymphoma were used (Zahalka et al., 1993) which do not show any wt1 expression (data not shown). The results from the RNase protection analysis can be seen in Fig. 3. A sense probe 1 (with regard to wt1 transcrip-
Y. Gong et al. / Gene 279 (2001) 119–126
123
Fig. 2. Exon/intron junctions of the murine wt1 gene. Nucleotide numbering begins with the first nucleotide of the published sequence (Buckler et al., 1991). Exonic and the corresponding amino acid sequences are shown in upper case letters, and intronic sequences are in lower case letters. Consensus 5 0 -donor and 3 0 -acceptor splice site residues are underlined. The alternatively spliced sequences are shown in italics.
tion) detected a transcript of approximately 240 bases, indicating full protection of the probe. Interestingly, a signal could be seen in RNA from the kidney, the spleen (see inset) as well as from M15 cells (Fig. 3B, top). This is the pattern which would be expected from wt1 expression.
When the probe was used in the antisense orientation, however, no specific signal could be detected (Fig. 3B, bottom). This suggests the existence of a transcript which is transcribed into the opposite direction from wt1 and encompasses the minor transcriptional initiation sites of
124
Y. Gong et al. / Gene 279 (2001) 119–126
Fig. 3. Characterization of a divergent transcript at the wt1 locus. (A) Schematic representation of the wt1 promoter region. Right-angled arrows indicate minor (11 and 125) and major (1337) wt1 transcriptional start sites (Pelletier et al., 1991b). The arrow at position 723 denotes the major start site of wt1 translation. The positions of the probes are indicated. (B–D) RNase protection analysis of the wt1 promoter region. Single-stranded RNA probes were used representing the sense (upper) or the antisense (lower) orientation (with regard to the direction of wt1 transcription) of probes 1 (B), 2 (C) and 3 (D). Due to the use of restriction enzymes for linearization of the template plasmids all six probes contain sequences of variable length which is not complementary to the genomic wt1 sequence. Total RNA from the mouse tissues indicated as well as from cell lines was hybridized with the probes and processed as described. After RNase digestion the sense probe 1 detects a specific signal in kidney, spleen (better seen on the longer exposure shown on top) and M15 cells. No specific signal can be seen with the sense probes 2 and 3. The reciprocal is true for use of the antisense probes. Specific signals are marked by arrowheads. A 100 bp DNA ladder was used to estimate the size of the protected fragments.
wt1. In this experiment we were, however, not able to detect wt1 transcription which is probably due to a lack of sensitivity. Alternatively the different tissues which served as a source for the RNA analyzed (data in the literature are based on RNA isolated from testis and ovary) could serve as an explanation for this discrepancy. When we used probes 2 and 3 (Fig. 3C,D) which cover exonic and intronic wt1 sequences further downstream from the transcriptional start site the antisense probes detected wt1 transcripts in kidney, spleen and M15 cells. In this case there was no evidence to suggest the existence of an antisense transcript. This suggests that in this genomic area only one strand, namely the sense strand (wt1), is transcribed. The length of the various fragments detected by the antisense probe 3 (Fig. 3D, bottom) suggests that the RNA preparation contained significant amounts of non-spliced wt1 mRNA.
This was also confirmed by RT-PCR analysis using intron 1specific primers (data not shown). Our analysis of the transcription of the 5 0 end of the murine wt1 locus demonstrates the existence of two divergent transcripts. In addition to wt1 there is a second mRNA which encompasses sequences overlapping with the reported 5 0 end of a minor portion of wt1 transcripts. This second transcription unit is transcribed in the opposite direction relative to the wt1 gene. We found no evidence for the existence of a true antisense transcription, i.e. a significant overlap of transcription units containing the same sequences but transcribed in opposite directions. The absence of an antisense transcript in the area of the wt1 exon 1/intron 1 boundary is different from the situation with the human WT1 locus for which such an antisense transcript has been reported (Campbell et al., 1994; Eccles et al., 1994; Moor-
Y. Gong et al. / Gene 279 (2001) 119–126
wood et al., 1998). It has been speculated that the antisense WT1 transcript might serve to regulate WT1 expression at the RNA and protein level (Moorwood et al., 1998; Malik et al., 2000). Our data suggest that at least in the mouse, antisense transcription is not a mechanism which regulates wt1 expression levels. It is curious that the divergent transcript in the mouse as well as WIT-1 in human is expressed in the same spatiotemporal pattern as the Wt1 transcripts. If this does not have a functional role, might this be a reflection of processes at the Wt1 locus? Obviously the expression of a gene like Wt1 with a defined role during development needs to be exquisitely regulated. In most organs and at most times the status of Wt1 gene expression is ‘off’. Activation of Wt1 transcription is very likely accompanied by changes in chromatin structure. This process usually involves a decondensation of the nucleosomes and results in increased accessibility of target sequences. Conceivably this loosening of the chromatin could in turn lead to the activation of cryptic promoter sequences which are also contained within this chromatin domain. Whether this is indeed the case or whether the existence of a divergent transcription unit has a functional role can only be determined once mouse models are generated which lack expression of the divergent transcript. Acknowledgements We are grateful to Dagmar Wilhelm and Jonathan Sleeman for reading and improving this manuscript. We would like to thank Dagmar Wilhelm for providing us with the wt1 exon 1-specific probe and Birgit Besenbeck and Nathalie Decker for their excellent technical help. This work was supported by a PhD scholarship from the Forschungszentrum Karlsruhe to Y.G. and a grant from the Deutsche Forschungsgemeinschaft (En 280/2-4) to C.E. References Armstrong, J.F., Pritchard-Jones, K., Bickmore, W.A., Hastie, N.D., Bard, J.B., 1992. The expression of the Wilms’ tumour gene, WT1, in the developing mammalian embryo. Mech. Dev. 40, 85–97. Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., Struhl, K., 1989. Current Protocols in Molecular Biology, Wiley, New York. Barbaux, S., Niaudet, P., Gubler, M.C., Grunfeld, J.P., Jaubert, F., Kuttenn, F., Fekete, C.N., Souleyreau-Therville, N., Thibaud, E., Fellous, M., McElreavey, K., 1997. Donor splice-site mutations in WT1 are responsible for Frasier syndrome. Nat. Genet. 17, 467–470. Bruening, W., Pelletier, J., 1996. A non-AUG translational initiation event generates novel WT1 isoforms. J. Biol. Chem. 271, 8646–8654. Buckler, A.J., Pelletier, J., Haber, D.A., Glaser, T., Housman, D.E., 1991. Isolation, characterization, and expression of the murine Wilms’ tumor gene (WT1) during kidney development. Mol. Cell. Biol. 11, 1707– 1712. Call, K.M., Glaser, T., Ito, C.Y., Buckler, A.J., Pelletier, J., Haber, D.A., Rose, E.A., Kral, A., Yeger, H., Lewis, W.H., et al., 1990. Isolation and characterization of a zinc finger polypeptide gene at the human chromosome 11 Wilms’ tumor locus. Cell 60, 509–520.
125
Campbell, C.E., Huang, A., Gurney, A.L., Kessler, P.M., Hewitt, J.A., Williams, B.R., 1994. Antisense transcripts and protein binding motifs within the Wilms tumour (WT1) locus. Oncogene 9, 583–595. Eccles, M.R., Grubb, G., Ogawa, O., Szeto, J., Reeve, A.E., 1994. Cloning of novel Wilms tumor gene (WT1) cDNAs; evidence for antisense transcription of WT1. Oncogene 9, 2059–2063. Gessler, M., Poustka, A., Cavenee, W., Neve, R.L., Orkin, S.H., Bruns, G.A., 1990. Homozygous deletion in Wilms tumours of a zinc-finger gene identified by chromosome jumping. Nature 343, 774–778. Haber, D.A., Sohn, R.L., Buckler, A.J., Pelletier, J., Call, K.M., Housman, D.E., 1991. Alternative splicing and genomic structure of the Wilms tumor gene WT1. Proc. Natl. Acad. Sci. USA 88, 9618–9622. Herzer, U., Crocoll, A., Barton, D., Howells, N., Englert, C., 1999. The Wilms tumor suppressor gene wt1 is required for development of the spleen. Curr. Biol. 9, 837–840. Huang, A., Campbell, C.E., Bonetta, L., McAndrews-Hill, M.S., ChiltonMacNeill, S., Coppes, M.J., Law, D.J., Feinberg, A.P., Yeger, H., Williams, B.R., 1990. Tissue, developmental, and tumor-specific expression of divergent transcripts in Wilms tumor. Science 250, 991–994. Kikuchi, H., Takata, A., Akasaka, Y., Fukuzawa, R., Yoneyama, H., Kurosawa, Y., Honda, M., Kamiyama, Y., Hata, J., 1998. Do intronic mutations affecting splicing of WT1 exon 9 cause Frasier syndrome? J. Med. Genet. 35, 45–48. Klamt, B., Koziell, A., Poulat, F., Wieacker, P., Scambler, P., Berta, P., Gessler, M., 1998. Frasier syndrome is caused by defective alternative splicing of WT1 leading to an altered ratio of WT1 1/-KTS splice isoforms. Hum. Mol. Genet. 7, 709–714. Kreidberg, J.A., Sariola, H., Loring, J.M., Maeda, M., Pelletier, J., Housman, D., Jaenisch, R., 1993. WT-1 is required for early kidney development. Cell 74, 679–691. Larsson, S.H., Charlieu, J.P., Miyagawa, K., Engelkamp, D., Rassoulzadegan, M., Ross, A., Cuzin, F., van Heyningen, V., Hastie, N.D., 1995. Subnuclear localization of WT1 in splicing or transcription factor domains is regulated by alternative splicing. Cell 81, 391–401. Malik, K.T., Wallace, J.I., Ivins, S.M., Brown, K.W., 1995. Identification of an antisense WT1 promoter in intron 1: implications for WT1 gene regulation. Oncogene 11, 1589–1595. Malik, K., Salpekar, A., Hancock, A., Moorwood, K., Jackson, S., Charles, A., Brown, K.W., 2000. Identification of differential methylation of the WT1 antisense regulatory region and relaxation of imprinting in Wilms’ tumor. Cancer Res. 60, 2356–2360. Menke, A., McInnes, L., Hastie, N.D., Schedl, A., 1998. The Wilms’ tumor suppressor WT1: approaches to gene function. Kidney Int. 53, 1512– 1518. Miles, C., Elgar, G., Coles, E., Kleinjan, D.J., van Heyningen, V., Hastie, N., 1998. Complete sequencing of the Fugu WAGR region from WT1 to PAX6: dramatic compaction and conservation of synteny with human chromosome 11p13. Proc. Natl. Acad. Sci. USA 95, 13068– 13072. Moore, A.W., Schedl, A., McInnes, L., Doyle, M., Hecksher-Sorensen, J., Hastie, N.D., 1998. YAC transgenic analysis reveals Wilms’ tumour 1 gene activity in the proliferating coelomic epithelium, developing diaphragm and limb. Mech. Dev. 79, 169–184. Moore, A.W., McInnes, L., Kreidberg, J., Hastie, N.D., Schedl, A., 1999. YAC complementation shows a requirement for Wt1 in the development of epicardium, adrenal gland and throughout nephrogenesis. Development 126, 1845–1857. Moorwood, K., Charles, A.K., Salpekar, A., Wallace, J.I., Brown, K.W., Malik, K., 1998. Antisense WT1 transcription parallels sense mRNA and protein expression in fetal kidney and can elevate protein levels in vitro. J. Pathol. 185, 352–359. Patek, C.E., Little, M.H., Fleming, S., Miles, C., Charlieu, J.P., Clarke, A.R., Miyagawa, K., Christie, S., Doig, J., Harrison, D.J., Porteous, D.J., Brookes, A.J., Hooper, M.L., Hastie, N.D., 1999. A zinc finger truncation of murine WT1 results in the characteristic urogenital
126
Y. Gong et al. / Gene 279 (2001) 119–126
abnormalities of Denys-Drash syndrome. Proc. Natl. Acad. Sci. USA 96, 2931–2936. Pelletier, J., Bruening, W., Li, F.P., Haber, D.A., Glaser, T., Housman, D.E., 1991a. WT1 mutations contribute to abnormal genital system development and hereditary Wilms’ tumour. Nature 353, 431–434. Pelletier, J., Schalling, M., Buckler, A.J., Rogers, A., Haber, D.A., Housman, D., 1991b. Expression of the Wilms’ tumor gene WT1 in the murine urogenital system. Genes Dev. 5, 1345–1356. Pritchard-Jones, K., Fleming, S., Davidson, D., Bickmore, W., Porteous, D., Gosden, C., Bard, J., Buckler, A., Pelletier, J., Housman, D., et al., 1990. The candidate Wilms’ tumour gene is involved in genitourinary development. Nature 346, 194–197. Rackley, R.R., Flenniken, A.M., Kuriyan, N.P., Kessler, P.M., Stoler, M.H., Williams, B.R., 1993. Expression of the Wilms’ tumor suppressor gene WT1 during mouse embryogenesis. Cell Growth Differ. 4, 1023–1031.
Riccardi, V.M., Sujansky, E., Smith, A.C., Francke, U., 1978. Chromosomal imbalance in the Aniridia-Wilms’ tumor association: 11p interstitial deletion. Pediatrics 61, 604–610. Scharnhorst, V., Dekker, P., van der Eb, A.J., Jochemsen, A.G., 1999. Internal translation initiation generates novel WT1 protein isoforms with distinct biological properties. J. Biol. Chem. 274, 23456–23462. Senapathy, P., Shapiro, M.B., Harris, N.L., 1990. Splice junctions, branch point sites, and exons: sequence statistics, identification, and applications to genome project. Methods Enzymol. 183, 252–278. Tadokoro, K., Oki, N., Fujii, H., Ohshima, A., Inoue, T., Yamada, M., 1992. Genomic organization of the human WT1 gene. Jpn. J. Cancer Res. 83, 1198–1203. Zahalka, M.A., Okon, E., Naor, D., 1993. Blocking lymphoma invasiveness with a monoclonal antibody directed against the beta-chain of the leukocyte adhesion molecule (CD18). J. Immunol. 150, 4466–4477.