- Email: [email protected]
flmD gene cluster of Helicobacter pylori is involved in flagellar biosynthesis and flagellin glycosylation
FEMS Microbiology Letters 210 (2002) 165^172
www.fems-microbiology.org
The neuA/£mD gene cluster of Helicobacter pylori is involved in £agellar biosynthesis and £agellin glycosylation Christine Josenhans a
a;b;1;
, Lutz Vossebein 1;2;b , Susanne Friedrich b , Sebastian Suerbaum a;b
Institut fu«r Hygiene und Mikrobiologie der Universita«t Wu«rzburg, Josef-Schneider-Strasse 2, D-97080 Wu«rzburg, Germany b Abteilung fu«r Medizinische Mikrobiologie der Ruhr-Universita«t Bochum, D-44780 Bochum, Germany Received 10 December 2001; received in revised form 7 February 2002; accepted 14 February 2002 First published online 25 April 2002
Abstract Helicobacter pylori possesses a gene (HP0326/JHP309) homologous to neuA of other bacteria, encoding a cytidyl monophosphate-Nacetylneuraminic acid synthetase-homologous enzyme in its N-terminal portion. We analysed the function of this gene, which is controlled by a flagellar class 2 c54 promoter, in flagellar biosynthesis. HP0326/JHP309 actually represents a bicistronic operon consisting of a neuA and a flmD-like putative glycosyl transferase gene. An isogenic flmD mutant synthesized basal bodies but no filaments, was non-motile, and expressed severely reduced amounts of a FlaA flagellin of reduced molecular mass. FlaA flagellin was found to be glycosylated in its exported form within the flagellar filament, but not inside the cytoplasm. Glycosylated FlaA was not detectable in the flmD mutant. Together with other genes in the H. pylori genome, a proposed function of the neuA/flmD gene products could be to provide a pathway for glycosylation of flagellin and other extracytoplasmic molecules during type III secretion. : 2002 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Flagellum; Flagellin ; Protein glycosylation ; Type III secretion system; Polysaccharide synthesis; RpoN ; Helicobacter pylori
1. Introduction Helicobacter pylori has an unusual pathway of £agellar biosynthesis and a unique £agellar structure. Flagellar ¢laments consist of two di¡erent £agellins, FlaA and FlaB, and are enveloped by a membranous £agellar sheath [1^3]. Sequencing of two H. pylori genomes revealed genes that are homologous to extracytoplasmic glycosylation enzymes, which play a role in capsule biosynthesis in other bacteria [4^7]. H. pylori has not been observed to express a capsule, but the £agellin proteins contain a number of possible glycosylation sites (serine and threonine residues) and ‘eucaryotic glycosylation motifs’ (N-X-T or N-X-S).
* Corresponding author, at address a. Tel.: +49 (931) 201 46905; Fax : +49 (931) 201 46445. E-mail address : [email protected] (C. Josenhans). 1
The authors C.J. and L.V. contributed equally to this work. Present address: Institute for Physiological Chemistry, RuhrUniversita«t Bochum, D-44780 Bochum, Germany. 2
In several other eubacterial species, £agellins contain glycosyl moieties in their mature assembled and polymeric state, a posttranslational modi¢cation likely to occur concomitantly with secretion by the £agellar type III secretion machinery. Pseudomonas aeruginosa synthesizes glycosylated £agellin subunits [8] and Campylobacter species possess enzymes that can modify £agellins or lipooligosaccharides by adding glycosyl residues [9^12]. However, the role of £agellin glycosylation in di¡erent bacteria is still incompletely understood. Glycosylation of £agellin subunits in Campylobacter most likely plays a role in antigenic variation of the £agellar surface [12]. Campylobacter £agellar ¢laments are exposed to the outer milieu, whereas Helicobacter £agellar ¢laments are not, because they are shielded from antibody by a membranous sheath. However, £agellins in Helicobacter felis have been found to be glycosylated despite the presence of a £agellar sheath [13]. The function of several genes in the H. pylori genome that encode enzymes with a putative role in protein glycosylation has not been investigated so far [4,5]. We hypothesized that some of them could be involved in glycosylation of £agellin subunits. The product of one gene, neuA
0378-1097 / 02 / $22.00 : 2002 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. PII : S 0 3 7 8 - 1 0 9 7 ( 0 2 ) 0 0 6 3 8 - 9
FEMSLE 10458 23-5-02
166
C. Josenhans et al. / FEMS Microbiology Letters 210 (2002) 165^172
(HP0326/JHP309), shows the most pronounced homology to Escherichia coli NeuA and Campylobacter PtmB, both of which are cytidine monophosphate-N-acetylneuraminic acid synthetases (neuraminate-cytidylyl synthetase, CMPNANA synthetase). Homologous enzymes are involved in the biosynthesis of a sialic acid-containing capsule in E. coli and Neisseria meningitidis [14,15], and in the posttranslational glycosylation of £agellins, respectively [9]. These data prompted us to look more closely at the function of the putative H. pylori neuA gene.
2. Materials and methods 2.1. Bacterial strains and culture conditions H. pylori strains N6 and 88-3887 (motile variant of 26695 [16]) were used. Culture conditions were as described [17]. Motility of the strains was assayed using a single colony testing method in semisolid motility agar medium [16], to which selective antibiotics were added as required. E. coli strains used for cloning were DH5K and TG1. 2.2. General techniques of molecular cloning and protein analysis DNA puri¢cation, DNA manipulation and cloning procedures were done according to standard protocols. PCR were run in a Perkin-Elmer thermocycler using Amersham Taq polymerase or the Expand High Fidelity1 Kit (Roche) for longer fragments ( s 2 kb), or if high ampli¢cation accuracy for protein expression was required. Protein analysis was done using denaturing 12% SDS^polyacrylamide gels [18] and Western immunoblot detection according to Towbin [19]. For immunolabelling £agellin proteins in Western blots, either rabbit antiserum AK179, raised against native puri¢ed H. pylori ¢laments [2], or rabbit antisera A and B, raised against recombinant FlaA (C-terminal half [16]) and recombinant FlaB (complete FlaB protein [16]) respectively, were used. Protein concentrations were determined using the Bradford assay [20]. H. pylori was transformed with plasmids by natural transformation [21] or electroporation [22]. H. pylori crude £agellar preparations and bacterial lysates were obtained as previously described [16]. 2.3. Cloning and mutagenesis of the H. pylori neuA/£mD gene cluster Using primers OLHPNANA1 (GTTCTCAATTGTATCTCCTGC ; forward) and OLHPNANA2 (ATTagatctGATTGCAACTTGCCCTTAAGC; reverse, BglII site underlined), a 3-kb fragment comprising the £gH, neuA and £aG genes was ampli¢ed from strain 26695. The fragment was cloned into the unique BglII site of plasmid
vector pILL570 (plasmid pSUS502). An EcoRI restriction site in the 5P portion of the H. pylori 26695 £mD gene (second half of the neuA gene in published 26695 sequence) was used to insert a kanamycin (km) resistance cassette (aphA3P-III). The resulting plasmid pSUS503 was transformed into H. pylori strains 26695 (motile variant 88-3887) and N6. Km-resistant colonies were selected and further characterized by PCR. 2.4. Complementation of the H. pylori neuA/£mD genes An approximately 1.55-kb genomic fragment, containing the complete H. pylori 26695 neuA/£mD genes including the putative c54 promoter region upstream from neuA was ampli¢ed using primers OLHPNANA3 (TCTTagatctCGCTAAGATTGAATACAAG) and OLHPNANA4 (TTTCagatctCTAAAAACTCCCTTAATGC), which contain BglII sites (underlined). The fragment was cloned into the E. coli/H. pylori shuttle vector pHel2 [23] using its unique BglII restriction site. The resulting plasmid pSUS505 was transformed into the H. pylori N6 £mD mutant strain by electroporation, and transformants were selected on chloramphenicol-containing plates. 2.5. Electron microscopy Electron microscopy was done on bacteria grown for 24 h on plates. Bacteria were transferred to EM copper grids coated with formvar and carbon, and negatively stained using 1% phosphotungstate pH 7.0. Grids were visualized in Zeiss EM10 or EM900 microscopes in transmission mode at an acceleration voltage of 80 keV. 2.6. Analysis of protein glycosylation Detection of glycosylated proteins was done using the DIG Glycan/Protein Double Labelling Kit (Roche) according to manufacturer’s protocol ‘A’. In protocol A, glycoproteins are labelled in a bu¡ered suspension before protein separation on SDS^PAGE and Western blotting are carried out. 10 Wg of each protein sample were treated ¢rst with sodium metaperiodate, followed by incubation in sodium disul¢te, and then treatment with DIG-hydrazide at room temperature in the presence of protease inhibitors (Complete1, EDTA-free, Roche Biochemicals). Then, the protein samples were concentrated in a speedvac to approximately 20-Wl volumes, SDS sample bu¡er was added and samples were run on a 12% SDS^PAGE. Detection on a Western blot membrane was done using anti-DIG antibodies coupled to horseradish peroxidase, and using the highly sensitive TETON substrate according to the manufacturer’s instructions. To detect proteins in addition to the glycosylated molecules, proteins were labelled with £uorescein directly on the blotting membrane and detected using anti-£uorescein antibodies coupled to alkaline phosphatase and the substrates INT and X-phosphate.
FEMSLE 10458 23-5-02
C. Josenhans et al. / FEMS Microbiology Letters 210 (2002) 165^172
167
Fig. 1. Similar genomic localization and arrangement of the £agella-associated neuA/£mD gene cluster in di¡erent bacterial species. The neuA-£mD-neuB genes are not present in all Aeromonas species, but exclusively in A. caviae. The C. crescentus genome contains four operons involved in £agellar modi¢cation. The H. hepaticus neuA/£mD gene cluster is interrupted by a 6-kb insertion between the neuA and £mD genes. H. hepaticus £mD is in a translational fusion with the downstream £mH gene. The homologous genes are marked with corresponding shading or hatching.
2.7. Lectin testing of H. pylori £agellin proteins The Roche Glycan di¡erentiation kit (lectin protein detection; see manufacturer’s manual) was utilized to further characterize the glycosidic modi¢cations. The kit contains ¢ve di¡erent DIG-labelled lectins : GNA (Galanthus nivalis agglutinin; speci¢c for terminal mannose residues), SNA (Sambucus nigra agglutinin ; speci¢c for terminal sialic acid, K2-6-linked to galactose), MAA (Maackia amurensis agglutinin; speci¢c for sialic acid, K2-3-linked to galactose), PNA (peanut agglutinin; speci¢c for the disaccharide galactose-L(1-3)-N-acetylgalactosamine), and DSA (Datura stramonium agglutinin ; speci¢c for the disaccharide galactose-L(1-4)-N-acetylneuraminic acid). The kit was used on Western blotted protein samples according to the manufacturer’s protocol. 10 Wg of each protein sample were used for analysis.
3. Results and discussion 3.1. Characterization of the H. pylori ‘neuA/£mD’ gene The gene product of HP0326 in the published H. pylori 26695 genome was originally annotated as NeuA, a CMPNANA synthetase. In its N-terminal half, the protein has signi¢cant homology with NeuA-like enzymes of other bacteria (alignment A in supplementary materials 1; http://www.hygiene.uni-wuerzburg.de/helico/supplementsFEMS2002.htm), notably the ptmB gene product of Campylobacter jejuni, which is involved in the posttranslational modi¢cation of Campylobacter £agellins [9,10]. However, the neuA derived protein consists of 517 amino acids (58.9 kDa), which is much larger than other known homologous CMP-NANA enzymes. Campylobacter PtmB comprises only 235 amino acids, and lacks the second half of the putative H. pylori NeuA protein. This second half of the NeuA protein shows signi¢cant homology to polysaccharide biosynthesis enzymes or proteins involved in £agellar biosynthesis and possibly £agellin glycosylation in di¡er-
ent bacteria (e.g. FlmD of Aeromonas sp., and Caulobacter crescentus [24,25], alignment B in supplementary materials 1; http://www.hygiene.uni-wuerzburg.de/helico/supplementsFEMS2002.htm). The exact function of the FlmDlike proteins is unknown. Closer analysis of the fully sequenced genome of strain J99 revealed that a neuA gene is present, but contains a frameshift at nucleotide 625 (JHP309; see http://scriabin.astrazeneca-boston.com/hpylori/). This frameshift splits JHP309 into two open reading frames (ORFs) (JHP309a and JHP309b), each starting with a regular methionine start codon (ATG). We resequenced the corresponding stretch of the H. pylori 26695 genome and found that strain 26695 also contains a frameshift (at nucleotide 625) within the previously described long neuA open reading frame. This separates the 517 amino acid ORF into two, the ¢rst of which is NeuA (amino acids 1^195, nucleotide position 687). The second ORF consists of 290 amino acids commencing at an ATG start codon at nucleotide 681. We propose that the second ORF be renamed FlmD, according to the current nomenclature in other bacteria. Several other bacterial species show a similar genomic colocalization of neuA and £mD, and there is also a conservation in gene order in the £mD cluster of H. pylori, Helicobacter hepaticus, Campylobacter sp., C. crescentus, and Aeromonas caviae; Fig. 1). The two genes neuA (CMP-sugar synthetase HP0326a) and £mD (glycosyl transferase-like gene HP0326b) overlap by seven nucleotides and are preceded by a c54 -like promoter (TGGAA-N6-ATGCC) located 25 bp upstream from the ATG start codon of neuA and well conserved in comparison with the E. coli and Bacillus subtilis consensus c54 promoters (TGGAA-N6-TTGCA). c54 is the typical promoter of class 2 £agellar genes in H. pylori [26] and transcription of neuA/£mD was dependent on the c54 (RpoN) sigma factor in whole transcriptome microarray analysis (Niehus and Josenhans, unpublished results). The two newly de¢ned genes have a conspicuous genomic localization between two other genes involved in the £agellar biosynthesis pathway, £gH, which encodes the L-ring protein of the £agellar basal body (HP0325/
FEMSLE 10458 23-5-02
168
C. Josenhans et al. / FEMS Microbiology Letters 210 (2002) 165^172
3.2. H. pylori £mD mutants make basal bodies, but lack £agellar hook and ¢lament, and are non-motile In order to elucidate a possible role of the putative glycosylation genes in £agellar biosynthesis, we constructed isogenic H. pylori mutants in the gene cluster. For inactivation, we chose the downstream £mD gene of the putative neuA/£mD operon to avoid polar e¡ects. Plasmid pSUS503 containing the complete £gH, neuA/£mD, and £aG(£mH) genes with an insertion of a km cassette into £mD (HP0326b) in the same transcriptional orientation as the gene was transformed into two H. pylori strains, N6 and 88-3887. Kanamycin-resistant mutants were obtained, and four mutants of each strain were shown by PCR using di¡erent primer combinations to have undergone double crossover allelic exchange. The phenotype of the mutants was ¢rst assessed by motility testing and electron microscopy (Fig. 2). The mutants did not show any motility in semisolid agar nor in microscopical analysis of wet mounts. FlmD function appears to be related to assembly of late £agellar structures (hook and ¢lament) as the mutants had no hooks and ¢laments, but regularly displayed approximately three to four £agellar basal bodies and straight short rod-like structures (Fig. 2B). 3.3. H. pylori £mD mutants express a FlaA £agellin of reduced molecular mass
Fig. 2. Electron micrographs (transmission EM) of the H. pylori N6 wild-type strain (A), H. pylori £mD mutant (B), and transcomplemented N6 £mD (pSUS505) strain (C). Bacteria were grown on blood plates for 24 h. Bars equal 0.5 Wm. Note basal body/rod structures of the £mD mutant (arrow).
JHP308), and £aG/£mH (HP0327/JHP310), a gene whose function is unknown, but which is similar to a gene £mH necessary for £agellar assembly in C. crescentus [25,27]. These observations prompted us to study the function of the neuA/£mD genes in H. pylori, and the possible implications of the derived proteins for £agellar biosynthesis.
We next analysed the amount of £agellin in the sheared material and cytoplasm of the bacteria by Western immunoblotting (Fig. 3). Using antiserum AK179 against native £agella, we found no trace of FlaA and FlaB £agellins in the material mechanically sheared from the £mD mutant or in the £mD mutant’s cytoplasm (not shown). The wildtype bacteria contained the usual large amounts of FlaA and less FlaB in the sheared material, and small amounts of both £agellins in cytoplasmic lysates after shearing of extracellular appendages. Wild-type FlaB displayed a signi¢cantly lower molecular mass in the cytoplasm compared with the £agellar preparations (Figs. 3 and 4). Using antisera against recombinant FlaA and FlaB, one FlaAspeci¢c protein band (FlaA*) that was smaller than native FlaA (approx. 51 kDa compared to 53 kDa of native FlaA; Fig. 3, lane 3) was visible in sheared material and lysates of the £mD mutant ; this band was not present in the wild-type strain (Fig. 3). In addition, a very faint band of 53-kDa FlaA £agellin was sometimes detected (Fig. 4, lane 2). The data indicate that the H. pylori £mD mutants are able to produce and release small amounts of FlaA* £agellin subunits, which are apparently unable to polymerize into ¢laments and are detectable as a 51-kDa product. Caulobacter mutants defective in £mD have been reported to produce a truncated 22-kDa form of the 25-kDa £agellin [25]. It seems most likely that the 51-kDa FlaA* protein is a truncated species of FlaA, but it is also possible that the smaller size is due a lack of glycosylation, as
FEMSLE 10458 23-5-02
C. Josenhans et al. / FEMS Microbiology Letters 210 (2002) 165^172
169
Fig. 3. Western immunoblot developed with antisera raised against recombinant FlaA and FlaB of H. pylori. Lanes: 1^4, £agellar preparations (15 Wg of protein loaded in each lane); 5^8, whole cell lysates (40 Wg of protein loaded); 1 and 8, H. pylori £aA/£aB double mutant; 2 and 7, H. pylori N6 wild-type strain; 3 and 5, H. pylori £mD mutant; 4 and 6, H. pylori £mD (pSUS505), neuA/£mD complementation strain. FlaA* is the FlaA-reactive band of 51 kDa in the sheared material and cytoplasm of the £mD mutant.
has been described for Campylobacter [28] and P. aeruginosa [29]. FlaB was not detected in any of the protein preparations of the £mD mutant (Fig. 3). 3.4. The negative £agellar phenotype of H. pylori £mD mutants can be complemented by neuA/£mD in trans To ascertain that the negative £agellar phenotype of the £mD mutants was not due to a polar e¡ect on downstream genes such as £mH, we complemented the mutant in H. pylori. An E. coli-H. pylori shuttle plasmid (pSUS505, see Section 2), which contained the complete neuA and £mD genes including their upstream putative c54 promoter region, was introduced into the H. pylori £mD mutant strain. The transformants showed a similar phenotype as the wild-type strains. FlaA and FlaB £agellin expression, £agellar biosynthesis and motility were restored (Figs. 2 and 3). Flagellin subunits appeared to be exported more e⁄ciently in the complemented strain, since more £agellin was found in mechanically sheared material and less in the cytoplasm compared to the wild-type strain (Fig. 3). The complementation also suggested that the 5P non-coding region upstream from the neuA gene, including the putative c54 -like promoter, is functional as a promoter of £mD transcription in H. pylori. 3.5. A possible function of H. pylori FlmD in £agellin glycosylation Our hypothesis was that the neuA/£mD gene cluster, which we showed to have an essential role in late £agellar biosynthesis, is involved in £agellin glycosylation in H. pylori, as was observed for other bacterial species [24,25,28]. Abundant glycosylation motifs (N-X-T, N-XS) are present in both FlaA and FlaB £agellins in H. pylori, but glycosylation of H. pylori £agellins has not been described. We tested for glycosyl modi¢cations using a highly sensitive variant of the periodic acid^Schi¡ staining
method on protein samples. We found that extracellular, sheared-o¡ £agellar material of wild-type bacteria contained a clear glycosyl-modi¢ed protein band which had the same molecular mass as FlaA (53 kDa ; Fig. 4). A much weaker glycosylated band corresponding to the less expressed FlaB above the glycosylated FlaA band was also detected. The glycosylated FlaA band was not detected in sheared material from £aA mutants (not shown), £aA/£aB double mutants, and £mD mutants (Fig. 4). However, since £mD mutants do not form £agellar ¢laments, and sheared material from those mutants only contained a low amount of 51-kDa FlaA* £agellin (Figs. 3 and 4), it cannot be excluded that a lack of sensitivity of the method prevented detection of glycosylated FlaA in the £mD mutant. When we applied the same method to cytoplasmic proteins (bacterial lysates without attached £agella) of the di¡erent H. pylori strains including the £mD mutant, no glycosylated protein bands that corresponded to £agellins or £agellin of reduced mass (FlaA*) could be observed (Fig. 4). This suggests that wild-type and £mD £agellins are not glycosylated to a detectable extent inside the cytoplasm. The most likely interpretation of these results is that wild-type H. pylori FlaA is present as a glycosylated protein when outside of the bacterial cytoplasm in a polymerized state (£agellar ¢lament), but not inside the cytoplasm, which suggests that glycosylation of the £agellins might be coupled to their secretion. The 51-kDa FlaA* of the £mD mutant seems to be not glycosylated outside or inside the bacterium. In all samples from wild-type and £agellar mutants, two cytoplasmic protein bands of unknown identities were detected (molecular masses of approx. 58 and 65 kDa) which were strongly glycosylated. The reaction of the 65kDa band in the glycosyl detection assay was stronger in the £mD mutants than in the other strains. The protein might be an intermediate donor of glycosyl moieties, accumulating sugar residues in the £mD mutant. Campylobacter £agellins were recently characterized to
FEMSLE 10458 23-5-02
170
C. Josenhans et al. / FEMS Microbiology Letters 210 (2002) 165^172
Fig. 4. Detection of glycosylated proteins in H. pylori £agella and cytoplasmic extracts. The control Western blot A in the left panel was developed using anti-FlaA and -FlaB antiserum. The glycosylation blot shown in B was ¢rst developed with the TETON substrate to detect exclusively the glycosylated molecules, then a picture was taken. Later, it was further treated to con¢rm the proteinaceous nature of the reactive bands (not shown). Lanes: 1^3, 5^7, £agellar preparations; 8, puri¢ed creatinase as unglycosylated control protein; 4, 9^11, soluble cytoplasmic proteins; 2, 5 and 9, H. pylori £mD mutant; 3, 6 and 11, H. pylori N6 £aA/£aB double mutant; 1, 4, 7 and 10, H. pylori N6 wild-type strain. The asterisk designates full length FlaA. The low molecular mass glycosylated molecules in the £agellar preparations are most likely LPS molecules derived from the £agellar sheath. The amount of these molecules is considerably reduced in the £aA/£aB and the £mD mutants, probably since the sheared fraction of the ¢lament-less mutants contains less £agellar sheath material.
contain an O-linked glycosyl modi¢cation consisting predominantly of pseudaminic acid at several residues in the central portion of the molecule, imparting an upshift of the molecular mass by approximately 6000 Da [28]. We used a lectin binding assay in an attempt to characterize the nature of the glycosyl residues in H. pylori £agellins. Lectins with high a⁄nities to complex sialylated sugars (see Section 2) as well as to other polyglycosidic modi¢cations all tested negative on H. pylori £agellins. In addition, an antiserum reactive with the sialylated capsule polysaccharide of N. meningitidis did not recognize the glycosylated £agellins of H. pylori (data not shown), which provided further evidence that the sugar moieties in the £agellin do not consist predominantly of sialic acid, or that they have other linkages to amino acids or secondary sugars than the ones recognized by the lectins used. 3.6. Other H. pylori genes possibly involved in enzymatic glycosylation The neuA/£mD/£mH (HP0326a, 0326b, 0327) gene products seem to be part of an enzymatic £agellin glycosylation pathway in H. pylori. Other genes in the complete H. pylori genomes are likely to also belong to this pathway. These include HP0178/JHP166, a putative NANA synthase (neuB homologue ‘spore coat polysaccharide biosynthesis protein’; homologous to Cj1317 of C. jejuni [28]), and HP366/JHP1015, a gene coding for a DegTlike protein with a domain homologous to aminoglycosyl
transferases [30]. HP0326a, HP0326b, HP0327, HP0178, and HP0366 together could represent a functional pathway for synthesis, activation and transfer of glycosyl moieties to proteins such as £agellins. A similar cluster of genes is also present in the closely related bacterium H. hepaticus (Suerbaum et al., unpublished data; Fig. 1). This novel glycosylation pathway, apparently essential for late £agellar biosynthesis, seems to be evolutionarily conserved in several more distantly related bacterial genera of the Proteobacteria, where £agellar ¢laments are complex and consist of di¡erent £agellin subunits (Fig. 1, supplementary materials 1; http://www.hygiene.uni-wuerzburg.de/helico/supplementsFEMS2002.htm). The genes involved in this pathway di¡er from the genes on the ‘£agellin glycosylation island’ recently discovered in a-type P. aeruginosa [29]. Except for H. pylori and H. hepaticus, all those bacteria do not possess a £agellar sheath. The role of £agellin glycosylation might as well be di¡erent in each of the bacterial species, and clearly needs to be investigated further in each single species. 3.7. Putative functions of the novel glycosylation pathway for £agellar synthesis in H. pylori In the £mD mutants, £agellins are present in the cytoplasm in severely reduced amounts, are released or secreted only in very low quantities, and are apparently not glycosylated. This could be due to reduced transcription or translation of £agellin genes, which will be further
FEMSLE 10458 23-5-02
C. Josenhans et al. / FEMS Microbiology Letters 210 (2002) 165^172
investigated. However, a di¡erent hypothesis would be that non-glycosylated FlaA is less stable than wild-type FlaA, supported by the detection of the apparently nonglycosylated 51-kDa FlaA* in addition to a very faint FlaA band of normal molecular mass. H. pylori £agellar subunits are unlikely to be in direct contact with the environment or the immune system of the host because of the £agellar sheath. Therefore, £agellin glycosylation is unlikely to provide a means of antigenic phase variation such as in Campylobacter. As has been described for pilins [31], £agellin glycosylation might a¡ect the interaction of the £agellin subunits amongst each other, or facilitate the dynamic interaction with their cognate chaperone FliS [32] during secretion. Thus it might be involved in the process of correct secretion of late structural proteins via the £agellar type III secretion system, and even provide a means for £agellin stabilization coupled to secretion.
Acknowledgements We thank Eike Niehus, Allison Stack, Christian Kraft, Stefanie Amersbach, Fang Ye, and Torsten Sterzenbach for critically reading the manuscript and for valuable suggestions. Joanna Andrzejewska was a great help with the preparation of TEM specimens and photographs. Ulrike Deiss and Doris Jaromin are acknowledged for expert technical assistance. We are very grateful to Rainer Haas for the gift of the pHel2 shuttle plasmid prior to publication. This work was supported by grant Su 133/2-3 from the Deutsche Forschungsgemeinschaft.
References [1] Kostrzynska, M., Betts, J.D., Austin, J.W. and Trust, T.J. (1991) Identi¢cation, characterization, and spatial localization of two £agellin species in Helicobacter pylori £agella. J. Bacteriol. 173, 937^946. [2] Suerbaum, S., Josenhans, C. and Labigne, A. (1993) Cloning and genetic characterization of the Helicobacter pylori and Helicobacter mustelae £aB £agellin genes and construction of H. pylori £aA- and £aB-negative mutants by electroporation-mediated allelic exchange. J. Bacteriol. 175, 3278^3288. [3] Geis, G., Suerbaum, S., Forstho¡, B., Leying, H. and Opferkuch, W. (1993) Ultrastructure and biochemical studies of the £agellar sheath of Helicobacter pylori. J. Med. Microbiol. 38, 371^377. [4] Tomb, J.-F., White, O. and Kerlavage, A.R. et al. (1997) The complete genome sequence of the gastric pathogen Helicobacter pylori. Nature 388, 539^547. [5] Alm, R.A., Ling, L.-S.L. and Moir, D.T. et al. (1999) Genomic-sequence comparison of two unrelated isolates of the human gastric pathogen Helicobacter pylori. Nature 397, 176^180. [6] Edwards, U., Muller, A., Hammerschmidt, S., Gerardy-Schahn, R. and Frosch, M. (1994) Molecular analysis of the biosynthesis pathway of the alpha-2,8 polysialic acid capsule by Neisseria meningitidis serogroup B. Mol. Microbiol. 14, 141^149. [7] Annunziato, P.W., Wright, L.F., Vann, W.F. and Silver, R.P. (1995) Nucleotide sequence and genetic analysis of the neuD and neuB genes in region 2 of the polysialic acid gene cluster of Escherichia coli K1. J. Bacteriol. 177, 312^319.
171
[8] Brimer, C.D. and Montie, T.C. (1998) Cloning and comparison of £iC genes and identi¢cation of glycosylation in the £agellin of Pseudomonas aeruginosa a-type strains. J. Bacteriol. 180, 3209^3217. [9] Guerry, P., Doig, P., Alm, R.A., Burr, D.H., Kinsella, N. and Trust, T.J. (1996) Identi¢cation and characterization of genes required for post-translational modi¢cation of Campylobacter coli VC167 £agellin. Mol. Microbiol. 19, 369^378. [10] Szymanski, C.M., Yao, R., Ewing, C.P., Trust, T.J. and Guerry, P. (1999) Evidence for a system of general protein glycosylation in Campylobacter jejuni. Mol. Microbiol. 32, 1022^1030. [11] Linton, D., Karlyshev, A.V., Hitchen, P.G., Morris, H.R., Dell, A., Gregson, N.A. and Wren, B.W. (2000) Multiple N-acetyl neuraminic acid synthetase (neuB) genes in Campylobacter jejuni : identi¢cation and characterization of the gene involved in sialylation of lipo-oligosaccharide. Mol. Microbiol. 35, 1120^1134. [12] Doig, P., Kinsella, N., Guerry, P. and Trust, T.J. (1996) Characterization of a post-translational modi¢cation of Campylobacter £agellin : identi¢cation of a sero-speci¢c glycosyl moiety. Mol. Microbiol. 19, 379^387. [13] Josenhans, C., Ferrero, R.L., Labigne, A. and Suerbaum, S. (1999) Cloning and allelic exchange mutagenesis of two £agellin genes from Helicobacter felis. Mol. Microbiol. 33, 350^362. [14] Silver, R.P., Finn, C.W., Vann, W.F., Aaronson, W., Schneerson, R., Kretschmer, P.J. and Garon, C.F. (1981) Molecular cloning of the K1 capsular polysaccharide genes of E. coli. Nature 289, 696^698. [15] Hammerschmidt, S., Hilse, R., van Putten, J.P., Gerardy-Schahn, R., Unkmeir, A. and Frosch, M. (1996) Modulation of cell surface sialic acid expression in Neisseria meningitidis via a transposable genetic element. EMBO J. 15, 192^198. [16] Josenhans, C., Eaton, K.A., Thevenot, T. and Suerbaum, S. (2000) Switching of £agellar motility in Helicobacter pylori by reversible length variation of a short homopolymeric sequence repeat in £iP, a gene encoding a basal body protein. Infect. Immun. 68, 4598^4603. [17] Josenhans, C., Niehus, E., Amersbach, S., Ho«rster, A., Betz, C., Drescher, B., Hughes, K.T. and Suerbaum, S. (2001) Functional characterization of the antagonistic £agellar late regulators FliA and FlgM of Helicobacter pylori and their e¡ects on the H. pylori transcriptome. Mol. Microbiol. 43, 307^322. [18] Lugtenberg, B., Meijers, J., Peters, R., van der Hoek, P. and van Alphen, L. (1975) Electrophoretic resolution of the ‘major outer membrane protein’ of Escherichia coli K12 into four bands. FEBS Lett. 58, 254^258. [19] Towbin, H., Staehelin, T. and Gordon, J. (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA 76, 4350^4354. [20] Bradford, M.M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 22, 248. [21] Wang, Y., Roos, K.P. and Taylor, D.E. (1993) Transformation of Helicobacter pylori by chromosomal metronidazole resistance and by a plasmid with a selectable chloramphenicol resistance marker. J. Gen. Microbiol. 139, 2485^2493. [22] Ferrero, R.L., Cussac, V., Courcoux, P. and Labigne, A. (1992) Construction of isogenic urease-negative mutants of Helicobacter pylori by allelic exchange. J. Bacteriol. 174, 4212^4217. [23] Heuermann, D. and Haas, R. (1998) A stable shuttle vector system for e⁄cient genetic complementation of Helicobacter pylori strains by transformation and conjugation. Mol. Gen. Genet. 257, 519^528. [24] Gryllos, I., Shaw, J.G., Gavin, R., Merino, S. and Tomas, J.M. (2001) Role of £m locus in mesophilic Aeromonas species adherence. Infect. Immun. 69, 65^74. [25] Leclerc, G., Wang, S.P. and Ely, B. (1998) A new class of Caulobacter crescentus £agellar genes. J. Bacteriol. 180, 5010^5019. [26] Josenhans, C. and Suerbaum, S. (2001) Motility and chemotaxis. In: Helicobacter pylori: Molecular and Cellular Biology (Achtman, M. and Suerbaum, S., Eds.). Horizon Press, Wymondham.
FEMSLE 10458 23-5-02
172
C. Josenhans et al. / FEMS Microbiology Letters 210 (2002) 165^172
[27] Schoenlein, P.V., Lui, J., Gallman, L. and Ely, B. (1992) The Caulobacter crescentus £aFG region regulates synthesis and assembly of £agellin proteins encoded by two genetically unlinked gene clusters. J. Bacteriol. 174, 6046^6053. [28] Thibault, P., Logan, S.M., Kelly, J.F., Brisson, J.R., Ewing, C.P., Trust, T.J. and Guerry, P. (2001) Identi¢cation of the carbohydrate moieties and glycosylation motifs in Campylobacter jejuni £agellin. J. Biol. Chem. 276, 34862^34870. [29] Arora, S.K., Bangera, M., Lory, S. and Ramphal, R. (2001) A genomic island in Pseudomonas aeruginosa carries the determinant of £agellin glycosylation. Proc. Natl. Acad. Sci. USA 98, 9342^9347.
[30] Takagi, M., Takada, H. and Imanaka, T. (1990) Nucleotide sequence and cloning in Bacillus subtilis of the Bacillus stearothermophilus pleiotropic regulatory gene degT. J. Bacteriol. 172, 411^418. [31] Marceau, M., Forest, K., Beretti, J.L., Tainer, J. and Nassif, X. (1998) Consequences of the loss of O-linked glycosylation of meningococcal type IV pilin on piliation and pilus-mediated adhesion. Mol. Microbiol. 27, 705^715. [32] Auvray, F., Thomas, J., Fraser, G.M. and Hughes, C. (2001) Flagellin polymerisation control by a cytosolic export chaperone. J. Mol. Biol. 308, 221^229.
FEMSLE 10458 23-5-02
www.fems-microbiology.org
The neuA/£mD gene cluster of Helicobacter pylori is involved in £agellar biosynthesis and £agellin glycosylation Christine Josenhans a
a;b;1;
, Lutz Vossebein 1;2;b , Susanne Friedrich b , Sebastian Suerbaum a;b
Institut fu«r Hygiene und Mikrobiologie der Universita«t Wu«rzburg, Josef-Schneider-Strasse 2, D-97080 Wu«rzburg, Germany b Abteilung fu«r Medizinische Mikrobiologie der Ruhr-Universita«t Bochum, D-44780 Bochum, Germany Received 10 December 2001; received in revised form 7 February 2002; accepted 14 February 2002 First published online 25 April 2002
Abstract Helicobacter pylori possesses a gene (HP0326/JHP309) homologous to neuA of other bacteria, encoding a cytidyl monophosphate-Nacetylneuraminic acid synthetase-homologous enzyme in its N-terminal portion. We analysed the function of this gene, which is controlled by a flagellar class 2 c54 promoter, in flagellar biosynthesis. HP0326/JHP309 actually represents a bicistronic operon consisting of a neuA and a flmD-like putative glycosyl transferase gene. An isogenic flmD mutant synthesized basal bodies but no filaments, was non-motile, and expressed severely reduced amounts of a FlaA flagellin of reduced molecular mass. FlaA flagellin was found to be glycosylated in its exported form within the flagellar filament, but not inside the cytoplasm. Glycosylated FlaA was not detectable in the flmD mutant. Together with other genes in the H. pylori genome, a proposed function of the neuA/flmD gene products could be to provide a pathway for glycosylation of flagellin and other extracytoplasmic molecules during type III secretion. : 2002 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Flagellum; Flagellin ; Protein glycosylation ; Type III secretion system; Polysaccharide synthesis; RpoN ; Helicobacter pylori
1. Introduction Helicobacter pylori has an unusual pathway of £agellar biosynthesis and a unique £agellar structure. Flagellar ¢laments consist of two di¡erent £agellins, FlaA and FlaB, and are enveloped by a membranous £agellar sheath [1^3]. Sequencing of two H. pylori genomes revealed genes that are homologous to extracytoplasmic glycosylation enzymes, which play a role in capsule biosynthesis in other bacteria [4^7]. H. pylori has not been observed to express a capsule, but the £agellin proteins contain a number of possible glycosylation sites (serine and threonine residues) and ‘eucaryotic glycosylation motifs’ (N-X-T or N-X-S).
* Corresponding author, at address a. Tel.: +49 (931) 201 46905; Fax : +49 (931) 201 46445. E-mail address : [email protected] (C. Josenhans). 1
The authors C.J. and L.V. contributed equally to this work. Present address: Institute for Physiological Chemistry, RuhrUniversita«t Bochum, D-44780 Bochum, Germany. 2
In several other eubacterial species, £agellins contain glycosyl moieties in their mature assembled and polymeric state, a posttranslational modi¢cation likely to occur concomitantly with secretion by the £agellar type III secretion machinery. Pseudomonas aeruginosa synthesizes glycosylated £agellin subunits [8] and Campylobacter species possess enzymes that can modify £agellins or lipooligosaccharides by adding glycosyl residues [9^12]. However, the role of £agellin glycosylation in di¡erent bacteria is still incompletely understood. Glycosylation of £agellin subunits in Campylobacter most likely plays a role in antigenic variation of the £agellar surface [12]. Campylobacter £agellar ¢laments are exposed to the outer milieu, whereas Helicobacter £agellar ¢laments are not, because they are shielded from antibody by a membranous sheath. However, £agellins in Helicobacter felis have been found to be glycosylated despite the presence of a £agellar sheath [13]. The function of several genes in the H. pylori genome that encode enzymes with a putative role in protein glycosylation has not been investigated so far [4,5]. We hypothesized that some of them could be involved in glycosylation of £agellin subunits. The product of one gene, neuA
0378-1097 / 02 / $22.00 : 2002 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. PII : S 0 3 7 8 - 1 0 9 7 ( 0 2 ) 0 0 6 3 8 - 9
FEMSLE 10458 23-5-02
166
C. Josenhans et al. / FEMS Microbiology Letters 210 (2002) 165^172
(HP0326/JHP309), shows the most pronounced homology to Escherichia coli NeuA and Campylobacter PtmB, both of which are cytidine monophosphate-N-acetylneuraminic acid synthetases (neuraminate-cytidylyl synthetase, CMPNANA synthetase). Homologous enzymes are involved in the biosynthesis of a sialic acid-containing capsule in E. coli and Neisseria meningitidis [14,15], and in the posttranslational glycosylation of £agellins, respectively [9]. These data prompted us to look more closely at the function of the putative H. pylori neuA gene.
2. Materials and methods 2.1. Bacterial strains and culture conditions H. pylori strains N6 and 88-3887 (motile variant of 26695 [16]) were used. Culture conditions were as described [17]. Motility of the strains was assayed using a single colony testing method in semisolid motility agar medium [16], to which selective antibiotics were added as required. E. coli strains used for cloning were DH5K and TG1. 2.2. General techniques of molecular cloning and protein analysis DNA puri¢cation, DNA manipulation and cloning procedures were done according to standard protocols. PCR were run in a Perkin-Elmer thermocycler using Amersham Taq polymerase or the Expand High Fidelity1 Kit (Roche) for longer fragments ( s 2 kb), or if high ampli¢cation accuracy for protein expression was required. Protein analysis was done using denaturing 12% SDS^polyacrylamide gels [18] and Western immunoblot detection according to Towbin [19]. For immunolabelling £agellin proteins in Western blots, either rabbit antiserum AK179, raised against native puri¢ed H. pylori ¢laments [2], or rabbit antisera A and B, raised against recombinant FlaA (C-terminal half [16]) and recombinant FlaB (complete FlaB protein [16]) respectively, were used. Protein concentrations were determined using the Bradford assay [20]. H. pylori was transformed with plasmids by natural transformation [21] or electroporation [22]. H. pylori crude £agellar preparations and bacterial lysates were obtained as previously described [16]. 2.3. Cloning and mutagenesis of the H. pylori neuA/£mD gene cluster Using primers OLHPNANA1 (GTTCTCAATTGTATCTCCTGC ; forward) and OLHPNANA2 (ATTagatctGATTGCAACTTGCCCTTAAGC; reverse, BglII site underlined), a 3-kb fragment comprising the £gH, neuA and £aG genes was ampli¢ed from strain 26695. The fragment was cloned into the unique BglII site of plasmid
vector pILL570 (plasmid pSUS502). An EcoRI restriction site in the 5P portion of the H. pylori 26695 £mD gene (second half of the neuA gene in published 26695 sequence) was used to insert a kanamycin (km) resistance cassette (aphA3P-III). The resulting plasmid pSUS503 was transformed into H. pylori strains 26695 (motile variant 88-3887) and N6. Km-resistant colonies were selected and further characterized by PCR. 2.4. Complementation of the H. pylori neuA/£mD genes An approximately 1.55-kb genomic fragment, containing the complete H. pylori 26695 neuA/£mD genes including the putative c54 promoter region upstream from neuA was ampli¢ed using primers OLHPNANA3 (TCTTagatctCGCTAAGATTGAATACAAG) and OLHPNANA4 (TTTCagatctCTAAAAACTCCCTTAATGC), which contain BglII sites (underlined). The fragment was cloned into the E. coli/H. pylori shuttle vector pHel2 [23] using its unique BglII restriction site. The resulting plasmid pSUS505 was transformed into the H. pylori N6 £mD mutant strain by electroporation, and transformants were selected on chloramphenicol-containing plates. 2.5. Electron microscopy Electron microscopy was done on bacteria grown for 24 h on plates. Bacteria were transferred to EM copper grids coated with formvar and carbon, and negatively stained using 1% phosphotungstate pH 7.0. Grids were visualized in Zeiss EM10 or EM900 microscopes in transmission mode at an acceleration voltage of 80 keV. 2.6. Analysis of protein glycosylation Detection of glycosylated proteins was done using the DIG Glycan/Protein Double Labelling Kit (Roche) according to manufacturer’s protocol ‘A’. In protocol A, glycoproteins are labelled in a bu¡ered suspension before protein separation on SDS^PAGE and Western blotting are carried out. 10 Wg of each protein sample were treated ¢rst with sodium metaperiodate, followed by incubation in sodium disul¢te, and then treatment with DIG-hydrazide at room temperature in the presence of protease inhibitors (Complete1, EDTA-free, Roche Biochemicals). Then, the protein samples were concentrated in a speedvac to approximately 20-Wl volumes, SDS sample bu¡er was added and samples were run on a 12% SDS^PAGE. Detection on a Western blot membrane was done using anti-DIG antibodies coupled to horseradish peroxidase, and using the highly sensitive TETON substrate according to the manufacturer’s instructions. To detect proteins in addition to the glycosylated molecules, proteins were labelled with £uorescein directly on the blotting membrane and detected using anti-£uorescein antibodies coupled to alkaline phosphatase and the substrates INT and X-phosphate.
FEMSLE 10458 23-5-02
C. Josenhans et al. / FEMS Microbiology Letters 210 (2002) 165^172
167
Fig. 1. Similar genomic localization and arrangement of the £agella-associated neuA/£mD gene cluster in di¡erent bacterial species. The neuA-£mD-neuB genes are not present in all Aeromonas species, but exclusively in A. caviae. The C. crescentus genome contains four operons involved in £agellar modi¢cation. The H. hepaticus neuA/£mD gene cluster is interrupted by a 6-kb insertion between the neuA and £mD genes. H. hepaticus £mD is in a translational fusion with the downstream £mH gene. The homologous genes are marked with corresponding shading or hatching.
2.7. Lectin testing of H. pylori £agellin proteins The Roche Glycan di¡erentiation kit (lectin protein detection; see manufacturer’s manual) was utilized to further characterize the glycosidic modi¢cations. The kit contains ¢ve di¡erent DIG-labelled lectins : GNA (Galanthus nivalis agglutinin; speci¢c for terminal mannose residues), SNA (Sambucus nigra agglutinin ; speci¢c for terminal sialic acid, K2-6-linked to galactose), MAA (Maackia amurensis agglutinin; speci¢c for sialic acid, K2-3-linked to galactose), PNA (peanut agglutinin; speci¢c for the disaccharide galactose-L(1-3)-N-acetylgalactosamine), and DSA (Datura stramonium agglutinin ; speci¢c for the disaccharide galactose-L(1-4)-N-acetylneuraminic acid). The kit was used on Western blotted protein samples according to the manufacturer’s protocol. 10 Wg of each protein sample were used for analysis.
3. Results and discussion 3.1. Characterization of the H. pylori ‘neuA/£mD’ gene The gene product of HP0326 in the published H. pylori 26695 genome was originally annotated as NeuA, a CMPNANA synthetase. In its N-terminal half, the protein has signi¢cant homology with NeuA-like enzymes of other bacteria (alignment A in supplementary materials 1; http://www.hygiene.uni-wuerzburg.de/helico/supplementsFEMS2002.htm), notably the ptmB gene product of Campylobacter jejuni, which is involved in the posttranslational modi¢cation of Campylobacter £agellins [9,10]. However, the neuA derived protein consists of 517 amino acids (58.9 kDa), which is much larger than other known homologous CMP-NANA enzymes. Campylobacter PtmB comprises only 235 amino acids, and lacks the second half of the putative H. pylori NeuA protein. This second half of the NeuA protein shows signi¢cant homology to polysaccharide biosynthesis enzymes or proteins involved in £agellar biosynthesis and possibly £agellin glycosylation in di¡er-
ent bacteria (e.g. FlmD of Aeromonas sp., and Caulobacter crescentus [24,25], alignment B in supplementary materials 1; http://www.hygiene.uni-wuerzburg.de/helico/supplementsFEMS2002.htm). The exact function of the FlmDlike proteins is unknown. Closer analysis of the fully sequenced genome of strain J99 revealed that a neuA gene is present, but contains a frameshift at nucleotide 625 (JHP309; see http://scriabin.astrazeneca-boston.com/hpylori/). This frameshift splits JHP309 into two open reading frames (ORFs) (JHP309a and JHP309b), each starting with a regular methionine start codon (ATG). We resequenced the corresponding stretch of the H. pylori 26695 genome and found that strain 26695 also contains a frameshift (at nucleotide 625) within the previously described long neuA open reading frame. This separates the 517 amino acid ORF into two, the ¢rst of which is NeuA (amino acids 1^195, nucleotide position 687). The second ORF consists of 290 amino acids commencing at an ATG start codon at nucleotide 681. We propose that the second ORF be renamed FlmD, according to the current nomenclature in other bacteria. Several other bacterial species show a similar genomic colocalization of neuA and £mD, and there is also a conservation in gene order in the £mD cluster of H. pylori, Helicobacter hepaticus, Campylobacter sp., C. crescentus, and Aeromonas caviae; Fig. 1). The two genes neuA (CMP-sugar synthetase HP0326a) and £mD (glycosyl transferase-like gene HP0326b) overlap by seven nucleotides and are preceded by a c54 -like promoter (TGGAA-N6-ATGCC) located 25 bp upstream from the ATG start codon of neuA and well conserved in comparison with the E. coli and Bacillus subtilis consensus c54 promoters (TGGAA-N6-TTGCA). c54 is the typical promoter of class 2 £agellar genes in H. pylori [26] and transcription of neuA/£mD was dependent on the c54 (RpoN) sigma factor in whole transcriptome microarray analysis (Niehus and Josenhans, unpublished results). The two newly de¢ned genes have a conspicuous genomic localization between two other genes involved in the £agellar biosynthesis pathway, £gH, which encodes the L-ring protein of the £agellar basal body (HP0325/
FEMSLE 10458 23-5-02
168
C. Josenhans et al. / FEMS Microbiology Letters 210 (2002) 165^172
3.2. H. pylori £mD mutants make basal bodies, but lack £agellar hook and ¢lament, and are non-motile In order to elucidate a possible role of the putative glycosylation genes in £agellar biosynthesis, we constructed isogenic H. pylori mutants in the gene cluster. For inactivation, we chose the downstream £mD gene of the putative neuA/£mD operon to avoid polar e¡ects. Plasmid pSUS503 containing the complete £gH, neuA/£mD, and £aG(£mH) genes with an insertion of a km cassette into £mD (HP0326b) in the same transcriptional orientation as the gene was transformed into two H. pylori strains, N6 and 88-3887. Kanamycin-resistant mutants were obtained, and four mutants of each strain were shown by PCR using di¡erent primer combinations to have undergone double crossover allelic exchange. The phenotype of the mutants was ¢rst assessed by motility testing and electron microscopy (Fig. 2). The mutants did not show any motility in semisolid agar nor in microscopical analysis of wet mounts. FlmD function appears to be related to assembly of late £agellar structures (hook and ¢lament) as the mutants had no hooks and ¢laments, but regularly displayed approximately three to four £agellar basal bodies and straight short rod-like structures (Fig. 2B). 3.3. H. pylori £mD mutants express a FlaA £agellin of reduced molecular mass
Fig. 2. Electron micrographs (transmission EM) of the H. pylori N6 wild-type strain (A), H. pylori £mD mutant (B), and transcomplemented N6 £mD (pSUS505) strain (C). Bacteria were grown on blood plates for 24 h. Bars equal 0.5 Wm. Note basal body/rod structures of the £mD mutant (arrow).
JHP308), and £aG/£mH (HP0327/JHP310), a gene whose function is unknown, but which is similar to a gene £mH necessary for £agellar assembly in C. crescentus [25,27]. These observations prompted us to study the function of the neuA/£mD genes in H. pylori, and the possible implications of the derived proteins for £agellar biosynthesis.
We next analysed the amount of £agellin in the sheared material and cytoplasm of the bacteria by Western immunoblotting (Fig. 3). Using antiserum AK179 against native £agella, we found no trace of FlaA and FlaB £agellins in the material mechanically sheared from the £mD mutant or in the £mD mutant’s cytoplasm (not shown). The wildtype bacteria contained the usual large amounts of FlaA and less FlaB in the sheared material, and small amounts of both £agellins in cytoplasmic lysates after shearing of extracellular appendages. Wild-type FlaB displayed a signi¢cantly lower molecular mass in the cytoplasm compared with the £agellar preparations (Figs. 3 and 4). Using antisera against recombinant FlaA and FlaB, one FlaAspeci¢c protein band (FlaA*) that was smaller than native FlaA (approx. 51 kDa compared to 53 kDa of native FlaA; Fig. 3, lane 3) was visible in sheared material and lysates of the £mD mutant ; this band was not present in the wild-type strain (Fig. 3). In addition, a very faint band of 53-kDa FlaA £agellin was sometimes detected (Fig. 4, lane 2). The data indicate that the H. pylori £mD mutants are able to produce and release small amounts of FlaA* £agellin subunits, which are apparently unable to polymerize into ¢laments and are detectable as a 51-kDa product. Caulobacter mutants defective in £mD have been reported to produce a truncated 22-kDa form of the 25-kDa £agellin [25]. It seems most likely that the 51-kDa FlaA* protein is a truncated species of FlaA, but it is also possible that the smaller size is due a lack of glycosylation, as
FEMSLE 10458 23-5-02
C. Josenhans et al. / FEMS Microbiology Letters 210 (2002) 165^172
169
Fig. 3. Western immunoblot developed with antisera raised against recombinant FlaA and FlaB of H. pylori. Lanes: 1^4, £agellar preparations (15 Wg of protein loaded in each lane); 5^8, whole cell lysates (40 Wg of protein loaded); 1 and 8, H. pylori £aA/£aB double mutant; 2 and 7, H. pylori N6 wild-type strain; 3 and 5, H. pylori £mD mutant; 4 and 6, H. pylori £mD (pSUS505), neuA/£mD complementation strain. FlaA* is the FlaA-reactive band of 51 kDa in the sheared material and cytoplasm of the £mD mutant.
has been described for Campylobacter [28] and P. aeruginosa [29]. FlaB was not detected in any of the protein preparations of the £mD mutant (Fig. 3). 3.4. The negative £agellar phenotype of H. pylori £mD mutants can be complemented by neuA/£mD in trans To ascertain that the negative £agellar phenotype of the £mD mutants was not due to a polar e¡ect on downstream genes such as £mH, we complemented the mutant in H. pylori. An E. coli-H. pylori shuttle plasmid (pSUS505, see Section 2), which contained the complete neuA and £mD genes including their upstream putative c54 promoter region, was introduced into the H. pylori £mD mutant strain. The transformants showed a similar phenotype as the wild-type strains. FlaA and FlaB £agellin expression, £agellar biosynthesis and motility were restored (Figs. 2 and 3). Flagellin subunits appeared to be exported more e⁄ciently in the complemented strain, since more £agellin was found in mechanically sheared material and less in the cytoplasm compared to the wild-type strain (Fig. 3). The complementation also suggested that the 5P non-coding region upstream from the neuA gene, including the putative c54 -like promoter, is functional as a promoter of £mD transcription in H. pylori. 3.5. A possible function of H. pylori FlmD in £agellin glycosylation Our hypothesis was that the neuA/£mD gene cluster, which we showed to have an essential role in late £agellar biosynthesis, is involved in £agellin glycosylation in H. pylori, as was observed for other bacterial species [24,25,28]. Abundant glycosylation motifs (N-X-T, N-XS) are present in both FlaA and FlaB £agellins in H. pylori, but glycosylation of H. pylori £agellins has not been described. We tested for glycosyl modi¢cations using a highly sensitive variant of the periodic acid^Schi¡ staining
method on protein samples. We found that extracellular, sheared-o¡ £agellar material of wild-type bacteria contained a clear glycosyl-modi¢ed protein band which had the same molecular mass as FlaA (53 kDa ; Fig. 4). A much weaker glycosylated band corresponding to the less expressed FlaB above the glycosylated FlaA band was also detected. The glycosylated FlaA band was not detected in sheared material from £aA mutants (not shown), £aA/£aB double mutants, and £mD mutants (Fig. 4). However, since £mD mutants do not form £agellar ¢laments, and sheared material from those mutants only contained a low amount of 51-kDa FlaA* £agellin (Figs. 3 and 4), it cannot be excluded that a lack of sensitivity of the method prevented detection of glycosylated FlaA in the £mD mutant. When we applied the same method to cytoplasmic proteins (bacterial lysates without attached £agella) of the di¡erent H. pylori strains including the £mD mutant, no glycosylated protein bands that corresponded to £agellins or £agellin of reduced mass (FlaA*) could be observed (Fig. 4). This suggests that wild-type and £mD £agellins are not glycosylated to a detectable extent inside the cytoplasm. The most likely interpretation of these results is that wild-type H. pylori FlaA is present as a glycosylated protein when outside of the bacterial cytoplasm in a polymerized state (£agellar ¢lament), but not inside the cytoplasm, which suggests that glycosylation of the £agellins might be coupled to their secretion. The 51-kDa FlaA* of the £mD mutant seems to be not glycosylated outside or inside the bacterium. In all samples from wild-type and £agellar mutants, two cytoplasmic protein bands of unknown identities were detected (molecular masses of approx. 58 and 65 kDa) which were strongly glycosylated. The reaction of the 65kDa band in the glycosyl detection assay was stronger in the £mD mutants than in the other strains. The protein might be an intermediate donor of glycosyl moieties, accumulating sugar residues in the £mD mutant. Campylobacter £agellins were recently characterized to
FEMSLE 10458 23-5-02
170
C. Josenhans et al. / FEMS Microbiology Letters 210 (2002) 165^172
Fig. 4. Detection of glycosylated proteins in H. pylori £agella and cytoplasmic extracts. The control Western blot A in the left panel was developed using anti-FlaA and -FlaB antiserum. The glycosylation blot shown in B was ¢rst developed with the TETON substrate to detect exclusively the glycosylated molecules, then a picture was taken. Later, it was further treated to con¢rm the proteinaceous nature of the reactive bands (not shown). Lanes: 1^3, 5^7, £agellar preparations; 8, puri¢ed creatinase as unglycosylated control protein; 4, 9^11, soluble cytoplasmic proteins; 2, 5 and 9, H. pylori £mD mutant; 3, 6 and 11, H. pylori N6 £aA/£aB double mutant; 1, 4, 7 and 10, H. pylori N6 wild-type strain. The asterisk designates full length FlaA. The low molecular mass glycosylated molecules in the £agellar preparations are most likely LPS molecules derived from the £agellar sheath. The amount of these molecules is considerably reduced in the £aA/£aB and the £mD mutants, probably since the sheared fraction of the ¢lament-less mutants contains less £agellar sheath material.
contain an O-linked glycosyl modi¢cation consisting predominantly of pseudaminic acid at several residues in the central portion of the molecule, imparting an upshift of the molecular mass by approximately 6000 Da [28]. We used a lectin binding assay in an attempt to characterize the nature of the glycosyl residues in H. pylori £agellins. Lectins with high a⁄nities to complex sialylated sugars (see Section 2) as well as to other polyglycosidic modi¢cations all tested negative on H. pylori £agellins. In addition, an antiserum reactive with the sialylated capsule polysaccharide of N. meningitidis did not recognize the glycosylated £agellins of H. pylori (data not shown), which provided further evidence that the sugar moieties in the £agellin do not consist predominantly of sialic acid, or that they have other linkages to amino acids or secondary sugars than the ones recognized by the lectins used. 3.6. Other H. pylori genes possibly involved in enzymatic glycosylation The neuA/£mD/£mH (HP0326a, 0326b, 0327) gene products seem to be part of an enzymatic £agellin glycosylation pathway in H. pylori. Other genes in the complete H. pylori genomes are likely to also belong to this pathway. These include HP0178/JHP166, a putative NANA synthase (neuB homologue ‘spore coat polysaccharide biosynthesis protein’; homologous to Cj1317 of C. jejuni [28]), and HP366/JHP1015, a gene coding for a DegTlike protein with a domain homologous to aminoglycosyl
transferases [30]. HP0326a, HP0326b, HP0327, HP0178, and HP0366 together could represent a functional pathway for synthesis, activation and transfer of glycosyl moieties to proteins such as £agellins. A similar cluster of genes is also present in the closely related bacterium H. hepaticus (Suerbaum et al., unpublished data; Fig. 1). This novel glycosylation pathway, apparently essential for late £agellar biosynthesis, seems to be evolutionarily conserved in several more distantly related bacterial genera of the Proteobacteria, where £agellar ¢laments are complex and consist of di¡erent £agellin subunits (Fig. 1, supplementary materials 1; http://www.hygiene.uni-wuerzburg.de/helico/supplementsFEMS2002.htm). The genes involved in this pathway di¡er from the genes on the ‘£agellin glycosylation island’ recently discovered in a-type P. aeruginosa [29]. Except for H. pylori and H. hepaticus, all those bacteria do not possess a £agellar sheath. The role of £agellin glycosylation might as well be di¡erent in each of the bacterial species, and clearly needs to be investigated further in each single species. 3.7. Putative functions of the novel glycosylation pathway for £agellar synthesis in H. pylori In the £mD mutants, £agellins are present in the cytoplasm in severely reduced amounts, are released or secreted only in very low quantities, and are apparently not glycosylated. This could be due to reduced transcription or translation of £agellin genes, which will be further
FEMSLE 10458 23-5-02
C. Josenhans et al. / FEMS Microbiology Letters 210 (2002) 165^172
investigated. However, a di¡erent hypothesis would be that non-glycosylated FlaA is less stable than wild-type FlaA, supported by the detection of the apparently nonglycosylated 51-kDa FlaA* in addition to a very faint FlaA band of normal molecular mass. H. pylori £agellar subunits are unlikely to be in direct contact with the environment or the immune system of the host because of the £agellar sheath. Therefore, £agellin glycosylation is unlikely to provide a means of antigenic phase variation such as in Campylobacter. As has been described for pilins [31], £agellin glycosylation might a¡ect the interaction of the £agellin subunits amongst each other, or facilitate the dynamic interaction with their cognate chaperone FliS [32] during secretion. Thus it might be involved in the process of correct secretion of late structural proteins via the £agellar type III secretion system, and even provide a means for £agellin stabilization coupled to secretion.
Acknowledgements We thank Eike Niehus, Allison Stack, Christian Kraft, Stefanie Amersbach, Fang Ye, and Torsten Sterzenbach for critically reading the manuscript and for valuable suggestions. Joanna Andrzejewska was a great help with the preparation of TEM specimens and photographs. Ulrike Deiss and Doris Jaromin are acknowledged for expert technical assistance. We are very grateful to Rainer Haas for the gift of the pHel2 shuttle plasmid prior to publication. This work was supported by grant Su 133/2-3 from the Deutsche Forschungsgemeinschaft.
References [1] Kostrzynska, M., Betts, J.D., Austin, J.W. and Trust, T.J. (1991) Identi¢cation, characterization, and spatial localization of two £agellin species in Helicobacter pylori £agella. J. Bacteriol. 173, 937^946. [2] Suerbaum, S., Josenhans, C. and Labigne, A. (1993) Cloning and genetic characterization of the Helicobacter pylori and Helicobacter mustelae £aB £agellin genes and construction of H. pylori £aA- and £aB-negative mutants by electroporation-mediated allelic exchange. J. Bacteriol. 175, 3278^3288. [3] Geis, G., Suerbaum, S., Forstho¡, B., Leying, H. and Opferkuch, W. (1993) Ultrastructure and biochemical studies of the £agellar sheath of Helicobacter pylori. J. Med. Microbiol. 38, 371^377. [4] Tomb, J.-F., White, O. and Kerlavage, A.R. et al. (1997) The complete genome sequence of the gastric pathogen Helicobacter pylori. Nature 388, 539^547. [5] Alm, R.A., Ling, L.-S.L. and Moir, D.T. et al. (1999) Genomic-sequence comparison of two unrelated isolates of the human gastric pathogen Helicobacter pylori. Nature 397, 176^180. [6] Edwards, U., Muller, A., Hammerschmidt, S., Gerardy-Schahn, R. and Frosch, M. (1994) Molecular analysis of the biosynthesis pathway of the alpha-2,8 polysialic acid capsule by Neisseria meningitidis serogroup B. Mol. Microbiol. 14, 141^149. [7] Annunziato, P.W., Wright, L.F., Vann, W.F. and Silver, R.P. (1995) Nucleotide sequence and genetic analysis of the neuD and neuB genes in region 2 of the polysialic acid gene cluster of Escherichia coli K1. J. Bacteriol. 177, 312^319.
171
[8] Brimer, C.D. and Montie, T.C. (1998) Cloning and comparison of £iC genes and identi¢cation of glycosylation in the £agellin of Pseudomonas aeruginosa a-type strains. J. Bacteriol. 180, 3209^3217. [9] Guerry, P., Doig, P., Alm, R.A., Burr, D.H., Kinsella, N. and Trust, T.J. (1996) Identi¢cation and characterization of genes required for post-translational modi¢cation of Campylobacter coli VC167 £agellin. Mol. Microbiol. 19, 369^378. [10] Szymanski, C.M., Yao, R., Ewing, C.P., Trust, T.J. and Guerry, P. (1999) Evidence for a system of general protein glycosylation in Campylobacter jejuni. Mol. Microbiol. 32, 1022^1030. [11] Linton, D., Karlyshev, A.V., Hitchen, P.G., Morris, H.R., Dell, A., Gregson, N.A. and Wren, B.W. (2000) Multiple N-acetyl neuraminic acid synthetase (neuB) genes in Campylobacter jejuni : identi¢cation and characterization of the gene involved in sialylation of lipo-oligosaccharide. Mol. Microbiol. 35, 1120^1134. [12] Doig, P., Kinsella, N., Guerry, P. and Trust, T.J. (1996) Characterization of a post-translational modi¢cation of Campylobacter £agellin : identi¢cation of a sero-speci¢c glycosyl moiety. Mol. Microbiol. 19, 379^387. [13] Josenhans, C., Ferrero, R.L., Labigne, A. and Suerbaum, S. (1999) Cloning and allelic exchange mutagenesis of two £agellin genes from Helicobacter felis. Mol. Microbiol. 33, 350^362. [14] Silver, R.P., Finn, C.W., Vann, W.F., Aaronson, W., Schneerson, R., Kretschmer, P.J. and Garon, C.F. (1981) Molecular cloning of the K1 capsular polysaccharide genes of E. coli. Nature 289, 696^698. [15] Hammerschmidt, S., Hilse, R., van Putten, J.P., Gerardy-Schahn, R., Unkmeir, A. and Frosch, M. (1996) Modulation of cell surface sialic acid expression in Neisseria meningitidis via a transposable genetic element. EMBO J. 15, 192^198. [16] Josenhans, C., Eaton, K.A., Thevenot, T. and Suerbaum, S. (2000) Switching of £agellar motility in Helicobacter pylori by reversible length variation of a short homopolymeric sequence repeat in £iP, a gene encoding a basal body protein. Infect. Immun. 68, 4598^4603. [17] Josenhans, C., Niehus, E., Amersbach, S., Ho«rster, A., Betz, C., Drescher, B., Hughes, K.T. and Suerbaum, S. (2001) Functional characterization of the antagonistic £agellar late regulators FliA and FlgM of Helicobacter pylori and their e¡ects on the H. pylori transcriptome. Mol. Microbiol. 43, 307^322. [18] Lugtenberg, B., Meijers, J., Peters, R., van der Hoek, P. and van Alphen, L. (1975) Electrophoretic resolution of the ‘major outer membrane protein’ of Escherichia coli K12 into four bands. FEBS Lett. 58, 254^258. [19] Towbin, H., Staehelin, T. and Gordon, J. (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA 76, 4350^4354. [20] Bradford, M.M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 22, 248. [21] Wang, Y., Roos, K.P. and Taylor, D.E. (1993) Transformation of Helicobacter pylori by chromosomal metronidazole resistance and by a plasmid with a selectable chloramphenicol resistance marker. J. Gen. Microbiol. 139, 2485^2493. [22] Ferrero, R.L., Cussac, V., Courcoux, P. and Labigne, A. (1992) Construction of isogenic urease-negative mutants of Helicobacter pylori by allelic exchange. J. Bacteriol. 174, 4212^4217. [23] Heuermann, D. and Haas, R. (1998) A stable shuttle vector system for e⁄cient genetic complementation of Helicobacter pylori strains by transformation and conjugation. Mol. Gen. Genet. 257, 519^528. [24] Gryllos, I., Shaw, J.G., Gavin, R., Merino, S. and Tomas, J.M. (2001) Role of £m locus in mesophilic Aeromonas species adherence. Infect. Immun. 69, 65^74. [25] Leclerc, G., Wang, S.P. and Ely, B. (1998) A new class of Caulobacter crescentus £agellar genes. J. Bacteriol. 180, 5010^5019. [26] Josenhans, C. and Suerbaum, S. (2001) Motility and chemotaxis. In: Helicobacter pylori: Molecular and Cellular Biology (Achtman, M. and Suerbaum, S., Eds.). Horizon Press, Wymondham.
FEMSLE 10458 23-5-02
172
C. Josenhans et al. / FEMS Microbiology Letters 210 (2002) 165^172
[27] Schoenlein, P.V., Lui, J., Gallman, L. and Ely, B. (1992) The Caulobacter crescentus £aFG region regulates synthesis and assembly of £agellin proteins encoded by two genetically unlinked gene clusters. J. Bacteriol. 174, 6046^6053. [28] Thibault, P., Logan, S.M., Kelly, J.F., Brisson, J.R., Ewing, C.P., Trust, T.J. and Guerry, P. (2001) Identi¢cation of the carbohydrate moieties and glycosylation motifs in Campylobacter jejuni £agellin. J. Biol. Chem. 276, 34862^34870. [29] Arora, S.K., Bangera, M., Lory, S. and Ramphal, R. (2001) A genomic island in Pseudomonas aeruginosa carries the determinant of £agellin glycosylation. Proc. Natl. Acad. Sci. USA 98, 9342^9347.
[30] Takagi, M., Takada, H. and Imanaka, T. (1990) Nucleotide sequence and cloning in Bacillus subtilis of the Bacillus stearothermophilus pleiotropic regulatory gene degT. J. Bacteriol. 172, 411^418. [31] Marceau, M., Forest, K., Beretti, J.L., Tainer, J. and Nassif, X. (1998) Consequences of the loss of O-linked glycosylation of meningococcal type IV pilin on piliation and pilus-mediated adhesion. Mol. Microbiol. 27, 705^715. [32] Auvray, F., Thomas, J., Fraser, G.M. and Hughes, C. (2001) Flagellin polymerisation control by a cytosolic export chaperone. J. Mol. Biol. 308, 221^229.
FEMSLE 10458 23-5-02